>Feature sequence001 26 3565 gene locus_tag LOCUS_00010 gene brxC 26 3565 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942753.1 protein_id gnl|my_center|LOCUS_00010 3710 4084 gene locus_tag LOCUS_00020 3710 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4065 4484 gene locus_tag LOCUS_00030 4065 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4830 9653 gene locus_tag LOCUS_00040 4830 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 9667 10920 gene locus_tag LOCUS_00050 9667 10920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 10917 11618 gene locus_tag LOCUS_00060 10917 11618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 11618 14146 gene locus_tag LOCUS_00070 11618 14146 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942750.1 protein_id gnl|my_center|LOCUS_00070 14256 14522 gene locus_tag LOCUS_00080 14256 14522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 14774 14947 gene locus_tag LOCUS_00090 14774 14947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 14937 15128 gene locus_tag LOCUS_00100 14937 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 15141 17189 gene locus_tag LOCUS_00110 gene brxL 15141 17189 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942749.1 protein_id gnl|my_center|LOCUS_00110 17221 17874 gene locus_tag LOCUS_00120 17221 17874 CDS product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_00120 17852 18397 gene locus_tag LOCUS_00130 17852 18397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00130 18449 18790 gene locus_tag LOCUS_00140 18449 18790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00140 19689 18940 gene locus_tag LOCUS_00150 19689 18940 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044922.1 protein_id gnl|my_center|LOCUS_00150 21725 19893 gene locus_tag LOCUS_00160 gene glmS 21725 19893 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269442.1 protein_id gnl|my_center|LOCUS_00160 23225 21855 gene locus_tag LOCUS_00170 gene glmU 23225 21855 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707907.1 protein_id gnl|my_center|LOCUS_00170 23745 23248 gene locus_tag LOCUS_00180 23745 23248 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036503.1 protein_id gnl|my_center|LOCUS_00180 23635 23844 gene locus_tag LOCUS_00190 23635 23844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24323 23901 gene locus_tag LOCUS_00200 24323 23901 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948665.1 protein_id gnl|my_center|LOCUS_00200 25739 24357 gene locus_tag LOCUS_00210 gene atpD 25739 24357 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097130.1 protein_id gnl|my_center|LOCUS_00210 26733 25870 gene locus_tag LOCUS_00220 gene atpG 26733 25870 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_00220 28399 26858 gene locus_tag LOCUS_00230 gene atpA 28399 26858 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_00230 28952 28413 gene locus_tag LOCUS_00240 28952 28413 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357053.1 protein_id gnl|my_center|LOCUS_00240 29432 28962 gene locus_tag LOCUS_00250 gene atpF 29432 28962 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884340.1 protein_id gnl|my_center|LOCUS_00250 29745 29512 gene locus_tag LOCUS_00260 29745 29512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30667 29801 gene locus_tag LOCUS_00270 gene atpB 30667 29801 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377888.1 protein_id gnl|my_center|LOCUS_00270 31103 30678 gene locus_tag LOCUS_00280 31103 30678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32176 31163 gene locus_tag LOCUS_00290 32176 31163 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_00290 33005 32217 gene locus_tag LOCUS_00300 33005 32217 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948577.1 protein_id gnl|my_center|LOCUS_00300 33663 33013 gene locus_tag LOCUS_00310 gene rsmG 33663 33013 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212261.1 protein_id gnl|my_center|LOCUS_00310 35534 33660 gene locus_tag LOCUS_00320 gene mnmG 35534 33660 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114649.1 protein_id gnl|my_center|LOCUS_00320 35618 36562 gene locus_tag LOCUS_00330 35618 36562 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 protein_id gnl|my_center|LOCUS_00330 36628 37596 gene locus_tag LOCUS_00340 36628 37596 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_00340 37565 39586 gene locus_tag LOCUS_00350 gene tgpA 37565 39586 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_00350 39709 41253 gene locus_tag LOCUS_00360 39709 41253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 41584 41225 gene locus_tag LOCUS_00370 41584 41225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 41654 42700 gene locus_tag LOCUS_00380 41654 42700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 44561 42723 gene locus_tag LOCUS_00390 44561 42723 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_00390 46066 44891 gene locus_tag LOCUS_00400 46066 44891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 47571 46063 gene locus_tag LOCUS_00410 47571 46063 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768668.1 protein_id gnl|my_center|LOCUS_00410 48583 47561 gene locus_tag LOCUS_00420 48583 47561 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 protein_id gnl|my_center|LOCUS_00420 49467 48673 gene locus_tag LOCUS_00430 49467 48673 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 protein_id gnl|my_center|LOCUS_00430 50111 49506 gene locus_tag LOCUS_00440 50111 49506 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140946.1 protein_id gnl|my_center|LOCUS_00440 50629 50826 gene locus_tag LOCUS_00450 50629 50826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 51782 50805 gene locus_tag LOCUS_00460 51782 50805 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_00460 51789 53840 gene locus_tag LOCUS_00470 gene fusA 51789 53840 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943165.1 protein_id gnl|my_center|LOCUS_00470 54468 53905 gene locus_tag LOCUS_00480 54468 53905 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222279.1 protein_id gnl|my_center|LOCUS_00480 54467 54715 gene locus_tag LOCUS_00490 54467 54715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 55522 54647 gene locus_tag LOCUS_00500 55522 54647 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_00500 56132 55515 gene locus_tag LOCUS_00510 56132 55515 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_00510 56821 59094 gene locus_tag LOCUS_00520 56821 59094 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 protein_id gnl|my_center|LOCUS_00520 59292 61064 gene locus_tag LOCUS_00530 gene argS 59292 61064 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_00530 61066 61662 gene locus_tag LOCUS_00540 61066 61662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 62387 61716 gene locus_tag LOCUS_00550 gene phoU 62387 61716 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259745.1 protein_id gnl|my_center|LOCUS_00550 63586 62408 gene locus_tag LOCUS_00560 gene nahK 63586 62408 CDS product N-acetylhexosamine 1-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068766.1 protein_id gnl|my_center|LOCUS_00560 65780 63567 gene locus_tag LOCUS_00570 gene relA 65780 63567 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_00570 67211 65949 gene locus_tag LOCUS_00580 67211 65949 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_00580 67452 67525 gene locus_tag LOCUS_t00010 67452 67525 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 67609 67693 gene locus_tag LOCUS_t00020 67609 67693 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 67698 68459 gene locus_tag LOCUS_00590 67698 68459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_00590 69227 68481 gene locus_tag LOCUS_00600 69227 68481 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404265.1 protein_id gnl|my_center|LOCUS_00600 69824 69243 gene locus_tag LOCUS_00610 69824 69243 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_00610 70894 69824 gene locus_tag LOCUS_00620 gene cobT 70894 69824 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112354.1 protein_id gnl|my_center|LOCUS_00620 71412 70891 gene locus_tag LOCUS_00630 gene cobU 71412 70891 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082599.1 protein_id gnl|my_center|LOCUS_00630 72066 71461 gene locus_tag LOCUS_00640 gene cobO 72066 71461 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038179.1 protein_id gnl|my_center|LOCUS_00640 72650 72063 gene locus_tag LOCUS_00650 72650 72063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038180.1 protein_id gnl|my_center|LOCUS_00650 74614 72770 gene locus_tag LOCUS_00660 gene btuB 74614 72770 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_00660 76181 75210 gene locus_tag LOCUS_00670 76181 75210 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_00670 77585 76386 gene locus_tag LOCUS_00680 77585 76386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 78662 77592 gene locus_tag LOCUS_00690 gene amrS 78662 77592 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_00690 78543 78815 gene locus_tag LOCUS_00700 78543 78815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 78996 79781 gene locus_tag LOCUS_00710 gene amrB 78996 79781 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_00710 79759 80433 gene locus_tag LOCUS_00720 79759 80433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 80454 82856 gene locus_tag LOCUS_00730 80454 82856 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_00730 85830 83002 gene locus_tag LOCUS_00740 85830 83002 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_00740 86129 87982 gene locus_tag LOCUS_00750 86129 87982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 88210 90798 gene locus_tag LOCUS_00760 88210 90798 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390312.1 protein_id gnl|my_center|LOCUS_00760 90795 91745 gene locus_tag LOCUS_00770 90795 91745 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_00770 92452 91898 gene locus_tag LOCUS_00780 92452 91898 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 protein_id gnl|my_center|LOCUS_00780 93245 92487 gene locus_tag LOCUS_00790 93245 92487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 93552 93896 gene locus_tag LOCUS_00800 93552 93896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 94077 95513 gene locus_tag LOCUS_00810 gene cls 94077 95513 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122347.1 protein_id gnl|my_center|LOCUS_00810 95784 95608 gene locus_tag LOCUS_00820 95784 95608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 95979 96449 gene locus_tag LOCUS_00830 95979 96449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 96463 97371 gene locus_tag LOCUS_00840 96463 97371 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808402.1 protein_id gnl|my_center|LOCUS_00840 97386 97970 gene locus_tag LOCUS_00850 97386 97970 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941521.1 protein_id gnl|my_center|LOCUS_00850 99440 99249 gene locus_tag LOCUS_00860 99440 99249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 100193 99585 gene locus_tag LOCUS_00870 100193 99585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 100686 100198 gene locus_tag LOCUS_00880 100686 100198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 101005 101538 gene locus_tag LOCUS_00890 101005 101538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 102881 102375 gene locus_tag LOCUS_00900 102881 102375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 104080 103223 gene locus_tag LOCUS_00910 104080 103223 CDS product NAD(+)--dinitrogen-reductase ADP-D-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943429.1 protein_id gnl|my_center|LOCUS_00910 104263 105147 gene locus_tag LOCUS_00920 gene nifH 104263 105147 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 protein_id gnl|my_center|LOCUS_00920 105274 106758 gene locus_tag LOCUS_00930 gene nifD 105274 106758 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_00930 106910 108481 gene locus_tag LOCUS_00940 gene nifK 106910 108481 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 protein_id gnl|my_center|LOCUS_00940 108557 108775 gene locus_tag LOCUS_00950 108557 108775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 108896 109096 gene locus_tag LOCUS_00960 108896 109096 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723758.1 protein_id gnl|my_center|LOCUS_00960 109157 109864 gene locus_tag LOCUS_00970 109157 109864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 109861 110130 gene locus_tag LOCUS_00980 109861 110130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 112527 110329 gene locus_tag LOCUS_00990 112527 110329 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_00990 113403 112624 gene locus_tag LOCUS_01000 113403 112624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 114077 113667 gene locus_tag LOCUS_01010 114077 113667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 115397 114534 gene locus_tag LOCUS_01020 gene metF 115397 114534 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118821.1 protein_id gnl|my_center|LOCUS_01020 116896 115490 gene locus_tag LOCUS_01030 gene ahcY 116896 115490 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229256.1 protein_id gnl|my_center|LOCUS_01030 118346 117153 gene locus_tag LOCUS_01040 gene metK 118346 117153 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 protein_id gnl|my_center|LOCUS_01040 118628 119182 gene locus_tag LOCUS_01050 118628 119182 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_01050 119564 121570 gene locus_tag LOCUS_01060 gene tkt 119564 121570 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098688.1 protein_id gnl|my_center|LOCUS_01060 121749 122750 gene locus_tag LOCUS_01070 gene gap 121749 122750 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785248.1 protein_id gnl|my_center|LOCUS_01070 122974 124155 gene locus_tag LOCUS_01080 122974 124155 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482432.1 protein_id gnl|my_center|LOCUS_01080 124221 125669 gene locus_tag LOCUS_01090 gene pyk 124221 125669 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093930.1 protein_id gnl|my_center|LOCUS_01090 125737 126801 gene locus_tag LOCUS_01100 gene fba 125737 126801 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763563.1 protein_id gnl|my_center|LOCUS_01100 126939 127334 gene locus_tag LOCUS_01110 126939 127334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 127521 128183 gene locus_tag LOCUS_01120 127521 128183 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966324.1 protein_id gnl|my_center|LOCUS_01120 128230 128976 gene locus_tag LOCUS_01130 128230 128976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 129236 130690 gene locus_tag LOCUS_01140 129236 130690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 130874 132754 gene locus_tag LOCUS_01150 gene speA 130874 132754 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038943.1 protein_id gnl|my_center|LOCUS_01150 132758 133111 gene locus_tag LOCUS_01160 gene hypA 132758 133111 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544945.1 protein_id gnl|my_center|LOCUS_01160 