>Feature sequence01 274 200 gene locus_tag LOCUS_t00010 274 200 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 942 367 gene locus_tag LOCUS_00010 942 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1692 1054 gene locus_tag LOCUS_00020 1692 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4530 1855 gene locus_tag LOCUS_00030 4530 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3698 3793 gene locus_tag LOCUS_t00020 3698 3793 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4979 6151 gene locus_tag LOCUS_00040 4979 6151 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783085.1 protein_id gnl|my_center|LOCUS_00040 7027 6296 gene locus_tag LOCUS_00050 7027 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8201 7062 gene locus_tag LOCUS_00060 8201 7062 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805132.1 protein_id gnl|my_center|LOCUS_00060 8952 8203 gene locus_tag LOCUS_00070 8952 8203 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895185.1 protein_id gnl|my_center|LOCUS_00070 9524 8949 gene locus_tag LOCUS_00080 9524 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10353 9514 gene locus_tag LOCUS_00090 10353 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11200 10337 gene locus_tag LOCUS_00100 11200 10337 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805130.1 protein_id gnl|my_center|LOCUS_00100 12187 11237 gene locus_tag LOCUS_00110 gene xerD 12187 11237 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286377.1 protein_id gnl|my_center|LOCUS_00110 12323 14431 gene locus_tag LOCUS_00120 gene tkt 12323 14431 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_00120 14798 16324 gene locus_tag LOCUS_00130 gene zwf 14798 16324 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805125.1 protein_id gnl|my_center|LOCUS_00130 16321 17268 gene locus_tag LOCUS_00140 16321 17268 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122823891.1 protein_id gnl|my_center|LOCUS_00140 17265 18155 gene locus_tag LOCUS_00150 17265 18155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19025 18780 gene locus_tag LOCUS_00160 gene secG 19025 18780 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115170.1 protein_id gnl|my_center|LOCUS_00160 19968 19192 gene locus_tag LOCUS_00170 gene tpiA 19968 19192 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_00170 21162 19972 gene locus_tag LOCUS_00180 21162 19972 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930207.1 protein_id gnl|my_center|LOCUS_00180 22287 21280 gene locus_tag LOCUS_00190 gene gap 22287 21280 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805120.1 protein_id gnl|my_center|LOCUS_00190 23468 22485 gene locus_tag LOCUS_00200 gene whiA 23468 22485 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877572.1 protein_id gnl|my_center|LOCUS_00200 24518 23514 gene locus_tag LOCUS_00210 gene yvcK 24518 23514 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805118.1 protein_id gnl|my_center|LOCUS_00210 25468 24518 gene locus_tag LOCUS_00220 gene rapZ 25468 24518 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363500.1 protein_id gnl|my_center|LOCUS_00220 26688 25465 gene locus_tag LOCUS_00230 gene purT 26688 25465 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522466.1 protein_id gnl|my_center|LOCUS_00230 28773 26761 gene locus_tag LOCUS_00240 gene uvrC 28773 26761 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407347.1 protein_id gnl|my_center|LOCUS_00240 28977 30401 gene locus_tag LOCUS_00250 gene glnA 28977 30401 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775685.1 protein_id gnl|my_center|LOCUS_00250 30641 32473 gene locus_tag LOCUS_00260 30641 32473 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805025.1 protein_id gnl|my_center|LOCUS_00260 32470 34383 gene locus_tag LOCUS_00270 32470 34383 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907996.1 protein_id gnl|my_center|LOCUS_00270 34386 35090 gene locus_tag LOCUS_00280 34386 35090 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082813.1 protein_id gnl|my_center|LOCUS_00280 35332 35123 gene locus_tag LOCUS_00290 35332 35123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 38345 35430 gene locus_tag LOCUS_00300 gene uvrA 38345 35430 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467399.1 protein_id gnl|my_center|LOCUS_00300 39130 39411 gene locus_tag LOCUS_00310 39130 39411 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803874.1 protein_id gnl|my_center|LOCUS_00310 42311 39717 gene locus_tag LOCUS_00320 42311 39717 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994557.1 protein_id gnl|my_center|LOCUS_00320 43322 42324 gene locus_tag LOCUS_00330 43322 42324 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014789.1 protein_id gnl|my_center|LOCUS_00330 44422 43322 gene locus_tag LOCUS_00340 44422 43322 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014789.1 protein_id gnl|my_center|LOCUS_00340 46842 44740 gene locus_tag LOCUS_00350 gene uvrB 46842 44740 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389776.1 protein_id gnl|my_center|LOCUS_00350 50238 46897 gene locus_tag LOCUS_00360 50238 46897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 50917 50255 gene locus_tag LOCUS_00370 50917 50255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 51036 52379 gene locus_tag LOCUS_00380 gene brnQ 51036 52379 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015030.1 protein_id gnl|my_center|LOCUS_00380 54865 53426 gene locus_tag LOCUS_00390 gene rpsA 54865 53426 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_00390 57904 55190 gene locus_tag LOCUS_00400 gene polA 57904 55190 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729359.1 protein_id gnl|my_center|LOCUS_00400 58080 58469 gene locus_tag LOCUS_00410 58080 58469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 58861 58787 gene locus_tag LOCUS_t00030 58861 58787 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 58927 59520 gene locus_tag LOCUS_00420 58927 59520 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805096.1 protein_id gnl|my_center|LOCUS_00420 60240 60025 gene locus_tag LOCUS_00430 60240 60025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 62292 60844 gene locus_tag LOCUS_00440 gene pyk 62292 60844 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805095.1 protein_id gnl|my_center|LOCUS_00440 63466 62408 gene locus_tag LOCUS_00450 63466 62408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 64368 63523 gene locus_tag LOCUS_00460 gene trpC 64368 63523 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224167.1 protein_id gnl|my_center|LOCUS_00460 64881 64516 gene locus_tag LOCUS_00470 gene hisI 64881 64516 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052762.1 protein_id gnl|my_center|LOCUS_00470 65626 64910 gene locus_tag LOCUS_00480 65626 64910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 66450 65617 gene locus_tag LOCUS_00490 66450 65617 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_00490 67569 66454 gene locus_tag LOCUS_00500 gene mltG 67569 66454 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053383.1 protein_id gnl|my_center|LOCUS_00500 67860 68234 gene locus_tag LOCUS_00510 67860 68234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 68741 68259 gene locus_tag LOCUS_00520 gene ruvX 68741 68259 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_00520 71437 68738 gene locus_tag LOCUS_00530 gene alaS 71437 68738 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775671.1 protein_id gnl|my_center|LOCUS_00530 72168 71545 gene locus_tag LOCUS_00540 gene rpsD 72168 71545 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775672.1 protein_id gnl|my_center|LOCUS_00540 73635 72292 gene locus_tag LOCUS_00550 73635 72292 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775673.1 protein_id gnl|my_center|LOCUS_00550 74474 73857 gene locus_tag LOCUS_00560 74474 73857 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328048.1 protein_id gnl|my_center|LOCUS_00560 75987 74494 gene locus_tag LOCUS_00570 75987 74494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 76408 76043 gene locus_tag LOCUS_00580 76408 76043 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140688.1 protein_id gnl|my_center|LOCUS_00580 78353 76554 gene locus_tag LOCUS_00590 gene aspS 78353 76554 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014498.1 protein_id gnl|my_center|LOCUS_00590 78457 79827 gene locus_tag LOCUS_00600 78457 79827 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_00600 80160 79843 gene locus_tag LOCUS_00610 80160 79843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 82598 80280 gene locus_tag LOCUS_00620 82598 80280 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805008.1 protein_id gnl|my_center|LOCUS_00620 84374 83025 gene locus_tag LOCUS_00630 gene hisS 84374 83025 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_00630 85163 84447 gene locus_tag LOCUS_00640 85163 84447 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_00640 86503 85163 gene locus_tag LOCUS_00650 86503 85163 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_00650 88978 86672 gene locus_tag LOCUS_00660 88978 86672 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805003.1 protein_id gnl|my_center|LOCUS_00660 89570 89025 gene locus_tag LOCUS_00670 89570 89025 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_00670 90652 89567 gene locus_tag LOCUS_00680 gene secF 90652 89567 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805001.1 protein_id gnl|my_center|LOCUS_00680 92616 90649 gene locus_tag LOCUS_00690 gene secD 92616 90649 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805000.1 protein_id gnl|my_center|LOCUS_00690 93042 92650 gene locus_tag LOCUS_00700 93042 92650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 94178 93132 gene locus_tag LOCUS_00710 gene ruvB 94178 93132 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804998.1 protein_id gnl|my_center|LOCUS_00710 94767 94165 gene locus_tag LOCUS_00720 gene ruvA 94767 94165 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804997.1 protein_id gnl|my_center|LOCUS_00720 95442 94813 gene locus_tag LOCUS_00730 gene ruvC 95442 94813 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446569.1 protein_id gnl|my_center|LOCUS_00730 96038 95439 gene locus_tag LOCUS_00740 gene pdxT 96038 95439 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111403.1 protein_id gnl|my_center|LOCUS_00740 96931 96032 gene locus_tag LOCUS_00750 gene pdxS 96931 96032 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939476.1 protein_id gnl|my_center|LOCUS_00750 97755 96934 gene locus_tag LOCUS_00760 97755 96934 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894318.1 protein_id gnl|my_center|LOCUS_00760 98566 98075 gene locus_tag LOCUS_00770 98566 98075 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805188.1 protein_id gnl|my_center|LOCUS_00770 98459 98830 gene locus_tag LOCUS_00780 98459 98830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 99694 99023 gene locus_tag LOCUS_00790 99694 99023 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971514.1 protein_id gnl|my_center|LOCUS_00790 102744 99802 gene locus_tag LOCUS_00800 102744 99802 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775691.1 protein_id gnl|my_center|LOCUS_00800 104095 102761 gene locus_tag LOCUS_00810 gene glnA 104095 102761 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112411.1 protein_id gnl|my_center|LOCUS_00810 105038 104142 gene locus_tag LOCUS_00820 105038 104142 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_00820 105496 105068 gene locus_tag LOCUS_00830 105496 105068 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057865.1 protein_id gnl|my_center|LOCUS_00830 106299 105508 gene locus_tag LOCUS_00840 106299 105508 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_00840 107606 106341 gene locus_tag LOCUS_00850 gene glgA 107606 106341 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805185.1 protein_id gnl|my_center|LOCUS_00850 107684 108922 gene locus_tag LOCUS_00860 gene glgC 107684 108922 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805186.1 protein_id gnl|my_center|LOCUS_00860 108919 109617 gene locus_tag LOCUS_00870 gene serB 108919 109617 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905459.1 protein_id gnl|my_center|LOCUS_00870 110349 109762 gene locus_tag LOCUS_00880 110349 109762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 111641 110346 gene locus_tag LOCUS_00890 111641 110346 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230460.1 protein_id gnl|my_center|LOCUS_00890 112306 111677 gene locus_tag LOCUS_00900 112306 111677 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057532.1 protein_id gnl|my_center|LOCUS_00900 112869 112306 gene locus_tag LOCUS_00910 112869 112306 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804993.1 protein_id gnl|my_center|LOCUS_00910 114898 112871 gene locus_tag LOCUS_00920 gene thrS 114898 112871 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804992.1 protein_id gnl|my_center|LOCUS_00920 116114 115083 gene locus_tag LOCUS_00930 116114 115083 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068007.1 protein_id gnl|my_center|LOCUS_00930 117373 116126 gene locus_tag LOCUS_00940 117373 116126 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804838.1 protein_id gnl|my_center|LOCUS_00940 117590 117516 gene locus_tag LOCUS_t00040 117590 117516 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 117662 117591 gene locus_tag LOCUS_t00050 117662 117591 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 117774 117701 gene locus_tag LOCUS_t00060 117774 117701 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 117907 117835 gene locus_tag LOCUS_t00070 117907 117835 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 117981 117908 gene locus_tag LOCUS_t00080 117981 117908 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 118566 119117 gene locus_tag LOCUS_00950 118566 119117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 119121 120365 gene locus_tag LOCUS_00960 119121 120365 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_00960 122270 120381 gene locus_tag LOCUS_00970 gene dxs 122270 120381 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_00970 122446 124446 gene locus_tag LOCUS_00980 122446 124446 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258483.1 protein_id gnl|my_center|LOCUS_00980 124443 126284 gene locus_tag LOCUS_00990 124443 126284 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_00990 126908 127723 gene locus_tag LOCUS_01000 gene yaaA 126908 127723 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729112.1 protein_id gnl|my_center|LOCUS_01000 128717 127977 gene locus_tag LOCUS_01010 128717 127977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 129532 128714 gene locus_tag LOCUS_01020 129532 128714 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_01020 129671 130342 gene locus_tag LOCUS_01030 gene lipB 129671 130342 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895681.1 protein_id gnl|my_center|LOCUS_01030 130339 131397 gene locus_tag LOCUS_01040 gene lipA 130339 131397 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775682.1 protein_id gnl|my_center|LOCUS_01040 131399 132880 gene locus_tag LOCUS_01050 131399 132880 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085966.1 protein_id gnl|my_center|LOCUS_01050 132960 134291 gene locus_tag LOCUS_01060 132960 134291 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296549.1 protein_id gnl|my_center|LOCUS_01060 134620 134952 gene locus_tag LOCUS_01070 134620 134952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 135310 135234 gene locus_tag LOCUS_t00090 135310 135234 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 135927 135394 gene locus_tag LOCUS_01080 135927 135394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 136132 138879 gene locus_tag LOCUS_01090 gene aceE 136132 138879 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775706.1 protein_id gnl|my_center|LOCUS_01090 139700 139065 gene locus_tag LOCUS_01100 139700 139065 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775779.1 protein_id gnl|my_center|LOCUS_01100 141506 140034 gene locus_tag LOCUS_01110 gene aspA 141506 140034 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995201.1 protein_id gnl|my_center|LOCUS_01110 142470 141724 gene locus_tag LOCUS_01120 142470 141724 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015582873.1 protein_id gnl|my_center|LOCUS_01120 144470 142467 gene locus_tag LOCUS_01130 144470 142467 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013606.1 protein_id gnl|my_center|LOCUS_01130 145177 144467 gene locus_tag LOCUS_01140 145177 144467 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855465.1 protein_id gnl|my_center|LOCUS_01140 145611 145294 gene locus_tag LOCUS_01150 145611 145294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 146116 145613 gene locus_tag LOCUS_01160 146116 145613 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_01160 146761 146270 gene locus_tag LOCUS_01170 gene def 146761 146270 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052751.1 protein_id gnl|my_center|LOCUS_01170 148563 146764 gene locus_tag LOCUS_01180 148563 146764 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804649.1 protein_id gnl|my_center|LOCUS_01180 149101 148667 gene locus_tag LOCUS_01190 149101 148667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 149691 149200 gene locus_tag LOCUS_01200 149691 149200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 151032 149728 gene locus_tag LOCUS_01210 gene ispG 151032 149728 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973330.1 protein_id gnl|my_center|LOCUS_01210 152057 151008 gene locus_tag LOCUS_01220 152057 151008 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456217.1 protein_id gnl|my_center|LOCUS_01220 153320 152082 gene locus_tag LOCUS_01230 153320 152082 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804643.1 protein_id gnl|my_center|LOCUS_01230 154555 153320 gene locus_tag LOCUS_01240 gene dxr 154555 153320 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389635.1 protein_id gnl|my_center|LOCUS_01240 155103 154552 gene locus_tag LOCUS_01250 155103 154552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 156335 155100 gene locus_tag LOCUS_01260 gene rlmN 156335 155100 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804639.1 protein_id gnl|my_center|LOCUS_01260 157219 156332 gene locus_tag LOCUS_01270 157219 156332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 157782 157225 gene locus_tag LOCUS_01280 gene frr 157782 157225 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_01280 158516 157800 gene locus_tag LOCUS_01290 gene pyrH 158516 157800 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804636.1 protein_id gnl|my_center|LOCUS_01290 159438 158611 gene locus_tag LOCUS_01300 gene tsf 159438 158611 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804635.1 protein_id gnl|my_center|LOCUS_01300 160326 159469 gene locus_tag LOCUS_01310 gene rpsB 160326 159469 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_01310 160273 160485 gene locus_tag LOCUS_01320 160273 160485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 160703 161470 gene locus_tag LOCUS_01330 160703 161470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 162681 161767 gene locus_tag LOCUS_01340 162681 161767 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088347.1 protein_id gnl|my_center|LOCUS_01340 163831 162692 gene locus_tag LOCUS_01350 gene dprA 163831 162692 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804631.1 protein_id gnl|my_center|LOCUS_01350 165356 163821 gene locus_tag LOCUS_01360 165356 163821 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030329.1 protein_id gnl|my_center|LOCUS_01360 165805 165353 gene locus_tag LOCUS_01370 165805 165353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 166276 165977 gene locus_tag LOCUS_01380 166276 165977 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_01380 167020 166352 gene locus_tag LOCUS_01390 167020 166352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 167757 167020 gene locus_tag LOCUS_01400 167757 167020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 168202 167846 gene locus_tag LOCUS_01410 gene rplS 168202 167846 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804624.1 protein_id gnl|my_center|LOCUS_01410 169720 168377 gene locus_tag LOCUS_01420 169720 168377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 170241 169717 gene locus_tag LOCUS_01430 gene rimM 170241 169717 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804622.1 protein_id gnl|my_center|LOCUS_01430 170583 170344 gene locus_tag LOCUS_01440 170583 170344 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_01440 171034 170585 gene locus_tag LOCUS_01450 171034 170585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 171272 172201 gene locus_tag LOCUS_01460 171272 172201 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804929.1 protein_id gnl|my_center|LOCUS_01460 173327 172230 gene locus_tag LOCUS_01470 173327 172230 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899537.1 protein_id gnl|my_center|LOCUS_01470 174910 173324 gene locus_tag LOCUS_01480 gene ffh 174910 173324 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804617.1 protein_id gnl|my_center|LOCUS_01480 176260 175025 gene locus_tag LOCUS_01490 gene ftsY 176260 175025 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056312.1 protein_id gnl|my_center|LOCUS_01490 176652 176314 gene locus_tag LOCUS_01500 176652 176314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 178467 176887 gene locus_tag LOCUS_01510 178467 176887 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973202.1 protein_id gnl|my_center|LOCUS_01510 178781 179878 gene locus_tag LOCUS_01520 178781 179878 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512886.1 protein_id gnl|my_center|LOCUS_01520 180391 180041 gene locus_tag LOCUS_01530 180391 180041 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_01530 180476 182515 gene locus_tag LOCUS_01540 gene pknB 180476 182515 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_01540 184023 182584 gene locus_tag LOCUS_01550 184023 182584 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265947.1 protein_id gnl|my_center|LOCUS_01550 185237 184020 gene locus_tag LOCUS_01560 185237 184020 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775974.1 protein_id gnl|my_center|LOCUS_01560 186179 185361 gene locus_tag LOCUS_01570 186179 185361 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_01570 186321 187088 gene locus_tag LOCUS_01580 186321 187088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 187636 187244 gene locus_tag LOCUS_01590 187636 187244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224078.1 protein_id gnl|my_center|LOCUS_01590 188705 187749 gene locus_tag LOCUS_01600 188705 187749 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977187.1 protein_id gnl|my_center|LOCUS_01600 189075 188722 gene locus_tag LOCUS_01610 189075 188722 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_01610 190207 189227 gene locus_tag LOCUS_01620 190207 189227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 191619 190204 gene locus_tag LOCUS_01630 191619 190204 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389742.1 protein_id gnl|my_center|LOCUS_01630 191671 192261 gene locus_tag LOCUS_01640 191671 192261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 192431 192934 gene locus_tag LOCUS_01650 192431 192934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 192953 194011 gene locus_tag LOCUS_01660 192953 194011 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930218.1 protein_id gnl|my_center|LOCUS_01660 194008 194874 gene locus_tag LOCUS_01670 194008 194874 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930212.1 protein_id gnl|my_center|LOCUS_01670 195104 194943 gene locus_tag LOCUS_01680 195104 194943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 196687 195101 gene locus_tag LOCUS_01690 196687 195101 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776843.1 protein_id gnl|my_center|LOCUS_01690 198009 196870 gene locus_tag LOCUS_01700 gene glf 198009 196870 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776101.1 protein_id gnl|my_center|LOCUS_01700 199182 198163 gene locus_tag LOCUS_01710 199182 198163 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056302.1 protein_id gnl|my_center|LOCUS_01710 199854 199435 gene locus_tag LOCUS_01720 199854 199435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 200080 200988 gene locus_tag LOCUS_01730 200080 200988 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582540.1 protein_id gnl|my_center|LOCUS_01730 201123 201353 gene locus_tag LOCUS_01740 201123 201353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 201350 201811 gene locus_tag LOCUS_01750 201350 201811 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224597.1 protein_id gnl|my_center|LOCUS_01750 204114 201964 gene locus_tag LOCUS_01760 gene malQ 204114 201964 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408795.1 protein_id gnl|my_center|LOCUS_01760 204664 204425 gene locus_tag LOCUS_01770 204664 204425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 204807 205766 gene locus_tag LOCUS_01780 204807 205766 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804769.1 protein_id gnl|my_center|LOCUS_01780 207639 205957 gene locus_tag LOCUS_01790 gene ettA 207639 205957 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804765.1 protein_id gnl|my_center|LOCUS_01790 208518 207808 gene locus_tag LOCUS_01800 208518 207808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 209472 208774 gene locus_tag LOCUS_01810 209472 208774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 209522 210823 gene locus_tag LOCUS_01820 gene ilvA 209522 210823 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223532.1 protein_id gnl|my_center|LOCUS_01820 211520 211047 gene locus_tag LOCUS_01830 211520 211047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 214116 211810 gene locus_tag LOCUS_01840 gene metE 214116 211810 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803923.1 protein_id gnl|my_center|LOCUS_01840 215189 214203 gene locus_tag LOCUS_01850 gene metF 215189 214203 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_01850 215071 215361 gene locus_tag LOCUS_01860 215071 215361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 215515 216102 gene locus_tag LOCUS_01870 215515 216102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 216099 218003 gene locus_tag LOCUS_01880 216099 218003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021751.1 protein_id gnl|my_center|LOCUS_01880 218000 218929 gene locus_tag LOCUS_01890 218000 218929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 218936 220666 gene locus_tag LOCUS_01900 218936 220666 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485997.1 protein_id gnl|my_center|LOCUS_01900 220663 222414 gene locus_tag LOCUS_01910 220663 222414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031834.1 protein_id gnl|my_center|LOCUS_01910 222543 222468 gene locus_tag LOCUS_t00100 222543 222468 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 223173 222871 gene locus_tag LOCUS_01920 223173 222871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 223630 224286 gene locus_tag LOCUS_01930 223630 224286 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014898.1 protein_id gnl|my_center|LOCUS_01930 224498 225430 gene locus_tag LOCUS_01940 gene cysK 224498 225430 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767706.1 protein_id gnl|my_center|LOCUS_01940 225430 226221 gene locus_tag LOCUS_01950 225430 226221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 226290 226781 gene locus_tag LOCUS_01960 226290 226781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 227751 226789 gene locus_tag LOCUS_01970 227751 226789 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804784.1 protein_id gnl|my_center|LOCUS_01970 230800 227867 gene locus_tag LOCUS_01980 gene leuS 230800 227867 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804869.1 protein_id gnl|my_center|LOCUS_01980 230898 231362 gene locus_tag LOCUS_01990 230898 231362 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015240.1 protein_id gnl|my_center|LOCUS_01990 232572 231829 gene locus_tag LOCUS_02000 232572 231829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 232672 232745 gene locus_tag LOCUS_t00110 232672 232745 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 232775 232850 gene locus_tag LOCUS_t00120 232775 232850 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 233574 234020 gene locus_tag LOCUS_02010 233574 234020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 234022 234351 gene locus_tag LOCUS_02020 234022 234351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 234498 235202 gene locus_tag LOCUS_02030 234498 235202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 235636 235160 gene locus_tag LOCUS_02040 gene bcp 235636 235160 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_02040 236102 236968 gene locus_tag LOCUS_02050 236102 236968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 237072 238118 gene locus_tag LOCUS_02060 237072 238118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 239189 238497 gene locus_tag LOCUS_02070 239189 238497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 239886 239803 gene locus_tag LOCUS_t00130 239886 239803 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 241317 240199 gene locus_tag LOCUS_02080 gene mnmA 241317 240199 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775920.1 protein_id gnl|my_center|LOCUS_02080 242501 241317 gene locus_tag LOCUS_02090 242501 241317 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081348.1 protein_id gnl|my_center|LOCUS_02090 243577 242579 gene locus_tag LOCUS_02100 243577 242579 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_02100 244298 243579 gene locus_tag LOCUS_02110 244298 243579 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_02110 244221 244391 gene locus_tag LOCUS_02120 244221 244391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 244590 246881 gene locus_tag LOCUS_02130 gene glgX 244590 246881 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775928.1 protein_id gnl|my_center|LOCUS_02130 247064 248164 gene locus_tag LOCUS_02140 gene trpS 247064 248164 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804845.1 protein_id gnl|my_center|LOCUS_02140 248465 250513 gene locus_tag LOCUS_02150 248465 250513 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775929.1 protein_id gnl|my_center|LOCUS_02150 250712 252907 gene locus_tag LOCUS_02160 gene glgB 250712 252907 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812706.1 protein_id gnl|my_center|LOCUS_02160 253159 254601 gene locus_tag LOCUS_02170 253159 254601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031593.1 protein_id gnl|my_center|LOCUS_02170 255530 254658 gene locus_tag LOCUS_02180 255530 