133305 134180 gene locus_tag LOCUS_01170 gene hypB 133305 134180 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388055.1 protein_id gnl|my_center|LOCUS_01170 134443 134952 gene locus_tag LOCUS_01180 134443 134952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 135162 135611 gene locus_tag LOCUS_01190 135162 135611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 138081 135667 gene locus_tag LOCUS_01200 138081 135667 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_01200 138739 138386 gene locus_tag LOCUS_01210 138739 138386 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_01210 140187 138799 gene locus_tag LOCUS_01220 gene argH 140187 138799 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401567.1 protein_id gnl|my_center|LOCUS_01220 140455 141726 gene locus_tag LOCUS_01230 140455 141726 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_01230 141723 145265 gene locus_tag LOCUS_01240 141723 145265 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922355.1 protein_id gnl|my_center|LOCUS_01240 146187 145297 gene locus_tag LOCUS_01250 146187 145297 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928875.1 protein_id gnl|my_center|LOCUS_01250 146297 147469 gene locus_tag LOCUS_01260 146297 147469 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_01260 147469 148830 gene locus_tag LOCUS_01270 147469 148830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 148827 149993 gene locus_tag LOCUS_01280 148827 149993 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926038.1 protein_id gnl|my_center|LOCUS_01280 150013 151143 gene locus_tag LOCUS_01290 150013 151143 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_01290 151128 152231 gene locus_tag LOCUS_01300 gene waaC 151128 152231 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_01300 152228 153337 gene locus_tag LOCUS_01310 152228 153337 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925739.1 protein_id gnl|my_center|LOCUS_01310 153651 153334 gene locus_tag LOCUS_01320 153651 153334 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723777.1 protein_id gnl|my_center|LOCUS_01320 154395 153694 gene locus_tag LOCUS_01330 154395 153694 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119632344.1 protein_id gnl|my_center|LOCUS_01330 155175 154456 gene locus_tag LOCUS_01340 gene rsxG 155175 154456 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339119.1 protein_id gnl|my_center|LOCUS_01340 156263 155172 gene locus_tag LOCUS_01350 156263 155172 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 protein_id gnl|my_center|LOCUS_01350 157833 156265 gene locus_tag LOCUS_01360 gene rsxC 157833 156265 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 protein_id gnl|my_center|LOCUS_01360 158407 157874 gene locus_tag LOCUS_01370 gene rsxB 158407 157874 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103780.1 protein_id gnl|my_center|LOCUS_01370 159090 158515 gene locus_tag LOCUS_01380 gene rsxA 159090 158515 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723764.1 protein_id gnl|my_center|LOCUS_01380 159608 161248 gene locus_tag LOCUS_01390 159608 161248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 161245 162885 gene locus_tag LOCUS_01400 161245 162885 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 protein_id gnl|my_center|LOCUS_01400 163215 163853 gene locus_tag LOCUS_01410 163215 163853 CDS product DUF3611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056251.1 protein_id gnl|my_center|LOCUS_01410 164061 166889 gene locus_tag LOCUS_01420 164061 166889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 167512 167018 gene locus_tag LOCUS_01430 167512 167018 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141597.1 protein_id gnl|my_center|LOCUS_01430 167972 167748 gene locus_tag LOCUS_01440 167972 167748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 168702 168451 gene locus_tag LOCUS_01450 168702 168451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 168607 170076 gene locus_tag LOCUS_01460 168607 170076 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209573.1 protein_id gnl|my_center|LOCUS_01460 170129 170848 gene locus_tag LOCUS_01470 170129 170848 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667131.1 protein_id gnl|my_center|LOCUS_01470 171991 171011 gene locus_tag LOCUS_01480 171991 171011 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_01480 172721 172257 gene locus_tag LOCUS_01490 172721 172257 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545179.1 protein_id gnl|my_center|LOCUS_01490 174163 173129 gene locus_tag LOCUS_01500 174163 173129 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143073.1 protein_id gnl|my_center|LOCUS_01500 175045 174173 gene locus_tag LOCUS_01510 175045 174173 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531939.1 protein_id gnl|my_center|LOCUS_01510 175382 175122 gene locus_tag LOCUS_01520 175382 175122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 176923 175478 gene locus_tag LOCUS_01530 gene gatB 176923 175478 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 protein_id gnl|my_center|LOCUS_01530 178465 177011 gene locus_tag LOCUS_01540 gene gatA 178465 177011 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_01540 178752 178465 gene locus_tag LOCUS_01550 gene gatC 178752 178465 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_01550 179031 179106 gene locus_tag LOCUS_t00030 179031 179106 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 179470 179745 gene locus_tag LOCUS_01560 179470 179745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 179745 180725 gene locus_tag LOCUS_01570 179745 180725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 180758 181180 gene locus_tag LOCUS_01580 180758 181180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 181273 181551 gene locus_tag LOCUS_01590 181273 181551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 181535 182014 gene locus_tag LOCUS_01600 181535 182014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 182051 182353 gene locus_tag LOCUS_01610 182051 182353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 182433 182675 gene locus_tag LOCUS_01620 182433 182675 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_01620 183403 183176 gene locus_tag LOCUS_01630 183403 183176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 183677 183384 gene locus_tag LOCUS_01640 183677 183384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 184272 186218 gene locus_tag LOCUS_01650 184272 186218 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870222.1 protein_id gnl|my_center|LOCUS_01650 188055 186994 gene locus_tag LOCUS_01660 188055 186994 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400551.1 protein_id gnl|my_center|LOCUS_01660 188459 188271 gene locus_tag LOCUS_01670 188459 188271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 188753 188926 gene locus_tag LOCUS_01680 188753 188926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 189868 189029 gene locus_tag LOCUS_01690 gene rpoH 189868 189029 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013101924.1 protein_id gnl|my_center|LOCUS_01690 190793 190308 gene locus_tag LOCUS_01700 190793 190308 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483573.1 protein_id gnl|my_center|LOCUS_01700 192784 190823 gene locus_tag LOCUS_01710 192784 190823 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489098.1 protein_id gnl|my_center|LOCUS_01710 194193 192781 gene locus_tag LOCUS_01720 194193 192781 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626043.1 protein_id gnl|my_center|LOCUS_01720 195196 194225 gene locus_tag LOCUS_01730 gene ftsX 195196 194225 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_01730 195876 195208 gene locus_tag LOCUS_01740 gene ftsE 195876 195208 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_01740 196932 195889 gene locus_tag LOCUS_01750 196932 195889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 197202 198581 gene locus_tag LOCUS_01760 197202 198581 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_01760 198571 199923 gene locus_tag LOCUS_01770 198571 199923 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 protein_id gnl|my_center|LOCUS_01770 199910 200473 gene locus_tag LOCUS_01780 gene rsmD 199910 200473 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211502.1 protein_id gnl|my_center|LOCUS_01780 200591 201067 gene locus_tag LOCUS_01790 gene coaD 200591 201067 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084466.1 protein_id gnl|my_center|LOCUS_01790 201134 201385 gene locus_tag LOCUS_01800 201134 201385 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_01800 201513 203096 gene locus_tag LOCUS_01810 gene ggt 201513 203096 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112970.1 protein_id gnl|my_center|LOCUS_01810 203343 204287 gene locus_tag LOCUS_01820 203343 204287 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099685.1 protein_id gnl|my_center|LOCUS_01820 204918 204478 gene locus_tag LOCUS_01830 204918 204478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 204958 207075 gene locus_tag LOCUS_01840 204958 207075 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125686.1 protein_id gnl|my_center|LOCUS_01840 207978 211043 gene locus_tag LOCUS_01850 207978 211043 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_01850 211191 211526 gene locus_tag LOCUS_01860 211191 211526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 211665 211889 gene locus_tag LOCUS_01870 211665 211889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790422.1 protein_id gnl|my_center|LOCUS_01870 211879 212301 gene locus_tag LOCUS_01880 211879 212301 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391721.1 protein_id gnl|my_center|LOCUS_01880 212311 215697 gene locus_tag LOCUS_01890 212311 215697 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036268.1 protein_id gnl|my_center|LOCUS_01890 215724 216902 gene locus_tag LOCUS_01900 215724 216902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 216906 217679 gene locus_tag LOCUS_01910 216906 217679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 217763 219850 gene locus_tag LOCUS_01920 217763 219850 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036269.1 protein_id gnl|my_center|LOCUS_01920 220441 220366 gene locus_tag LOCUS_t00040 220441 220366 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 221717 220533 gene locus_tag LOCUS_01930 221717 220533 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_01930 221874 223883 gene locus_tag LOCUS_01940 gene uvrB 221874 223883 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104590.1 protein_id gnl|my_center|LOCUS_01940 223987 224700 gene locus_tag LOCUS_01950 gene mtgA 223987 224700 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705989.1 protein_id gnl|my_center|LOCUS_01950 225144 224788 gene locus_tag LOCUS_01960 gene rsfS 225144 224788 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_01960 225933 225298 gene locus_tag LOCUS_01970 gene nadD 225933 225298 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 protein_id gnl|my_center|LOCUS_01970 227257 225983 gene locus_tag LOCUS_01980 227257 225983 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_01980 228227 227331 gene locus_tag LOCUS_01990 228227 227331 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_01990 228422 228838 gene locus_tag LOCUS_02000 228422 228838 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014535.1 protein_id gnl|my_center|LOCUS_02000 229637 228963 gene locus_tag LOCUS_02010 gene radC 229637 228963 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_02010 229898 231172 gene locus_tag LOCUS_02020 gene coaBC 229898 231172 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_02020 231144 231614 gene locus_tag LOCUS_02030 gene dut 231144 231614 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098293.1 protein_id gnl|my_center|LOCUS_02030 231628 233022 gene locus_tag LOCUS_02040 231628 233022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 233086 233982 gene locus_tag LOCUS_02050 gene argB 233086 233982 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_02050 234661 234008 gene locus_tag LOCUS_02060 gene pyrE 234661 234008 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703811.1 protein_id gnl|my_center|LOCUS_02060 234820 235509 gene locus_tag LOCUS_02070 234820 235509 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412360.1 protein_id gnl|my_center|LOCUS_02070 235964 235506 gene locus_tag LOCUS_02080 235964 235506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 236371 236042 gene locus_tag LOCUS_02090 236371 236042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 236969 236394 gene locus_tag LOCUS_02100 236969 236394 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_02100 237796 236966 gene locus_tag LOCUS_02110 gene proC 237796 236966 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958646.1 protein_id gnl|my_center|LOCUS_02110 237969 237793 gene locus_tag LOCUS_02120 237969 237793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 238700 237966 gene locus_tag LOCUS_02130 238700 237966 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 protein_id gnl|my_center|LOCUS_02130 239335 238703 gene locus_tag LOCUS_02140 239335 238703 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725019.1 protein_id gnl|my_center|LOCUS_02140 240176 239433 gene locus_tag LOCUS_02150 gene rph 240176 239433 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_02150 241300 240353 gene locus_tag LOCUS_02160 241300 240353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02160 241575 242441 gene locus_tag LOCUS_02170 241575 242441 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621336.1 protein_id gnl|my_center|LOCUS_02170 242711 243316 gene locus_tag LOCUS_02180 gene gmk 242711 243316 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458969.1 protein_id gnl|my_center|LOCUS_02180 243709 244011 gene locus_tag LOCUS_02190 gene rpoZ 243709 244011 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116990.1 protein_id gnl|my_center|LOCUS_02190 244183 246429 gene locus_tag LOCUS_02200 gene spoT 244183 246429 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_02200 246588 247001 gene locus_tag LOCUS_02210 246588 247001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 248123 247137 gene locus_tag LOCUS_02220 gene hemF 248123 247137 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097311.1 protein_id gnl|my_center|LOCUS_02220 248415 248969 gene locus_tag LOCUS_02230 248415 248969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 248972 249388 gene locus_tag LOCUS_02240 248972 249388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02240 249392 251449 gene locus_tag LOCUS_02250 249392 251449 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02250 251918 251481 gene locus_tag LOCUS_02260 gene dtd 251918 251481 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266358.1 protein_id gnl|my_center|LOCUS_02260 252876 251926 gene locus_tag LOCUS_02270 gene pip 252876 251926 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095918.1 protein_id gnl|my_center|LOCUS_02270 254762 252948 gene locus_tag LOCUS_02280 gene typA 254762 252948 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211151.1 protein_id gnl|my_center|LOCUS_02280 257135 254964 gene locus_tag LOCUS_02290 257135 254964 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528604.1 protein_id gnl|my_center|LOCUS_02290 258636 257584 gene locus_tag LOCUS_02300 258636 257584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 260447 258699 gene locus_tag LOCUS_02310 gene ilvB 260447 258699 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938671.1 protein_id gnl|my_center|LOCUS_02310 260584 261723 gene locus_tag LOCUS_02320 260584 261723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 262097 262534 gene locus_tag LOCUS_02330 262097 262534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 268276 262640 gene locus_tag LOCUS_02340 gene uvrA 268276 262640 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194485.1 protein_id gnl|my_center|LOCUS_02340 269469 268276 gene locus_tag LOCUS_02350 269469 268276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 271609 269996 gene locus_tag LOCUS_02360 271609 269996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 271731 272252 gene locus_tag LOCUS_02370 271731 272252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 273911 272406 gene locus_tag LOCUS_02380 gene pepA 273911 272406 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209310.1 protein_id gnl|my_center|LOCUS_02380 274125 275189 gene locus_tag LOCUS_02390 gene lptG 274125 275189 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694193.1 protein_id gnl|my_center|LOCUS_02390 275796 275263 gene locus_tag LOCUS_02400 275796 275263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 276007 278721 gene locus_tag LOCUS_02410 276007 278721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 278730 279359 gene locus_tag LOCUS_02420 278730 279359 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811946.1 protein_id gnl|my_center|LOCUS_02420 279476 280459 gene locus_tag LOCUS_02430 279476 280459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 281073 280552 gene locus_tag LOCUS_02440 281073 280552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 281513 282094 gene locus_tag LOCUS_02450 281513 282094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 283791 282418 gene locus_tag LOCUS_02460 gene purB 283791 282418 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705315.1 protein_id gnl|my_center|LOCUS_02460 286457 283797 gene locus_tag LOCUS_02470 gene acnA 286457 283797 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_02470 287317 286664 gene locus_tag LOCUS_02480 gene hflD 287317 286664 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334622.1 protein_id gnl|my_center|LOCUS_02480 288569 287418 gene locus_tag LOCUS_02490 gene mnmA 288569 287418 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073282.1 protein_id gnl|my_center|LOCUS_02490 288809 290068 gene locus_tag LOCUS_02500 gene icd 288809 290068 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814059.1 protein_id gnl|my_center|LOCUS_02500 290447 290241 gene locus_tag LOCUS_02510 290447 290241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 290705 291028 gene locus_tag LOCUS_02520 gene clpS 290705 291028 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037130.1 protein_id gnl|my_center|LOCUS_02520 291143 293407 gene locus_tag LOCUS_02530 gene clpA 291143 293407 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_02530 294089 293733 gene locus_tag LOCUS_02540 294089 293733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 294981 294208 gene locus_tag LOCUS_02550 294981 294208 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767401.1 protein_id gnl|my_center|LOCUS_02550 295768 295034 gene locus_tag LOCUS_02560 gene aat 295768 295034 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_02560 297027 295861 gene locus_tag LOCUS_02570 297027 295861 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626386.1 protein_id gnl|my_center|LOCUS_02570 298091 297126 gene locus_tag LOCUS_02580 gene trxB 298091 297126 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097640.1 protein_id gnl|my_center|LOCUS_02580 299465 298188 gene locus_tag LOCUS_02590 299465 298188 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_02590 299834 300292 gene locus_tag LOCUS_02600 299834 300292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 300568 300936 gene locus_tag LOCUS_02610 300568 300936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 301254 302006 gene locus_tag LOCUS_02620 301254 302006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 302011 302631 gene locus_tag LOCUS_02630 gene rlmE 302011 302631 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_02630 302707 304629 gene locus_tag LOCUS_02640 gene ftsH 302707 304629 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 protein_id gnl|my_center|LOCUS_02640 304641 306002 gene locus_tag LOCUS_02650 gene glmM 304641 306002 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_02650 306076 307461 gene locus_tag LOCUS_02660 306076 307461 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_02660 307806 308240 gene locus_tag LOCUS_02670 307806 308240 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210715.1 protein_id gnl|my_center|LOCUS_02670 308230 308559 gene locus_tag LOCUS_02680 308230 308559 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649214.1 protein_id gnl|my_center|LOCUS_02680 309199 308708 gene locus_tag LOCUS_02690 309199 308708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 309596 310024 gene locus_tag LOCUS_02700 gene fur 309596 310024 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_02700 313744 310250 gene locus_tag LOCUS_02710 gene mfd 313744 310250 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024299434.1 protein_id gnl|my_center|LOCUS_02710 314760 313903 gene locus_tag LOCUS_02720 314760 313903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 315879 314839 gene locus_tag LOCUS_02730 315879 314839 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_02730 318376 316208 gene locus_tag LOCUS_02740 318376 316208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 319589 318660 gene locus_tag LOCUS_02750 319589 318660 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_02750 321345 319579 gene locus_tag LOCUS_02760 gene glsA 321345 319579 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087566.1 protein_id gnl|my_center|LOCUS_02760 325039 321473 gene locus_tag LOCUS_02770 325039 321473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251825.1 protein_id gnl|my_center|LOCUS_02770 325519 326532 gene locus_tag LOCUS_02780 gene galE 325519 326532 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_02780 328643 326751 gene locus_tag LOCUS_02790 gene thiC 328643 326751 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_02790 329666 329451 gene locus_tag LOCUS_02800 329666 329451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 329553 331613 gene locus_tag LOCUS_02810 329553 331613 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275209.1 protein_id gnl|my_center|LOCUS_02810 331640 332200 gene locus_tag LOCUS_02820 331640 332200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 333155 332220 gene locus_tag LOCUS_02830 333155 332220 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 protein_id gnl|my_center|LOCUS_02830 333695 333192 gene locus_tag LOCUS_02840 333695 333192 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349084.1 protein_id gnl|my_center|LOCUS_02840 334606 334118 gene locus_tag LOCUS_02850 334606 334118 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423235.1 protein_id gnl|my_center|LOCUS_02850 335284 334631 gene locus_tag LOCUS_02860 335284 334631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 335488 336303 gene locus_tag LOCUS_02870 335488 336303 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103253.1 protein_id gnl|my_center|LOCUS_02870 336477 337256 gene locus_tag LOCUS_02880 336477 337256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 337749 337288 gene locus_tag LOCUS_02890 337749 337288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 337633 337992 gene locus_tag LOCUS_02900 337633 337992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 338452 338033 gene locus_tag LOCUS_02910 338452 338033 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_02910 339315 339013 gene locus_tag LOCUS_02920 339315 339013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 339343 339522 gene locus_tag LOCUS_02930 339343 339522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 339762 340607 gene locus_tag LOCUS_02940 gene nadC 339762 340607 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_02940 341021 340677 gene locus_tag LOCUS_02950 341021 340677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 341951 341025 gene locus_tag LOCUS_02960 341951 341025 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_02960 343709 342180 gene locus_tag LOCUS_02970 343709 342180 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_02970 344036 345652 gene locus_tag LOCUS_02980 344036 345652 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_02980 345839 346462 gene locus_tag LOCUS_02990 345839 346462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 346618 346983 gene locus_tag LOCUS_03000 346618 346983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 347717 347190 gene locus_tag LOCUS_03010 347717 347190 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_03010 348813 348157 gene locus_tag LOCUS_03020 348813 348157 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110585.1 protein_id gnl|my_center|LOCUS_03020 349284 349676 gene locus_tag LOCUS_03030 349284 349676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 349673 352039 gene locus_tag LOCUS_03040 gene ptsP 349673 352039 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958293.1 protein_id gnl|my_center|LOCUS_03040 353502 352096 gene locus_tag LOCUS_03050 353502 352096 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_03050 354100 353495 gene locus_tag LOCUS_03060 354100 353495 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958410.1 protein_id gnl|my_center|LOCUS_03060 354470 354105 gene locus_tag LOCUS_03070 354470 354105 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 protein_id gnl|my_center|LOCUS_03070 356308 354494 gene locus_tag LOCUS_03080 356308 354494 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268851.1 protein_id gnl|my_center|LOCUS_03080 356342 357238 gene locus_tag LOCUS_03090 gene rsmI 356342 357238 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809262.1 protein_id gnl|my_center|LOCUS_03090 358135 358590 gene locus_tag LOCUS_03100 gene mraZ 358135 358590 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103101.1 protein_id gnl|my_center|LOCUS_03100 358587 359537 gene locus_tag LOCUS_03110 gene rsmH 358587 359537 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095568.1 protein_id gnl|my_center|LOCUS_03110 359534 359824 gene locus_tag LOCUS_03120 359534 359824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 359811 361580 gene locus_tag LOCUS_03130 359811 361580 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042597405.1 protein_id gnl|my_center|LOCUS_03130 361577 362938 gene locus_tag LOCUS_03140 361577 362938 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103103.1 protein_id gnl|my_center|LOCUS_03140 362938 364020 gene locus_tag LOCUS_03150 gene mraY 362938 364020 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_03150 364151 365503 gene locus_tag LOCUS_03160 gene murD 364151 365503 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766566.1 protein_id gnl|my_center|LOCUS_03160 365500 366711 gene locus_tag LOCUS_03170 gene ftsW 365500 366711 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406017.1 protein_id gnl|my_center|LOCUS_03170 366696 367784 gene locus_tag LOCUS_03180 gene murG 366696 367784 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_03180 367781 369226 gene locus_tag LOCUS_03190 gene murC 367781 369226 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_03190 369235 370128 gene locus_tag LOCUS_03200 gene murB 369235 370128 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_03200 370125 371060 gene locus_tag LOCUS_03210 370125 371060 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_03210 371053 371856 gene locus_tag LOCUS_03220 371053 371856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 371863 373098 gene locus_tag LOCUS_03230 gene ftsA 371863 373098 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364017.1 protein_id gnl|my_center|LOCUS_03230 373367 374539 gene locus_tag LOCUS_03240 gene ftsZ 373367 374539 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948309.1 protein_id gnl|my_center|LOCUS_03240 374803 375714 gene locus_tag LOCUS_03250 gene lpxC 374803 375714 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_03250 376255 375767 gene locus_tag LOCUS_03260 376255 375767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 376415 377362 gene locus_tag LOCUS_03270 376415 377362 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_03270 377510 380353 gene locus_tag LOCUS_03280 gene secA 377510 380353 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073892.1 protein_id gnl|my_center|LOCUS_03280 380400 381587 gene locus_tag LOCUS_03290 gene argJ 380400 381587 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208443.1 protein_id gnl|my_center|LOCUS_03290 381584 382534 gene locus_tag LOCUS_03300 381584 382534 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 protein_id gnl|my_center|LOCUS_03300 382654 384183 gene locus_tag LOCUS_03310 382654 384183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 384455 384261 gene locus_tag LOCUS_03320 gene yacG 384455 384261 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070771.1 protein_id gnl|my_center|LOCUS_03320 385223 384456 gene locus_tag LOCUS_03330 gene zapD 385223 384456 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095583.1 protein_id gnl|my_center|LOCUS_03330 387359 385383 gene locus_tag LOCUS_03340 387359 385383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 387579 388328 gene locus_tag LOCUS_03350 387579 388328 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072407.1 protein_id gnl|my_center|LOCUS_03350 388321 388902 gene locus_tag LOCUS_03360 gene ruvC 388321 388902 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026245.1 protein_id gnl|my_center|LOCUS_03360 388907 389515 gene locus_tag LOCUS_03370 gene ruvA 388907 389515 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245442.1 protein_id gnl|my_center|LOCUS_03370 389588 390688 gene locus_tag LOCUS_03380 gene glcE 389588 390688 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_03380 390697 391908 gene locus_tag LOCUS_03390 gene glcF 390697 391908 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194661.1 protein_id gnl|my_center|LOCUS_03390 391905 392798 gene locus_tag LOCUS_03400 391905 392798 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970417.1 protein_id gnl|my_center|LOCUS_03400 393118 392801 gene locus_tag LOCUS_03410 393118 392801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 393718 393143 gene locus_tag LOCUS_03420 393718 