254658 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740584.1 protein_id gnl|my_center|LOCUS_02180 256562 255558 gene locus_tag LOCUS_02190 256562 255558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 257971 256559 gene locus_tag LOCUS_02200 257971 256559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 258451 258152 gene locus_tag LOCUS_02210 258451 258152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 259650 258448 gene locus_tag LOCUS_02220 259650 258448 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775935.1 protein_id gnl|my_center|LOCUS_02220 260457 259729 gene locus_tag LOCUS_02230 gene nucS 260457 259729 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775934.1 protein_id gnl|my_center|LOCUS_02230 260938 260528 gene locus_tag LOCUS_02240 260938 260528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 261266 261003 gene locus_tag LOCUS_02250 261266 261003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 262714 261266 gene locus_tag LOCUS_02260 gene atpD 262714 261266 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004120484.1 protein_id gnl|my_center|LOCUS_02260 263667 262738 gene locus_tag LOCUS_02270 263667 262738 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814331.1 protein_id gnl|my_center|LOCUS_02270 265308 263671 gene locus_tag LOCUS_02280 gene atpA 265308 263671 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814328.1 protein_id gnl|my_center|LOCUS_02280 266168 265350 gene locus_tag LOCUS_02290 266168 265350 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054765.1 protein_id gnl|my_center|LOCUS_02290 266737 266165 gene locus_tag LOCUS_02300 266737 266165 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775942.1 protein_id gnl|my_center|LOCUS_02300 266940 266734 gene locus_tag LOCUS_02310 gene atpE 266940 266734 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814320.1 protein_id gnl|my_center|LOCUS_02310 267794 266997 gene locus_tag LOCUS_02320 gene atpB 267794 266997 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051483.1 protein_id gnl|my_center|LOCUS_02320 268416 268012 gene locus_tag LOCUS_02330 268416 268012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 269530 268403 gene locus_tag LOCUS_02340 269530 268403 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775946.1 protein_id gnl|my_center|LOCUS_02340 270223 269576 gene locus_tag LOCUS_02350 270223 269576 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973635.1 protein_id gnl|my_center|LOCUS_02350 271107 270220 gene locus_tag LOCUS_02360 gene prmC 271107 270220 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818926.1 protein_id gnl|my_center|LOCUS_02360 272210 271104 gene locus_tag LOCUS_02370 gene prfA 272210 271104 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814857.1 protein_id gnl|my_center|LOCUS_02370 272577 272356 gene locus_tag LOCUS_02380 gene rpmE 272577 272356 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973638.1 protein_id gnl|my_center|LOCUS_02380 274754 273006 gene locus_tag LOCUS_02390 274754 273006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 275955 275002 gene locus_tag LOCUS_02400 gene thrB 275955 275002 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775957.1 protein_id gnl|my_center|LOCUS_02400 277042 275957 gene locus_tag LOCUS_02410 277042 275957 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_02410 276926 277336 gene locus_tag LOCUS_02420 276926 277336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 277743 279857 gene locus_tag LOCUS_02430 gene pflB 277743 279857 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582507.1 protein_id gnl|my_center|LOCUS_02430 279932 280183 gene locus_tag LOCUS_02440 279932 280183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 280283 281221 gene locus_tag LOCUS_02450 gene pflA 280283 281221 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112608.1 protein_id gnl|my_center|LOCUS_02450 281417 281842 gene locus_tag LOCUS_02460 281417 281842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 282643 282017 gene locus_tag LOCUS_02470 282643 282017 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 protein_id gnl|my_center|LOCUS_02470 282791 283726 gene locus_tag LOCUS_02480 282791 283726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 >Feature sequence02 545 105 gene locus_tag LOCUS_02490 545 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 537 1055 gene locus_tag LOCUS_02500 537 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 1682 1756 gene locus_tag LOCUS_t00140 1682 1756 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2143 2415 gene locus_tag LOCUS_02510 2143 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 2698 3771 gene locus_tag LOCUS_02520 2698 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 3900 6152 gene locus_tag LOCUS_02530 3900 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 6406 6678 gene locus_tag LOCUS_02540 6406 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 6675 7877 gene locus_tag LOCUS_02550 6675 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 7874 8920 gene locus_tag LOCUS_02560 7874 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 9304 9020 gene locus_tag LOCUS_02570 9304 9020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 9591 9307 gene locus_tag LOCUS_02580 9591 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 9650 10243 gene locus_tag LOCUS_02590 9650 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189903631.1 protein_id gnl|my_center|LOCUS_02590 10240 10512 gene locus_tag LOCUS_02600 10240 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 10512 11294 gene locus_tag LOCUS_02610 10512 11294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 11291 12634 gene locus_tag LOCUS_02620 11291 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 12724 14121 gene locus_tag LOCUS_02630 12724 14121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068083.1 protein_id gnl|my_center|LOCUS_02630 14118 15611 gene locus_tag LOCUS_02640 14118 15611 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080790597.1 protein_id gnl|my_center|LOCUS_02640 15608 17263 gene locus_tag LOCUS_02650 15608 17263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 17260 17967 gene locus_tag LOCUS_02660 17260 17967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 18440 17982 gene locus_tag LOCUS_02670 18440 17982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 18822 18433 gene locus_tag LOCUS_02680 18822 18433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 19415 18873 gene locus_tag LOCUS_02690 19415 18873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 19981 19538 gene locus_tag LOCUS_02700 19981 19538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 21619 20003 gene locus_tag LOCUS_02710 21619 20003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 21906 21616 gene locus_tag LOCUS_02720 21906 21616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 21818 22123 gene locus_tag LOCUS_02730 21818 22123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 22839 22558 gene locus_tag LOCUS_02740 22839 22558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 22967 23848 gene locus_tag LOCUS_02750 22967 23848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 24249 24638 gene locus_tag LOCUS_02760 24249 24638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 24786 25019 gene locus_tag LOCUS_02770 24786 25019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 25607 25128 gene locus_tag LOCUS_02780 25607 25128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 30893 25668 gene locus_tag LOCUS_02790 30893 25668 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974882.1 protein_id gnl|my_center|LOCUS_02790 31516 30803 gene locus_tag LOCUS_02800 31516 30803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 32107 31742 gene locus_tag LOCUS_02810 32107 31742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 32319 32128 gene locus_tag LOCUS_02820 32319 32128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 33292 32339 gene locus_tag LOCUS_02830 gene tgdA 33292 32339 CDS product transglycosylase TgdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029455.1 protein_id gnl|my_center|LOCUS_02830 34002 33289 gene locus_tag LOCUS_02840 34002 33289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 34860 34090 gene locus_tag LOCUS_02850 34860 34090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 35242 34922 gene locus_tag LOCUS_02860 35242 34922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 36027 35239 gene locus_tag LOCUS_02870 36027 35239 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 protein_id gnl|my_center|LOCUS_02870 36280 36053 gene locus_tag LOCUS_02880 36280 36053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 36483 36286 gene locus_tag LOCUS_02890 36483 36286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 37129 36527 gene locus_tag LOCUS_02900 37129 36527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 37375 37605 gene locus_tag LOCUS_02910 37375 37605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 38236 41760 gene locus_tag LOCUS_02920 gene rpoB 38236 41760 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776389.1 protein_id gnl|my_center|LOCUS_02920 41775 45674 gene locus_tag LOCUS_02930 41775 45674 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776388.1 protein_id gnl|my_center|LOCUS_02930 46338 46601 gene locus_tag LOCUS_02940 46338 46601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 48846 47710 gene locus_tag LOCUS_02950 48846 47710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 50814 51188 gene locus_tag LOCUS_02960 gene rpsL 50814 51188 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_02960 51188 51658 gene locus_tag LOCUS_02970 gene rpsG 51188 51658 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892787.1 protein_id gnl|my_center|LOCUS_02970 51764 53875 gene locus_tag LOCUS_02980 gene fusA 51764 53875 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055595.1 protein_id gnl|my_center|LOCUS_02980 54032 55219 gene locus_tag LOCUS_02990 gene tuf 54032 55219 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776383.1 protein_id gnl|my_center|LOCUS_02990 55682 58198 gene locus_tag LOCUS_03000 55682 58198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 58991 59857 gene locus_tag LOCUS_03010 58991 59857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 60123 61574 gene locus_tag LOCUS_03020 60123 61574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 62565 62873 gene locus_tag LOCUS_03030 gene rpsJ 62565 62873 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776378.1 protein_id gnl|my_center|LOCUS_03030 62885 63553 gene locus_tag LOCUS_03040 gene rplC 62885 63553 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776377.1 protein_id gnl|my_center|LOCUS_03040 63555 64199 gene locus_tag LOCUS_03050 63555 64199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 64196 64501 gene locus_tag LOCUS_03060 gene rplW 64196 64501 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776375.1 protein_id gnl|my_center|LOCUS_03060 64525 65361 gene locus_tag LOCUS_03070 gene rplB 64525 65361 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776374.1 protein_id gnl|my_center|LOCUS_03070 65378 65659 gene locus_tag LOCUS_03080 gene rpsS 65378 65659 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776373.1 protein_id gnl|my_center|LOCUS_03080 65689 66060 gene locus_tag LOCUS_03090 gene rplV 65689 66060 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053035.1 protein_id gnl|my_center|LOCUS_03090 66062 66859 gene locus_tag LOCUS_03100 gene rpsC 66062 66859 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776371.1 protein_id gnl|my_center|LOCUS_03100 66865 67284 gene locus_tag LOCUS_03110 gene rplP 66865 67284 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776370.1 protein_id gnl|my_center|LOCUS_03110 67284 67517 gene locus_tag LOCUS_03120 gene rpmC 67284 67517 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776369.1 protein_id gnl|my_center|LOCUS_03120 67523 67789 gene locus_tag LOCUS_03130 gene rpsQ 67523 67789 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222609.1 protein_id gnl|my_center|LOCUS_03130 69635 70003 gene locus_tag LOCUS_03140 gene rplN 69635 70003 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776366.1 protein_id gnl|my_center|LOCUS_03140 70003 70431 gene locus_tag LOCUS_03150 gene rplX 70003 70431 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776365.1 protein_id gnl|my_center|LOCUS_03150 70434 70979 gene locus_tag LOCUS_03160 gene rplE 70434 70979 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_03160 70984 71169 gene locus_tag LOCUS_03170 70984 71169 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_03170 71233 71631 gene locus_tag LOCUS_03180 gene rpsH 71233 71631 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 protein_id gnl|my_center|LOCUS_03180 71647 72183 gene locus_tag LOCUS_03190 gene rplF 71647 72183 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_03190 72183 72554 gene locus_tag LOCUS_03200 gene rplR 72183 72554 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053041.1 protein_id gnl|my_center|LOCUS_03200 72583 73278 gene locus_tag LOCUS_03210 gene rpsE 72583 73278 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776360.1 protein_id gnl|my_center|LOCUS_03210 73278 73460 gene locus_tag LOCUS_03220 gene rpmD 73278 73460 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_03220 73463 73939 gene locus_tag LOCUS_03230 gene rplO 73463 73939 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776358.1 protein_id gnl|my_center|LOCUS_03230 74127 75419 gene locus_tag LOCUS_03240 gene secY 74127 75419 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776357.1 protein_id gnl|my_center|LOCUS_03240 75416 75994 gene locus_tag LOCUS_03250 75416 75994 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_03250 75972 76904 gene locus_tag LOCUS_03260 gene map 75972 76904 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776355.1 protein_id gnl|my_center|LOCUS_03260 77355 77155 gene locus_tag LOCUS_03270 77355 77155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 77709 77930 gene locus_tag LOCUS_03280 gene infA 77709 77930 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_03280 78232 78606 gene locus_tag LOCUS_03290 gene rpsM 78232 78606 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776352.1 protein_id gnl|my_center|LOCUS_03290 78675 79085 gene locus_tag LOCUS_03300 gene rpsK 78675 79085 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558885.1 protein_id gnl|my_center|LOCUS_03300 79237 80235 gene locus_tag LOCUS_03310 79237 80235 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_03310 79695 79602 gene locus_tag LOCUS_t00150 79695 79602 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 80282 80773 gene locus_tag LOCUS_03320 80282 80773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 81024 81593 gene locus_tag LOCUS_03330 81024 81593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 81880 82125 gene locus_tag LOCUS_03340 81880 82125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 82291 83040 gene locus_tag LOCUS_03350 82291 83040 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_03350 83028 83960 gene locus_tag LOCUS_03360 gene truA 83028 83960 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 protein_id gnl|my_center|LOCUS_03360 83903 84064 gene locus_tag LOCUS_03370 83903 84064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 84218 84661 gene locus_tag LOCUS_03380 gene rplM 84218 84661 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_03380 84706 85197 gene locus_tag LOCUS_03390 gene rpsI 84706 85197 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence03 339 755 gene locus_tag LOCUS_03400 339 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 2570 834 gene locus_tag LOCUS_03410 gene sucB 2570 834 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110455.1 protein_id gnl|my_center|LOCUS_03410 3969 2596 gene locus_tag LOCUS_03420 gene lpdA 3969 2596 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_03420 4322 3987 gene locus_tag LOCUS_03430 4322 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 4257 4682 gene locus_tag LOCUS_03440 4257 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 5303 4842 gene locus_tag LOCUS_03450 5303 4842 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775666.1 protein_id gnl|my_center|LOCUS_03450 5900 5367 gene locus_tag LOCUS_03460 5900 5367 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977028.1 protein_id gnl|my_center|LOCUS_03460 6265 6738 gene locus_tag LOCUS_03470 6265 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 6735 8348 gene locus_tag LOCUS_03480 6735 8348 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900042.1 protein_id gnl|my_center|LOCUS_03480 8419 11535 gene locus_tag LOCUS_03490 8419 11535 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776321.1 protein_id gnl|my_center|LOCUS_03490 11743 15360 gene locus_tag LOCUS_03500 11743 15360 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136193899.1 protein_id gnl|my_center|LOCUS_03500 16278 15613 gene locus_tag LOCUS_03510 16278 15613 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729723.1 protein_id gnl|my_center|LOCUS_03510 16334 16882 gene locus_tag LOCUS_03520 16334 16882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 17044 17130 gene locus_tag LOCUS_t00160 17044 17130 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17320 17111 gene locus_tag LOCUS_03530 17320 17111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 17204 17884 gene locus_tag LOCUS_03540 17204 17884 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742128.1 protein_id gnl|my_center|LOCUS_03540 17887 18927 gene locus_tag LOCUS_03550 17887 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 18977 20116 gene locus_tag LOCUS_03560 18977 20116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 20149 20433 gene locus_tag LOCUS_03570 20149 20433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 21439 20501 gene locus_tag LOCUS_03580 21439 20501 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 protein_id gnl|my_center|LOCUS_03580 21526 22383 gene locus_tag LOCUS_03590 21526 22383 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971321.1 protein_id gnl|my_center|LOCUS_03590 22383 23054 gene locus_tag LOCUS_03600 22383 23054 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729623.1 protein_id gnl|my_center|LOCUS_03600 24164 23316 gene locus_tag LOCUS_03610 24164 23316 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_03610 24244 25323 gene locus_tag LOCUS_03620 24244 25323 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_03620 25316 26875 gene locus_tag LOCUS_03630 gene arc 25316 26875 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284603.1 protein_id gnl|my_center|LOCUS_03630 26872 28383 gene locus_tag LOCUS_03640 gene dop 26872 28383 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_03640 28401 28583 gene locus_tag LOCUS_03650 28401 28583 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775654.1 protein_id gnl|my_center|LOCUS_03650 28585 29973 gene locus_tag LOCUS_03660 gene pafA 28585 29973 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061320.1 protein_id gnl|my_center|LOCUS_03660 29970 30941 gene locus_tag LOCUS_03670 29970 30941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 31018 31791 gene locus_tag LOCUS_03680 gene hisF 31018 31791 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466799.1 protein_id gnl|my_center|LOCUS_03680 32003 33046 gene locus_tag LOCUS_03690 gene aroC 32003 33046 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805102.1 protein_id gnl|my_center|LOCUS_03690 33043 34632 gene locus_tag LOCUS_03700 33043 34632 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363407.1 protein_id gnl|my_center|LOCUS_03700 34629 35159 gene locus_tag LOCUS_03710 34629 35159 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027814.1 protein_id gnl|my_center|LOCUS_03710 35184 35747 gene locus_tag LOCUS_03720 gene efp 35184 35747 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076127.1 protein_id gnl|my_center|LOCUS_03720 35747 36421 gene locus_tag LOCUS_03730 35747 36421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 36612 37181 gene locus_tag LOCUS_03740 gene pyrR 36612 37181 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805074.1 protein_id gnl|my_center|LOCUS_03740 37183 38175 gene locus_tag LOCUS_03750 37183 38175 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805075.1 protein_id gnl|my_center|LOCUS_03750 38168 39487 gene locus_tag LOCUS_03760 38168 39487 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_03760 39487 40077 gene locus_tag LOCUS_03770 39487 40077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 40077 43373 gene locus_tag LOCUS_03780 gene carB 40077 43373 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_03780 43370 44209 gene locus_tag LOCUS_03790 gene pyrF 43370 44209 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_03790 44510 44821 gene locus_tag LOCUS_03800 gene mihF 44510 44821 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907783.1 protein_id gnl|my_center|LOCUS_03800 44863 45420 gene locus_tag LOCUS_03810 gene gmk 44863 45420 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805082.1 protein_id gnl|my_center|LOCUS_03810 45468 45734 gene locus_tag LOCUS_03820 gene rpoZ 45468 45734 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_03820 45740 47023 gene locus_tag LOCUS_03830 gene coaBC 45740 47023 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618227.1 protein_id gnl|my_center|LOCUS_03830 47020 48213 gene locus_tag LOCUS_03840 gene metK 47020 48213 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057696.1 protein_id gnl|my_center|LOCUS_03840 48210 48842 gene locus_tag LOCUS_03850 48210 48842 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112337.1 protein_id gnl|my_center|LOCUS_03850 48930 50873 gene locus_tag LOCUS_03860 48930 50873 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 protein_id gnl|my_center|LOCUS_03860 50905 51846 gene locus_tag LOCUS_03870 gene fmt 50905 51846 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805211.1 protein_id gnl|my_center|LOCUS_03870 51846 53321 gene locus_tag LOCUS_03880 51846 53321 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_03880 53358 54020 gene locus_tag LOCUS_03890 gene rpe 53358 54020 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805209.1 protein_id gnl|my_center|LOCUS_03890 54270 55043 gene locus_tag LOCUS_03900 54270 55043 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728490.1 protein_id gnl|my_center|LOCUS_03900 55054 56079 gene locus_tag LOCUS_03910 55054 56079 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256709.1 protein_id gnl|my_center|LOCUS_03910 56186 56455 gene locus_tag LOCUS_03920 56186 56455 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054261.1 protein_id gnl|my_center|LOCUS_03920 56613 57458 gene locus_tag LOCUS_03930 gene hisG 56613 57458 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389929.1 protein_id gnl|my_center|LOCUS_03930 57530 58420 gene locus_tag LOCUS_03940 57530 58420 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027895.1 protein_id gnl|my_center|LOCUS_03940 58413 59402 gene locus_tag LOCUS_03950 58413 59402 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027894.1 protein_id gnl|my_center|LOCUS_03950 59399 62164 gene locus_tag LOCUS_03960 59399 62164 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_03960 62161 63774 gene locus_tag LOCUS_03970 gene lnt 62161 63774 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805197.1 protein_id gnl|my_center|LOCUS_03970 64461 64096 gene locus_tag LOCUS_03980 64461 64096 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805194.1 protein_id gnl|my_center|LOCUS_03980 64679 65482 gene locus_tag LOCUS_03990 64679 65482 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028214.1 protein_id gnl|my_center|LOCUS_03990 65479 66990 gene locus_tag LOCUS_04000 65479 66990 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015077.1 protein_id gnl|my_center|LOCUS_04000 67627 67247 gene locus_tag LOCUS_04010 67627 67247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 68796 68242 gene locus_tag LOCUS_04020 68796 68242 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_04020 69693 68920 gene locus_tag LOCUS_04030 69693 68920 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856252.1 protein_id gnl|my_center|LOCUS_04030 70121 69690 gene locus_tag LOCUS_04040 70121 69690 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805151.1 protein_id gnl|my_center|LOCUS_04040 70957 70184 gene locus_tag LOCUS_04050 70957 70184 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296544.1 protein_id gnl|my_center|LOCUS_04050 71291 70959 gene locus_tag LOCUS_04060 71291 70959 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813185.1 protein_id gnl|my_center|LOCUS_04060 72150 71293 gene locus_tag LOCUS_04070 72150 71293 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052289.1 protein_id gnl|my_center|LOCUS_04070 74641 72152 gene locus_tag LOCUS_04080 gene pepN 74641 72152 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326219.1 protein_id gnl|my_center|LOCUS_04080 74790 76373 gene locus_tag LOCUS_04090 74790 76373 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_04090 76447 77925 gene locus_tag LOCUS_04100 gene der 76447 77925 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_04100 77935 78450 gene locus_tag LOCUS_04110 77935 78450 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729729.1 protein_id gnl|my_center|LOCUS_04110 78550 79527 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatgcaccttatggtgcgaggtgctttctgac >Feature sequence04 202 1941 gene locus_tag LOCUS_04120 202 1941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014012.1 protein_id gnl|my_center|LOCUS_04120 1992 4100 gene locus_tag LOCUS_04130 1992 4100 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776837.1 protein_id gnl|my_center|LOCUS_04130 4398 5243 gene locus_tag LOCUS_04140 4398 5243 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_04140 5362 5772 gene locus_tag LOCUS_04150 5362 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 6015 7334 gene locus_tag LOCUS_04160 6015 7334 CDS product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014867.1 protein_id gnl|my_center|LOCUS_04160 8493 7369 gene locus_tag LOCUS_04170 8493 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 8656 8919 gene locus_tag LOCUS_04180 8656 8919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 9414 9049 gene locus_tag LOCUS_04190 9414 9049 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804521.1 protein_id gnl|my_center|LOCUS_04190 9736 10689 gene locus_tag LOCUS_04200 9736 10689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 11118 10954 gene locus_tag LOCUS_04210 11118 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 11729 11130 gene locus_tag LOCUS_04220 11729 11130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04220 14510 12144 gene locus_tag LOCUS_04230 gene purL 14510 12144 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776349.1 protein_id gnl|my_center|LOCUS_04230 15304 14594 gene locus_tag LOCUS_04240 gene purQ 15304 14594 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776337.1 protein_id gnl|my_center|LOCUS_04240 15564 15301 gene locus_tag LOCUS_04250 gene purS 15564 15301 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776336.1 protein_id gnl|my_center|LOCUS_04250 16672 15617 gene locus_tag LOCUS_04260 16672 15617 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_04260 18033 16699 gene locus_tag LOCUS_04270 gene purD 18033 16699 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_04270 22083 20248 gene locus_tag LOCUS_04280 22083 20248 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_04280 22322 22954 gene locus_tag LOCUS_04290 22322 22954 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_04290 22959 24023 gene locus_tag LOCUS_04300 gene pitH 22959 24023 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_04300 24152 24484 gene locus_tag LOCUS_04310 24152 24484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 25658 24669 gene locus_tag LOCUS_04320 25658 24669 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_04320 25783 25607 gene locus_tag LOCUS_04330 25783 25607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 25851 26198 gene locus_tag LOCUS_04340 25851 26198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 26400 27617 gene locus_tag LOCUS_04350 26400 27617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256189.1 protein_id gnl|my_center|LOCUS_04350 30228 27751 gene locus_tag LOCUS_04360 30228 27751 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_04360 31180 32619 gene locus_tag LOCUS_04370 31180 32619 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731247.1 protein_id gnl|my_center|LOCUS_04370 32700 33179 gene locus_tag LOCUS_04380 32700 33179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 33455 33934 gene locus_tag LOCUS_04390 33455 33934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 34213 34692 gene locus_tag LOCUS_04400 34213 34692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 35550 34918 gene locus_tag LOCUS_04410 35550 34918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364002.1 protein_id gnl|my_center|LOCUS_04410 35624 35698 gene locus_tag LOCUS_t00170 35624 35698 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 35883 37115 gene locus_tag LOCUS_04420 35883 37115 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929944.1 protein_id gnl|my_center|LOCUS_04420 37646 37143 gene locus_tag LOCUS_04430 37646 37143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 39555 37864 gene locus_tag LOCUS_04440 39555 37864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 39832 39905 gene locus_tag LOCUS_t00180 39832 39905 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 39965 40040 gene locus_tag LOCUS_t00190 39965 40040 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 40066 40141 gene locus_tag LOCUS_t00200 40066 40141 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 40778 42580 gene locus_tag LOCUS_04450 40778 42580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 43158 43613 gene locus_tag LOCUS_04460 43158 43613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 43610 43912 gene locus_tag LOCUS_04470 43610 43912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 44111 44371 gene locus_tag LOCUS_04480 44111 44371 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974884.1 protein_id gnl|my_center|LOCUS_04480 44630 45910 gene locus_tag LOCUS_04490 44630 45910 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804192.1 protein_id gnl|my_center|LOCUS_04490 47637 46492 gene locus_tag LOCUS_04500 gene purM 47637 46492 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804525.1 protein_id gnl|my_center|LOCUS_04500 49543 47951 gene locus_tag LOCUS_04510 gene purF 49543 47951 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_04510 49993 49811 gene locus_tag LOCUS_04520 49993 49811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 