393143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 395081 393849 gene locus_tag LOCUS_03430 395081 393849 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_03430 395231 396259 gene locus_tag LOCUS_03440 gene queA 395231 396259 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_03440 396480 396884 gene locus_tag LOCUS_03450 396480 396884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 397234 398502 gene locus_tag LOCUS_03460 397234 398502 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_03460 398691 398966 gene locus_tag LOCUS_03470 398691 398966 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_03470 399083 400924 gene locus_tag LOCUS_03480 399083 400924 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 protein_id gnl|my_center|LOCUS_03480 400903 401940 gene locus_tag LOCUS_03490 gene birA 400903 401940 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262797.1 protein_id gnl|my_center|LOCUS_03490 401937 402704 gene locus_tag LOCUS_03500 401937 402704 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093768.1 protein_id gnl|my_center|LOCUS_03500 402847 402771 gene locus_tag LOCUS_t00050 402847 402771 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 403283 402996 gene locus_tag LOCUS_03510 403283 402996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388388.1 protein_id gnl|my_center|LOCUS_03510 404516 403308 gene locus_tag LOCUS_03520 404516 403308 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720441.1 protein_id gnl|my_center|LOCUS_03520 405682 404774 gene locus_tag LOCUS_03530 gene chlG 405682 404774 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388385.1 protein_id gnl|my_center|LOCUS_03530 407085 405688 gene locus_tag LOCUS_03540 gene ppsR 407085 405688 CDS product transcriptional regulator PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388384.1 protein_id gnl|my_center|LOCUS_03540 407734 408213 gene locus_tag LOCUS_03550 gene bchF 407734 408213 CDS product 2-vinyl bacteriochlorophyllide hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388382.1 protein_id gnl|my_center|LOCUS_03550 408210 409496 gene locus_tag LOCUS_03560 408210 409496 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388381.1 protein_id gnl|my_center|LOCUS_03560 409501 411078 gene locus_tag LOCUS_03570 gene bchB 409501 411078 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388380.1 protein_id gnl|my_center|LOCUS_03570 411053 414790 gene locus_tag LOCUS_03580 411053 414790 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388379.1 protein_id gnl|my_center|LOCUS_03580 414787 415698 gene locus_tag LOCUS_03590 gene bchL 414787 415698 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388378.1 protein_id gnl|my_center|LOCUS_03590 415698 416399 gene locus_tag LOCUS_03600 gene bchM 415698 416399 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388377.1 protein_id gnl|my_center|LOCUS_03600 416675 417442 gene locus_tag LOCUS_03610 gene puhA 416675 417442 CDS product photosynthetic reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388375.1 protein_id gnl|my_center|LOCUS_03610 417439 418101 gene locus_tag LOCUS_03620 gene puhB 417439 418101 CDS product photosynthetic complex putative assembly protein PuhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388374.1 protein_id gnl|my_center|LOCUS_03620 418148 418615 gene locus_tag LOCUS_03630 418148 418615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 418897 419817 gene locus_tag LOCUS_03640 gene puhE 418897 419817 CDS product putative photosynthetic complex assembly protein PuhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388372.1 protein_id gnl|my_center|LOCUS_03640 420184 421839 gene locus_tag LOCUS_03650 gene bchE 420184 421839 CDS product magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259511.1 protein_id gnl|my_center|LOCUS_03650 421853 423211 gene locus_tag LOCUS_03660 gene hemN 421853 423211 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256540.1 protein_id gnl|my_center|LOCUS_03660 423208 423816 gene locus_tag LOCUS_03670 gene bchJ 423208 423816 CDS product bacteriochlorophyll 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388371.1 protein_id gnl|my_center|LOCUS_03670 424000 425250 gene locus_tag LOCUS_03680 424000 425250 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902770.1 protein_id gnl|my_center|LOCUS_03680 426144 425296 gene locus_tag LOCUS_03690 426144 425296 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390733.1 protein_id gnl|my_center|LOCUS_03690 427706 426210 gene locus_tag LOCUS_03700 gene crtI 427706 426210 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390732.1 protein_id gnl|my_center|LOCUS_03700 427873 428739 gene locus_tag LOCUS_03710 427873 428739 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390731.1 protein_id gnl|my_center|LOCUS_03710 428929 430044 gene locus_tag LOCUS_03720 428929 430044 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390730.1 protein_id gnl|my_center|LOCUS_03720 430112 431065 gene locus_tag LOCUS_03730 gene bchC 430112 431065 CDS product chlorophyll synthesis pathway protein BchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390729.1 protein_id gnl|my_center|LOCUS_03730 431062 432054 gene locus_tag LOCUS_03740 431062 432054 CDS product chlorophyllide a reductase iron protein subunit X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390728.1 protein_id gnl|my_center|LOCUS_03740 432047 433552 gene locus_tag LOCUS_03750 gene bchY 432047 433552 CDS product chlorophyllide a reductase subunit Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390727.1 protein_id gnl|my_center|LOCUS_03750 433578 435020 gene locus_tag LOCUS_03760 gene bchZ 433578 435020 CDS product chlorophyllide a reductase subunit Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390726.1 protein_id gnl|my_center|LOCUS_03760 435953 436096 gene locus_tag LOCUS_03770 435953 436096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 436179 436391 gene locus_tag LOCUS_03780 gene pufA 436179 436391 CDS product light-harvesting antenna LH1, alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390724.1 protein_id gnl|my_center|LOCUS_03780 436477 437328 gene locus_tag LOCUS_03790 gene pufL 436477 437328 CDS product photosynthetic reaction center subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390723.1 protein_id gnl|my_center|LOCUS_03790 437344 438315 gene locus_tag LOCUS_03800 gene pufM 437344 438315 CDS product photosynthetic reaction center subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390722.1 protein_id gnl|my_center|LOCUS_03800 438312 439388 gene locus_tag LOCUS_03810 438312 439388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 439582 439728 gene locus_tag LOCUS_03820 439582 439728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03820 440076 440219 gene locus_tag LOCUS_03830 440076 440219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 440308 440511 gene locus_tag LOCUS_03840 gene pufA 440308 440511 CDS product light-harvesting antenna LH1, alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390724.1 protein_id gnl|my_center|LOCUS_03840 440536 441021 gene locus_tag LOCUS_03850 440536 441021 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932031.1 protein_id gnl|my_center|LOCUS_03850 441025 442344 gene locus_tag LOCUS_03860 441025 442344 CDS product RuBisCO large subunit C-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933432.1 protein_id gnl|my_center|LOCUS_03860 442388 442960 gene locus_tag LOCUS_03870 gene idi 442388 442960 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_03870 443425 444348 gene locus_tag LOCUS_03880 gene lipA 443425 444348 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958112.1 protein_id gnl|my_center|LOCUS_03880 444335 445201 gene locus_tag LOCUS_03890 444335 445201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 446347 445307 gene locus_tag LOCUS_03900 446347 445307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 448073 446658 gene locus_tag LOCUS_03910 448073 446658 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927109.1 protein_id gnl|my_center|LOCUS_03910 448838 448149 gene locus_tag LOCUS_03920 gene murU 448838 448149 CDS product N-acetylmuramate alpha-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099549.1 protein_id gnl|my_center|LOCUS_03920 449096 449401 gene locus_tag LOCUS_03930 449096 449401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 449419 450237 gene locus_tag LOCUS_03940 gene xthA 449419 450237 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104169.1 protein_id gnl|my_center|LOCUS_03940 450401 451297 gene locus_tag LOCUS_03950 gene murI 450401 451297 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_03950 452772 451366 gene locus_tag LOCUS_03960 gene mtaB 452772 451366 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816469.1 protein_id gnl|my_center|LOCUS_03960 453185 452769 gene locus_tag LOCUS_03970 453185 452769 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 protein_id gnl|my_center|LOCUS_03970 453791 453186 gene locus_tag LOCUS_03980 453791 453186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 454381 453806 gene locus_tag LOCUS_03990 454381 453806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 454963 454391 gene locus_tag LOCUS_04000 454963 454391 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258358.1 protein_id gnl|my_center|LOCUS_04000 455217 455426 gene locus_tag LOCUS_04010 455217 455426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 455562 456227 gene locus_tag LOCUS_04020 455562 456227 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103868.1 protein_id gnl|my_center|LOCUS_04020 456242 457048 gene locus_tag LOCUS_04030 gene djlA 456242 457048 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220839.1 protein_id gnl|my_center|LOCUS_04030 457345 458028 gene locus_tag LOCUS_04040 gene rpe 457345 458028 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174695.1 protein_id gnl|my_center|LOCUS_04040 458190 458858 gene locus_tag LOCUS_04050 458190 458858 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070665.1 protein_id gnl|my_center|LOCUS_04050 458961 460439 gene locus_tag LOCUS_04060 gene trpE 458961 460439 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113204.1 protein_id gnl|my_center|LOCUS_04060 460817 461299 gene locus_tag LOCUS_04070 460817 461299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 461694 463049 gene locus_tag LOCUS_04080 gene mgtE 461694 463049 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071378.1 protein_id gnl|my_center|LOCUS_04080 463525 464103 gene locus_tag LOCUS_04090 463525 464103 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_04090 464181 465206 gene locus_tag LOCUS_04100 gene trpD 464181 465206 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316297.1 protein_id gnl|my_center|LOCUS_04100 465224 466030 gene locus_tag LOCUS_04110 gene trpC 465224 466030 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_04110 466728 466072 gene locus_tag LOCUS_04120 gene crp 466728 466072 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 protein_id gnl|my_center|LOCUS_04120 466933 467382 gene locus_tag LOCUS_04130 466933 467382 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401957.1 protein_id gnl|my_center|LOCUS_04130 467423 468247 gene locus_tag LOCUS_04140 gene speD 467423 468247 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316303.1 protein_id gnl|my_center|LOCUS_04140 468986 468342 gene locus_tag LOCUS_04150 gene coq7 468986 468342 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035727.1 protein_id gnl|my_center|LOCUS_04150 470424 469249 gene locus_tag LOCUS_04160 gene glcF 470424 469249 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888365.1 protein_id gnl|my_center|LOCUS_04160 470664 470978 gene locus_tag LOCUS_04170 470664 470978 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_04170 471274 471699 gene locus_tag LOCUS_04180 gene rplM 471274 471699 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098967.1 protein_id gnl|my_center|LOCUS_04180 471711 472100 gene locus_tag LOCUS_04190 gene rpsI 471711 472100 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035728.1 protein_id gnl|my_center|LOCUS_04190 472234 472307 gene locus_tag LOCUS_t00060 472234 472307 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 473100 474485 gene locus_tag LOCUS_04200 473100 474485 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073642.1 protein_id gnl|my_center|LOCUS_04200 475273 474611 gene locus_tag LOCUS_04210 gene rpiA 475273 474611 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084386.1 protein_id gnl|my_center|LOCUS_04210 475470 477002 gene locus_tag LOCUS_04220 gene ilvA 475470 477002 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_04220 477775 477167 gene locus_tag LOCUS_04230 477775 477167 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266316.1 protein_id gnl|my_center|LOCUS_04230 478323 477994 gene locus_tag LOCUS_04240 478323 477994 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_04240 478529 478320 gene locus_tag LOCUS_04250 478529 478320 CDS product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038363.1 protein_id gnl|my_center|LOCUS_04250 478877 479428 gene locus_tag LOCUS_04260 478877 479428 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021494.1 protein_id gnl|my_center|LOCUS_04260 479425 480741 gene locus_tag LOCUS_04270 gene pepP 479425 480741 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_04270 480818 482050 gene locus_tag LOCUS_04280 gene ubiH 480818 482050 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703430.1 protein_id gnl|my_center|LOCUS_04280 482043 483329 gene locus_tag LOCUS_04290 482043 483329 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481236.1 protein_id gnl|my_center|LOCUS_04290 483585 484838 gene locus_tag LOCUS_04300 483585 484838 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_04300 485183 485731 gene locus_tag LOCUS_04310 gene ppa 485183 485731 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948454.1 protein_id gnl|my_center|LOCUS_04310 485835 486317 gene locus_tag LOCUS_04320 gene moaC 485835 486317 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_04320 486455 486928 gene locus_tag LOCUS_04330 486455 486928 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940308.1 protein_id gnl|my_center|LOCUS_04330 487239 487685 gene locus_tag LOCUS_04340 487239 487685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 488506 487745 gene locus_tag LOCUS_04350 488506 487745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 489091 490584 gene locus_tag LOCUS_04360 489091 490584 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022277.1 protein_id gnl|my_center|LOCUS_04360 492515 490773 gene locus_tag LOCUS_04370 gene ptsP 492515 490773 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_04370 492781 492512 gene locus_tag LOCUS_04380 492781 492512 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_04380 493331 492900 gene locus_tag LOCUS_04390 493331 492900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_04390 494245 493328 gene locus_tag LOCUS_04400 gene rapZ 494245 493328 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377550.1 protein_id gnl|my_center|LOCUS_04400 495204 494242 gene locus_tag LOCUS_04410 gene hprK 495204 494242 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993219.1 protein_id gnl|my_center|LOCUS_04410 495687 495223 gene locus_tag LOCUS_04420 gene ptsN 495687 495223 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098853.1 protein_id gnl|my_center|LOCUS_04420 496228 495896 gene locus_tag LOCUS_04430 gene hpf 496228 495896 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_04430 497701 496259 gene locus_tag LOCUS_04440 497701 496259 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_04440 498915 498178 gene locus_tag LOCUS_04450 gene lptB 498915 498178 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_04450 499442 498912 gene locus_tag LOCUS_04460 gene lptA 499442 498912 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120916.1 protein_id gnl|my_center|LOCUS_04460 500053 499439 gene locus_tag LOCUS_04470 500053 499439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 500571 500050 gene locus_tag LOCUS_04480 500571 500050 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_04480 501751 500732 gene locus_tag LOCUS_04490 gene kdsD 501751 500732 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134758.1 protein_id gnl|my_center|LOCUS_04490 502234 502794 gene locus_tag LOCUS_04500 502234 502794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 503080 503925 gene locus_tag LOCUS_04510 503080 503925 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 protein_id gnl|my_center|LOCUS_04510 503925 504707 gene locus_tag LOCUS_04520 gene mlaE 503925 504707 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925786.1 protein_id gnl|my_center|LOCUS_04520 504713 505177 gene locus_tag LOCUS_04530 gene mlaD 504713 505177 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_04530 505179 505808 gene locus_tag LOCUS_04540 505179 505808 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_04540 505805 506119 gene locus_tag LOCUS_04550 505805 506119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 506220 507530 gene locus_tag LOCUS_04560 gene murA 506220 507530 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_04560 507527 508171 gene locus_tag LOCUS_04570 gene hisG 507527 508171 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766526.1 protein_id gnl|my_center|LOCUS_04570 508242 509537 gene locus_tag LOCUS_04580 gene hisD 508242 509537 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 protein_id gnl|my_center|LOCUS_04580 509544 510620 gene locus_tag LOCUS_04590 gene hisC 509544 510620 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_04590 510840 511991 gene locus_tag LOCUS_04600 gene carA 510840 511991 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045131.1 protein_id gnl|my_center|LOCUS_04600 512009 515218 gene locus_tag LOCUS_04610 gene carB 512009 515218 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340565.1 protein_id gnl|my_center|LOCUS_04610 515354 515830 gene locus_tag LOCUS_04620 gene greA 515354 515830 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694444.1 protein_id gnl|my_center|LOCUS_04620 516738 515875 gene locus_tag LOCUS_04630 516738 515875 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478523.1 protein_id gnl|my_center|LOCUS_04630 516937 517284 gene locus_tag LOCUS_04640 516937 517284 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929971.1 protein_id gnl|my_center|LOCUS_04640 517378 519156 gene locus_tag LOCUS_04650 gene aspS 517378 519156 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104814.1 protein_id gnl|my_center|LOCUS_04650 519279 519770 gene locus_tag LOCUS_04660 gene nudB 519279 519770 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 protein_id gnl|my_center|LOCUS_04660 519852 520403 gene locus_tag LOCUS_04670 519852 520403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 521082 520651 gene locus_tag LOCUS_04680 521082 520651 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405616.1 protein_id gnl|my_center|LOCUS_04680 521277 523109 gene locus_tag LOCUS_04690 gene hcuC 521277 523109 CDS product hydrophobic compound transporter HcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112499.1 protein_id gnl|my_center|LOCUS_04690 524965 523268 gene locus_tag LOCUS_04700 524965 523268 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582481.1 protein_id gnl|my_center|LOCUS_04700 526236 525424 gene locus_tag LOCUS_04710 526236 525424 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050725350.1 protein_id gnl|my_center|LOCUS_04710 527283 526237 gene locus_tag LOCUS_04720 527283 526237 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_04720 528245 527343 gene locus_tag LOCUS_04730 528245 527343 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_04730 528831 528238 gene locus_tag LOCUS_04740 gene hutZ 528831 528238 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704904.1 protein_id gnl|my_center|LOCUS_04740 530830 528878 gene locus_tag LOCUS_04750 530830 528878 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073464.1 protein_id gnl|my_center|LOCUS_04750 531331 532719 gene locus_tag LOCUS_04760 gene hutW 531331 532719 CDS product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209066.1 protein_id gnl|my_center|LOCUS_04760 532716 533234 gene locus_tag LOCUS_04770 gene hutX 532716 533234 CDS product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089811.1 protein_id gnl|my_center|LOCUS_04770 534779 533328 gene locus_tag LOCUS_04780 534779 533328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 535191 536576 gene locus_tag LOCUS_04790 535191 536576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 538080 536608 gene locus_tag LOCUS_04800 538080 536608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 538243 539643 gene locus_tag LOCUS_04810 538243 539643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 540123 539635 gene locus_tag LOCUS_04820 540123 539635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 540872 540159 gene locus_tag LOCUS_04830 540872 540159 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257174.1 protein_id gnl|my_center|LOCUS_04830 541176 540886 gene locus_tag LOCUS_04840 541176 540886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 541263 542465 gene locus_tag LOCUS_04850 gene lapB 541263 542465 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_04850 542504 543202 gene locus_tag LOCUS_04860 gene pyrF 542504 543202 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090975.1 protein_id gnl|my_center|LOCUS_04860 543363 544238 gene locus_tag LOCUS_04870 gene galU 543363 544238 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225519.1 protein_id gnl|my_center|LOCUS_04870 545193 544276 gene locus_tag LOCUS_04880 gene gluQRS 545193 544276 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941983.1 protein_id gnl|my_center|LOCUS_04880 545699 545265 gene locus_tag LOCUS_04890 gene dksA 545699 545265 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence002 151 2658 gene locus_tag LOCUS_04900 151 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 1527 1600 gene locus_tag LOCUS_t00070 1527 1600 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2655 3581 gene locus_tag LOCUS_04910 2655 3581 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731568.1 protein_id gnl|my_center|LOCUS_04910 4185 3703 gene locus_tag LOCUS_04920 4185 3703 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276952.1 protein_id gnl|my_center|LOCUS_04920 4582 4214 gene locus_tag LOCUS_04930 4582 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 4765 5526 gene locus_tag LOCUS_04940 4765 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 5766 6305 gene locus_tag LOCUS_04950 5766 6305 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 protein_id gnl|my_center|LOCUS_04950 6441 6983 gene locus_tag LOCUS_04960 6441 6983 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054081306.1 protein_id gnl|my_center|LOCUS_04960 7001 8398 gene locus_tag LOCUS_04970 7001 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 8594 8412 gene locus_tag LOCUS_04980 8594 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 8517 9308 gene locus_tag LOCUS_04990 8517 9308 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_04990 9435 10457 gene locus_tag LOCUS_05000 9435 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 11431 10589 gene locus_tag LOCUS_05010 11431 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 13166 11700 gene locus_tag LOCUS_05020 13166 11700 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090686.1 protein_id gnl|my_center|LOCUS_05020 15014 16099 gene locus_tag LOCUS_05030 15014 16099 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966094.1 protein_id gnl|my_center|LOCUS_05030 16269 16096 gene locus_tag LOCUS_05040 16269 16096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 17028 16801 gene locus_tag LOCUS_05050 17028 16801 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_05050 17497 17120 gene locus_tag LOCUS_05060 17497 17120 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857681.1 protein_id gnl|my_center|LOCUS_05060 17735 17481 gene locus_tag LOCUS_05070 17735 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 18084 17899 gene locus_tag LOCUS_05080 18084 17899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 18552 18477 gene locus_tag LOCUS_t00080 18552 18477 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 18797 18722 gene locus_tag LOCUS_t00090 18797 18722 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 18991 19878 gene locus_tag LOCUS_05090 gene htpX 18991 19878 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397849.1 protein_id gnl|my_center|LOCUS_05090 20306 20049 gene locus_tag LOCUS_05100 20306 20049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 21281 20448 gene locus_tag LOCUS_05110 21281 20448 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 protein_id gnl|my_center|LOCUS_05110 21863 21282 gene locus_tag LOCUS_05120 21863 21282 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_05120 23227 21854 gene locus_tag LOCUS_05130 23227 21854 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_05130 23928 23419 gene locus_tag LOCUS_05140 23928 23419 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036687.1 protein_id gnl|my_center|LOCUS_05140 24270 25013 gene locus_tag LOCUS_05150 gene fpr 24270 25013 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208956.1 protein_id gnl|my_center|LOCUS_05150 25214 25020 gene locus_tag LOCUS_05160 25214 25020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 25247 26830 gene locus_tag LOCUS_05170 25247 26830 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415991.1 protein_id gnl|my_center|LOCUS_05170 26967 28517 gene locus_tag LOCUS_05180 26967 28517 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922119.1 protein_id gnl|my_center|LOCUS_05180 28753 30072 gene locus_tag LOCUS_05190 28753 30072 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_05190 30238 30882 gene locus_tag LOCUS_05200 30238 30882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 30945 31448 gene locus_tag LOCUS_05210 30945 31448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 32471 31614 gene locus_tag LOCUS_05220 32471 31614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 34212 32593 gene locus_tag LOCUS_05230 34212 32593 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_05230 35222 34209 gene locus_tag LOCUS_05240 35222 34209 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620024.1 protein_id gnl|my_center|LOCUS_05240 36033 35395 gene locus_tag LOCUS_05250 gene yjgA 36033 35395 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364101.1 protein_id gnl|my_center|LOCUS_05250 37965 36214 gene locus_tag LOCUS_05260 gene recJ 37965 36214 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_05260 39893 37965 gene locus_tag LOCUS_05270 39893 37965 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_05270 40565 39972 gene locus_tag LOCUS_05280 40565 39972 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_05280 40997 42238 gene locus_tag LOCUS_05290 40997 42238 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826550.1 protein_id gnl|my_center|LOCUS_05290 44012 42324 gene locus_tag LOCUS_05300 44012 42324 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_05300 44361 45485 gene locus_tag LOCUS_05310 44361 45485 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 protein_id gnl|my_center|LOCUS_05310 45732 46274 gene locus_tag LOCUS_05320 45732 46274 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036687.1 protein_id gnl|my_center|LOCUS_05320 46766 46305 gene locus_tag LOCUS_05330 46766 46305 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921433.1 protein_id gnl|my_center|LOCUS_05330 47064 50126 gene locus_tag LOCUS_05340 47064 50126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 50799 50248 gene locus_tag LOCUS_05350 50799 50248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 51424 50882 gene locus_tag LOCUS_05360 51424 50882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 51992 53236 gene locus_tag LOCUS_05370 51992 53236 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973356.1 protein_id gnl|my_center|LOCUS_05370 53357 53557 gene locus_tag LOCUS_05380 53357 53557 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263379.1 protein_id gnl|my_center|LOCUS_05380 53567 53878 gene locus_tag LOCUS_05390 53567 53878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 53871 54413 gene locus_tag LOCUS_05400 53871 54413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 54809 55198 gene locus_tag LOCUS_05410 54809 55198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 56473 56384 gene locus_tag LOCUS_t00100 56473 56384 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 57047 56595 gene locus_tag LOCUS_05420 57047 56595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 58652 57072 gene locus_tag LOCUS_05430 gene guaA 58652 57072 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771001.1 protein_id gnl|my_center|LOCUS_05430 60175 58709 gene locus_tag LOCUS_05440 gene guaB 60175 58709 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314194.1 protein_id gnl|my_center|LOCUS_05440 60490 61878 gene locus_tag LOCUS_05450 gene xseA 60490 61878 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_05450 62982 61921 gene locus_tag LOCUS_05460 62982 61921 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_05460 65825 63159 gene locus_tag LOCUS_05470 65825 63159 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_05470 66534 65863 gene locus_tag LOCUS_05480 gene lolD 66534 65863 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_05480 66669 67385 gene locus_tag LOCUS_05490 66669 67385 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_05490 67609 68586 gene locus_tag LOCUS_05500 gene accA 67609 68586 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055753.1 protein_id gnl|my_center|LOCUS_05500 68591 69994 gene locus_tag LOCUS_05510 gene tilS 68591 69994 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_05510 70322 70873 gene locus_tag LOCUS_05520 70322 70873 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083123.1 protein_id gnl|my_center|LOCUS_05520 71148 72326 gene locus_tag LOCUS_05530 71148 72326 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948653.1 