49992 52757 gene locus_tag LOCUS_04530 49992 52757 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230881.1 protein_id gnl|my_center|LOCUS_04530 55564 52892 gene locus_tag LOCUS_04540 55564 52892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 56795 55800 gene locus_tag LOCUS_04550 56795 55800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 58496 57279 gene locus_tag LOCUS_04560 58496 57279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 59541 58960 gene locus_tag LOCUS_04570 gene dcd 59541 58960 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_04570 60179 61090 gene locus_tag LOCUS_04580 60179 61090 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_04580 63216 61777 gene locus_tag LOCUS_04590 63216 61777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 63935 63213 gene locus_tag LOCUS_04600 63935 63213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855103.1 protein_id gnl|my_center|LOCUS_04600 64998 63937 gene locus_tag LOCUS_04610 64998 63937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 >Feature sequence05 2146 875 gene locus_tag LOCUS_04620 gene tyrS 2146 875 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_04620 3656 2220 gene locus_tag LOCUS_04630 gene argH 3656 2220 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776175.1 protein_id gnl|my_center|LOCUS_04630 5099 3699 gene locus_tag LOCUS_04640 5099 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 6710 5487 gene locus_tag LOCUS_04650 6710 5487 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776176.1 protein_id gnl|my_center|LOCUS_04650 7270 6755 gene locus_tag LOCUS_04660 7270 6755 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_04660 8529 7267 gene locus_tag LOCUS_04670 8529 7267 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776179.1 protein_id gnl|my_center|LOCUS_04670 9914 8571 gene locus_tag LOCUS_04680 gene argJ 9914 8571 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068278.1 protein_id gnl|my_center|LOCUS_04680 10984 9911 gene locus_tag LOCUS_04690 gene argC 10984 9911 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776182.1 protein_id gnl|my_center|LOCUS_04690 11588 11094 gene locus_tag LOCUS_04700 11588 11094 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 protein_id gnl|my_center|LOCUS_04700 14354 11706 gene locus_tag LOCUS_04710 gene pheT 14354 11706 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776192.1 protein_id gnl|my_center|LOCUS_04710 15441 14356 gene locus_tag LOCUS_04720 gene pheS 15441 14356 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227844.1 protein_id gnl|my_center|LOCUS_04720 15833 16720 gene locus_tag LOCUS_04730 gene map 15833 16720 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_04730 17346 18095 gene locus_tag LOCUS_04740 17346 18095 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053237.1 protein_id gnl|my_center|LOCUS_04740 21010 18320 gene locus_tag LOCUS_04750 gene acnA 21010 18320 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_04750 22767 21448 gene locus_tag LOCUS_04760 22767 21448 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_04760 24798 22834 gene locus_tag LOCUS_04770 24798 22834 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973119.1 protein_id gnl|my_center|LOCUS_04770 25151 25816 gene locus_tag LOCUS_04780 25151 25816 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_04780 25818 26522 gene locus_tag LOCUS_04790 25818 26522 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_04790 27401 26706 gene locus_tag LOCUS_04800 27401 26706 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113335.1 protein_id gnl|my_center|LOCUS_04800 27793 27398 gene locus_tag LOCUS_04810 27793 27398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 28433 27786 gene locus_tag LOCUS_04820 28433 27786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 28746 28444 gene locus_tag LOCUS_04830 28746 28444 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_04830 28923 30122 gene locus_tag LOCUS_04840 gene sepH 28923 30122 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973165.1 protein_id gnl|my_center|LOCUS_04840 31448 30291 gene locus_tag LOCUS_04850 31448 30291 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390077.1 protein_id gnl|my_center|LOCUS_04850 31918 31445 gene locus_tag LOCUS_04860 31918 31445 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_04860 32048 34519 gene locus_tag LOCUS_04870 32048 34519 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929932.1 protein_id gnl|my_center|LOCUS_04870 34800 34543 gene locus_tag LOCUS_04880 34800 34543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 35774 34824 gene locus_tag LOCUS_04890 35774 34824 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776299.1 protein_id gnl|my_center|LOCUS_04890 36327 35767 gene locus_tag LOCUS_04900 36327 35767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04900 37224 36340 gene locus_tag LOCUS_04910 37224 36340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04910 38563 37502 gene locus_tag LOCUS_04920 38563 37502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 39598 38579 gene locus_tag LOCUS_04930 39598 38579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 41785 39680 gene locus_tag LOCUS_04940 41785 39680 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805040.1 protein_id gnl|my_center|LOCUS_04940 42109 42330 gene locus_tag LOCUS_04950 42109 42330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_04950 46075 42536 gene locus_tag LOCUS_04960 gene smc 46075 42536 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_04960 46981 46523 gene locus_tag LOCUS_04970 gene ndk 46981 46523 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804615.1 protein_id gnl|my_center|LOCUS_04970 48041 47340 gene locus_tag LOCUS_04980 gene dhaM 48041 47340 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229493.1 protein_id gnl|my_center|LOCUS_04980 48673 48041 gene locus_tag LOCUS_04990 gene dhaL 48673 48041 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259134.1 protein_id gnl|my_center|LOCUS_04990 49676 48684 gene locus_tag LOCUS_05000 gene dhaK 49676 48684 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259135.1 protein_id gnl|my_center|LOCUS_05000 51537 49768 gene locus_tag LOCUS_05010 51537 49768 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_05010 52126 52698 gene locus_tag LOCUS_05020 52126 52698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 52695 53954 gene locus_tag LOCUS_05030 52695 53954 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776733.1 protein_id gnl|my_center|LOCUS_05030 54595 54215 gene locus_tag LOCUS_05040 54595 54215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 58420 55139 gene locus_tag LOCUS_05050 gene ileS 58420 55139 CDS product mupirocin-resistant isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994615.1 protein_id gnl|my_center|LOCUS_05050 58952 58695 gene locus_tag LOCUS_05060 58952 58695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 59918 58956 gene locus_tag LOCUS_05070 59918 58956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 61228 60206 gene locus_tag LOCUS_05080 61228 60206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 61746 63053 gene locus_tag LOCUS_05090 gene trpB 61746 63053 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567953.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence06 <1 821 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggctcatccccgctcacgcggggagcac 1244 840 gene locus_tag LOCUS_05100 1244 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 2066 1251 gene locus_tag LOCUS_05110 gene cas1e 2066 1251 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 protein_id gnl|my_center|LOCUS_05110 2959 2201 gene locus_tag LOCUS_05120 gene cas6e 2959 2201 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_05120 3180 2959 gene locus_tag LOCUS_05130 3180 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 3346 3642 gene locus_tag LOCUS_05140 3346 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 4805 3681 gene locus_tag LOCUS_05150 gene cas7e 4805 3681 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_05150 5371 4820 gene locus_tag LOCUS_05160 5371 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 7170 5506 gene locus_tag LOCUS_05170 7170 5506 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 protein_id gnl|my_center|LOCUS_05170 10160 7170 gene locus_tag LOCUS_05180 gene cas3 10160 7170 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440412.1 protein_id gnl|my_center|LOCUS_05180 11618 10641 gene locus_tag LOCUS_05190 gene rlmB 11618 10641 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_05190 11810 12040 gene locus_tag LOCUS_05200 11810 12040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 13692 12214 gene locus_tag LOCUS_05210 gene cysS 13692 12214 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804883.1 protein_id gnl|my_center|LOCUS_05210 13990 14835 gene locus_tag LOCUS_05220 13990 14835 CDS product DUF4132 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027634.1 protein_id gnl|my_center|LOCUS_05220 14916 19442 gene locus_tag LOCUS_05230 14916 19442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 19676 20809 gene locus_tag LOCUS_05240 19676 20809 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977648.1 protein_id gnl|my_center|LOCUS_05240 20858 24475 gene locus_tag LOCUS_05250 20858 24475 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220451701.1 protein_id gnl|my_center|LOCUS_05250 24472 26463 gene locus_tag LOCUS_05260 24472 26463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 28531 26948 gene locus_tag LOCUS_05270 gene thrC 28531 26948 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014964.1 protein_id gnl|my_center|LOCUS_05270 28888 28616 gene locus_tag LOCUS_05280 28888 28616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 29079 29723 gene locus_tag LOCUS_05290 gene ispF 29079 29723 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804549.1 protein_id gnl|my_center|LOCUS_05290 30004 30816 gene locus_tag LOCUS_05300 30004 30816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 32433 31069 gene locus_tag LOCUS_05310 32433 31069 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015250.1 protein_id gnl|my_center|LOCUS_05310 33903 32959 gene locus_tag LOCUS_05320 33903 32959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 34412 33900 gene locus_tag LOCUS_05330 34412 33900 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804554.1 protein_id gnl|my_center|LOCUS_05330 35374 34640 gene locus_tag LOCUS_05340 35374 34640 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112459.1 protein_id gnl|my_center|LOCUS_05340 35774 35442 gene locus_tag LOCUS_05350 35774 35442 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065018.1 protein_id gnl|my_center|LOCUS_05350 36943 37131 gene locus_tag LOCUS_05360 36943 37131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 37273 37707 gene locus_tag LOCUS_05370 37273 37707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05370 39062 38001 gene locus_tag LOCUS_05380 gene hemH 39062 38001 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814087.1 protein_id gnl|my_center|LOCUS_05380 39356 39281 gene locus_tag LOCUS_t00210 39356 39281 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 41408 39747 gene locus_tag LOCUS_05390 41408 39747 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776491.1 protein_id gnl|my_center|LOCUS_05390 42718 41510 gene locus_tag LOCUS_05400 42718 41510 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_05400 43728 42715 gene locus_tag LOCUS_05410 43728 42715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 46825 44117 gene locus_tag LOCUS_05420 gene topA 46825 44117 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776591.1 protein_id gnl|my_center|LOCUS_05420 49543 47795 gene locus_tag LOCUS_05430 49543 47795 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776589.1 protein_id gnl|my_center|LOCUS_05430 49786 50757 gene locus_tag LOCUS_05440 49786 50757 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887939.1 protein_id gnl|my_center|LOCUS_05440 51240 51863 gene locus_tag LOCUS_05450 51240 51863 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775980.1 protein_id gnl|my_center|LOCUS_05450 54220 52535 gene locus_tag LOCUS_05460 gene ptsP 54220 52535 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231021.1 protein_id gnl|my_center|LOCUS_05460 54489 54223 gene locus_tag LOCUS_05470 54489 54223 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726655.1 protein_id gnl|my_center|LOCUS_05470 54963 55982 gene locus_tag LOCUS_05480 54963 55982 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641783.1 protein_id gnl|my_center|LOCUS_05480 58402 56345 gene locus_tag LOCUS_05490 58402 56345 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015272.1 protein_id gnl|my_center|LOCUS_05490 60208 58637 gene locus_tag LOCUS_05500 gene scrB 60208 58637 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015273.1 protein_id gnl|my_center|LOCUS_05500 62226 60346 gene locus_tag LOCUS_05510 62226 60346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 62657 62385 gene locus_tag LOCUS_05520 62657 62385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 >Feature sequence07 1619 339 gene locus_tag LOCUS_05530 1619 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 1730 2422 gene locus_tag LOCUS_05540 1730 2422 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775683.1 protein_id gnl|my_center|LOCUS_05540 2738 2499 gene locus_tag LOCUS_05550 2738 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 2737 3672 gene locus_tag LOCUS_05560 2737 3672 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051290.1 protein_id gnl|my_center|LOCUS_05560 3732 4640 gene locus_tag LOCUS_05570 3732 4640 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053710.1 protein_id gnl|my_center|LOCUS_05570 4655 5410 gene locus_tag LOCUS_05580 4655 5410 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930300.1 protein_id gnl|my_center|LOCUS_05580 5617 5435 gene locus_tag LOCUS_05590 5617 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 5831 5643 gene locus_tag LOCUS_05600 5831 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 5881 6072 gene locus_tag LOCUS_05610 5881 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 7796 6186 gene locus_tag LOCUS_05620 7796 6186 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_05620 7901 8587 gene locus_tag LOCUS_05630 7901 8587 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863385.1 protein_id gnl|my_center|LOCUS_05630 8584 9897 gene locus_tag LOCUS_05640 gene tgt 8584 9897 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776643.1 protein_id gnl|my_center|LOCUS_05640 9935 11665 gene locus_tag LOCUS_05650 9935 11665 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188700193.1 protein_id gnl|my_center|LOCUS_05650 12793 12374 gene locus_tag LOCUS_05660 12793 12374 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057839.1 protein_id gnl|my_center|LOCUS_05660 13260 12790 gene locus_tag LOCUS_05670 13260 12790 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_05670 14552 13260 gene locus_tag LOCUS_05680 14552 13260 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894512.1 protein_id gnl|my_center|LOCUS_05680 15301 14549 gene locus_tag LOCUS_05690 gene sufC 15301 14549 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805067.1 protein_id gnl|my_center|LOCUS_05690 16532 15357 gene locus_tag LOCUS_05700 gene sufD 16532 15357 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_05700 17982 16534 gene locus_tag LOCUS_05710 gene sufB 17982 16534 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805064.1 protein_id gnl|my_center|LOCUS_05710 18728 18018 gene locus_tag LOCUS_05720 18728 18018 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_05720 19519 18869 gene locus_tag LOCUS_05730 19519 18869 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804982.1 protein_id gnl|my_center|LOCUS_05730 20462 19551 gene locus_tag LOCUS_05740 20462 19551 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_05740 21649 20456 gene locus_tag LOCUS_05750 gene steA 21649 20456 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_05750 23316 21646 gene locus_tag LOCUS_05760 gene recN 23316 21646 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_05760 24158 23313 gene locus_tag LOCUS_05770 24158 23313 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_05770 24991 24155 gene locus_tag LOCUS_05780 24991 24155 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_05780 25158 24988 gene locus_tag LOCUS_05790 25158 24988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 27497 25155 gene locus_tag LOCUS_05800 27497 25155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 28135 27407 gene locus_tag LOCUS_05810 28135 27407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 28870 28481 gene locus_tag LOCUS_05820 28870 28481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 29037 29213 gene locus_tag LOCUS_05830 29037 29213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 29994 29776 gene locus_tag LOCUS_05840 29994 29776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 30129 30329 gene locus_tag LOCUS_05850 30129 30329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 31891 32073 gene locus_tag LOCUS_05860 31891 32073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 32082 32753 gene locus_tag LOCUS_05870 32082 32753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 35700 35413 gene locus_tag LOCUS_05880 35700 35413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 36365 35781 gene locus_tag LOCUS_05890 36365 35781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 37923 36415 gene locus_tag LOCUS_05900 gene dnaK 37923 36415 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430934.1 protein_id gnl|my_center|LOCUS_05900 38728 38171 gene locus_tag LOCUS_05910 38728 38171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 39224 39427 gene locus_tag LOCUS_05920 39224 39427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 42294 41410 gene locus_tag LOCUS_05930 42294 41410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 43151 42462 gene locus_tag LOCUS_05940 43151 42462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 46201 43508 gene locus_tag LOCUS_05950 46201 43508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 47871 46258 gene locus_tag LOCUS_05960 47871 46258 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775379.1 protein_id gnl|my_center|LOCUS_05960 48718 47900 gene locus_tag LOCUS_05970 48718 47900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 >Feature sequence08 364 2043 gene locus_tag LOCUS_05980 gene argS 364 2043 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138659.1 protein_id gnl|my_center|LOCUS_05980 2046 3473 gene locus_tag LOCUS_05990 gene lysA 2046 3473 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775960.1 protein_id gnl|my_center|LOCUS_05990 4654 3842 gene locus_tag LOCUS_06000 4654 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 7901 5178 gene locus_tag LOCUS_06010 gene hrpB 7901 5178 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804016.1 protein_id gnl|my_center|LOCUS_06010 8154 8900 gene locus_tag LOCUS_06020 8154 8900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895205.1 protein_id gnl|my_center|LOCUS_06020 8897 9652 gene locus_tag LOCUS_06030 8897 9652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912666.1 protein_id gnl|my_center|LOCUS_06030 9649 10242 gene locus_tag LOCUS_06040 9649 10242 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408366.1 protein_id gnl|my_center|LOCUS_06040 10548 11597 gene locus_tag LOCUS_06050 10548 11597 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775755.1 protein_id gnl|my_center|LOCUS_06050 11594 12043 gene locus_tag LOCUS_06060 gene ybeY 11594 12043 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775754.1 protein_id gnl|my_center|LOCUS_06060 12040 13359 gene locus_tag LOCUS_06070 12040 13359 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775753.1 protein_id gnl|my_center|LOCUS_06070 13364 14653 gene locus_tag LOCUS_06080 13364 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 17363 16518 gene locus_tag LOCUS_06090 17363 16518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 18477 17377 gene locus_tag LOCUS_06100 18477 17377 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939034.1 protein_id gnl|my_center|LOCUS_06100 18654 21482 gene locus_tag LOCUS_06110 18654 21482 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_06110 21486 24869 gene locus_tag LOCUS_06120 21486 24869 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_06120 24873 26390 gene locus_tag LOCUS_06130 24873 26390 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 protein_id gnl|my_center|LOCUS_06130 26383 27363 gene locus_tag LOCUS_06140 26383 27363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 27360 30356 gene locus_tag LOCUS_06150 27360 30356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 30346 30777 gene locus_tag LOCUS_06160 30346 30777 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 protein_id gnl|my_center|LOCUS_06160 31346 31729 gene locus_tag LOCUS_06170 31346 31729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06170 31745 31957 gene locus_tag LOCUS_06180 31745 31957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06180 32516 34270 gene locus_tag LOCUS_06190 gene leuA 32516 34270 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976275.1 protein_id gnl|my_center|LOCUS_06190 34525 35259 gene locus_tag LOCUS_06200 gene recO 34525 35259 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 protein_id gnl|my_center|LOCUS_06200 35259 36080 gene locus_tag LOCUS_06210 35259 36080 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112377.1 protein_id gnl|my_center|LOCUS_06210 36378 36635 gene locus_tag LOCUS_06220 36378 36635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 36632 37618 gene locus_tag LOCUS_06230 36632 37618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 37738 38229 gene locus_tag LOCUS_06240 37738 38229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 38254 38580 gene locus_tag LOCUS_06250 38254 38580 CDS product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837102.1 protein_id gnl|my_center|LOCUS_06250 39315 38797 gene locus_tag LOCUS_06260 39315 38797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906139.1 protein_id gnl|my_center|LOCUS_06260 39704 39312 gene locus_tag LOCUS_06270 39704 39312 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_06270 40693 39752 gene locus_tag LOCUS_06280 40693 39752 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775740.1 protein_id gnl|my_center|LOCUS_06280 >Feature sequence09 585 1187 gene locus_tag LOCUS_06290 585 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 1184 1606 gene locus_tag LOCUS_06300 1184 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 2947 1670 gene locus_tag LOCUS_06310 2947 1670 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_06310 3128 4084 gene locus_tag LOCUS_06320 3128 4084 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920469.1 protein_id gnl|my_center|LOCUS_06320 4237 4788 gene locus_tag LOCUS_06330 4237 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 5295 5702 gene locus_tag LOCUS_06340 5295 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 6153 6395 gene locus_tag LOCUS_06350 6153 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06350 7063 6599 gene locus_tag LOCUS_06360 7063 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 7348 7136 gene locus_tag LOCUS_06370 7348 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 8290 7487 gene locus_tag LOCUS_06380 8290 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 8984 9214 gene locus_tag LOCUS_06390 8984 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06390 9230 9502 gene locus_tag LOCUS_06400 9230 9502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06400 9784 11532 gene locus_tag LOCUS_06410 9784 11532 CDS product anchored repeat ABC transporter, substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993979.1 protein_id gnl|my_center|LOCUS_06410 11567 12559 gene locus_tag LOCUS_06420 11567 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 12556 13602 gene locus_tag LOCUS_06430 12556 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 13599 14456 gene locus_tag LOCUS_06440 13599 14456 CDS product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 protein_id gnl|my_center|LOCUS_06440 16167 14761 gene locus_tag LOCUS_06450 gene fumC 16167 14761 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889251.1 protein_id gnl|my_center|LOCUS_06450 17656 16268 gene locus_tag LOCUS_06460 17656 16268 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 protein_id gnl|my_center|LOCUS_06460 17772 18332 gene locus_tag LOCUS_06470 17772 18332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 18871 18341 gene locus_tag LOCUS_06480 18871 18341 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776902.1 protein_id gnl|my_center|LOCUS_06480 19665 18868 gene locus_tag LOCUS_06490 19665 18868 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862391.1 protein_id gnl|my_center|LOCUS_06490 20558 19803 gene locus_tag LOCUS_06500 20558 19803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 21006 20560 gene locus_tag LOCUS_06510 21006 20560 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414812.1 protein_id gnl|my_center|LOCUS_06510 21705 21232 gene locus_tag LOCUS_06520 21705 21232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 21794 23254 gene locus_tag LOCUS_06530 21794 23254 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051898.1 protein_id gnl|my_center|LOCUS_06530 23722 23474 gene locus_tag LOCUS_06540 gene whiB1 23722 23474 CDS product transcriptional regulator WhiB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907938.1 protein_id gnl|my_center|LOCUS_06540 27360 23857 gene locus_tag LOCUS_06550 27360 23857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 27600 29960 gene locus_tag LOCUS_06560 gene ligA 27600 29960 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073823859.1 protein_id gnl|my_center|LOCUS_06560 31329 30064 gene locus_tag LOCUS_06570 31329 30064 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168581903.1 protein_id gnl|my_center|LOCUS_06570 31431 31727 gene locus_tag LOCUS_06580 gene gatC 31431 31727 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_06580 31727 33232 gene locus_tag LOCUS_06590 gene gatA 31727 33232 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775913.1 protein_id gnl|my_center|LOCUS_06590 33232 34728 gene locus_tag LOCUS_06600 gene gatB 33232 34728 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775912.1 protein_id gnl|my_center|LOCUS_06600 35126 36577 gene locus_tag LOCUS_06610 35126 36577 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804449.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence10 1160 975 gene locus_tag LOCUS_06620 1160 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776783.1 protein_id gnl|my_center|LOCUS_06620 3001 1319 gene locus_tag LOCUS_06630 3001 1319 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817202.1 protein_id gnl|my_center|LOCUS_06630 3094 3384 gene locus_tag LOCUS_06640 3094 3384 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978241.1 protein_id gnl|my_center|LOCUS_06640 3518 4960 gene locus_tag LOCUS_06650 3518 4960 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109272.1 protein_id gnl|my_center|LOCUS_06650 5284 8700 gene locus_tag LOCUS_06660 5284 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 9155 8796 gene locus_tag LOCUS_06670 9155 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 9472 9152 gene locus_tag LOCUS_06680 9472 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 11304 9700 gene locus_tag LOCUS_06690 11304 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 12484 11465 gene locus_tag LOCUS_06700 gene srlD 12484 11465 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582810.1 protein_id gnl|my_center|LOCUS_06700 13832 12531 gene locus_tag LOCUS_06710 13832 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 16505 14055 gene locus_tag LOCUS_06720 16505 14055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 17907 16540 gene locus_tag LOCUS_06730 gene lpdA 17907 16540 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_06730 19269 17935 gene locus_tag LOCUS_06740 19269 17935 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_06740 20032 19280 gene locus_tag LOCUS_06750 20032 19280 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991277.1 protein_id gnl|my_center|LOCUS_06750 20749 20318 gene locus_tag LOCUS_06760 20749 20318 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_06760 21794 20799 gene locus_tag LOCUS_06770 21794 20799 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776913.1 protein_id gnl|my_center|LOCUS_06770 23178 21769 gene locus_tag LOCUS_06780 23178 21769 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783910.1 protein_id gnl|my_center|LOCUS_06780 25216 23408 gene locus_tag LOCUS_06790 25216 23408 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614258.1 protein_id gnl|my_center|LOCUS_06790 26317 25280 gene locus_tag LOCUS_06800 26317 25280 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_06800 27443 26427 gene locus_tag LOCUS_06810 27443 26427 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_06810 28960 27440 gene locus_tag LOCUS_06820 gene gguA 28960 27440 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence11 345 1460 gene locus_tag LOCUS_06830 345 1460 CDS product IS1249 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034254716.1 protein_id gnl|my_center|LOCUS_06830 3061 2465 gene locus_tag LOCUS_06840 gene recR 3061 2465 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_06840 6667 3065 gene locus_tag LOCUS_06850 6667 3065 CDS product DNA polymerase III subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776815.1 protein_id gnl|my_center|LOCUS_06850 7943 7143 gene locus_tag LOCUS_06860 7943 7143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 protein_id gnl|my_center|LOCUS_06860 8704 7943 gene locus_tag LOCUS_06870 8704 7943 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856992.1 protein_id gnl|my_center|LOCUS_06870 10275 9283 gene locus_tag LOCUS_06880 10275 9283 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_06880 10590 11951 gene locus_tag LOCUS_06890 10590 11951 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776800.1 protein_id gnl|my_center|LOCUS_06890 12149 13198 gene locus_tag LOCUS_06900 12149 13198 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013506.1 protein_id gnl|my_center|LOCUS_06900 14515 13223 gene locus_tag LOCUS_06910 14515 13223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 14852 14508 gene locus_tag LOCUS_06920 14852 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 15685 14753 gene locus_tag LOCUS_06930 15685 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 16499 15630 gene locus_tag LOCUS_06940 16499 15630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 17009 16569 gene locus_tag LOCUS_06950 17009 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 18558 17161 gene locus_tag LOCUS_06960 gene glpT 18558 17161 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010111.1 protein_id gnl|my_center|LOCUS_06960 19413 18700 gene locus_tag LOCUS_06970 gene phoB 19413 18700 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091117.1 protein_id gnl|my_center|LOCUS_06970 19844 19410 gene locus_tag LOCUS_06980 19844 19410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06980 20715 20353 gene locus_tag LOCUS_06990 gene trxA 20715 20353 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 protein_id gnl|my_center|LOCUS_06990 21804 21112 gene locus_tag LOCUS_07000 21804 21112 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082703.1 protein_id gnl|my_center|LOCUS_07000 22435 21998 gene locus_tag LOCUS_07010 22435 21998 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_07010 22649 22440 gene locus_tag LOCUS_07020 22649 22440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 22906 22977 gene locus_tag LOCUS_t00220 22906 22977 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence12 232 1593 gene locus_tag LOCUS_07030 gene glmM 232 1593 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574382.1 protein_id gnl|my_center|LOCUS_07030 2942 1965 gene locus_tag LOCUS_07040 gene coaA 2942 1965 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776319.1 protein_id gnl|my_center|LOCUS_07040 5133 2953 gene locus_tag LOCUS_07050 5133 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 5666 5169 gene locus_tag LOCUS_07060 5666 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 5844 7757 gene locus_tag LOCUS_07070 gene glmS 5844 7757 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015000.1 protein_id gnl|my_center|LOCUS_07070 7937 8830 gene locus_tag LOCUS_07080 gene glcU 7937 8830 CDS product glucose uptake protein GlcU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350861.1 protein_id gnl|my_center|LOCUS_07080 8934 10532 gene locus_tag LOCUS_07090 8934 10532 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912231.1 protein_id gnl|my_center|LOCUS_07090 10541 11776 gene locus_tag LOCUS_07100 gene alr 10541 11776 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_07100 12029 12550 gene locus_tag LOCUS_07110 12029 12550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 12534 13091 gene locus_tag LOCUS_07120 12534 13091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 13097 13876 gene locus_tag LOCUS_07130 13097 13876 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_07130 14210 15766 gene locus_tag LOCUS_07140 14210 15766 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339154.1 protein_id gnl|my_center|LOCUS_07140 15771 16724 gene locus_tag LOCUS_07150 15771 16724 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284829.1 protein_id gnl|my_center|LOCUS_07150 16721 17623 gene locus_tag LOCUS_07160 16721 17623 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086015.1 protein_id gnl|my_center|LOCUS_07160 17620 18618 gene locus_tag LOCUS_07170 17620 18618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966043.1 protein_id gnl|my_center|LOCUS_07170 18615 19433 gene locus_tag LOCUS_07180 18615 19433 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086017.1 protein_id gnl|my_center|LOCUS_07180 19433 20803 gene locus_tag LOCUS_07190 19433 20803 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922239.1 protein_id gnl|my_center|LOCUS_07190 20781 21722 gene locus_tag LOCUS_07200 gene nagB 20781 21722 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118913.1 protein_id gnl|my_center|LOCUS_07200 21726 22889 gene locus_tag LOCUS_07210 gene nagA 21726 22889 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765558.1 protein_id gnl|my_center|LOCUS_07210 22882 23499 gene locus_tag LOCUS_07220 22882 23499 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733192.1 protein_id gnl|my_center|LOCUS_07220 23496 24200 gene locus_tag LOCUS_07230 23496 24200 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674983.1 protein_id gnl|my_center|LOCUS_07230 24234 24737 gene locus_tag LOCUS_07240 24234 24737 CDS product YjbQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576695.1 protein_id gnl|my_center|LOCUS_07240 24743 26149 gene locus_tag LOCUS_07250 gene xylB 24743 26149 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_07250 26264 26887 gene locus_tag LOCUS_07260 26264 26887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 26898 27593 gene locus_tag LOCUS_07270 gene tsaB 26898 27593 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776313.1 protein_id gnl|my_center|LOCUS_07270 27590 28114 gene locus_tag LOCUS_07280 27590 28114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 28351 29052 gene locus_tag LOCUS_07290 28351 29052 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 protein_id gnl|my_center|LOCUS_07290 29069 31048 gene locus_tag LOCUS_07300 29069 31048 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977936.1 protein_id gnl|my_center|LOCUS_07300 31045 31788 gene locus_tag LOCUS_07310 31045 31788 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_07310 32077 32355 gene locus_tag LOCUS_07320 32077 32355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 32384 33436 gene locus_tag LOCUS_07330 gene tsaD 32384 33436 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_07330 35209 33824 gene locus_tag LOCUS_07340 35209 33824 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804479.1 protein_id gnl|my_center|LOCUS_07340 35578 35874 gene locus_tag LOCUS_07350 gene groES 35578 35874 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_07350 36945 36097 gene locus_tag LOCUS_07360 36945 36097 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112272.1 protein_id gnl|my_center|LOCUS_07360 37760 36942 gene locus_tag LOCUS_07370 37760 36942 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030586.1 protein_id gnl|my_center|LOCUS_07370 38152 37862 gene locus_tag LOCUS_07380 38152 37862 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222678.1 protein_id gnl|my_center|LOCUS_07380 38667 39428 gene locus_tag LOCUS_07390 38667 39428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 39760 41091 gene locus_tag LOCUS_07400 39760 41091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 41352 42875 gene locus_tag LOCUS_07410 gene guaB 41352 42875 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114891.1 protein_id gnl|my_center|LOCUS_07410 43286 43975 gene locus_tag LOCUS_07420 43286 43975 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048325.1 protein_id gnl|my_center|LOCUS_07420 44681 43980 gene locus_tag LOCUS_07430 44681 43980 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804500.1 protein_id gnl|my_center|LOCUS_07430 44792 45925 gene locus_tag LOCUS_07440 44792 45925 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804502.1 protein_id gnl|my_center|LOCUS_07440 46100 48592 gene locus_tag LOCUS_07450 46100 48592 CDS product SpnA family nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015235.1 protein_id gnl|my_center|LOCUS_07450 48585 50840 gene locus_tag LOCUS_07460 48585 50840 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013569.1 protein_id gnl|my_center|LOCUS_07460 51158 51769 gene locus_tag LOCUS_07470 51158 51769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 51927 53015 gene locus_tag LOCUS_07480 51927 53015 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_07480 53109 54653 gene locus_tag LOCUS_07490 53109 54653 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776143.1 protein_id gnl|my_center|LOCUS_07490 54650 55912 gene locus_tag LOCUS_07500 54650 55912 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776142.1 protein_id gnl|my_center|LOCUS_07500 55909 57192 gene locus_tag LOCUS_07510 55909 57192 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776141.1 protein_id gnl|my_center|LOCUS_07510 57201 57632 gene locus_tag LOCUS_07520 57201 57632 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908747.1 protein_id gnl|my_center|LOCUS_07520 57682 58965 gene locus_tag LOCUS_07530 57682 58965 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_07530 59201 60151 gene locus_tag LOCUS_07540 59201 60151 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989862.1 protein_id gnl|my_center|LOCUS_07540 60372 61088 gene locus_tag LOCUS_07550 gene deoD 60372 61088 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 protein_id gnl|my_center|LOCUS_07550 61131 61781 gene locus_tag LOCUS_07560 gene deoC 61131 61781 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776136.1 protein_id gnl|my_center|LOCUS_07560 61787 63469 gene locus_tag LOCUS_07570 61787 63469 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776135.1 protein_id gnl|my_center|LOCUS_07570 64430 64170 gene locus_tag LOCUS_07580 64430 64170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 64314 65399 gene locus_tag LOCUS_07590 64314 65399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 67388 67017 gene locus_tag LOCUS_07600 67388 67017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 69667 67385 gene locus_tag LOCUS_07610 69667 67385 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729965.1 protein_id gnl|my_center|LOCUS_07610 70524 69826 gene locus_tag LOCUS_07620 70524 69826 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226433.1 protein_id gnl|my_center|LOCUS_07620 70654 71655 gene locus_tag LOCUS_07630 70654 71655 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226432.1 protein_id gnl|my_center|LOCUS_07630 71819 72544 gene locus_tag LOCUS_07640 71819 72544 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226431.1 protein_id gnl|my_center|LOCUS_07640 74993 73797 gene locus_tag LOCUS_07650 74993 73797 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068227.1 protein_id gnl|my_center|LOCUS_07650 76671 75172 gene locus_tag LOCUS_07660 76671 75172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 76797 77111 gene locus_tag LOCUS_07670 76797 77111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 77686 78906 gene locus_tag LOCUS_07680 77686 78906 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222746.1 protein_id gnl|my_center|LOCUS_07680 79041 80372 gene locus_tag LOCUS_07690 79041 80372 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804601.1 protein_id gnl|my_center|LOCUS_07690 82370 80592 gene locus_tag LOCUS_07700 82370 80592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141301.1 protein_id gnl|my_center|LOCUS_07700 84103 82370 gene locus_tag LOCUS_07710 84103 82370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 84523 85671 gene locus_tag LOCUS_07720 84523 85671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 85839 88121 gene locus_tag LOCUS_07730 85839 88121 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256758.1 protein_id gnl|my_center|LOCUS_07730 88216 89889 gene locus_tag LOCUS_07740 gene pgi 88216 89889 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804725.1 protein_id gnl|my_center|LOCUS_07740 90239 91228 gene locus_tag LOCUS_07750 90239 91228 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_07750 91736 92599 gene locus_tag LOCUS_07760 gene purU 91736 92599 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 protein_id gnl|my_center|LOCUS_07760 93004 94296 gene locus_tag LOCUS_07770 gene glyA 93004 94296 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 protein_id gnl|my_center|LOCUS_07770 94293 95189 gene locus_tag LOCUS_07780 94293 95189 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776152.1 protein_id gnl|my_center|LOCUS_07780 95250 96485 gene locus_tag LOCUS_07790 95250 96485 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 protein_id gnl|my_center|LOCUS_07790 96500 97498 gene locus_tag LOCUS_07800 96500 97498 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212820.1 protein_id gnl|my_center|LOCUS_07800 97566 98483 gene locus_tag LOCUS_07810 gene argB 97566 98483 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813526.1 protein_id gnl|my_center|LOCUS_07810 98480 99280 gene locus_tag LOCUS_07820 98480 99280 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776151.1 protein_id gnl|my_center|LOCUS_07820 100086 99538 gene locus_tag LOCUS_07830 100086 99538 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_07830 100378 101289 gene locus_tag LOCUS_07840 100378 101289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 101286 101903 gene locus_tag LOCUS_07850 gene pth 101286 101903 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 protein_id gnl|my_center|LOCUS_07850 101900 105490 gene locus_tag LOCUS_07860 gene mfd 101900 105490 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068204100.1 protein_id gnl|my_center|LOCUS_07860 105768 106355 gene locus_tag LOCUS_07870 105768 106355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 106615 107895 gene locus_tag LOCUS_07880 gene eno 106615 107895 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804956.1 protein_id gnl|my_center|LOCUS_07880 108303 109088 gene locus_tag LOCUS_07890 108303 109088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 109085 109600 gene locus_tag LOCUS_07900 109085 109600 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_07900 110000 110968 gene locus_tag LOCUS_07910 110000 110968 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_07910 111195 111120 gene locus_tag LOCUS_t00230 111195 111120 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 111278 112543 gene locus_tag LOCUS_07920 gene nhaA 111278 112543 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029088.1 protein_id gnl|my_center|LOCUS_07920 113079 114038 gene locus_tag LOCUS_07930 113079 114038 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229844.1 protein_id gnl|my_center|LOCUS_07930 114085 114480 gene locus_tag LOCUS_07940 114085 114480 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112263.1 protein_id gnl|my_center|LOCUS_07940 115559 114951 gene locus_tag LOCUS_07950 gene msrA 115559 114951 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383597.1 protein_id gnl|my_center|LOCUS_07950 116087 117508 gene locus_tag LOCUS_07960 116087 117508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 118471 118289 gene locus_tag LOCUS_07970 118471 118289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 119093 118614 gene locus_tag LOCUS_07980 gene greA 119093 118614 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776308.1 protein_id gnl|my_center|LOCUS_07980 119939 119259 gene locus_tag LOCUS_07990 119939 119259 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_07990 120210 120968 gene locus_tag LOCUS_08000 120210 120968 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059325.1 protein_id gnl|my_center|LOCUS_08000 121594 122433 gene locus_tag LOCUS_08010 121594 122433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 123880 122945 gene locus_tag LOCUS_08020 123880 122945 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776299.1 protein_id gnl|my_center|LOCUS_08020 124200 123925 gene locus_tag LOCUS_08030 124200 123925 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030026.1 protein_id gnl|my_center|LOCUS_08030 126190 124202 gene locus_tag LOCUS_08040 126190 124202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 126654 127730 gene locus_tag LOCUS_08050 126654 127730 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776295.1 protein_id gnl|my_center|LOCUS_08050 129495 128431 gene locus_tag LOCUS_08060 129495 128431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 129898 130980 gene locus_tag LOCUS_08070 gene ychF 129898 130980 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730394.1 protein_id gnl|my_center|LOCUS_08070 131566 134865 gene locus_tag LOCUS_08080 131566 134865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 135627 136598 gene locus_tag LOCUS_08090 135627 136598 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775988.1 protein_id gnl|my_center|LOCUS_08090 138350 136890 gene locus_tag LOCUS_08100 138350 136890 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114709.1 protein_id gnl|my_center|LOCUS_08100 139365 138769 gene locus_tag LOCUS_08110 139365 138769 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776270.1 protein_id gnl|my_center|LOCUS_08110 139624 141543 gene locus_tag LOCUS_08120 gene typA 139624 141543 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804730.1 protein_id gnl|my_center|LOCUS_08120 142370 141870 gene locus_tag LOCUS_08130 142370 141870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 142263 142586 gene locus_tag LOCUS_08140 142263 142586 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_08140 142603 143745 gene locus_tag LOCUS_08150 gene dapC 142603 143745 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804734.1 protein_id gnl|my_center|LOCUS_08150 143877 145205 gene locus_tag LOCUS_08160 143877 145205 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976064.1 protein_id gnl|my_center|LOCUS_08160 146501 145518 gene locus_tag LOCUS_08170 gene dapD 146501 145518 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730317.1 protein_id gnl|my_center|LOCUS_08170 147449 146757 gene locus_tag LOCUS_08180 147449 146757 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222850.1 protein_id gnl|my_center|LOCUS_08180 147831 148871 gene locus_tag LOCUS_08190 147831 148871 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929977.1 protein_id gnl|my_center|LOCUS_08190 149005 149700 gene locus_tag LOCUS_08200 149005 149700 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 protein_id gnl|my_center|LOCUS_08200 149899 151224 gene locus_tag LOCUS_08210 gene draK 149899 151224 CDS product two-component system sensor histidine kinase DraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028744.1 protein_id gnl|my_center|LOCUS_08210 151263 152426 gene locus_tag LOCUS_08220 151263 152426 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219537380.1 protein_id gnl|my_center|LOCUS_08220 152531 153100 gene locus_tag LOCUS_08230 gene purE 152531 153100 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776122.1 protein_id gnl|my_center|LOCUS_08230 154267 153356 gene locus_tag LOCUS_08240 154267 153356 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776104.1 protein_id gnl|my_center|LOCUS_08240 156345 155038 gene locus_tag LOCUS_08250 156345 155038 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776964.1 protein_id gnl|my_center|LOCUS_08250 156791 156378 gene locus_tag LOCUS_08260 156791 156378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 157417 156794 gene locus_tag LOCUS_08270 157417 156794 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776105.1 protein_id gnl|my_center|LOCUS_08270 157561 158154 gene locus_tag LOCUS_08280 157561 158154 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776120.1 protein_id gnl|my_center|LOCUS_08280 158151 159257 gene locus_tag LOCUS_08290 158151 159257 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776119.1 protein_id gnl|my_center|LOCUS_08290 159254 160243 gene locus_tag LOCUS_08300 159254 160243 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776118.1 protein_id gnl|my_center|LOCUS_08300 161963 160233 gene locus_tag LOCUS_08310 161963 160233 CDS product asparagine synthetase B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776117.1 protein_id gnl|my_center|LOCUS_08310 162404 163633 gene locus_tag LOCUS_08320 162404 163633 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929976.1 protein_id gnl|my_center|LOCUS_08320 163630 164808 gene locus_tag LOCUS_08330 163630 164808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08330 164805 165905 gene locus_tag LOCUS_08340 164805 165905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08340 167424 166231 gene locus_tag LOCUS_08350 167424 166231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 168746 167421 gene locus_tag LOCUS_08360 gene wecB 168746 167421 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776111.1 protein_id gnl|my_center|LOCUS_08360 169903 168737 gene locus_tag LOCUS_08370 169903 168737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 170192 171457 gene locus_tag LOCUS_08380 170192 171457 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776110.1 protein_id gnl|my_center|LOCUS_08380 171490 172782 gene locus_tag LOCUS_08390 171490 172782 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776106.1 protein_id gnl|my_center|LOCUS_08390 172998 174806 gene locus_tag LOCUS_08400 172998 174806 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102374990.1 protein_id gnl|my_center|LOCUS_08400 174803 175726 gene locus_tag LOCUS_08410 174803 175726 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017005.1 protein_id gnl|my_center|LOCUS_08410 176010 176759 gene locus_tag LOCUS_08420 176010 176759 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878191.1 protein_id gnl|my_center|LOCUS_08420 176759 177148 gene locus_tag LOCUS_08430 176759 177148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 178185 177298 gene locus_tag LOCUS_08440 178185 177298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 179338 178313 gene locus_tag LOCUS_08450 179338 178313 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110231.1 protein_id gnl|my_center|LOCUS_08450 181258 179441 gene locus_tag LOCUS_08460 181258 179441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 181359 183134 gene locus_tag LOCUS_08470 181359 183134 CDS product rhamnan synthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994691.1 protein_id gnl|my_center|LOCUS_08470 183198 184088 gene locus_tag LOCUS_08480 183198 184088 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021650009.1 protein_id gnl|my_center|LOCUS_08480 184128 186026 gene locus_tag LOCUS_08490 184128 186026 CDS product rhamnan synthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389355.1 protein_id gnl|my_center|LOCUS_08490 186023 187222 gene locus_tag LOCUS_08500 186023 187222 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004575007.1 protein_id gnl|my_center|LOCUS_08500 187328 188194 gene locus_tag LOCUS_08510 187328 188194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 188200 189429 gene locus_tag LOCUS_08520 188200 189429 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_08520 190280 189975 gene locus_tag LOCUS_08530 190280 189975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 192092 190458 gene locus_tag LOCUS_08540 192092 190458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 193439 192171 gene locus_tag LOCUS_08550 193439 192171 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775569.1 protein_id gnl|my_center|LOCUS_08550 194318 193449 gene locus_tag LOCUS_08560 194318 193449 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_08560 195341 194469 gene locus_tag LOCUS_08570 gene rfbA 195341 194469 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401670.1 protein_id gnl|my_center|LOCUS_08570 195536 196984 gene locus_tag LOCUS_08580 195536 196984 CDS product bifunctional dTDP-4-dehydrorhamnose 3,5-epimerase family protein/NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803927.1 protein_id gnl|my_center|LOCUS_08580 198659 197181 gene locus_tag LOCUS_08590 198659 197181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 198897 199949 gene locus_tag LOCUS_08600 198897 199949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 200024 201031 gene locus_tag LOCUS_08610 gene rfbB 200024 201031 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803926.1 protein_id gnl|my_center|LOCUS_08610 201035 201973 gene locus_tag LOCUS_08620 gene rfbG 201035 201973 CDS product dTDP-rhamnosyl transferase RfbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005049197.1 protein_id gnl|my_center|LOCUS_08620 202057 202935 gene locus_tag LOCUS_08630 202057 202935 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765256.1 protein_id gnl|my_center|LOCUS_08630 203778 203080 gene locus_tag LOCUS_08640 203778 203080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 203967 204263 gene locus_tag LOCUS_08650 203967 204263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 204272 207436 gene locus_tag LOCUS_08660 204272 207436 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053572.1 protein_id gnl|my_center|LOCUS_08660 207433 208833 gene locus_tag LOCUS_08670 207433 208833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 208944 209150 gene locus_tag LOCUS_08680 208944 209150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 209465 209049 gene locus_tag LOCUS_08690 209465 209049 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776092.1 protein_id gnl|my_center|LOCUS_08690 209793 210188 gene locus_tag LOCUS_08700 209793 210188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 211686 210742 gene locus_tag LOCUS_08710 211686 210742 CDS product glycerophosphoryl diester phosphodiesterase membrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776082.1 protein_id gnl|my_center|LOCUS_08710 212035 212715 gene locus_tag LOCUS_08720 gene mtrA 212035 212715 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_08720 212900 214501 gene locus_tag LOCUS_08730 212900 214501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 214501 216174 gene locus_tag LOCUS_08740 214501 216174 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067925.1 protein_id gnl|my_center|LOCUS_08740 216641 217081 gene locus_tag LOCUS_08750 216641 217081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 217527 218171 gene locus_tag LOCUS_08760 gene raiA 217527 218171 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813792.1 protein_id gnl|my_center|LOCUS_08760 219314 222193 gene locus_tag LOCUS_08770 gene secA 219314 222193 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776076.1 protein_id gnl|my_center|LOCUS_08770 222714 222241 gene locus_tag LOCUS_08780 222714 222241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 223685 222711 gene locus_tag LOCUS_08790 223685 222711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 223844 224410 gene locus_tag LOCUS_08800 223844 224410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 224949 224740 gene locus_tag LOCUS_08810 224949 224740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 225101 225727 gene locus_tag LOCUS_08820 225101 225727 CDS product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776071.1 protein_id gnl|my_center|LOCUS_08820 225724 227295 gene locus_tag LOCUS_08830 225724 227295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 227282 227764 gene locus_tag LOCUS_08840 227282 227764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 231266 228069 gene locus_tag LOCUS_08850 231266 228069 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072762.1 protein_id gnl|my_center|LOCUS_08850 232471 231263 gene locus_tag LOCUS_08860 232471 231263 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284170.1 protein_id gnl|my_center|LOCUS_08860 233668 232850 gene locus_tag LOCUS_08870 233668 232850 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775973.1 protein_id gnl|my_center|LOCUS_08870 235056 234001 gene locus_tag LOCUS_08880 gene rsgA 235056 234001 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 protein_id gnl|my_center|LOCUS_08880 236327 235053 gene locus_tag LOCUS_08890 gene aroA 236327 235053 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775971.1 protein_id gnl|my_center|LOCUS_08890 237012 236497 gene locus_tag LOCUS_08900 237012 236497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 237306 237956 gene locus_tag LOCUS_08910 gene sigR 237306 237956 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_08910 237949 238308 gene locus_tag LOCUS_08920 237949 238308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 239439 238747 gene locus_tag LOCUS_08930 239439 238747 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399561.1 protein_id gnl|my_center|LOCUS_08930 240581 239436 gene locus_tag LOCUS_08940 240581 239436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 240612 240866 gene locus_tag LOCUS_08950 240612 240866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 241819 241220 gene locus_tag LOCUS_08960 241819 241220 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775967.1 protein_id gnl|my_center|LOCUS_08960 245654 241836 gene locus_tag LOCUS_08970 245654 241836 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775966.1 protein_id gnl|my_center|LOCUS_08970 246050 247381 gene locus_tag LOCUS_08980 246050 247381 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_08980 247378 248445 gene locus_tag LOCUS_08990 247378 248445 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183373870.1 protein_id gnl|my_center|LOCUS_08990 248858 249589 gene locus_tag LOCUS_09000 248858 249589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 249589 250404 gene locus_tag LOCUS_09010 249589 250404 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_09010 251338 251616 gene locus_tag LOCUS_09020 251338 251616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 252912 251500 gene locus_tag LOCUS_09030 252912 251500 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777006.1 protein_id gnl|my_center|LOCUS_09030 253373 253298 gene locus_tag LOCUS_t00240 253373 253298 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 253816 254271 gene locus_tag LOCUS_09040 253816 254271 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804783.1 protein_id gnl|my_center|LOCUS_09040 255007 254345 gene locus_tag LOCUS_09050 255007 254345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 256076 255018 gene locus_tag LOCUS_09060 gene degA 256076 255018 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_09060 256211 256220 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 257177 256299 gene locus_tag LOCUS_09070 257177 256299 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015137.1 protein_id gnl|my_center|LOCUS_09070 258019 257174 gene locus_tag LOCUS_09080 258019 257174 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567523.1 protein_id gnl|my_center|LOCUS_09080 259445 258114 gene locus_tag LOCUS_09090 259445 258114 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence13 1112 1558 gene locus_tag LOCUS_09100 1112 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2346 3533 gene locus_tag LOCUS_09110 2346 3533 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115334.1 protein_id gnl|my_center|LOCUS_09110 3530 4315 gene locus_tag LOCUS_09120 3530 4315 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399558.1 protein_id gnl|my_center|LOCUS_09120 4315 5271 gene locus_tag LOCUS_09130 4315 5271 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111894.1 protein_id gnl|my_center|LOCUS_09130 5268 6134 gene locus_tag LOCUS_09140 5268 6134 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111893.1 protein_id gnl|my_center|LOCUS_09140 6172 7032 gene locus_tag LOCUS_09150 gene rsmI 6172 7032 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804940.1 protein_id gnl|my_center|LOCUS_09150 7753 7178 gene locus_tag LOCUS_09160 7753 7178 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389798.1 protein_id gnl|my_center|LOCUS_09160 7864 9705 gene locus_tag LOCUS_09170 gene metG 7864 9705 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775786.1 protein_id gnl|my_center|LOCUS_09170 11230 9797 gene locus_tag LOCUS_09180 11230 9797 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804657.1 protein_id gnl|my_center|LOCUS_09180 11786 11316 gene locus_tag LOCUS_09190 11786 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 12356 11859 gene locus_tag LOCUS_09200 12356 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 12654 12340 gene locus_tag LOCUS_09210 12654 12340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 12997 13395 gene locus_tag LOCUS_09220 12997 13395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 13882 13538 gene locus_tag LOCUS_09230 13882 13538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 13860 15092 gene locus_tag LOCUS_09240 13860 15092 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 protein_id gnl|my_center|LOCUS_09240 15089 15739 gene locus_tag LOCUS_09250 15089 15739 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814649.1 protein_id gnl|my_center|LOCUS_09250 15851 17341 gene locus_tag LOCUS_09260 15851 17341 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015555.1 protein_id gnl|my_center|LOCUS_09260 17542 20352 gene locus_tag LOCUS_09270 gene pcrA 17542 20352 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence14 474 1205 gene locus_tag LOCUS_09280 474 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1257 1829 gene locus_tag LOCUS_09290 1257 1829 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 protein_id gnl|my_center|LOCUS_09290 2761 2252 gene locus_tag LOCUS_09300 2761 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 3720 2788 gene locus_tag LOCUS_09310 3720 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 3607 3978 gene locus_tag LOCUS_09320 3607 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 4052 5620 gene locus_tag LOCUS_09330 4052 5620 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803796.1 protein_id gnl|my_center|LOCUS_09330 6057 6596 gene locus_tag LOCUS_09340 6057 6596 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859635.1 protein_id gnl|my_center|LOCUS_09340 8221 6914 gene locus_tag LOCUS_09350 8221 6914 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285177.1 protein_id gnl|my_center|LOCUS_09350 10042 8309 gene locus_tag LOCUS_09360 10042 8309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141301.1 protein_id gnl|my_center|LOCUS_09360 11805 10039 gene locus_tag LOCUS_09370 11805 10039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141300.1 protein_id gnl|my_center|LOCUS_09370 12869 11829 gene locus_tag LOCUS_09380 12869 11829 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027505.1 protein_id gnl|my_center|LOCUS_09380 13661 12882 gene locus_tag LOCUS_09390 13661 12882 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014492.1 protein_id gnl|my_center|LOCUS_09390 14770 13658 gene locus_tag LOCUS_09400 14770 13658 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804087.1 protein_id gnl|my_center|LOCUS_09400 16877 14763 gene locus_tag LOCUS_09410 16877 14763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 17013 16882 gene locus_tag LOCUS_09420 17013 16882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 17803 17354 gene locus_tag LOCUS_09430 17803 17354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 19147 17975 gene locus_tag LOCUS_09440 gene rlmC 19147 17975 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804013.