protein_id gnl|my_center|LOCUS_05530 72371 73315 gene locus_tag LOCUS_05540 gene argF 72371 73315 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092090.1 protein_id gnl|my_center|LOCUS_05540 73416 74099 gene locus_tag LOCUS_05550 73416 74099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 74494 74201 gene locus_tag LOCUS_05560 74494 74201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 74876 76084 gene locus_tag LOCUS_05570 74876 76084 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088477.1 protein_id gnl|my_center|LOCUS_05570 76159 76614 gene locus_tag LOCUS_05580 76159 76614 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941703.1 protein_id gnl|my_center|LOCUS_05580 77287 76751 gene locus_tag LOCUS_05590 77287 76751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 80472 77326 gene locus_tag LOCUS_05600 80472 77326 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 protein_id gnl|my_center|LOCUS_05600 81619 80474 gene locus_tag LOCUS_05610 81619 80474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 82263 81616 gene locus_tag LOCUS_05620 82263 81616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 83475 83720 gene locus_tag LOCUS_05630 83475 83720 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533122.1 protein_id gnl|my_center|LOCUS_05630 83768 85273 gene locus_tag LOCUS_05640 83768 85273 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976176.1 protein_id gnl|my_center|LOCUS_05640 85278 87272 gene locus_tag LOCUS_05650 gene asnB 85278 87272 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_05650 87290 88276 gene locus_tag LOCUS_05660 gene nadE 87290 88276 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533125.1 protein_id gnl|my_center|LOCUS_05660 89200 88325 gene locus_tag LOCUS_05670 89200 88325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 89563 89267 gene locus_tag LOCUS_05680 89563 89267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 91281 89839 gene locus_tag LOCUS_05690 91281 89839 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_05690 91512 95015 gene locus_tag LOCUS_05700 gene smc 91512 95015 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_05700 95181 95882 gene locus_tag LOCUS_05710 gene zipA 95181 95882 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083352.1 protein_id gnl|my_center|LOCUS_05710 95858 98209 gene locus_tag LOCUS_05720 gene ligA 95858 98209 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114675.1 protein_id gnl|my_center|LOCUS_05720 98408 98680 gene locus_tag LOCUS_05730 98408 98680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 98685 99482 gene locus_tag LOCUS_05740 98685 99482 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478264.1 protein_id gnl|my_center|LOCUS_05740 100436 99492 gene locus_tag LOCUS_05750 100436 99492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 101679 100591 gene locus_tag LOCUS_05760 101679 100591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 102641 101793 gene locus_tag LOCUS_05770 102641 101793 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821314.1 protein_id gnl|my_center|LOCUS_05770 103085 102783 gene locus_tag LOCUS_05780 103085 102783 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767703.1 protein_id gnl|my_center|LOCUS_05780 103124 103303 gene locus_tag LOCUS_05790 103124 103303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 104540 103464 gene locus_tag LOCUS_05800 104540 103464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 109438 104822 gene locus_tag LOCUS_05810 109438 104822 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_05810 110084 113257 gene locus_tag LOCUS_05820 110084 113257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 113845 115296 gene locus_tag LOCUS_05830 113845 115296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112913.1 protein_id gnl|my_center|LOCUS_05830 115448 117448 gene locus_tag LOCUS_05840 gene betT 115448 117448 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 protein_id gnl|my_center|LOCUS_05840 119017 117482 gene locus_tag LOCUS_05850 119017 117482 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973731.1 protein_id gnl|my_center|LOCUS_05850 119994 119167 gene locus_tag LOCUS_05860 gene mutM 119994 119167 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039216.1 protein_id gnl|my_center|LOCUS_05860 121322 119994 gene locus_tag LOCUS_05870 121322 119994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 122692 121319 gene locus_tag LOCUS_05880 122692 121319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 123435 122689 gene locus_tag LOCUS_05890 123435 122689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 124376 123432 gene locus_tag LOCUS_05900 124376 123432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_05900 125412 124435 gene locus_tag LOCUS_05910 125412 124435 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_05910 125840 126697 gene locus_tag LOCUS_05920 125840 126697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 127238 126741 gene locus_tag LOCUS_05930 127238 126741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 128328 127282 gene locus_tag LOCUS_05940 gene hypE 128328 127282 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_05940 129481 128342 gene locus_tag LOCUS_05950 gene hypD 129481 128342 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_05950 129720 129478 gene locus_tag LOCUS_05960 129720 129478 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_05960 130957 129776 gene locus_tag LOCUS_05970 130957 129776 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388922.1 protein_id gnl|my_center|LOCUS_05970 131007 131651 gene locus_tag LOCUS_05980 131007 131651 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763279.1 protein_id gnl|my_center|LOCUS_05980 132483 131827 gene locus_tag LOCUS_05990 132483 131827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 132774 133010 gene locus_tag LOCUS_06000 132774 133010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 133214 133921 gene locus_tag LOCUS_06010 gene ompR 133214 133921 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074227.1 protein_id gnl|my_center|LOCUS_06010 133921 135288 gene locus_tag LOCUS_06020 gene envZ 133921 135288 CDS product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369373.1 protein_id gnl|my_center|LOCUS_06020 135469 135933 gene locus_tag LOCUS_06030 135469 135933 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_06030 136075 138465 gene locus_tag LOCUS_06040 136075 138465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 138525 139457 gene locus_tag LOCUS_06050 138525 139457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 139454 139789 gene locus_tag LOCUS_06060 139454 139789 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137286.1 protein_id gnl|my_center|LOCUS_06060 139865 140716 gene locus_tag LOCUS_06070 gene speE 139865 140716 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038944.1 protein_id gnl|my_center|LOCUS_06070 142127 140865 gene locus_tag LOCUS_06080 142127 140865 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 protein_id gnl|my_center|LOCUS_06080 142484 142146 gene locus_tag LOCUS_06090 gene glnK 142484 142146 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_06090 143349 142567 gene locus_tag LOCUS_06100 143349 142567 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_06100 143857 144123 gene locus_tag LOCUS_06110 143857 144123 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307315.1 protein_id gnl|my_center|LOCUS_06110 144144 145670 gene locus_tag LOCUS_06120 144144 145670 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_06120 145792 147708 gene locus_tag LOCUS_06130 145792 147708 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168667914.1 protein_id gnl|my_center|LOCUS_06130 148101 150608 gene locus_tag LOCUS_06140 148101 150608 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022951227.1 protein_id gnl|my_center|LOCUS_06140 150907 150527 gene locus_tag LOCUS_06150 150907 150527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 151001 152197 gene locus_tag LOCUS_06160 151001 152197 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 protein_id gnl|my_center|LOCUS_06160 152467 152859 gene locus_tag LOCUS_06170 152467 152859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 152939 153280 gene locus_tag LOCUS_06180 152939 153280 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975744.1 protein_id gnl|my_center|LOCUS_06180 153372 154370 gene locus_tag LOCUS_06190 153372 154370 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771202.1 protein_id gnl|my_center|LOCUS_06190 154450 156609 gene locus_tag LOCUS_06200 154450 156609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 156764 157816 gene locus_tag LOCUS_06210 156764 157816 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942893.1 protein_id gnl|my_center|LOCUS_06210 157816 158826 gene locus_tag LOCUS_06220 157816 158826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 158980 159564 gene locus_tag LOCUS_06230 158980 159564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 159709 161088 gene locus_tag LOCUS_06240 159709 161088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 161225 162013 gene locus_tag LOCUS_06250 161225 162013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 162067 163719 gene locus_tag LOCUS_06260 162067 163719 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143842.1 protein_id gnl|my_center|LOCUS_06260 163727 165205 gene locus_tag LOCUS_06270 163727 165205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 166070 165546 gene locus_tag LOCUS_06280 166070 165546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 168643 167570 gene locus_tag LOCUS_06290 168643 167570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 168993 169253 gene locus_tag LOCUS_06300 168993 169253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 170625 169675 gene locus_tag LOCUS_06310 170625 169675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 171762 170716 gene locus_tag LOCUS_06320 171762 170716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 172275 173618 gene locus_tag LOCUS_06330 172275 173618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 173677 174924 gene locus_tag LOCUS_06340 173677 174924 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_06340 174921 177227 gene locus_tag LOCUS_06350 174921 177227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 177224 178471 gene locus_tag LOCUS_06360 177224 178471 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256778.1 protein_id gnl|my_center|LOCUS_06360 178464 179462 gene locus_tag LOCUS_06370 178464 179462 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202693.1 protein_id gnl|my_center|LOCUS_06370 179506 180033 gene locus_tag LOCUS_06380 179506 180033 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103738.1 protein_id gnl|my_center|LOCUS_06380 180030 181400 gene locus_tag LOCUS_06390 180030 181400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 181397 182185 gene locus_tag LOCUS_06400 181397 182185 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_06400 182309 183796 gene locus_tag LOCUS_06410 182309 183796 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257357.1 protein_id gnl|my_center|LOCUS_06410 184313 183846 gene locus_tag LOCUS_06420 184313 183846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 187787 184488 gene locus_tag LOCUS_06430 187787 184488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 188060 188791 gene locus_tag LOCUS_06440 188060 188791 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188391.1 protein_id gnl|my_center|LOCUS_06440 189150 188935 gene locus_tag LOCUS_06450 189150 188935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 189034 190317 gene locus_tag LOCUS_06460 189034 190317 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531459.1 protein_id gnl|my_center|LOCUS_06460 190314 190958 gene locus_tag LOCUS_06470 190314 190958 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_06470 190955 191641 gene locus_tag LOCUS_06480 190955 191641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 191794 191618 gene locus_tag LOCUS_06490 191794 191618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 192916 191825 gene locus_tag LOCUS_06500 192916 191825 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_06500 194057 192990 gene locus_tag LOCUS_06510 194057 192990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 194261 195445 gene locus_tag LOCUS_06520 194261 195445 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_06520 195637 196239 gene locus_tag LOCUS_06530 gene phaR 195637 196239 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037439.1 protein_id gnl|my_center|LOCUS_06530 196415 196780 gene locus_tag LOCUS_06540 196415 196780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 197005 197745 gene locus_tag LOCUS_06550 gene phbB 197005 197745 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813586.1 protein_id gnl|my_center|LOCUS_06550 198485 198345 gene locus_tag LOCUS_06560 198485 198345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 198789 198574 gene locus_tag LOCUS_06570 198789 198574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 198952 198809 gene locus_tag LOCUS_06580 198952 198809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 199421 200887 gene locus_tag LOCUS_06590 gene kaiC 199421 200887 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390295.1 protein_id gnl|my_center|LOCUS_06590 200884 201204 gene locus_tag LOCUS_06600 200884 201204 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725098.1 protein_id gnl|my_center|LOCUS_06600 201236 201637 gene locus_tag LOCUS_06610 201236 201637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 201634 203772 gene locus_tag LOCUS_06620 201634 203772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 203803 204528 gene locus_tag LOCUS_06630 203803 204528 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083090.1 protein_id gnl|my_center|LOCUS_06630 208044 204586 gene locus_tag LOCUS_06640 208044 204586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 212029 208028 gene locus_tag LOCUS_06650 212029 208028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 213237 212059 gene locus_tag LOCUS_06660 213237 212059 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706047.1 protein_id gnl|my_center|LOCUS_06660 214789 213500 gene locus_tag LOCUS_06670 gene purD 214789 213500 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197681.1 protein_id gnl|my_center|LOCUS_06670 215630 214845 gene locus_tag LOCUS_06680 gene lpxA 215630 214845 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690880.1 protein_id gnl|my_center|LOCUS_06680 217278 215719 gene locus_tag LOCUS_06690 gene purH 217278 215719 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_06690 217674 217381 gene locus_tag LOCUS_06700 gene fis 217674 217381 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035757.1 protein_id gnl|my_center|LOCUS_06700 218684 217686 gene locus_tag LOCUS_06710 gene dusB 218684 217686 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035999.1 protein_id gnl|my_center|LOCUS_06710 219571 218681 gene locus_tag LOCUS_06720 gene prmA 219571 218681 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_06720 220971 219622 gene locus_tag LOCUS_06730 gene accC 220971 219622 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884620.1 protein_id gnl|my_center|LOCUS_06730 221509 221057 gene locus_tag LOCUS_06740 gene accB 221509 221057 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354622.1 protein_id gnl|my_center|LOCUS_06740 221973 221512 gene locus_tag LOCUS_06750 gene aroQ 221973 221512 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_06750 222669 222106 gene locus_tag LOCUS_06760 222669 222106 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_06760 225095 222666 gene locus_tag LOCUS_06770 225095 222666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 225400 225074 gene locus_tag LOCUS_06780 225400 225074 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_06780 225961 226401 gene locus_tag LOCUS_06790 gene fxsA 225961 226401 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528723.1 protein_id gnl|my_center|LOCUS_06790 226950 227240 gene locus_tag LOCUS_06800 gene groES 226950 227240 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_06800 227317 228966 gene locus_tag LOCUS_06810 gene groL 227317 228966 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_06810 229808 229131 gene locus_tag LOCUS_06820 229808 229131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 230128 230400 gene locus_tag LOCUS_06830 230128 230400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 230397 230681 gene locus_tag LOCUS_06840 230397 230681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 230779 232032 gene locus_tag LOCUS_06850 230779 232032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 232029 233597 gene locus_tag LOCUS_06860 232029 233597 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_06860 235590 234016 gene locus_tag LOCUS_06870 235590 234016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 235779 236756 gene locus_tag LOCUS_06880 235779 236756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 237667 237134 gene locus_tag LOCUS_06890 237667 237134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 protein_id gnl|my_center|LOCUS_06890 238513 238268 gene locus_tag LOCUS_06900 238513 238268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 238412 238615 gene locus_tag LOCUS_06910 238412 238615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 239110 238844 gene locus_tag LOCUS_06920 239110 238844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 240326 239097 gene locus_tag LOCUS_06930 240326 239097 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_06930 247007 240501 gene locus_tag LOCUS_06940 247007 240501 CDS product autotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170100.1 protein_id gnl|my_center|LOCUS_06940 248434 247097 gene locus_tag LOCUS_06950 248434 247097 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_06950 249275 248577 gene locus_tag LOCUS_06960 249275 248577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 250258 249260 gene locus_tag LOCUS_06970 250258 249260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 250967 250503 gene locus_tag LOCUS_06980 250967 250503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 251285 250968 gene locus_tag LOCUS_06990 251285 250968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 253056 251242 gene locus_tag LOCUS_07000 253056 251242 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 protein_id gnl|my_center|LOCUS_07000 253594 254505 gene locus_tag LOCUS_07010 253594 254505 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707359.1 protein_id gnl|my_center|LOCUS_07010 254517 257405 gene locus_tag LOCUS_07020 gene glnE 254517 257405 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_07020 257486 258400 gene locus_tag LOCUS_07030 gene ilvE 257486 258400 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_07030 258523 258714 gene locus_tag LOCUS_07040 258523 258714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 258775 259869 gene locus_tag LOCUS_07050 gene pyrC 258775 259869 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_07050 260703 259969 gene locus_tag LOCUS_07060 260703 259969 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_07060 261672 260851 gene locus_tag LOCUS_07070 261672 260851 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067145.1 protein_id gnl|my_center|LOCUS_07070 261812 262447 gene locus_tag LOCUS_07080 gene rnt 261812 262447 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036706.1 protein_id gnl|my_center|LOCUS_07080 263035 262703 gene locus_tag LOCUS_07090 gene grxD 263035 262703 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017327.1 protein_id gnl|my_center|LOCUS_07090 264934 263150 gene locus_tag LOCUS_07100 264934 263150 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969278.1 protein_id gnl|my_center|LOCUS_07100 266555 264939 gene locus_tag LOCUS_07110 266555 264939 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_07110 266809 267390 gene locus_tag LOCUS_07120 gene sodB 266809 267390 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931119.1 protein_id gnl|my_center|LOCUS_07120 267499 268041 gene locus_tag LOCUS_07130 267499 268041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 268121 268309 gene locus_tag LOCUS_07140 268121 268309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 268685 268377 gene locus_tag LOCUS_07150 268685 268377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 269032 269334 gene locus_tag LOCUS_07160 269032 269334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07160 269301 270692 gene locus_tag LOCUS_07170 269301 270692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07170 270850 272184 gene locus_tag LOCUS_07180 270850 272184 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001540814.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07180 272218 272418 gene locus_tag LOCUS_07190 272218 272418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 272418 273569 gene locus_tag LOCUS_07200 272418 273569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 273655 274560 gene locus_tag LOCUS_07210 273655 274560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036226.1 protein_id gnl|my_center|LOCUS_07210 274563 275294 gene locus_tag LOCUS_07220 274563 275294 CDS product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036227.1 protein_id gnl|my_center|LOCUS_07220 275782 275531 gene locus_tag LOCUS_07230 275782 275531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 276964 275786 gene locus_tag LOCUS_07240 gene zigA 276964 275786 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099674.1 protein_id gnl|my_center|LOCUS_07240 277298 277690 gene locus_tag LOCUS_07250 gene gloA 277298 277690 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216418.1 protein_id gnl|my_center|LOCUS_07250 277831 278772 gene locus_tag LOCUS_07260 277831 278772 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925699.1 protein_id gnl|my_center|LOCUS_07260 279078 278875 gene locus_tag LOCUS_07270 279078 278875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 279107 280053 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgcaggcgcggggaacac 280444 280145 gene locus_tag LOCUS_07280 gene cas2e 280444 280145 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942042.1 protein_id gnl|my_center|LOCUS_07280 281336 280425 gene locus_tag LOCUS_07290 gene cas1e 281336 280425 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942041.1 protein_id gnl|my_center|LOCUS_07290 281610 281398 gene locus_tag LOCUS_07300 281610 281398 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_07300 281844 281623 gene locus_tag LOCUS_07310 281844 281623 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_07310 282428 281805 gene locus_tag LOCUS_07320 gene cas6e 282428 281805 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229112.1 protein_id gnl|my_center|LOCUS_07320 283065 282415 gene locus_tag LOCUS_07330 gene cas5e 283065 282415 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_07330 284210 283068 gene locus_tag LOCUS_07340 gene cas7e 284210 283068 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_07340 284781 284224 gene locus_tag LOCUS_07350 gene casB 284781 284224 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227613.1 protein_id gnl|my_center|LOCUS_07350 286343 284778 gene locus_tag LOCUS_07360 gene casA 286343 284778 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229116.1 protein_id gnl|my_center|LOCUS_07360 289027 286364 gene locus_tag LOCUS_07370 289027 286364 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229117.1 protein_id gnl|my_center|LOCUS_07370 289898 289461 gene locus_tag LOCUS_07380 289898 289461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 289928 290536 gene locus_tag LOCUS_07390 289928 290536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 291241 290663 gene locus_tag LOCUS_07400 291241 290663 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328180.1 protein_id gnl|my_center|LOCUS_07400 292062 291433 gene locus_tag LOCUS_07410 292062 291433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 292505 292921 gene locus_tag LOCUS_07420 292505 292921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 293010 294491 gene locus_tag LOCUS_07430 293010 294491 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265498.1 protein_id gnl|my_center|LOCUS_07430 295863 294532 gene locus_tag LOCUS_07440 295863 294532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 297542 296052 gene locus_tag LOCUS_07450 gene glgA 297542 296052 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262948.1 protein_id gnl|my_center|LOCUS_07450 300174 298336 gene locus_tag LOCUS_07460 300174 298336 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539133.1 protein_id gnl|my_center|LOCUS_07460 300722 300171 gene locus_tag LOCUS_07470 300722 300171 CDS product DUF2760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524145.1 protein_id gnl|my_center|LOCUS_07470 301042 301290 gene locus_tag LOCUS_07480 301042 301290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 301731 302273 gene locus_tag LOCUS_07490 gene msrA 301731 302273 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421586.1 protein_id gnl|my_center|LOCUS_07490 302327 303037 gene locus_tag LOCUS_07500 302327 303037 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 protein_id gnl|my_center|LOCUS_07500 303044 304183 gene locus_tag LOCUS_07510 gene tgt 303044 304183 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100607.1 protein_id gnl|my_center|LOCUS_07510 304684 305016 gene locus_tag LOCUS_07520 gene yajC 304684 305016 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 protein_id gnl|my_center|LOCUS_07520 305209 307065 gene locus_tag LOCUS_07530 gene secD 305209 307065 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 protein_id gnl|my_center|LOCUS_07530 307182 308135 gene locus_tag LOCUS_07540 gene secF 307182 308135 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 protein_id gnl|my_center|LOCUS_07540 308643 308233 gene locus_tag LOCUS_07550 gene rnk 308643 308233 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072033.1 protein_id gnl|my_center|LOCUS_07550 309784 308657 gene locus_tag LOCUS_07560 309784 308657 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880477.1 protein_id gnl|my_center|LOCUS_07560 310535 309903 gene locus_tag LOCUS_07570 310535 309903 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994095.1 protein_id gnl|my_center|LOCUS_07570 310534 311223 gene locus_tag LOCUS_07580 310534 311223 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_07580 311220 313766 gene locus_tag LOCUS_07590 311220 313766 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_07590 313819 314424 gene locus_tag LOCUS_07600 313819 314424 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483578.1 protein_id gnl|my_center|LOCUS_07600 314948 314751 gene locus_tag LOCUS_07610 314948 314751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 315420 316352 gene locus_tag LOCUS_07620 315420 316352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 316345 317673 gene locus_tag LOCUS_07630 316345 317673 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809081.1 protein_id gnl|my_center|LOCUS_07630 317727 319235 gene locus_tag LOCUS_07640 317727 319235 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112546.1 protein_id gnl|my_center|LOCUS_07640 319618 320091 gene locus_tag LOCUS_07650 gene soxY 319618 320091 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_07650 320145 320456 gene locus_tag LOCUS_07660 gene soxZ 320145 320456 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_07660 321608 320628 gene locus_tag LOCUS_07670 321608 320628 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_07670 321934 322314 gene locus_tag LOCUS_07680 321934 322314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 322886 322344 gene locus_tag LOCUS_07690 gene hscB 322886 322344 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098293.1 protein_id gnl|my_center|LOCUS_07690 323579 323097 gene locus_tag LOCUS_07700 gene iscR 323579 323097 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_07700 324522 323728 gene locus_tag LOCUS_07710 gene cysE 324522 323728 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_07710 325355 324549 gene locus_tag LOCUS_07720 gene trmJ 325355 324549 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705633.1 protein_id gnl|my_center|LOCUS_07720 325432 326232 gene locus_tag LOCUS_07730 325432 326232 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_07730 326382 326852 gene locus_tag LOCUS_07740 326382 326852 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197880.1 protein_id gnl|my_center|LOCUS_07740 326911 327435 gene locus_tag LOCUS_07750 326911 327435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 328471 327518 gene locus_tag LOCUS_07760 328471 327518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 328672 330123 gene locus_tag LOCUS_07770 328672 330123 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_07770 330120 331022 gene locus_tag LOCUS_07780 330120 331022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 331760 331191 gene locus_tag LOCUS_07790 331760 331191 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_07790 332849 332043 gene locus_tag LOCUS_07800 332849 332043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 336322 333017 gene locus_tag LOCUS_07810 336322 333017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 337537 337010 gene locus_tag LOCUS_07820 gene rfaH 337537 337010 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268290.1 protein_id gnl|my_center|LOCUS_07820 338547 337810 gene locus_tag LOCUS_07830 338547 337810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093325.1 protein_id gnl|my_center|LOCUS_07830 339229 338648 gene locus_tag LOCUS_07840 339229 338648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 339895 339449 gene locus_tag LOCUS_07850 339895 339449 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 protein_id gnl|my_center|LOCUS_07850 340769 339915 gene locus_tag LOCUS_07860 340769 339915 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_07860 341573 340773 