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence15 447 705 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcagaaagcacctcgcaccataaggtgcattaagac 703 712 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 722 1622 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcagaaagcacctcgcaccataaggtgcattaagac 2237 1722 gene locus_tag LOCUS_09450 2237 1722 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729729.1 protein_id gnl|my_center|LOCUS_09450 3725 2247 gene locus_tag LOCUS_09460 gene der 3725 2247 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_09460 5382 3799 gene locus_tag LOCUS_09470 5382 3799 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_09470 5531 8020 gene locus_tag LOCUS_09480 gene pepN 5531 8020 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326219.1 protein_id gnl|my_center|LOCUS_09480 8022 8879 gene locus_tag LOCUS_09490 8022 8879 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052289.1 protein_id gnl|my_center|LOCUS_09490 8881 9213 gene locus_tag LOCUS_09500 8881 9213 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813185.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence16 1325 312 gene locus_tag LOCUS_09510 1325 312 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_09510 1503 2753 gene locus_tag LOCUS_09520 1503 2753 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804843.1 protein_id gnl|my_center|LOCUS_09520 2938 4539 gene locus_tag LOCUS_09530 2938 4539 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804842.1 protein_id gnl|my_center|LOCUS_09530 4539 5441 gene locus_tag LOCUS_09540 4539 5441 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804841.1 protein_id gnl|my_center|LOCUS_09540 5546 7966 gene locus_tag LOCUS_09550 5546 7966 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582331.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence17 837 646 gene locus_tag LOCUS_09560 837 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 749 1588 gene locus_tag LOCUS_09570 749 1588 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267623.1 protein_id gnl|my_center|LOCUS_09570 1949 2077 gene locus_tag LOCUS_09580 1949 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2500 2676 gene locus_tag LOCUS_09590 2500 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2947 7548 gene locus_tag LOCUS_09600 2947 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence18 155 49 gene locus_tag LOCUS_r00010 155 49 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3430 307 gene locus_tag LOCUS_r00020 3430 307 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5331 3784 gene locus_tag LOCUS_r00030 5331 3784 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence19 2949 391 gene locus_tag LOCUS_09610 2949 391 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805172.1 protein_id gnl|my_center|LOCUS_09610 3044 3754 gene locus_tag LOCUS_09620 3044 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence20 220 3358 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggctcatccccgctcacgcggggagcac >Feature sequence21 2455 1064 gene locus_tag LOCUS_09630 2455 1064 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857047.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence22 <1 972 gene locus_tag LOCUS_09640 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389557.1:sugar-binding transcriptional regulator 1478 996 gene locus_tag LOCUS_09650 1478 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09650 >Feature sequence23 183 749 gene locus_tag LOCUS_09660 183 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1202 786 gene locus_tag LOCUS_09670 1202 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1584 1742 gene locus_tag LOCUS_09680 1584 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2347 2658 gene locus_tag LOCUS_09690 2347 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 3029 2604 gene locus_tag LOCUS_09700 3029 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 3183 4868 gene locus_tag LOCUS_09710 3183 4868 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014910.1 protein_id gnl|my_center|LOCUS_09710 5613 6230 gene locus_tag LOCUS_09720 5613 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 6750 7091 gene locus_tag LOCUS_09730 6750 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 7336 7638 gene locus_tag LOCUS_09740 7336 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 8789 7611 gene locus_tag LOCUS_09750 8789 7611 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390161.1 protein_id gnl|my_center|LOCUS_09750 9826 9104 gene locus_tag LOCUS_09760 gene pgpB 9826 9104 CDS product phosphatidylglycerophosphatase PgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399336.1 protein_id gnl|my_center|LOCUS_09760 10260 9823 gene locus_tag LOCUS_09770 10260 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 11722 10688 gene locus_tag LOCUS_09780 gene trxB 11722 10688 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777150.1 protein_id gnl|my_center|LOCUS_09780 13201 11798 gene locus_tag LOCUS_09790 13201 11798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 14945 13194 gene locus_tag LOCUS_09800 14945 13194 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777147.1 protein_id gnl|my_center|LOCUS_09800 17317 14945 gene locus_tag LOCUS_09810 17317 14945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 17854 17318 gene locus_tag LOCUS_09820 17854 17318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 18283 19887 gene locus_tag LOCUS_09830 18283 19887 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930081.1 protein_id gnl|my_center|LOCUS_09830 20376 21839 gene locus_tag LOCUS_09840 gene gndA 20376 21839 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804424.1 protein_id gnl|my_center|LOCUS_09840 22128 24599 gene locus_tag LOCUS_09850 22128 24599 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390331.1 protein_id gnl|my_center|LOCUS_09850 26071 26256 gene locus_tag LOCUS_09860 26071 26256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 26983 27312 gene locus_tag LOCUS_09870 26983 27312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 27994 27536 gene locus_tag LOCUS_09880 gene rplI 27994 27536 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777136.1 protein_id gnl|my_center|LOCUS_09880 28255 28013 gene locus_tag LOCUS_09890 gene rpsR 28255 28013 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777137.1 protein_id gnl|my_center|LOCUS_09890 28879 28343 gene locus_tag LOCUS_09900 28879 28343 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898320.1 protein_id gnl|my_center|LOCUS_09900 29213 28923 gene locus_tag LOCUS_09910 gene rpsF 29213 28923 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400520.1 protein_id gnl|my_center|LOCUS_09910 31187 29751 gene locus_tag LOCUS_09920 31187 29751 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_09920 31559 32914 gene locus_tag LOCUS_09930 gene dnaB 31559 32914 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929839.1 protein_id gnl|my_center|LOCUS_09930 33631 33413 gene locus_tag LOCUS_09940 33631 33413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 34418 34185 gene locus_tag LOCUS_09950 34418 34185 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804343.1 protein_id gnl|my_center|LOCUS_09950 35197 35111 gene locus_tag LOCUS_t00250 35197 35111 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 36362 35268 gene locus_tag LOCUS_09960 36362 35268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 38869 36359 gene locus_tag LOCUS_09970 38869 36359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 39066 40520 gene locus_tag LOCUS_09980 39066 40520 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482205.1 protein_id gnl|my_center|LOCUS_09980 40522 42594 gene locus_tag LOCUS_09990 40522 42594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 42591 43061 gene locus_tag LOCUS_10000 42591 43061 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454901.1 protein_id gnl|my_center|LOCUS_10000 43768 43127 gene locus_tag LOCUS_10010 43768 43127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 44649 43864 gene locus_tag LOCUS_10020 44649 43864 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546159.1 protein_id gnl|my_center|LOCUS_10020 45687 44941 gene locus_tag LOCUS_10030 45687 44941 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803866.1 protein_id gnl|my_center|LOCUS_10030 46417 45896 gene locus_tag LOCUS_10040 46417 45896 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929825.1 protein_id gnl|my_center|LOCUS_10040 46567 47172 gene locus_tag LOCUS_10050 46567 47172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 48282 47413 gene locus_tag LOCUS_10060 48282 47413 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819430.1 protein_id gnl|my_center|LOCUS_10060 49204 48941 gene locus_tag LOCUS_10070 49204 48941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 49723 50364 gene locus_tag LOCUS_10080 49723 50364 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485254.1 protein_id gnl|my_center|LOCUS_10080 50366 51127 gene locus_tag LOCUS_10090 50366 51127 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776677.1 protein_id gnl|my_center|LOCUS_10090 51151 51303 gene locus_tag LOCUS_10100 51151 51303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 53475 51466 gene locus_tag LOCUS_10110 gene pknB 53475 51466 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389386.1 protein_id gnl|my_center|LOCUS_10110 55172 53448 gene locus_tag LOCUS_10120 55172 53448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 56623 55169 gene locus_tag LOCUS_10130 56623 55169 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056822.1 protein_id gnl|my_center|LOCUS_10130 58017 56620 gene locus_tag LOCUS_10140 58017 56620 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776671.1 protein_id gnl|my_center|LOCUS_10140 59333 58017 gene locus_tag LOCUS_10150 59333 58017 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776670.1 protein_id gnl|my_center|LOCUS_10150 59826 59335 gene locus_tag LOCUS_10160 gene fhaB 59826 59335 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_10160 60527 59823 gene locus_tag LOCUS_10170 60527 59823 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811419.1 protein_id gnl|my_center|LOCUS_10170 61743 60781 gene locus_tag LOCUS_10180 gene nrdF 61743 60781 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415973.1 protein_id gnl|my_center|LOCUS_10180 61988 61740 gene locus_tag LOCUS_10190 61988 61740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 63456 62143 gene locus_tag LOCUS_10200 63456 62143 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027368.1 protein_id gnl|my_center|LOCUS_10200 63960 63634 gene locus_tag LOCUS_10210 gene brnE 63960 63634 CDS product branched-chain amino acid exporter BrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013513.1 protein_id gnl|my_center|LOCUS_10210 65072 63957 gene locus_tag LOCUS_10220 65072 63957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 65350 66225 gene locus_tag LOCUS_10230 65350 66225 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804415.1 protein_id gnl|my_center|LOCUS_10230 66222 66458 gene locus_tag LOCUS_10240 66222 66458 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941406.1 protein_id gnl|my_center|LOCUS_10240 66600 67940 gene locus_tag LOCUS_10250 66600 67940 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461029.1 protein_id gnl|my_center|LOCUS_10250 70360 68009 gene locus_tag LOCUS_10260 70360 68009 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803998.1 protein_id gnl|my_center|LOCUS_10260 70875 71831 gene locus_tag LOCUS_10270 70875 71831 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854943.1 protein_id gnl|my_center|LOCUS_10270 72145 71777 gene locus_tag LOCUS_10280 72145 71777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 74034 72259 gene locus_tag LOCUS_10290 74034 72259 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804193.1 protein_id gnl|my_center|LOCUS_10290 74848 74117 gene locus_tag LOCUS_10300 74848 74117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 78970 75422 gene locus_tag LOCUS_10310 78970 75422 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197702416.1 protein_id gnl|my_center|LOCUS_10310 80675 79170 gene locus_tag LOCUS_10320 gene putP 80675 79170 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 protein_id gnl|my_center|LOCUS_10320 83281 81125 gene locus_tag LOCUS_10330 gene nrdE 83281 81125 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694643.1 protein_id gnl|my_center|LOCUS_10330 83667 83251 gene locus_tag LOCUS_10340 gene nrdI 83667 83251 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776482.1 protein_id gnl|my_center|LOCUS_10340 84303 84040 gene locus_tag LOCUS_10350 84303 84040 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056596.1 protein_id gnl|my_center|LOCUS_10350 86901 85060 gene locus_tag LOCUS_10360 86901 85060 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930277.1 protein_id gnl|my_center|LOCUS_10360 87024 87776 gene locus_tag LOCUS_10370 gene mtnN 87024 87776 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804292.1 protein_id gnl|my_center|LOCUS_10370 87861 88349 gene locus_tag LOCUS_10380 87861 88349 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804863.1 protein_id gnl|my_center|LOCUS_10380 89810 88452 gene locus_tag LOCUS_10390 89810 88452 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166233908.1 protein_id gnl|my_center|LOCUS_10390 91383 89998 gene locus_tag LOCUS_10400 91383 89998 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214261.1 protein_id gnl|my_center|LOCUS_10400 92537 91755 gene locus_tag LOCUS_10410 92537 91755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 93099 92548 gene locus_tag LOCUS_10420 93099 92548 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776234.1 protein_id gnl|my_center|LOCUS_10420 94316 93165 gene locus_tag LOCUS_10430 94316 93165 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_10430 94342 94557 gene locus_tag LOCUS_10440 94342 94557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 95198 94482 gene locus_tag LOCUS_10450 95198 94482 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994509.1 protein_id gnl|my_center|LOCUS_10450 95340 96371 gene locus_tag LOCUS_10460 95340 96371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 96344 97129 gene locus_tag LOCUS_10470 96344 97129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101009.1 protein_id gnl|my_center|LOCUS_10470 97684 97163 gene locus_tag LOCUS_10480 97684 97163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 103614 97681 gene locus_tag LOCUS_10490 103614 97681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 104098 104529 gene locus_tag LOCUS_10500 104098 104529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 104529 105470 gene locus_tag LOCUS_10510 104529 105470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 105538 107229 gene locus_tag LOCUS_10520 105538 107229 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870224.1 protein_id gnl|my_center|LOCUS_10520 108839 107253 gene locus_tag LOCUS_10530 108839 107253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 109754 108840 gene locus_tag LOCUS_10540 109754 108840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 110176 109664 gene locus_tag LOCUS_10550 110176 109664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10550 110389 110850 gene locus_tag LOCUS_10560 110389 110850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 110865 111521 gene locus_tag LOCUS_10570 110865 111521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 111548 112591 gene locus_tag LOCUS_10580 111548 112591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 112588 113586 gene locus_tag LOCUS_10590 112588 113586 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938996.1 protein_id gnl|my_center|LOCUS_10590 113583 116066 gene locus_tag LOCUS_10600 gene pglZ 113583 116066 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038873.1 protein_id gnl|my_center|LOCUS_10600 116075 116452 gene locus_tag LOCUS_10610 116075 116452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10610 116376 118244 gene locus_tag LOCUS_10620 gene brxL 116376 118244 CDS product BREX system Lon protease-like protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939301.1 protein_id gnl|my_center|LOCUS_10620 118775 119833 gene locus_tag LOCUS_10630 118775 119833 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_10630 121364 119880 gene locus_tag LOCUS_10640 121364 119880 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_10640 122397 121621 gene locus_tag LOCUS_10650 122397 121621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 122656 122952 gene locus_tag LOCUS_10660 122656 122952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 123113 124171 gene locus_tag LOCUS_10670 123113 124171 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015009.1 protein_id gnl|my_center|LOCUS_10670 124208 124993 gene locus_tag LOCUS_10680 124208 124993 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013417.1 protein_id gnl|my_center|LOCUS_10680 125054 125788 gene locus_tag LOCUS_10690 125054 125788 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_10690 125830 127338 gene locus_tag LOCUS_10700 gene aroP 125830 127338 CDS product aromatic amino acid transport protein AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014125.1 protein_id gnl|my_center|LOCUS_10700 127669 128442 gene locus_tag LOCUS_10710 127669 128442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 129179 128526 gene locus_tag LOCUS_10720 129179 128526 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_10720 130357 129176 gene locus_tag LOCUS_10730 130357 129176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 131273 130461 gene locus_tag LOCUS_10740 131273 130461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 132349 131432 gene locus_tag LOCUS_10750 132349 131432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223406.1 protein_id gnl|my_center|LOCUS_10750 134491 132563 gene locus_tag LOCUS_10760 134491 132563 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014807.1 protein_id gnl|my_center|LOCUS_10760 135456 134488 gene locus_tag LOCUS_10770 135456 134488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284211.1 protein_id gnl|my_center|LOCUS_10770 136375 135449 gene locus_tag LOCUS_10780 136375 135449 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857497.1 protein_id gnl|my_center|LOCUS_10780 138257 136650 gene locus_tag LOCUS_10790 138257 136650 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014806.1 protein_id gnl|my_center|LOCUS_10790 138975 140066 gene locus_tag LOCUS_10800 138975 140066 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485041.1 protein_id gnl|my_center|LOCUS_10800 141232 140198 gene locus_tag LOCUS_10810 141232 140198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 141116 141376 gene locus_tag LOCUS_10820 141116 141376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 142412 141492 gene locus_tag LOCUS_10830 142412 141492 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776965.1 protein_id gnl|my_center|LOCUS_10830 143401 142430 gene locus_tag LOCUS_10840 143401 142430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 144084 143398 gene locus_tag LOCUS_10850 144084 143398 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776967.1 protein_id gnl|my_center|LOCUS_10850 144956 144081 gene locus_tag LOCUS_10860 144956 144081 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776968.1 protein_id gnl|my_center|LOCUS_10860 146708 145341 gene locus_tag LOCUS_10870 146708 145341 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399566.1 protein_id gnl|my_center|LOCUS_10870 147312 148088 gene locus_tag LOCUS_10880 147312 148088 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014437.1 protein_id gnl|my_center|LOCUS_10880 148871 148956 gene locus_tag LOCUS_t00260 148871 148956 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 149650 149723 gene locus_tag LOCUS_t00270 149650 149723 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 150862 150491 gene locus_tag LOCUS_10890 150862 150491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 152288 151431 gene locus_tag LOCUS_10900 gene gluQRS 152288 151431 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803860.1 protein_id gnl|my_center|LOCUS_10900 152263 152514 gene locus_tag LOCUS_10910 152263 152514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 153026 152718 gene locus_tag LOCUS_10920 153026 152718 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 protein_id gnl|my_center|LOCUS_10920 153567 154133 gene locus_tag LOCUS_10930 153567 154133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 154130 154732 gene locus_tag LOCUS_10940 154130 154732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 154947 155939 gene locus_tag LOCUS_10950 154947 155939 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929841.1 protein_id gnl|my_center|LOCUS_10950 155936 156676 gene locus_tag LOCUS_10960 155936 156676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_10960 156868 157707 gene locus_tag LOCUS_10970 156868 157707 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803995.1 protein_id gnl|my_center|LOCUS_10970 158106 159386 gene locus_tag LOCUS_10980 158106 159386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 159827 160276 gene locus_tag LOCUS_10990 159827 160276 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085354.1 protein_id gnl|my_center|LOCUS_10990 161232 160594 gene locus_tag LOCUS_11000 gene upp 161232 160594 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114100.1 protein_id gnl|my_center|LOCUS_11000 161405 162463 gene locus_tag LOCUS_11010 161405 162463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 162566 163078 gene locus_tag LOCUS_11020 162566 163078 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_11020 163805 163323 gene locus_tag LOCUS_11030 gene moaC 163805 163323 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_11030 165416 164022 gene locus_tag LOCUS_11040 165416 164022 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113181.1 protein_id gnl|my_center|LOCUS_11040 166207 165467 gene locus_tag LOCUS_11050 166207 165467 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067598.1 protein_id gnl|my_center|LOCUS_11050 166674 166252 gene locus_tag LOCUS_11060 166674 166252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 167667 166684 gene locus_tag LOCUS_11070 167667 166684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 168652 167870 gene locus_tag LOCUS_11080 gene narI 168652 167870 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854891.1 protein_id gnl|my_center|LOCUS_11080 169338 168658 gene locus_tag LOCUS_11090 gene narJ 169338 168658 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014185.1 protein_id gnl|my_center|LOCUS_11090 170870 169335 gene locus_tag LOCUS_11100 gene narH 170870 169335 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014186.1 protein_id gnl|my_center|LOCUS_11100 174631 170870 gene locus_tag LOCUS_11110 174631 170870 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014187.1 protein_id gnl|my_center|LOCUS_11110 176047 174704 gene locus_tag LOCUS_11120 176047 174704 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 protein_id gnl|my_center|LOCUS_11120 177265 176255 gene locus_tag LOCUS_11130 gene moaA 177265 176255 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014195.1 protein_id gnl|my_center|LOCUS_11130 177375 178145 gene locus_tag LOCUS_11140 177375 178145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 179620 178244 gene locus_tag LOCUS_11150 179620 178244 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123927512.1 protein_id gnl|my_center|LOCUS_11150 180468 179839 gene locus_tag LOCUS_11160 180468 179839 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804347.1 protein_id gnl|my_center|LOCUS_11160 181308 180655 gene locus_tag LOCUS_11170 181308 180655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 190481 181305 gene locus_tag LOCUS_11180 190481 181305 CDS product DUF1729 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128772428.1 protein_id gnl|my_center|LOCUS_11180 192276 190534 gene locus_tag LOCUS_11190 192276 190534 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052982.1 protein_id gnl|my_center|LOCUS_11190 194204 192273 gene locus_tag LOCUS_11200 194204 192273 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994305.1 protein_id gnl|my_center|LOCUS_11200 194863 194201 gene locus_tag LOCUS_11210 194863 194201 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403305.1 protein_id gnl|my_center|LOCUS_11210 196008 195265 gene locus_tag LOCUS_11220 196008 195265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 195895 196104 gene locus_tag LOCUS_11230 195895 196104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 197213 196152 gene locus_tag LOCUS_11240 197213 196152 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690162.1 protein_id gnl|my_center|LOCUS_11240 198118 197327 gene locus_tag LOCUS_11250 198118 197327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 198637 198125 gene locus_tag LOCUS_11260 198637 198125 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_11260 198921 199724 gene locus_tag LOCUS_11270 gene modA 198921 199724 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 protein_id gnl|my_center|LOCUS_11270 199721 201799 gene locus_tag LOCUS_11280 199721 201799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 202686 202018 gene locus_tag LOCUS_11290 202686 202018 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224164.1 protein_id gnl|my_center|LOCUS_11290 203062 207696 gene locus_tag LOCUS_11300 203062 207696 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 protein_id gnl|my_center|LOCUS_11300 207893 207982 gene locus_tag LOCUS_t00280 207893 207982 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence24 1 840 gene locus_tag LOCUS_11310 1 840 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence25 1232 24 gene locus_tag LOCUS_11320 1232 24 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531949.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence26 346 1236 gene locus_tag LOCUS_11330 346 1236 CDS product IS1249 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053543917.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence27 238 915 gene locus_tag LOCUS_11340 238 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11340 908 1126 gene locus_tag LOCUS_11350 908 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence28 >Feature sequence29 156 1281 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgctccccgcgtgagcggggatgagcc 1770 2267 gene locus_tag LOCUS_11360 1770 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 2716 3678 gene locus_tag LOCUS_11370 2716 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3748 3972 gene locus_tag LOCUS_11380 3748 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 4236 5498 gene locus_tag LOCUS_11390 4236 5498 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_11390 5976 7256 gene locus_tag LOCUS_11400 5976 7256 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804520.1 protein_id gnl|my_center|LOCUS_11400 7950 7657 gene locus_tag LOCUS_11410 7950 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 9234 10208 gene locus_tag LOCUS_11420 9234 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 10521 11168 gene locus_tag LOCUS_11430 10521 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 11165 12520 gene locus_tag LOCUS_11440 11165 12520 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930019.1 protein_id gnl|my_center|LOCUS_11440 12520 12945 gene locus_tag LOCUS_11450 gene dtd 12520 12945 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804517.1 protein_id gnl|my_center|LOCUS_11450 13232 19048 gene locus_tag LOCUS_11460 13232 19048 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193495474.1 protein_id gnl|my_center|LOCUS_11460 19133 20098 gene locus_tag LOCUS_11470 19133 20098 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929980.1 protein_id gnl|my_center|LOCUS_11470 20104 21351 gene locus_tag LOCUS_11480 20104 21351 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776170.1 protein_id gnl|my_center|LOCUS_11480 21348 23978 gene locus_tag LOCUS_11490 21348 23978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 23975 25576 gene locus_tag LOCUS_11500 23975 25576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 27253 25820 gene locus_tag LOCUS_11510 27253 25820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 28710 27250 gene locus_tag LOCUS_11520 28710 27250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 30041 28710 gene locus_tag LOCUS_11530 30041 28710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 30960 31271 gene locus_tag LOCUS_11540 30960 31271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 31303 31587 gene locus_tag LOCUS_11550 31303 31587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 33250 31961 gene locus_tag LOCUS_11560 33250 31961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 34689 33349 gene locus_tag LOCUS_11570 34689 33349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 34956 38990 gene locus_tag LOCUS_11580 34956 38990 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_11580 39104 39652 gene locus_tag LOCUS_11590 39104 39652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 39733 40590 gene locus_tag LOCUS_11600 39733 40590 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776167.1 protein_id gnl|my_center|LOCUS_11600 40606 42009 gene locus_tag LOCUS_11610 40606 42009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 43554 42127 gene locus_tag LOCUS_11620 43554 42127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 44098 43598 gene locus_tag LOCUS_11630 44098 43598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 45415 44201 gene locus_tag LOCUS_11640 45415 44201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 46867 45665 gene locus_tag LOCUS_11650 46867 45665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 49906 47207 gene locus_tag LOCUS_11660 49906 47207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 50315 49914 gene locus_tag LOCUS_11670 50315 49914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 52807 50369 gene locus_tag LOCUS_11680 52807 50369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 53691 52804 gene locus_tag LOCUS_11690 53691 52804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 55224 54400 gene locus_tag LOCUS_11700 55224 54400 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262988.1 protein_id gnl|my_center|LOCUS_11700 55560 55372 gene locus_tag LOCUS_11710 55560 55372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 55465 57936 gene locus_tag LOCUS_11720 55465 57936 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_11720 58043 58834 gene locus_tag LOCUS_11730 58043 58834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 58831 60420 gene locus_tag LOCUS_11740 58831 60420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 60414 62117 gene locus_tag LOCUS_11750 60414 62117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 63507 62326 gene locus_tag LOCUS_11760 63507 62326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 64459 63605 gene locus_tag LOCUS_11770 64459 63605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 65483 64473 gene locus_tag LOCUS_11780 65483 64473 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_11780 65866 67524 gene locus_tag LOCUS_11790 65866 67524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 67640 67649 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 68288 70996 gene locus_tag LOCUS_11800 gene ppdK 68288 70996 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_11800 71140 71358 gene locus_tag LOCUS_11810 71140 71358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 73177 71519 gene locus_tag LOCUS_11820 73177 71519 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731564.1 protein_id gnl|my_center|LOCUS_11820 73454 73960 gene locus_tag LOCUS_11830 73454 73960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 73969 74859 gene locus_tag LOCUS_11840 73969 74859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 74856 76049 gene locus_tag LOCUS_11850 74856 76049 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017091.1 protein_id gnl|my_center|LOCUS_11850 76087 77295 gene locus_tag LOCUS_11860 76087 77295 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994904.1 protein_id gnl|my_center|LOCUS_11860 77297 78097 gene locus_tag LOCUS_11870 77297 78097 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902775.1 protein_id gnl|my_center|LOCUS_11870 78478 80088 gene locus_tag LOCUS_11880 78478 80088 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994324.1 protein_id gnl|my_center|LOCUS_11880 80130 80759 gene locus_tag LOCUS_11890 80130 80759 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114233.1 protein_id gnl|my_center|LOCUS_11890 81037 82299 gene locus_tag LOCUS_11900 81037 82299 CDS product DUF2318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399782.1 protein_id gnl|my_center|LOCUS_11900 82346 83617 gene locus_tag LOCUS_11910 82346 83617 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679164.1 protein_id gnl|my_center|LOCUS_11910 83635 84855 gene locus_tag LOCUS_11920 83635 84855 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814181.1 protein_id gnl|my_center|LOCUS_11920 84866 85609 gene locus_tag LOCUS_11930 84866 85609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068491.1 protein_id gnl|my_center|LOCUS_11930 85606 86148 gene locus_tag LOCUS_11940 85606 86148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 86148 87383 gene locus_tag LOCUS_11950 86148 87383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 87491 89095 gene locus_tag LOCUS_11960 87491 89095 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_11960 90256 89501 gene locus_tag LOCUS_11970 90256 89501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927299.1 protein_id gnl|my_center|LOCUS_11970 91065 90262 gene locus_tag LOCUS_11980 91065 90262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 92042 91107 gene locus_tag LOCUS_11990 92042 91107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860908.1 protein_id gnl|my_center|LOCUS_11990 95600 92403 gene locus_tag LOCUS_12000 95600 92403 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029608.1 protein_id gnl|my_center|LOCUS_12000 95721 96929 gene locus_tag LOCUS_12010 95721 96929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 98339 97215 gene locus_tag LOCUS_12020 98339 97215 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857515.1 protein_id gnl|my_center|LOCUS_12020 99772 99020 gene locus_tag LOCUS_12030 99772 99020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 100646 99774 gene locus_tag LOCUS_12040 100646 99774 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462188.1 protein_id gnl|my_center|LOCUS_12040 101032 100646 gene locus_tag LOCUS_12050 101032 100646 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948844.1 protein_id gnl|my_center|LOCUS_12050 103153 102005 gene locus_tag LOCUS_12060 103153 102005 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_12060 104632 103298 gene locus_tag LOCUS_12070 104632 103298 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_12070 104912 106282 gene locus_tag LOCUS_12080 104912 106282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 107217 106723 gene locus_tag LOCUS_12090 107217 106723 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804890.1 protein_id gnl|my_center|LOCUS_12090 107322 108698 gene locus_tag LOCUS_12100 gene dacB 107322 108698 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068787.1 protein_id gnl|my_center|LOCUS_12100 108782 109624 gene locus_tag LOCUS_12110 108782 109624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 109764 110801 gene locus_tag LOCUS_12120 gene tilS 109764 110801 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_12120 111033 111587 gene locus_tag LOCUS_12130 gene hpt 111033 111587 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_12130 111599 113611 gene locus_tag LOCUS_12140 gene ftsH 111599 113611 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004575067.1 protein_id gnl|my_center|LOCUS_12140 113611 114180 gene locus_tag LOCUS_12150 gene folE 113611 114180 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_12150 114183 115010 gene locus_tag LOCUS_12160 gene folP 114183 115010 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_12160 115007 117358 gene locus_tag LOCUS_12170 115007 117358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 117355 117840 gene locus_tag LOCUS_12180 117355 117840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 118044 118730 gene locus_tag LOCUS_12190 118044 118730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 120170 119100 gene locus_tag LOCUS_12200 gene disA 120170 119100 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_12200 121576 120206 gene locus_tag LOCUS_12210 gene radA 121576 120206 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_12210 122427 121744 gene locus_tag LOCUS_12220 122427 121744 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_12220 123978 122455 gene locus_tag LOCUS_12230 123978 122455 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_12230 124178 124396 gene locus_tag LOCUS_12240 124178 124396 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222402.1 protein_id gnl|my_center|LOCUS_12240 124784 125452 gene locus_tag LOCUS_12250 124784 125452 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974480.1 protein_id gnl|my_center|LOCUS_12250 126002 125556 gene locus_tag LOCUS_12260 126002 125556 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035800727.1 protein_id gnl|my_center|LOCUS_12260 127087 126194 gene locus_tag LOCUS_12270 127087 126194 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466560.1 protein_id gnl|my_center|LOCUS_12270 128435 127110 gene locus_tag LOCUS_12280 gene menE 128435 127110 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098433.1 protein_id gnl|my_center|LOCUS_12280 128477 128755 gene locus_tag LOCUS_12290 128477 128755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 129812 128832 gene locus_tag LOCUS_12300 129812 128832 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776413.1 protein_id gnl|my_center|LOCUS_12300 130282 129809 gene locus_tag LOCUS_12310 130282 129809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 130536 131117 gene locus_tag LOCUS_12320 130536 131117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 131377 132450 gene locus_tag LOCUS_12330 131377 132450 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776412.1 protein_id gnl|my_center|LOCUS_12330 132447 134153 gene locus_tag LOCUS_12340 gene menD 132447 134153 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930001.1 protein_id gnl|my_center|LOCUS_12340 134937 136118 gene locus_tag LOCUS_12350 134937 136118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 137844 136447 gene locus_tag LOCUS_12360 137844 136447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 137936 138655 gene locus_tag LOCUS_12370 137936 138655 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_12370 138907 140187 gene locus_tag LOCUS_12380 138907 140187 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_12380 140228 140587 gene locus_tag LOCUS_12390 140228 140587 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_12390 140608 141162 gene locus_tag LOCUS_12400 140608 141162 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061196.1 protein_id gnl|my_center|LOCUS_12400 141159 141869 gene locus_tag LOCUS_12410 141159 141869 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_12410 141866 143218 gene locus_tag LOCUS_12420 141866 143218 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_12420 143215 143907 gene locus_tag LOCUS_12430 143215 143907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 143904 145205 gene locus_tag LOCUS_12440 gene nuoF 143904 145205 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974379.1 protein_id gnl|my_center|LOCUS_12440 145202 147766 gene locus_tag LOCUS_12450 145202 147766 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026459974.1 protein_id gnl|my_center|LOCUS_12450 147763 149073 gene locus_tag LOCUS_12460 gene nuoH 147763 149073 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147918608.1 protein_id gnl|my_center|LOCUS_12460 149066 149725 gene locus_tag LOCUS_12470 gene nuoI 149066 149725 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327003.1 protein_id gnl|my_center|LOCUS_12470 149722 150693 gene locus_tag LOCUS_12480 149722 150693 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029738.1 protein_id gnl|my_center|LOCUS_12480 150690 150989 gene locus_tag LOCUS_12490 gene nuoK 150690 150989 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_12490 151004 152974 gene locus_tag LOCUS_12500 gene nuoL 151004 152974 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_12500 152989 154545 gene locus_tag LOCUS_12510 152989 154545 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728119.1 protein_id gnl|my_center|LOCUS_12510 154542 156110 gene locus_tag LOCUS_12520 gene nuoN 154542 156110 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_12520 156107 157120 gene locus_tag LOCUS_12530 156107 157120 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_12530 157564 159060 gene locus_tag LOCUS_12540 157564 159060 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221998.1 protein_id gnl|my_center|LOCUS_12540 159079 160107 gene locus_tag LOCUS_12550 gene htpX 159079 160107 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_12550 160811 160308 gene locus_tag LOCUS_12560 160811 160308 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_12560 160945 161027 gene locus_tag LOCUS_t00290 160945 161027 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 161119 161192 gene locus_tag LOCUS_t00300 161119 161192 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 161217 161293 gene locus_tag LOCUS_t00310 161217 161293 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 161344 161514 gene locus_tag LOCUS_12570 gene rpmG 161344 161514 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776157.1 protein_id gnl|my_center|LOCUS_12570 162411 161749 gene locus_tag LOCUS_12580 162411 161749 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804466.1 protein_id gnl|my_center|LOCUS_12580 162582 164138 gene locus_tag LOCUS_12590 162582 164138 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116517.1 protein_id gnl|my_center|LOCUS_12590 164249 165202 gene locus_tag LOCUS_12600 164249 165202 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853884.1 protein_id gnl|my_center|LOCUS_12600 165202 167244 gene locus_tag LOCUS_12610 165202 167244 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993832.1 protein_id gnl|my_center|LOCUS_12610 167244 168062 gene locus_tag LOCUS_12620 167244 168062 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116524.1 protein_id gnl|my_center|LOCUS_12620 168062 168976 gene locus_tag LOCUS_12630 168062 168976 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993834.1 protein_id gnl|my_center|LOCUS_12630 169044 170003 gene locus_tag LOCUS_12640 169044 170003 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993557.1 protein_id gnl|my_center|LOCUS_12640 170078 170755 gene locus_tag LOCUS_12650 170078 170755 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113937.1 protein_id gnl|my_center|LOCUS_12650 170796 172487 gene locus_tag LOCUS_12660 170796 172487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 172585 173358 gene locus_tag LOCUS_12670 gene nagB 172585 173358 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728169.1 protein_id gnl|my_center|LOCUS_12670 173657 174712 gene locus_tag LOCUS_12680 gene galE 173657 174712 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156530.1 protein_id gnl|my_center|LOCUS_12680 174737 175867 gene locus_tag LOCUS_12690 174737 175867 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776154.1 protein_id gnl|my_center|LOCUS_12690 177028 175904 gene locus_tag LOCUS_12700 177028 175904 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776398.1 protein_id gnl|my_center|LOCUS_12700 177858 177028 gene locus_tag LOCUS_12710 177858 177028 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328024.1 protein_id gnl|my_center|LOCUS_12710 179404 178190 gene locus_tag LOCUS_12720 179404 178190 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_12720 179358 179522 gene locus_tag LOCUS_12730 179358 179522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 180004 180080 gene locus_tag LOCUS_t00320 180004 180080 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 180106 180399 gene locus_tag LOCUS_12740 180106 180399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 180493 181236 gene locus_tag LOCUS_12750 gene nusG 180493 181236 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776395.1 protein_id gnl|my_center|LOCUS_12750 181387 181818 gene locus_tag LOCUS_12760 gene rplK 181387 181818 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892734.1 protein_id gnl|my_center|LOCUS_12760 181891 182595 gene locus_tag LOCUS_12770 gene rplA 181891 182595 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_12770 183515 184036 gene locus_tag LOCUS_12780 gene rplJ 183515 184036 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_12780 184139 184522 gene locus_tag LOCUS_12790 gene rplL 184139 184522 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854210.1 protein_id gnl|my_center|LOCUS_12790 185759 185831 gene locus_tag LOCUS_t00330 185759 185831 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence30 455 895 gene locus_tag LOCUS_12800 gene arfB 455 895 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776269.1 protein_id gnl|my_center|LOCUS_12800 1084 899 gene locus_tag LOCUS_12810 1084 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1913 1164 gene locus_tag LOCUS_12820 1913 1164 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804604.1 protein_id gnl|my_center|LOCUS_12820 3282 2230 gene locus_tag LOCUS_12830 3282 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 4985 3735 gene locus_tag LOCUS_12840 4985 3735 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259130.1 protein_id gnl|my_center|LOCUS_12840 6235 4982 gene locus_tag LOCUS_12850 gene glpB 6235 4982 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259131.1 protein_id gnl|my_center|LOCUS_12850 7899 6232 gene locus_tag LOCUS_12860 gene glpA 7899 6232 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259132.1 protein_id gnl|my_center|LOCUS_12860 8207 10204 gene locus_tag LOCUS_12870 8207 10204 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089548.1 protein_id gnl|my_center|LOCUS_12870 10308 12878 gene locus_tag LOCUS_12880 gene pepN 10308 12878 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_12880 14171 13332 gene locus_tag LOCUS_12890 14171 13332 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068759.1 protein_id gnl|my_center|LOCUS_12890 15993 14212 gene locus_tag LOCUS_12900 15993 14212 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390207.1 protein_id gnl|my_center|LOCUS_12900 17323 16505 gene locus_tag LOCUS_12910 17323 16505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729967.1 protein_id gnl|my_center|LOCUS_12910 17980 19002 gene locus_tag LOCUS_12920 17980 19002 CDS product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 protein_id gnl|my_center|LOCUS_12920 20490 19465 gene locus_tag LOCUS_12930 20490 19465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 20670 22004 gene locus_tag LOCUS_12940 20670 22004 CDS product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 protein_id gnl|my_center|LOCUS_12940 22746 22462 gene locus_tag LOCUS_12950 22746 22462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 23254 22868 gene locus_tag LOCUS_12960 23254 22868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 23637 23413 gene locus_tag LOCUS_12970 23637 23413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12970 24145 24072 gene locus_tag LOCUS_t00340 24145 24072 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 25329 24604 gene locus_tag LOCUS_12980 25329 24604 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775846.1 protein_id gnl|my_center|LOCUS_12980 25706 25326 gene locus_tag LOCUS_12990 25706 25326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 26499 25732 gene locus_tag LOCUS_13000 gene nadD 26499 25732 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655767.1 protein_id gnl|my_center|LOCUS_13000 27776 26496 gene locus_tag LOCUS_13010 27776 26496 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775851.1 protein_id gnl|my_center|LOCUS_13010 29298 28183 gene locus_tag LOCUS_13020 gene proB 29298 28183 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055074.1 protein_id gnl|my_center|LOCUS_13020 30827 29295 gene locus_tag LOCUS_13030 gene obgE 30827 29295 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775853.1 protein_id gnl|my_center|LOCUS_13030 31248 30988 gene locus_tag LOCUS_13040 gene rpmA 31248 30988 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_13040 31602 31282 gene locus_tag LOCUS_13050 gene rplU 31602 31282 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775855.1 protein_id gnl|my_center|LOCUS_13050 35176 32426 gene locus_tag LOCUS_13060 35176 32426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 35779 37323 gene locus_tag LOCUS_13070 35779 37323 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111152.1 protein_id gnl|my_center|LOCUS_13070 37340 38461 gene locus_tag LOCUS_13080 gene cydB 37340 38461 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461541.1 protein_id gnl|my_center|LOCUS_13080 38650 40449 gene locus_tag LOCUS_13090 gene cydD 38650 40449 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775859.1 protein_id gnl|my_center|LOCUS_13090 40449 42209 gene locus_tag LOCUS_13100 gene cydC 40449 42209 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775860.1 protein_id gnl|my_center|LOCUS_13100 42209 43909 gene locus_tag LOCUS_13110 42209 43909 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080372.1 protein_id gnl|my_center|LOCUS_13110 45157 44507 gene locus_tag LOCUS_13120 45157 44507 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775862.1 protein_id gnl|my_center|LOCUS_13120 46088 45369 gene locus_tag LOCUS_13130 gene rnc 46088 45369 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742189.1 protein_id gnl|my_center|LOCUS_13130 46648 46094 gene locus_tag LOCUS_13140 46648 46094 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284376.1 protein_id gnl|my_center|LOCUS_13140 47354 46641 gene locus_tag LOCUS_13150 47354 46641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 47859 47362 gene locus_tag LOCUS_13160 gene coaD 47859 47362 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223683.1 protein_id gnl|my_center|LOCUS_13160 48521 47856 gene locus_tag LOCUS_13170 gene rsmD 48521 47856 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_13170 50703 48538 gene locus_tag LOCUS_13180 gene recG 50703 48538 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_13180 52337 50700 gene locus_tag LOCUS_13190 52337 50700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 52609 52800 gene locus_tag LOCUS_13200 gene rpmB 52609 52800 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_13200 54090 53101 gene locus_tag LOCUS_13210 54090 53101 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_13210 54745 54179 gene locus_tag LOCUS_13220 54745 54179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 54728 54931 gene locus_tag LOCUS_13230 54728 54931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 55407 55027 gene locus_tag LOCUS_13240 gene rplT 55407 55027 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776197.1 protein_id gnl|my_center|LOCUS_13240 55627 55433 gene locus_tag LOCUS_13250 gene rpmI 55627 55433 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 protein_id gnl|my_center|LOCUS_13250 56365 55670 gene locus_tag LOCUS_13260 gene infC 56365 55670 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227848.1 protein_id gnl|my_center|LOCUS_13260 57745 56813 gene locus_tag LOCUS_13270 57745 56813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 58479 57742 gene locus_tag LOCUS_13280 gene priA 58479 57742 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_13280 59211 58576 gene locus_tag LOCUS_13290 gene hisH 59211 58576 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776205.1 protein_id gnl|my_center|LOCUS_13290 59928 59215 gene locus_tag LOCUS_13300 59928 59215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 60612 59995 gene locus_tag LOCUS_13310 gene hisB 60612 59995 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052519.1 protein_id gnl|my_center|LOCUS_13310 61727 60609 gene locus_tag LOCUS_13320 61727 60609 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067977.1 protein_id gnl|my_center|LOCUS_13320 63058 61724 gene locus_tag LOCUS_13330 gene hisD 63058 61724 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224127.1 protein_id gnl|my_center|LOCUS_13330 63464 63697 gene locus_tag LOCUS_13340 63464 63697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 65889 64201 gene locus_tag LOCUS_13350 65889 64201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 70287 66739 gene locus_tag LOCUS_13360 gene dnaE 70287 66739 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_13360 71312 70395 gene locus_tag LOCUS_13370 71312 70395 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856488.1 protein_id gnl|my_center|LOCUS_13370 71949 71305 gene locus_tag LOCUS_13380 71949 71305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 72643 72023 gene locus_tag LOCUS_13390 72643 72023 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804709.1 protein_id gnl|my_center|LOCUS_13390 73122 72820 gene locus_tag LOCUS_13400 73122 72820 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054068.1 protein_id gnl|my_center|LOCUS_13400 73644 73132 gene locus_tag LOCUS_13410 73644 73132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 74596 74027 gene locus_tag LOCUS_13420 74596 74027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 76078 74792 gene locus_tag LOCUS_13430 gene ftsZ 76078 74792 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_13430 77215 76403 gene locus_tag LOCUS_13440 77215 76403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 78930 77524 gene locus_tag LOCUS_13450 gene murC 78930 77524 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_13450 80045 78927 gene locus_tag LOCUS_13460 80045 78927 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052550.1 protein_id gnl|my_center|LOCUS_13460 81337 80042 gene locus_tag LOCUS_13470 gene ftsW 81337 80042 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_13470 82781 81321 gene locus_tag LOCUS_13480 gene murD 82781 81321 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_13480 83854 82763 gene locus_tag LOCUS_13490 gene mraY 83854 82763 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804699.1 protein_id gnl|my_center|LOCUS_13490 85254 83851 gene locus_tag LOCUS_13500 85254 83851 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_13500 87053 85290 gene locus_tag LOCUS_13510 87053 85290 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052544.1 protein_id gnl|my_center|LOCUS_13510 87458 87063 gene locus_tag LOCUS_13520 87458 87063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 88432 87455 gene locus_tag LOCUS_13530 gene rsmH 88432 87455 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_13530 88969 88538 gene locus_tag LOCUS_13540 gene mraZ 88969 88538 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_13540 90214 89822 gene locus_tag LOCUS_13550 90214 89822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 91495 90245 gene locus_tag LOCUS_13560 gene dinB 91495 90245 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_13560 91523 92407 gene locus_tag LOCUS_13570 91523 92407 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_13570 93743 92586 gene locus_tag LOCUS_13580 93743 92586 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_13580 94220 96628 gene locus_tag LOCUS_13590 94220 96628 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363236.1 protein_id gnl|my_center|LOCUS_13590 96796 97947 gene locus_tag LOCUS_13600 gene serA 96796 97947 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363235.1 protein_id gnl|my_center|LOCUS_13600 98054 99862 gene locus_tag LOCUS_13610 98054 99862 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188700193.1 protein_id gnl|my_center|LOCUS_13610 100681 100019 gene locus_tag LOCUS_13620 100681 100019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 101020 100751 gene locus_tag LOCUS_13630 101020 100751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 101422 102129 gene locus_tag LOCUS_13640 gene lexA 101422 102129 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091617684.1 protein_id gnl|my_center|LOCUS_13640 103370 102381 gene locus_tag LOCUS_13650 103370 102381 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112440.1 protein_id gnl|my_center|LOCUS_13650 105536 103563 gene locus_tag LOCUS_13660 105536 103563 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_13660 107190 105529 gene locus_tag LOCUS_13670 gene hflX 107190 105529 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804682.1 protein_id gnl|my_center|LOCUS_13670 107439 108056 gene locus_tag LOCUS_13680 107439 108056 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054390.1 protein_id gnl|my_center|LOCUS_13680 109269 108331 gene locus_tag LOCUS_13690 gene miaA 109269 108331 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804679.1 protein_id gnl|my_center|LOCUS_13690 109541 109987 gene locus_tag LOCUS_13700 109541 109987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 109980 110537 gene locus_tag LOCUS_13710 109980 110537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 112711 111164 gene locus_tag LOCUS_13720 gene miaB 112711 111164 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_13720 113192 112698 gene locus_tag LOCUS_13730 113192 112698 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804672.1 protein_id gnl|my_center|LOCUS_13730 114127 113534 gene locus_tag LOCUS_13740 114127 113534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 115240 114134 gene locus_tag LOCUS_13750 gene recA 115240 114134 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804675.1 protein_id gnl|my_center|LOCUS_13750 115759 115526 gene locus_tag LOCUS_13760 115759 115526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 116076 115762 gene locus_tag LOCUS_13770 116076 115762 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804673.1 protein_id gnl|my_center|LOCUS_13770 116872 116243 gene locus_tag LOCUS_13780 gene pgsA 116872 116243 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857464.1 protein_id gnl|my_center|LOCUS_13780 119610 116893 gene locus_tag LOCUS_13790 119610 116893 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973274.1 protein_id gnl|my_center|LOCUS_13790 120801 119845 gene locus_tag LOCUS_13800 120801 119845 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230703.1 protein_id gnl|my_center|LOCUS_13800 122530 120839 gene locus_tag LOCUS_13810 122530 120839 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804669.1 protein_id gnl|my_center|LOCUS_13810 123056 122760 gene locus_tag LOCUS_13820 123056 122760 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461381.1 protein_id gnl|my_center|LOCUS_13820 124383 123085 gene locus_tag LOCUS_13830 124383 123085 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461382.1 protein_id gnl|my_center|LOCUS_13830 125271 124399 gene locus_tag LOCUS_13840 125271 124399 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771346.1 protein_id gnl|my_center|LOCUS_13840 126053 125289 gene locus_tag LOCUS_13850 126053 125289 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461748.1 protein_id gnl|my_center|LOCUS_13850 126174 126806 gene locus_tag LOCUS_13860 126174 126806 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728111.1 protein_id gnl|my_center|LOCUS_13860 127441 126770 gene locus_tag LOCUS_13870 127441 126770 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_13870 128778 127444 gene locus_tag LOCUS_13880 128778 127444 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183183.1 protein_id gnl|my_center|LOCUS_13880 129773 128898 gene locus_tag LOCUS_13890 129773 128898 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224387.1 protein_id gnl|my_center|LOCUS_13890 131382 129802 gene locus_tag LOCUS_13900 gene caiC 131382 129802 CDS product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355790.1 protein_id gnl|my_center|LOCUS_13900 132603 131383 gene locus_tag LOCUS_13910 gene caiB 132603 131383 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349936.1 protein_id gnl|my_center|LOCUS_13910 133762 132629 gene locus_tag LOCUS_13920 gene caiA 133762 132629 CDS product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 protein_id gnl|my_center|LOCUS_13920 134764 133796 gene locus_tag LOCUS_13930 gene aes 134764 133796 CDS product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801820.1 protein_id gnl|my_center|LOCUS_13930 136107 134773 gene locus_tag LOCUS_13940 136107 134773 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164557.1 protein_id gnl|my_center|LOCUS_13940 138133 137237 gene locus_tag LOCUS_13950 gene dapA 138133 137237 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048369.1 protein_id gnl|my_center|LOCUS_13950 138892 138209 gene locus_tag LOCUS_13960 138892 138209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 139670 138927 gene locus_tag LOCUS_13970 gene dapB 139670 138927 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816186.1 protein_id gnl|my_center|LOCUS_13970 140888 139893 gene locus_tag LOCUS_13980 140888 139893 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149762057.1 protein_id gnl|my_center|LOCUS_13980 142220 140904 gene locus_tag LOCUS_13990 142220 140904 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804661.1 protein_id gnl|my_center|LOCUS_13990 142580 142344 gene locus_tag LOCUS_14000 142580 142344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 143009 142599 gene locus_tag LOCUS_14010 143009 142599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 144364 143666 gene locus_tag LOCUS_14020 144364 143666 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029605.1 protein_id gnl|my_center|LOCUS_14020 145080 144361 gene locus_tag LOCUS_14030 145080 144361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 148288 145940 gene locus_tag LOCUS_14040 148288 145940 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_14040 148997 148728 gene locus_tag LOCUS_14050 gene rpsO 148997 148728 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052997.1 protein_id gnl|my_center|LOCUS_14050 150658 149669 gene locus_tag LOCUS_14060 150658 149669 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_14060 152292 150655 gene locus_tag LOCUS_14070 152292 150655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 152738 152295 gene locus_tag LOCUS_14080 gene rbfA 152738 152295 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973318.1 protein_id gnl|my_center|LOCUS_14080 153660 154691 gene locus_tag LOCUS_14090 153660 154691 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878294.1 protein_id gnl|my_center|LOCUS_14090 157466 155361 gene locus_tag LOCUS_14100 157466 155361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14100 157774 157466 gene locus_tag LOCUS_14110 157774 157466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 157780 158049 gene locus_tag LOCUS_14120 157780 158049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 158626 158414 gene locus_tag LOCUS_14130 158626 158414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 159808 158762 gene locus_tag LOCUS_14140 gene nusA 159808 158762 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_14140 160284 159814 gene locus_tag LOCUS_14150 gene rimP 160284 159814 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973323.1 protein_id gnl|my_center|LOCUS_14150 160561 161526 gene locus_tag LOCUS_14160 160561 161526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 161579 162064 gene locus_tag LOCUS_14170 161579 162064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 162721 162233 gene locus_tag LOCUS_14180 162721 162233 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547404.1 protein_id gnl|my_center|LOCUS_14180 165170 163203 gene locus_tag LOCUS_14190 gene dnaG 165170 163203 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775727.1 protein_id gnl|my_center|LOCUS_14190 165441 165217 gene locus_tag LOCUS_14200 165441 165217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 166821 165517 gene locus_tag LOCUS_14210 166821 165517 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775728.1 protein_id gnl|my_center|LOCUS_14210 167102 167503 gene locus_tag LOCUS_14220 167102 167503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 168171 167500 gene locus_tag LOCUS_14230 168171 167500 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976672.1 protein_id gnl|my_center|LOCUS_14230 169595 168168 gene locus_tag LOCUS_14240 169595 168168 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028162.1 protein_id gnl|my_center|LOCUS_14240 170038 169718 gene locus_tag LOCUS_14250 170038 169718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 170322 170035 gene locus_tag LOCUS_14260 170322 170035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 171411 170557 gene locus_tag LOCUS_14270 gene aroD 171411 170557 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704389.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence31 369 296 gene locus_tag LOCUS_t00350 369 296 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 624 548 gene locus_tag LOCUS_t00360 624 548 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1258 869 gene locus_tag LOCUS_14280 1258 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 3951 1255 gene locus_tag LOCUS_14290 gene gyrA 3951 1255 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_14290 6045 4018 gene locus_tag LOCUS_14300 gene gyrB 6045 4018 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803673.1 protein_id gnl|my_center|LOCUS_14300 7026 6256 gene locus_tag LOCUS_14310 7026 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 8573 7023 gene locus_tag LOCUS_14320 8573 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 9713 8577 gene locus_tag LOCUS_14330 gene dnaN 9713 8577 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803666.1 protein_id gnl|my_center|LOCUS_14330 11672 10203 gene locus_tag LOCUS_14340 11672 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 12138 12278 gene locus_tag LOCUS_14350 12138 12278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 12310 12645 gene locus_tag LOCUS_14360 gene rnpA 12310 12645 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 protein_id gnl|my_center|LOCUS_14360 12639 13142 gene locus_tag LOCUS_14370 12639 13142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 13153 14493 gene locus_tag LOCUS_14380 13153 14493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 14563 15102 gene locus_tag LOCUS_14390 14563 15102 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_14390 15099 15863 gene locus_tag LOCUS_14400 15099 15863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 16472 17356 gene locus_tag LOCUS_14410 16472 17356 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777153.1 protein_id gnl|my_center|LOCUS_14410 18956 20494 gene locus_tag LOCUS_14420 18956 20494 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068597.1 protein_id gnl|my_center|LOCUS_14420 20638 21267 gene locus_tag LOCUS_14430 20638 21267 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804764.1 protein_id gnl|my_center|LOCUS_14430 23255 22233 gene locus_tag LOCUS_14440 23255 22233 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_14440 24742 23411 gene locus_tag LOCUS_14450 24742 23411 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_14450 25462 26175 gene locus_tag LOCUS_14460 25462 26175 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804184.1 protein_id gnl|my_center|LOCUS_14460 26475 27428 gene locus_tag LOCUS_14470 gene rbsK 26475 27428 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169684.1 protein_id gnl|my_center|LOCUS_14470 27671 28708 gene locus_tag LOCUS_14480 27671 28708 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339569.1 protein_id gnl|my_center|LOCUS_14480 28812 30323 gene locus_tag LOCUS_14490 28812 30323 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339570.1 protein_id gnl|my_center|LOCUS_14490 30325 31335 gene locus_tag LOCUS_14500 30325 31335 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339571.1 protein_id gnl|my_center|LOCUS_14500 31350 32399 gene locus_tag LOCUS_14510 31350 32399 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389954.1 protein_id gnl|my_center|LOCUS_14510 32396 32959 gene locus_tag LOCUS_14520 32396 32959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 34464 33412 gene locus_tag LOCUS_14530 34464 33412 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252986.1 protein_id gnl|my_center|LOCUS_14530 36064 34622 gene locus_tag LOCUS_14540 36064 34622 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052115.1 protein_id gnl|my_center|LOCUS_14540 37406 36432 gene locus_tag LOCUS_14550 37406 36432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528388.1 protein_id gnl|my_center|LOCUS_14550 39539 37944 gene locus_tag LOCUS_14560 39539 37944 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244331.1 protein_id gnl|my_center|LOCUS_14560 39726 41084 gene locus_tag LOCUS_14570 39726 41084 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222955.1 protein_id gnl|my_center|LOCUS_14570 41827 42171 gene locus_tag LOCUS_14580 41827 42171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 42168 42746 gene locus_tag LOCUS_14590 42168 42746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 44451 42826 gene locus_tag LOCUS_14600 44451 42826 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_14600 45778 44456 gene locus_tag LOCUS_14610 45778 44456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 46997 45726 gene locus_tag LOCUS_14620 gene porA 46997 45726 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_14620 47577 46990 gene locus_tag LOCUS_14630 47577 46990 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_14630 48018 50027 gene locus_tag LOCUS_14640 48018 50027 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256471.1 protein_id gnl|my_center|LOCUS_14640 50675 50034 gene locus_tag LOCUS_14650 50675 50034 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805162.1 protein_id gnl|my_center|LOCUS_14650 50853 51518 gene locus_tag LOCUS_14660 50853 51518 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803956.1 protein_id gnl|my_center|LOCUS_14660 51563 52396 gene locus_tag LOCUS_14670 51563 52396 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803957.1 protein_id gnl|my_center|LOCUS_14670 52696 53160 gene locus_tag LOCUS_14680 52696 53160 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_14680 53440 53946 gene locus_tag LOCUS_14690 53440 53946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 54317 53907 gene locus_tag LOCUS_14700 54317 53907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 54950 54777 gene locus_tag LOCUS_14710 54950 54777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14710 55074 54913 gene locus_tag LOCUS_14720 55074 54913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 55480 55187 gene locus_tag LOCUS_14730 55480 55187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14730 55663 55484 gene locus_tag LOCUS_14740 55663 55484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14740 57459 57001 gene locus_tag LOCUS_14750 57459 57001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 58718 58350 gene locus_tag LOCUS_14760 58718 58350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 59047 58667 gene locus_tag LOCUS_14770 59047 58667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 61067 59592 gene locus_tag LOCUS_14780 gene pntB 61067 59592 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169667.1 protein_id gnl|my_center|LOCUS_14780 62621 61074 gene locus_tag LOCUS_14790 62621 61074 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877938.1 protein_id gnl|my_center|LOCUS_14790 62810 63283 gene locus_tag LOCUS_14800 62810 63283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 63406 64824 gene locus_tag LOCUS_14810 gene cycA 63406 64824 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729183.1 protein_id gnl|my_center|LOCUS_14810 65390 66001 gene locus_tag LOCUS_14820 65390 66001 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858584.1 protein_id gnl|my_center|LOCUS_14820 65994 68702 gene locus_tag LOCUS_14830 65994 68702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 69407 70198 gene locus_tag LOCUS_14840 69407 70198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 70341 71168 gene locus_tag LOCUS_14850 70341 71168 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776698.1 protein_id gnl|my_center|LOCUS_14850 73892 71235 gene locus_tag LOCUS_14860 73892 71235 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068847.1 protein_id gnl|my_center|LOCUS_14860 73965 74831 gene locus_tag LOCUS_14870 73965 74831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 74835 77351 gene locus_tag LOCUS_14880 74835 77351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 77628 78692 gene locus_tag LOCUS_14890 gene pheA 77628 78692 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222131.1 protein_id gnl|my_center|LOCUS_14890 79211 78954 gene locus_tag LOCUS_14900 79211 78954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 80307 79477 gene locus_tag LOCUS_14910 80307 79477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814366.1 protein_id gnl|my_center|LOCUS_14910 81323 80304 gene locus_tag LOCUS_14920 81323 80304 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810402.1 protein_id gnl|my_center|LOCUS_14920 82482 81376 gene locus_tag LOCUS_14930 82482 81376 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279122.1 protein_id gnl|my_center|LOCUS_14930 84851 83544 gene locus_tag LOCUS_14940 84851 83544 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 protein_id gnl|my_center|LOCUS_14940 85082 85564 gene locus_tag LOCUS_14950 85082 85564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 85712 86152 gene locus_tag LOCUS_14960 85712 86152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14960 86312 87586 gene locus_tag LOCUS_14970 gene serS 86312 87586 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831496.1 protein_id gnl|my_center|LOCUS_14970 87592 88509 gene locus_tag LOCUS_14980 87592 88509 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804321.1 protein_id gnl|my_center|LOCUS_14980 88659 90251 gene locus_tag LOCUS_14990 88659 90251 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_14990 90779 91660 gene locus_tag LOCUS_15000 90779 91660 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_15000 91866 91642 gene locus_tag LOCUS_15010 91866 91642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 91771 92073 gene locus_tag LOCUS_15020 91771 92073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 92207 93043 gene locus_tag LOCUS_15030 92207 93043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 95666 93186 gene locus_tag LOCUS_15040 95666 93186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 95635 95838 gene locus_tag LOCUS_15050 95635 95838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 96433 96188 gene locus_tag LOCUS_15060 96433 96188 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730261.1 protein_id gnl|my_center|LOCUS_15060 97188 96904 gene locus_tag LOCUS_15070 97188 96904 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 protein_id gnl|my_center|LOCUS_15070 98172 99704 gene locus_tag LOCUS_15080 98172 99704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 99701 100495 gene locus_tag LOCUS_15090 99701 100495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 100747 102477 gene locus_tag LOCUS_15100 100747 102477 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225052.1 protein_id gnl|my_center|LOCUS_15100 104156 102684 gene locus_tag LOCUS_15110 gene purB 104156 102684 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776538.1 protein_id gnl|my_center|LOCUS_15110 105219 104245 gene locus_tag LOCUS_15120 105219 104245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 105349 105711 gene locus_tag LOCUS_15130 105349 105711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 105715 107430 gene locus_tag LOCUS_15140 105715 107430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 107799 108602 gene locus_tag LOCUS_15150 gene thiM 107799 108602 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014383.1 protein_id gnl|my_center|LOCUS_15150 108599 109261 gene locus_tag LOCUS_15160 gene thiE 108599 109261 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939635.1 protein_id gnl|my_center|LOCUS_15160 109258 110064 gene locus_tag LOCUS_15170 gene thiD 109258 110064 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822292.1 protein_id gnl|my_center|LOCUS_15170 110061 110708 gene locus_tag LOCUS_15180 gene tenA 110061 110708 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256691.1 protein_id gnl|my_center|LOCUS_15180 111485 111081 gene locus_tag LOCUS_15190 111485 111081 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730612.1 protein_id gnl|my_center|LOCUS_15190 111636 112685 gene locus_tag LOCUS_15200 gene hisC 111636 112685 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112910.1 protein_id gnl|my_center|LOCUS_15200 113918 113844 gene locus_tag LOCUS_t00370 113918 113844 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 115720 114614 gene locus_tag LOCUS_15210 115720 114614 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467832.1 protein_id gnl|my_center|LOCUS_15210 117890 115806 gene locus_tag LOCUS_15220 117890 115806 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_15220 118166 118375 gene locus_tag LOCUS_15230 118166 118375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 118477 118638 gene locus_tag LOCUS_15240 118477 118638 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_15240 119290 119129 gene locus_tag LOCUS_15250 119290 119129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 119222 122533 gene locus_tag LOCUS_15260 119222 122533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 123478 122795 gene locus_tag LOCUS_15270 123478 122795 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_15270 125634 123670 gene locus_tag LOCUS_15280 125634 123670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 126658 125690 gene locus_tag LOCUS_15290 126658 125690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 127388 127179 gene locus_tag LOCUS_15300 127388 127179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 127273 127647 gene locus_tag LOCUS_15310 127273 127647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 128704 127886 gene locus_tag LOCUS_15320 128704 127886 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083519.1 protein_id gnl|my_center|LOCUS_15320 128897 129937 gene locus_tag LOCUS_15330 128897 129937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 130024 131298 gene locus_tag LOCUS_15340 130024 131298 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776567.1 protein_id gnl|my_center|LOCUS_15340 131931 132632 gene locus_tag LOCUS_15350 131931 132632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 133003 133272 gene locus_tag LOCUS_15360 133003 133272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 133269 133640 gene locus_tag LOCUS_15370 133269 133640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 133637 133999 gene locus_tag LOCUS_15380 133637 133999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 135041 134550 gene locus_tag LOCUS_15390 135041 134550 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804208.1 protein_id gnl|my_center|LOCUS_15390 139082 136524 gene locus_tag LOCUS_15400 139082 136524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15400 140290 139808 gene locus_tag LOCUS_15410 140290 139808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 140814 140287 gene locus_tag LOCUS_15420 140814 140287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 141300 142076 gene locus_tag LOCUS_15430 141300 142076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 142556 144436 gene locus_tag LOCUS_15440 142556 144436 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 protein_id gnl|my_center|LOCUS_15440 144460 145236 gene locus_tag LOCUS_15450 144460 145236 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389029.1 protein_id gnl|my_center|LOCUS_15450 146649 146056 gene locus_tag LOCUS_15460 146649 146056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 146980 146726 gene locus_tag LOCUS_15470 146980 146726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 147076 147660 gene locus_tag LOCUS_15480 147076 147660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 149167 148022 gene locus_tag LOCUS_15490 149167 148022 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804722.1 protein_id gnl|my_center|LOCUS_15490 149293 149964 gene locus_tag LOCUS_15500 149293 149964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 151929 150541 gene locus_tag LOCUS_15510 151929 150541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 153222 152005 gene locus_tag LOCUS_15520 153222 152005 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113745.1 protein_id gnl|my_center|LOCUS_15520 153916 153560 gene locus_tag LOCUS_15530 153916 153560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 154587 154189 gene locus_tag LOCUS_15540 154587 154189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 156620 154944 gene locus_tag LOCUS_15550 gene pgm 156620 154944 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081136.1 protein_id gnl|my_center|LOCUS_15550 157132 158472 gene locus_tag LOCUS_15560 gene yihS 157132 158472 CDS product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870897.1 protein_id gnl|my_center|LOCUS_15560 158866 158955 gene locus_tag LOCUS_t00380 158866 158955 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 159070 159158 gene locus_tag LOCUS_t00390 159070 159158 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence32 1592 795 gene locus_tag LOCUS_15570 1592 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 2791 1589 gene locus_tag LOCUS_15580 2791 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3094 2801 gene locus_tag LOCUS_15590 3094 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 3414 4589 gene locus_tag LOCUS_15600 gene sucC 3414 4589 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804537.1 protein_id gnl|my_center|LOCUS_15600 4610 5530 gene locus_tag LOCUS_15610 gene sucD 4610 5530 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804538.1 protein_id gnl|my_center|LOCUS_15610 5786 7744 gene locus_tag LOCUS_15620 5786 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 8006 7845 gene locus_tag LOCUS_15630 8006 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 8033 9883 gene locus_tag LOCUS_15640 gene purH 8033 9883 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776405.1 protein_id gnl|my_center|LOCUS_15640 10346 12340 gene locus_tag LOCUS_15650 10346 12340 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 protein_id gnl|my_center|LOCUS_15650 12337 14073 gene locus_tag LOCUS_15660 12337 14073 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030252.1 protein_id gnl|my_center|LOCUS_15660 15468 14092 gene locus_tag LOCUS_15670 15468 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 15723 17291 gene locus_tag LOCUS_15680 gene guaA 15723 17291 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_15680 17374 18582 gene locus_tag LOCUS_15690 17374 18582 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_15690 18660 19481 gene locus_tag LOCUS_15700 18660 19481 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037617203.1 protein_id gnl|my_center|LOCUS_15700 22458 20056 gene locus_tag LOCUS_15710 22458 20056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 23314 24132 gene locus_tag LOCUS_15720 23314 24132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 24720 24890 gene locus_tag LOCUS_15730 24720 24890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 25423 26379 gene locus_tag LOCUS_15740 25423 26379 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_15740 26536 27081 gene locus_tag LOCUS_15750 26536 27081 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224180.1 protein_id gnl|my_center|LOCUS_15750 27657 27142 gene locus_tag LOCUS_15760 27657 27142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 28110 28742 gene locus_tag LOCUS_15770 28110 28742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 28757 29200 gene locus_tag LOCUS_15780 28757 29200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 29430 30236 gene locus_tag LOCUS_15790 29430 30236 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016805.1 protein_id gnl|my_center|LOCUS_15790 30992 30369 gene locus_tag LOCUS_15800 30992 30369 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809641.1 protein_id gnl|my_center|LOCUS_15800 31135 32073 gene locus_tag LOCUS_15810 31135 32073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 33537 32209 gene locus_tag LOCUS_15820 33537 32209 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963649.1 protein_id gnl|my_center|LOCUS_15820 34580 33795 gene locus_tag LOCUS_15830 34580 33795 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_15830 34825 35139 gene locus_tag LOCUS_15840 34825 35139 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681704.1 protein_id gnl|my_center|LOCUS_15840 35775 35113 gene locus_tag LOCUS_15850 35775 35113 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102032.1 protein_id gnl|my_center|LOCUS_15850 36844 35927 gene locus_tag LOCUS_15860 36844 35927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 37726 37067 gene locus_tag LOCUS_15870 37726 37067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 38039 41863 gene locus_tag LOCUS_15880 38039 41863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 41890 43638 gene locus_tag LOCUS_15890 41890 43638 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775796.1 protein_id gnl|my_center|LOCUS_15890 43820 47233 gene locus_tag LOCUS_15900 43820 47233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 47288 47866 gene locus_tag LOCUS_15910 47288 47866 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_15910 47921 49375 gene locus_tag LOCUS_15920 gene amyS 47921 49375 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476408.1 protein_id gnl|my_center|LOCUS_15920 49388 50299 gene locus_tag LOCUS_15930 49388 50299 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_15930 50499 51626 gene locus_tag LOCUS_15940 50499 51626 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858490.1 protein_id gnl|my_center|LOCUS_15940 51681 53090 gene locus_tag LOCUS_15950 51681 53090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 53122 54204 gene locus_tag LOCUS_15960 gene rsmA 53122 54204 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_15960 54197 55159 gene locus_tag LOCUS_15970 54197 55159 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028794.1 protein_id gnl|my_center|LOCUS_15970 55332 57224 gene locus_tag LOCUS_15980 55332 57224 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729311.1 protein_id gnl|my_center|LOCUS_15980 57415 58800 gene locus_tag LOCUS_15990 57415 58800 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804657.1 protein_id gnl|my_center|LOCUS_15990 59384 58875 gene locus_tag LOCUS_16000 gene tamR 59384 58875 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_16000 60284 59487 gene locus_tag LOCUS_16010 60284 59487 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_16010 60293 60364 gene locus_tag LOCUS_t00400 60293 60364 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 60407 61447 gene locus_tag LOCUS_16020 60407 61447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 61485 62456 gene locus_tag LOCUS_16030 61485 62456 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390004.1 protein_id gnl|my_center|LOCUS_16030 62609 63190 gene locus_tag LOCUS_16040 62609 63190 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092871.1 protein_id gnl|my_center|LOCUS_16040 63294 64028 gene locus_tag LOCUS_16050 63294 64028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 64144 64308 gene locus_tag LOCUS_16060 64144 64308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 64402 64411 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65152 64523 gene locus_tag LOCUS_16070 65152 64523 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222974.1 protein_id gnl|my_center|LOCUS_16070 66362 65232 gene locus_tag LOCUS_16080 66362 65232 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286318.1 protein_id gnl|my_center|LOCUS_16080 67111 66506 gene locus_tag LOCUS_16090 67111 66506 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222980.1 protein_id gnl|my_center|LOCUS_16090 68393 67104 gene locus_tag LOCUS_16100 68393 67104 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804747.1 protein_id gnl|my_center|LOCUS_16100 68490 69194 gene locus_tag LOCUS_16110 68490 69194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 69463 69227 gene locus_tag LOCUS_16120 69463 69227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 71061 69472 gene locus_tag LOCUS_16130 71061 69472 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930178.1 protein_id gnl|my_center|LOCUS_16130 71189 72301 gene locus_tag LOCUS_16140 71189 72301 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_16140 72442 73287 gene locus_tag LOCUS_16150 72442 73287 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804749.1 protein_id gnl|my_center|LOCUS_16150 73284 73907 gene locus_tag LOCUS_16160 73284 73907 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223009.1 protein_id gnl|my_center|LOCUS_16160 74130 76496 gene locus_tag LOCUS_16170 gene malP 74130 76496 CDS product maltodextrin phosphorylase MalP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858869.1 protein_id gnl|my_center|LOCUS_16170 76686 77519 gene locus_tag LOCUS_16180 gene ppk2 76686 77519 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013972.1 protein_id gnl|my_center|LOCUS_16180 77631 78014 gene locus_tag LOCUS_16190 77631 78014 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119149.1 protein_id gnl|my_center|LOCUS_16190 78011 78715 gene locus_tag LOCUS_16200 78011 78715 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984437.1 protein_id gnl|my_center|LOCUS_16200 78715 79530 gene locus_tag LOCUS_16210 78715 79530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 79709 80635 gene locus_tag LOCUS_16220 79709 80635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 82436 80742 gene locus_tag LOCUS_16230 82436 80742 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804750.1 protein_id gnl|my_center|LOCUS_16230 82738 83367 gene locus_tag LOCUS_16240 82738 83367 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16240 83728 83504 gene locus_tag LOCUS_16250 83728 83504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 83806 86982 gene locus_tag LOCUS_16260 83806 86982 CDS product UrvD/REP family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804754.1 protein_id gnl|my_center|LOCUS_16260 86996 90340 gene locus_tag LOCUS_16270 gene adnB 86996 90340 CDS product ATP-dependent DNA helicase AdnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728029.1 protein_id gnl|my_center|LOCUS_16270 91428 90337 gene locus_tag LOCUS_16280 91428 90337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 91715 92953 gene locus_tag LOCUS_16290 91715 92953 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_16290 92953 93813 gene locus_tag LOCUS_16300 92953 93813 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776057.1 protein_id gnl|my_center|LOCUS_16300 93810 94703 gene locus_tag LOCUS_16310 93810 94703 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776056.1 protein_id gnl|my_center|LOCUS_16310 94787 94996 gene locus_tag LOCUS_16320 94787 94996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 94968 95375 gene locus_tag LOCUS_16330 94968 95375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 95375 95824 gene locus_tag LOCUS_16340 95375 95824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 95817 96320 gene locus_tag LOCUS_16350 95817 96320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 96437 97858 gene locus_tag LOCUS_16360 gene gdhA 96437 97858 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080503.1 protein_id gnl|my_center|LOCUS_16360 97917 99044 gene locus_tag LOCUS_16370 gene prfB 97917 99044 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776050.1 protein_id gnl|my_center|LOCUS_16370 99235 99924 gene locus_tag LOCUS_16380 gene ftsE 99235 99924 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_16380 99929 100843 gene locus_tag LOCUS_16390 gene ftsX 99929 100843 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812215.1 protein_id gnl|my_center|LOCUS_16390 100845 102119 gene locus_tag LOCUS_16400 100845 102119 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776047.1 protein_id gnl|my_center|LOCUS_16400 102161 102763 gene locus_tag LOCUS_16410 gene smpB 102161 102763 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113499.1 protein_id gnl|my_center|LOCUS_16410 102778 103350 gene locus_tag LOCUS_16420 102778 103350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 103694 103404 gene locus_tag LOCUS_16430 103694 103404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 103868 105610 gene locus_tag LOCUS_16440 103868 105610 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936521.1 protein_id gnl|my_center|LOCUS_16440 105669 106220 gene locus_tag LOCUS_16450 105669 106220 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977103.1 protein_id gnl|my_center|LOCUS_16450 106217 107095 gene locus_tag LOCUS_16460 106217 107095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 107228 107599 gene locus_tag LOCUS_tm00010 107228 107599 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 107852 108574 gene locus_tag LOCUS_16470 107852 108574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 108574 108849 gene locus_tag LOCUS_16480 108574 108849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 109762 108863 gene locus_tag LOCUS_16490 109762 108863 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884094.1 protein_id gnl|my_center|LOCUS_16490 110523 109747 gene locus_tag LOCUS_16500 110523 109747 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398521.1 protein_id gnl|my_center|LOCUS_16500 110741 111706 gene locus_tag LOCUS_16510 110741 111706 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_16510 112516 111749 gene locus_tag LOCUS_16520 112516 111749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 112685 113668 gene locus_tag LOCUS_16530 112685 113668 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804021.1 protein_id gnl|my_center|LOCUS_16530 115844 113886 gene locus_tag LOCUS_16540 115844 113886 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803967.1 protein_id gnl|my_center|LOCUS_16540 116082 116366 gene locus_tag LOCUS_16550 116082 116366 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053170.1 protein_id gnl|my_center|LOCUS_16550 116443 116826 gene locus_tag LOCUS_16560 116443 116826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 116925 118625 gene locus_tag LOCUS_16570 116925 118625 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929967.1 protein_id gnl|my_center|LOCUS_16570 119936 118632 gene locus_tag LOCUS_16580 119936 118632 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994867.1 protein_id gnl|my_center|LOCUS_16580 120069 120341 gene locus_tag LOCUS_16590 gene clpS 120069 120341 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_16590 120439 120933 gene locus_tag LOCUS_16600 120439 120933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 120945 121778 gene locus_tag LOCUS_16610 gene murI 120945 121778 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776024.1 protein_id gnl|my_center|LOCUS_16610 121778 122581 gene locus_tag LOCUS_16620 121778 122581 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730178.1 protein_id gnl|my_center|LOCUS_16620 123537 122617 gene locus_tag LOCUS_16630 123537 122617 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028476.1 protein_id gnl|my_center|LOCUS_16630 124512 123868 gene locus_tag LOCUS_16640 gene rdgB 124512 123868 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776021.1 protein_id gnl|my_center|LOCUS_16640 125279 124512 gene locus_tag LOCUS_16650 gene rph 125279 124512 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_16650 125358 126332 gene locus_tag LOCUS_16660 125358 126332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 126376 128397 gene locus_tag LOCUS_16670 126376 128397 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804758.1 protein_id gnl|my_center|LOCUS_16670 129400 128423 gene locus_tag LOCUS_16680 129400 128423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 131154 129610 gene locus_tag LOCUS_16690 131154 129610 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466645.1 protein_id gnl|my_center|LOCUS_16690 131264 132466 gene locus_tag LOCUS_16700 131264 132466 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 protein_id gnl|my_center|LOCUS_16700 133135 132497 gene locus_tag LOCUS_16710 133135 132497 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223149.1 protein_id gnl|my_center|LOCUS_16710 133454 136390 gene locus_tag LOCUS_16720 133454 136390 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929964.1 protein_id gnl|my_center|LOCUS_16720 136801 136875 gene locus_tag LOCUS_t00410 136801 136875 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 138177 137305 gene locus_tag LOCUS_16730 138177 137305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 138679 138155 gene locus_tag LOCUS_16740 138679 138155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 141343 139238 gene locus_tag LOCUS_16750 141343 139238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 142075 142734 gene locus_tag LOCUS_16760 142075 142734 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507544.1 protein_id gnl|my_center|LOCUS_16760 143827 143387 gene locus_tag LOCUS_16770 143827 143387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 144348 145886 gene locus_tag LOCUS_16780 144348 145886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 146814 145939 gene locus_tag LOCUS_16790 146814 145939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 147316 146792 gene locus_tag LOCUS_16800 147316 146792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence33 292 219 gene locus_tag LOCUS_t00420 292 219 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2056 935 gene locus_tag LOCUS_16810 2056 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3213 2446 gene locus_tag LOCUS_16820 3213 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4692 3463 gene locus_tag LOCUS_16830 4692 3463 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_16830 5522 4689 gene locus_tag LOCUS_16840 gene galU 5522 4689 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_16840 5654 6331 gene locus_tag LOCUS_16850 5654 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 6572 7192 gene locus_tag LOCUS_16860 6572 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 7219 7605 gene locus_tag LOCUS_16870 gene mscL 7219 7605 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907579.1 protein_id gnl|my_center|LOCUS_16870 8374 8087 gene locus_tag LOCUS_16880 8374 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 12627 8374 gene locus_tag LOCUS_16890 12627 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 12928 12854 gene locus_tag LOCUS_t00430 12928 12854 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14092 13163 gene locus_tag LOCUS_16900 14092 13163 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052357.1 protein_id gnl|my_center|LOCUS_16900 14974 14237 gene locus_tag LOCUS_16910 14974 14237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 16063 15392 gene locus_tag LOCUS_16920 16063 15392 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_16920 16252 17385 gene locus_tag LOCUS_16930 gene serC 16252 17385 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804964.1 protein_id gnl|my_center|LOCUS_16930 19011 17545 gene locus_tag LOCUS_16940 19011 17545 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804962.1 protein_id gnl|my_center|LOCUS_16940 19989 19195 gene locus_tag LOCUS_16950 19989 19195 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776598.1 protein_id gnl|my_center|LOCUS_16950 20359 19982 gene locus_tag LOCUS_16960 20359 19982 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776599.1 protein_id gnl|my_center|LOCUS_16960 21272 20703 gene locus_tag LOCUS_16970 21272 20703 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777132.1 protein_id gnl|my_center|LOCUS_16970 22890 21364 gene locus_tag LOCUS_16980 gene glpK 22890 21364 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222837.1 protein_id gnl|my_center|LOCUS_16980 23847 23086 gene locus_tag LOCUS_16990 23847 23086 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776957.1 protein_id gnl|my_center|LOCUS_16990 24320 25264 gene locus_tag LOCUS_17000 24320 25264 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618838.1 protein_id gnl|my_center|LOCUS_17000 25261 25842 gene locus_tag LOCUS_17010 25261 25842 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804919.1 protein_id gnl|my_center|LOCUS_17010 26706 26452 gene locus_tag LOCUS_17020 26706 26452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 26653 27309 gene locus_tag LOCUS_17030 26653 27309 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 protein_id gnl|my_center|LOCUS_17030 27311 28870 gene locus_tag LOCUS_17040 27311 28870 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_17040 28867 29526 gene locus_tag LOCUS_17050 28867 29526 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_17050 30792 29968 gene locus_tag LOCUS_17060 30792 29968 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026959.1 protein_id gnl|my_center|LOCUS_17060 32403 30814 gene locus_tag LOCUS_17070 gene lysS 32403 30814 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804903.1 protein_id gnl|my_center|LOCUS_17070 32902 32549 gene locus_tag LOCUS_17080 32902 32549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 34052 33600 gene locus_tag LOCUS_17090 34052 33600 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419523.1 protein_id gnl|my_center|LOCUS_17090 34962 34045 gene locus_tag LOCUS_17100 gene panC 34962 34045 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731036.1 protein_id gnl|my_center|LOCUS_17100 36098 35226 gene locus_tag LOCUS_17110 36098 35226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 38197 36095 gene locus_tag LOCUS_17120 38197 36095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 38676 38194 gene locus_tag LOCUS_17130 38676 38194 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860754.1 protein_id gnl|my_center|LOCUS_17130 38860 39570 gene locus_tag LOCUS_17140 38860 39570 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_17140 39573 41330 gene locus_tag LOCUS_17150 39573 41330 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804419.1 protein_id gnl|my_center|LOCUS_17150 41411 42373 gene locus_tag LOCUS_17160 41411 42373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 42548 42838 gene locus_tag LOCUS_17170 42548 42838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 44813 43188 gene locus_tag LOCUS_17180 gene groL 44813 43188 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892307.1 protein_id gnl|my_center|LOCUS_17180 46380 45781 gene locus_tag LOCUS_17190 46380 45781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 46705 47403 gene locus_tag LOCUS_17200 46705 47403 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893765.1 protein_id gnl|my_center|LOCUS_17200 48424 49548 gene locus_tag LOCUS_17210 48424 49548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 50434 49856 gene locus_tag LOCUS_17220 50434 49856 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813649.1 protein_id gnl|my_center|LOCUS_17220 51427 51352 gene locus_tag LOCUS_t00440 51427 51352 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 52362 51511 gene locus_tag LOCUS_17230 52362 51511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 54486 52390 gene locus_tag LOCUS_17240 54486 52390 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929877.1 protein_id gnl|my_center|LOCUS_17240 54400 54951 gene locus_tag LOCUS_17250 54400 54951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 55061 56188 gene locus_tag LOCUS_17260 gene ugpC 55061 56188 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015140.1 protein_id gnl|my_center|LOCUS_17260 56629 57891 gene locus_tag LOCUS_17270 56629 57891 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_17270 57927 58679 gene locus_tag LOCUS_17280 57927 58679 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263776.1 protein_id gnl|my_center|LOCUS_17280 59178 61016 gene locus_tag LOCUS_17290 59178 61016 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_17290 62031 61324 gene locus_tag LOCUS_17300 62031 61324 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777093.1 protein_id gnl|my_center|LOCUS_17300 63197 62172 gene locus_tag LOCUS_17310 gene nrdF 63197 62172 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776779.1 protein_id gnl|my_center|LOCUS_17310 63803 63300 gene locus_tag LOCUS_17320 gene nrdI 63803 63300 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776780.1 protein_id gnl|my_center|LOCUS_17320 65235 64054 gene locus_tag LOCUS_17330 65235 64054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 65650 65378 gene locus_tag LOCUS_17340 65650 65378 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944457.1 protein_id gnl|my_center|LOCUS_17340 65897 65643 gene locus_tag LOCUS_17350 65897 65643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 67339 66479 gene locus_tag LOCUS_17360 67339 66479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 68434 67406 gene locus_tag LOCUS_17370 gene fbaA 68434 67406 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_17370 69288 68578 gene locus_tag LOCUS_17380 69288 68578 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323891.1 protein_id gnl|my_center|LOCUS_17380 69287 69787 gene locus_tag LOCUS_17390 69287 69787 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222885.1 protein_id gnl|my_center|LOCUS_17390 70599 71414 gene locus_tag LOCUS_17400 70599 71414 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404240.1 protein_id gnl|my_center|LOCUS_17400 71562 72131 gene locus_tag LOCUS_17410 gene pyrE 71562 72131 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230857.1 protein_id gnl|my_center|LOCUS_17410 73351 72293 gene locus_tag LOCUS_17420 73351 72293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 75127 74012 gene locus_tag LOCUS_17430 75127 74012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 76058 75297 gene locus_tag LOCUS_17440 76058 75297 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776564.1 protein_id gnl|my_center|LOCUS_17440 76880 76656 gene locus_tag LOCUS_17450 76880 76656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 76958 79087 gene locus_tag LOCUS_17460 76958 79087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 79580 80377 gene locus_tag LOCUS_17470 79580 80377 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727225.1 protein_id gnl|my_center|LOCUS_17470 81495 80695 gene locus_tag LOCUS_17480 81495 80695 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930036.1 protein_id gnl|my_center|LOCUS_17480 84539 81876 gene locus_tag LOCUS_17490 gene clpB 84539 81876 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057489.1 protein_id gnl|my_center|LOCUS_17490 85399 84839 gene locus_tag LOCUS_17500 85399 84839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 85385 85549 gene locus_tag LOCUS_17510 85385 85549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 86064 85597 gene locus_tag LOCUS_17520 86064 85597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 87027 86164 gene locus_tag LOCUS_17530 87027 86164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 88251 87514 gene locus_tag LOCUS_17540 88251 87514 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083649.1 protein_id gnl|my_center|LOCUS_17540 89474 88251 gene locus_tag LOCUS_17550 89474 88251 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169592731.1 protein_id gnl|my_center|LOCUS_17550 90815 89943 gene locus_tag LOCUS_17560 90815 89943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 92685 92140 gene locus_tag LOCUS_17570 92685 92140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 93723 92689 gene locus_tag LOCUS_17580 93723 92689 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804832.1 protein_id gnl|my_center|LOCUS_17580 94541 93795 gene locus_tag LOCUS_17590 94541 93795 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804831.1 protein_id gnl|my_center|LOCUS_17590 96388 94538 gene locus_tag LOCUS_17600 gene dnaK 96388 94538 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814044.1 protein_id gnl|my_center|LOCUS_17600 96982 97365 gene locus_tag LOCUS_17610 96982 97365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 97477 98646 gene locus_tag LOCUS_17620 gene rlmC 97477 98646 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804013.1 protein_id gnl|my_center|LOCUS_17620 100021 98684 gene locus_tag LOCUS_17630 100021 98684 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_17630 100362 100820 gene locus_tag LOCUS_17640 100362 100820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 104855 100857 gene locus_tag LOCUS_17650 gene pulA 104855 100857 CDS product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804304.1 protein_id gnl|my_center|LOCUS_17650 105097 105711 gene locus_tag LOCUS_17660 105097 105711 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_17660 106658 105681 gene locus_tag LOCUS_17670 106658 105681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 107053 106751 gene locus_tag LOCUS_17680 107053 106751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 107534 109852 gene locus_tag LOCUS_17690 107534 109852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence34 435 1199 gene locus_tag LOCUS_17700 435 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243470.1 protein_id gnl|my_center|LOCUS_17700 1212 2525 gene locus_tag LOCUS_17710 1212 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2920 4380 gene locus_tag LOCUS_17720 2920 4380 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_17720 4406 4588 gene locus_tag LOCUS_17730 4406 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 6054 4717 gene locus_tag LOCUS_17740 6054 4717 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390254.1 protein_id gnl|my_center|LOCUS_17740 6195 7094 gene locus_tag LOCUS_17750 6195 7094 CDS product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052848.1 protein_id gnl|my_center|LOCUS_17750 8025 7243 gene locus_tag LOCUS_17760 8025 7243 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775758.1 protein_id gnl|my_center|LOCUS_17760 9137 8022 gene locus_tag LOCUS_17770 gene dnaJ 9137 8022 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_17770 10224 9205 gene locus_tag LOCUS_17780 gene hrcA 10224 9205 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_17780 11242 10328 gene locus_tag LOCUS_17790 11242 10328 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728763.1 protein_id gnl|my_center|LOCUS_17790 13323 11356 gene locus_tag LOCUS_17800 13323 11356 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727591.1 protein_id gnl|my_center|LOCUS_17800 13229 13444 gene locus_tag LOCUS_17810 13229 13444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 14776 13523 gene locus_tag LOCUS_17820 gene hemW 14776 13523 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_17820 15591 14773 gene locus_tag LOCUS_17830 gene trmB 15591 14773 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804561.1 protein_id gnl|my_center|LOCUS_17830 17465 15597 gene locus_tag LOCUS_17840 gene lepA 17465 15597 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775765.1 protein_id gnl|my_center|LOCUS_17840 18754 17705 gene locus_tag LOCUS_17850 18754 17705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 19187 19450 gene locus_tag LOCUS_17860 gene rpsT 19187 19450 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895949.1 protein_id gnl|my_center|LOCUS_17860 20638 19610 gene locus_tag LOCUS_17870 20638 19610 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775770.1 protein_id gnl|my_center|LOCUS_17870 22175 20613 gene locus_tag LOCUS_17880 22175 20613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 22843 22172 gene locus_tag LOCUS_17890 22843 22172 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775772.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17890 23097 25109 gene locus_tag LOCUS_17900 23097 25109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 25216 26034 gene locus_tag LOCUS_17910 gene proC 25216 26034 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476242.1 protein_id gnl|my_center|LOCUS_17910 26338 29073 gene locus_tag LOCUS_17920 gene valS 26338 29073 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054756.1 protein_id gnl|my_center|LOCUS_17920 29241 30422 gene locus_tag LOCUS_17930 29241 30422 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_17930 30649 32541 gene locus_tag LOCUS_17940 30649 32541 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805025.1 protein_id gnl|my_center|LOCUS_17940 33970 32768 gene locus_tag LOCUS_17950 33970 32768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_17950 34658 33963 gene locus_tag LOCUS_17960 34658 33963 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 protein_id gnl|my_center|LOCUS_17960 35797 34655 gene locus_tag LOCUS_17970 35797 34655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 36264 35794 gene locus_tag LOCUS_17980 36264 35794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 36897 36520 gene locus_tag LOCUS_17990 36897 36520 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976797.1 protein_id gnl|my_center|LOCUS_17990 38165 36909 gene locus_tag LOCUS_18000 gene clpX 38165 36909 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412634.1 protein_id gnl|my_center|LOCUS_18000 38984 38340 gene locus_tag LOCUS_18010 38984 38340 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930165.1 protein_id gnl|my_center|LOCUS_18010 39604 38984 gene locus_tag LOCUS_18020 39604 38984 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_18020 41148 39802 gene locus_tag LOCUS_18030 gene tig 41148 39802 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730000.1 protein_id gnl|my_center|LOCUS_18030 41356 42777 gene locus_tag LOCUS_18040 41356 42777 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 protein_id gnl|my_center|LOCUS_18040 43004 42810 gene locus_tag LOCUS_18050 43004 42810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 43014 43937 gene locus_tag LOCUS_18060 43014 43937 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812298.1 protein_id gnl|my_center|LOCUS_18060 44207 44133 gene locus_tag LOCUS_t00450 44207 44133 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 44318 44391 gene locus_tag LOCUS_t00460 44318 44391 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 45081 44704 gene locus_tag LOCUS_18070 45081 44704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 46550 45516 gene locus_tag LOCUS_18080 46550 45516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 46982 46907 gene locus_tag LOCUS_t00470 46982 46907 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 47525 47172 gene locus_tag LOCUS_18090 47525 47172 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_18090 48482 47544 gene locus_tag LOCUS_18100 48482 47544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877581.1 protein_id gnl|my_center|LOCUS_18100 49718 48576 gene locus_tag LOCUS_18110 49718 48576 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_18110 50893 49862 gene locus_tag LOCUS_18120 50893 49862 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223627.1 protein_id gnl|my_center|LOCUS_18120 50945 51592 gene locus_tag LOCUS_18130 50945 51592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 52471 51692 gene locus_tag LOCUS_18140 52471 51692 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_18140 53476 52499 gene locus_tag LOCUS_18150 53476 52499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 54798 53473 gene locus_tag LOCUS_18160 gene murA 54798 53473 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399439.1 protein_id gnl|my_center|LOCUS_18160 55686 54982 gene locus_tag LOCUS_18170 gene leuD 55686 54982 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893754.1 protein_id gnl|my_center|LOCUS_18170 57111 55711 gene locus_tag LOCUS_18180 gene leuC 57111 55711 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775884.1 protein_id gnl|my_center|LOCUS_18180 57287 58021 gene locus_tag LOCUS_18190 57287 58021 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775885.1 protein_id gnl|my_center|LOCUS_18190 58366 58293 gene locus_tag LOCUS_t00480 58366 58293 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 58507 58434 gene locus_tag LOCUS_t00490 58507 58434 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 58605 58533 gene locus_tag LOCUS_t00500 58605 58533 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 60514 59009 gene locus_tag LOCUS_18200 gene gltX 60514 59009 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051591.1 protein_id gnl|my_center|LOCUS_18200 60752 61933 gene locus_tag LOCUS_18210 60752 61933 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056294.1 protein_id gnl|my_center|LOCUS_18210 62947 62174 gene locus_tag LOCUS_18220 62947 62174 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775888.1 protein_id gnl|my_center|LOCUS_18220 64776 63319 gene locus_tag LOCUS_18230 64776 63319 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196738.1 protein_id gnl|my_center|LOCUS_18230 64931 67603 gene locus_tag LOCUS_18240 64931 67603 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_18240 67889 68191 gene locus_tag LOCUS_18250 67889 68191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 68188 68595 gene locus_tag LOCUS_18260 68188 68595 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230831.1 protein_id gnl|my_center|LOCUS_18260 68779 70092 gene locus_tag LOCUS_18270 68779 70092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 70619 70233 gene locus_tag LOCUS_18280 70619 70233 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858364.1 protein_id gnl|my_center|LOCUS_18280 70990 70811 gene locus_tag LOCUS_18290 70990 70811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 71016 71714 gene locus_tag LOCUS_18300 71016 71714 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804428.1 protein_id gnl|my_center|LOCUS_18300 72823 71774 gene locus_tag LOCUS_18310 72823 71774 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930166.1 protein_id gnl|my_center|LOCUS_18310 74781 73165 gene locus_tag LOCUS_18320 gene cimA 74781 73165 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775900.1 protein_id gnl|my_center|LOCUS_18320 76729 74858 gene locus_tag LOCUS_18330 gene ilvD 76729 74858 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223580.1 protein_id gnl|my_center|LOCUS_18330 77971 76826 gene locus_tag LOCUS_18340 77971 76826 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812920.1 protein_id gnl|my_center|LOCUS_18340 79170 78094 gene locus_tag LOCUS_18350 79170 78094 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775902.1 protein_id gnl|my_center|LOCUS_18350 80407 79382 gene locus_tag LOCUS_18360 gene ilvC 80407 79382 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775904.1 protein_id gnl|my_center|LOCUS_18360 80922 80410 gene locus_tag LOCUS_18370 gene ilvN 80922 80410 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_18370 82710 80926 gene locus_tag LOCUS_18380 82710 80926 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775906.1 protein_id gnl|my_center|LOCUS_18380 83012 84604 gene locus_tag LOCUS_18390 83012 84604 CDS product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941681.1 protein_id gnl|my_center|LOCUS_18390 86249 85020 gene locus_tag LOCUS_18400 86249 85020 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123926043.1 protein_id gnl|my_center|LOCUS_18400