gene locus_tag LOCUS_07870 341573 340773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933759.1 protein_id gnl|my_center|LOCUS_07870 342457 341573 gene locus_tag LOCUS_07880 342457 341573 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_07880 342952 343635 gene locus_tag LOCUS_07890 342952 343635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762167.1 protein_id gnl|my_center|LOCUS_07890 343806 344855 gene locus_tag LOCUS_07900 343806 344855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 344889 345275 gene locus_tag LOCUS_07910 344889 345275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 345374 345841 gene locus_tag LOCUS_07920 345374 345841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 345841 347022 gene locus_tag LOCUS_07930 345841 347022 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359221.1 protein_id gnl|my_center|LOCUS_07930 347138 347782 gene locus_tag LOCUS_07940 347138 347782 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229674.1 protein_id gnl|my_center|LOCUS_07940 347784 349124 gene locus_tag LOCUS_07950 347784 349124 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 protein_id gnl|my_center|LOCUS_07950 351020 349197 gene locus_tag LOCUS_07960 gene oadA 351020 349197 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269402.1 protein_id gnl|my_center|LOCUS_07960 352451 351033 gene locus_tag LOCUS_07970 352451 351033 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401293.1 protein_id gnl|my_center|LOCUS_07970 352683 353987 gene locus_tag LOCUS_07980 352683 353987 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072557.1 protein_id gnl|my_center|LOCUS_07980 354624 353941 gene locus_tag LOCUS_07990 354624 353941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 356695 354671 gene locus_tag LOCUS_08000 356695 354671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 357411 356863 gene locus_tag LOCUS_08010 357411 356863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 357973 358722 gene locus_tag LOCUS_08020 gene surE 357973 358722 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036883.1 protein_id gnl|my_center|LOCUS_08020 358701 359384 gene locus_tag LOCUS_08030 358701 359384 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence003 2916 1834 gene locus_tag LOCUS_08040 gene asd 2916 1834 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244780.1 protein_id gnl|my_center|LOCUS_08040 4128 3055 gene locus_tag LOCUS_08050 gene leuB 4128 3055 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038427.1 protein_id gnl|my_center|LOCUS_08050 4827 4177 gene locus_tag LOCUS_08060 gene leuD 4827 4177 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_08060 6232 4829 gene locus_tag LOCUS_08070 gene leuC 6232 4829 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_08070 8513 6348 gene locus_tag LOCUS_08080 8513 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 8415 8741 gene locus_tag LOCUS_08090 8415 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 9098 11965 gene locus_tag LOCUS_08100 9098 11965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 14141 12156 gene locus_tag LOCUS_08110 14141 12156 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887578.1 protein_id gnl|my_center|LOCUS_08110 14400 15344 gene locus_tag LOCUS_08120 14400 15344 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584138.1 protein_id gnl|my_center|LOCUS_08120 17695 15419 gene locus_tag LOCUS_08130 17695 15419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 18629 17712 gene locus_tag LOCUS_08140 18629 17712 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480130.1 protein_id gnl|my_center|LOCUS_08140 18924 18640 gene locus_tag LOCUS_08150 18924 18640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 21786 18997 gene locus_tag LOCUS_08160 21786 18997 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090068.1 protein_id gnl|my_center|LOCUS_08160 22618 24114 gene locus_tag LOCUS_08170 22618 24114 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083115.1 protein_id gnl|my_center|LOCUS_08170 24111 25121 gene locus_tag LOCUS_08180 gene cydB 24111 25121 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083114.1 protein_id gnl|my_center|LOCUS_08180 25165 25992 gene locus_tag LOCUS_08190 25165 25992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 26233 26796 gene locus_tag LOCUS_08200 26233 26796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 28189 26912 gene locus_tag LOCUS_08210 gene aaxA 28189 26912 CDS product porin AaxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883666.1 protein_id gnl|my_center|LOCUS_08210 29185 28247 gene locus_tag LOCUS_08220 29185 28247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020564.1 protein_id gnl|my_center|LOCUS_08220 30641 29412 gene locus_tag LOCUS_08230 30641 29412 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390206.1 protein_id gnl|my_center|LOCUS_08230 33295 30719 gene locus_tag LOCUS_08240 33295 30719 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496762.1 protein_id gnl|my_center|LOCUS_08240 34405 33449 gene locus_tag LOCUS_08250 34405 33449 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118674.1 protein_id gnl|my_center|LOCUS_08250 36097 34562 gene locus_tag LOCUS_08260 gene gadC 36097 34562 CDS product acid resistance gamma-aminobutyrate antiporter GadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246011.1 protein_id gnl|my_center|LOCUS_08260 37705 36272 gene locus_tag LOCUS_08270 37705 36272 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 protein_id gnl|my_center|LOCUS_08270 38248 39378 gene locus_tag LOCUS_08280 38248 39378 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077380485.1 protein_id gnl|my_center|LOCUS_08280 39559 41247 gene locus_tag LOCUS_08290 gene aspT 39559 41247 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965960.1 protein_id gnl|my_center|LOCUS_08290 42068 41412 gene locus_tag LOCUS_08300 42068 41412 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085490.1 protein_id gnl|my_center|LOCUS_08300 43379 42267 gene locus_tag LOCUS_08310 43379 42267 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976508.1 protein_id gnl|my_center|LOCUS_08310 45458 43395 gene locus_tag LOCUS_08320 45458 43395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 46277 45477 gene locus_tag LOCUS_08330 46277 45477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 46685 46491 gene locus_tag LOCUS_08340 46685 46491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 48412 47018 gene locus_tag LOCUS_08350 48412 47018 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815181.1 protein_id gnl|my_center|LOCUS_08350 50231 48699 gene locus_tag LOCUS_08360 50231 48699 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214220.1 protein_id gnl|my_center|LOCUS_08360 52171 50228 gene locus_tag LOCUS_08370 52171 50228 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050273.1 protein_id gnl|my_center|LOCUS_08370 53204 52137 gene locus_tag LOCUS_08380 gene mdtN 53204 52137 CDS product multidrug transporter subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817122.1 protein_id gnl|my_center|LOCUS_08380 53411 53208 gene locus_tag LOCUS_08390 53411 53208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 53972 53694 gene locus_tag LOCUS_08400 53972 53694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 54238 53969 gene locus_tag LOCUS_08410 54238 53969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 54986 54774 gene locus_tag LOCUS_08420 54986 54774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 57644 55386 gene locus_tag LOCUS_08430 57644 55386 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166873.1 protein_id gnl|my_center|LOCUS_08430 58228 59598 gene locus_tag LOCUS_08440 58228 59598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 61905 59938 gene locus_tag LOCUS_08450 61905 59938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 63415 61856 gene locus_tag LOCUS_08460 63415 61856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 64099 63575 gene locus_tag LOCUS_08470 64099 63575 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971655.1 protein_id gnl|my_center|LOCUS_08470 65079 64096 gene locus_tag LOCUS_08480 65079 64096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 65702 64986 gene locus_tag LOCUS_08490 65702 64986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 66868 65699 gene locus_tag LOCUS_08500 66868 65699 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_08500 70329 66865 gene locus_tag LOCUS_08510 70329 66865 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065207.1 protein_id gnl|my_center|LOCUS_08510 70664 70326 gene locus_tag LOCUS_08520 70664 70326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 71007 70681 gene locus_tag LOCUS_08530 71007 70681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 71199 71366 gene locus_tag LOCUS_08540 71199 71366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 71695 71345 gene locus_tag LOCUS_08550 71695 71345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 71926 71720 gene locus_tag LOCUS_08560 71926 71720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08560 72256 72017 gene locus_tag LOCUS_08570 72256 72017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08570 72695 72399 gene locus_tag LOCUS_08580 72695 72399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 73094 72786 gene locus_tag LOCUS_08590 73094 72786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 73314 74981 gene locus_tag LOCUS_08600 73314 74981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08600 74981 75256 gene locus_tag LOCUS_08610 74981 75256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 75260 75670 gene locus_tag LOCUS_08620 75260 75670 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_08620 75791 77311 gene locus_tag LOCUS_08630 75791 77311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200386714.1 protein_id gnl|my_center|LOCUS_08630 77308 78417 gene locus_tag LOCUS_08640 77308 78417 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_08640 78414 79016 gene locus_tag LOCUS_08650 78414 79016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 78946 79650 gene locus_tag LOCUS_08660 78946 79650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 79682 81919 gene locus_tag LOCUS_08670 79682 81919 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_08670 82556 83659 gene locus_tag LOCUS_08680 82556 83659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 83659 84600 gene locus_tag LOCUS_08690 83659 84600 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162620950.1 protein_id gnl|my_center|LOCUS_08690 84600 85670 gene locus_tag LOCUS_08700 84600 85670 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573583.1 protein_id gnl|my_center|LOCUS_08700 85667 86698 gene locus_tag LOCUS_08710 85667 86698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 86695 87525 gene locus_tag LOCUS_08720 86695 87525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 88542 88198 gene locus_tag LOCUS_08730 88542 88198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 89126 88542 gene locus_tag LOCUS_08740 89126 88542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 92134 89129 gene locus_tag LOCUS_08750 92134 89129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 92263 92634 gene locus_tag LOCUS_08760 92263 92634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 92823 92733 gene locus_tag LOCUS_t00110 92823 92733 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 93155 92943 gene locus_tag LOCUS_08770 gene csrA 93155 92943 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209449.1 protein_id gnl|my_center|LOCUS_08770 94650 93409 gene locus_tag LOCUS_08780 94650 93409 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 protein_id gnl|my_center|LOCUS_08780 97392 94786 gene locus_tag LOCUS_08790 gene alaS 97392 94786 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 protein_id gnl|my_center|LOCUS_08790 97882 97427 gene locus_tag LOCUS_08800 gene recX 97882 97427 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766020.1 protein_id gnl|my_center|LOCUS_08800 98974 97937 gene locus_tag LOCUS_08810 gene recA 98974 97937 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_08810 99779 99270 gene locus_tag LOCUS_08820 99779 99270 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945236.1 protein_id gnl|my_center|LOCUS_08820 99945 100226 gene locus_tag LOCUS_08830 99945 100226 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125708.1 protein_id gnl|my_center|LOCUS_08830 100369 100863 gene locus_tag LOCUS_08840 100369 100863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 101334 100924 gene locus_tag LOCUS_08850 101334 100924 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346198.1 protein_id gnl|my_center|LOCUS_08850 101469 102941 gene locus_tag LOCUS_08860 101469 102941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 104607 103069 gene locus_tag LOCUS_08870 gene lysS 104607 103069 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 protein_id gnl|my_center|LOCUS_08870 105700 104636 gene locus_tag LOCUS_08880 gene prfB 105700 104636 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990626.1 protein_id gnl|my_center|LOCUS_08880 105965 106717 gene locus_tag LOCUS_08890 105965 106717 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_08890 106714 107106 gene locus_tag LOCUS_08900 106714 107106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 107233 107520 gene locus_tag LOCUS_08910 107233 107520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 107533 108171 gene locus_tag LOCUS_08920 107533 108171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 108265 109134 gene locus_tag LOCUS_08930 108265 109134 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 protein_id gnl|my_center|LOCUS_08930 110739 109297 gene locus_tag LOCUS_08940 110739 109297 CDS product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881379.1 protein_id gnl|my_center|LOCUS_08940 112247 111093 gene locus_tag LOCUS_08950 112247 111093 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 protein_id gnl|my_center|LOCUS_08950 113764 112487 gene locus_tag LOCUS_08960 113764 112487 CDS product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 protein_id gnl|my_center|LOCUS_08960 114123 114977 gene locus_tag LOCUS_08970 114123 114977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 116269 115082 gene locus_tag LOCUS_08980 gene sat 116269 115082 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_08980 116560 116835 gene locus_tag LOCUS_08990 116560 116835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 117690 116929 gene locus_tag LOCUS_09000 117690 116929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 118161 118688 gene locus_tag LOCUS_09010 118161 118688 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195150.1 protein_id gnl|my_center|LOCUS_09010 120539 118716 gene locus_tag LOCUS_09020 120539 118716 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228742.1 protein_id gnl|my_center|LOCUS_09020 120663 121715 gene locus_tag LOCUS_09030 120663 121715 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114180.1 protein_id gnl|my_center|LOCUS_09030 121934 123397 gene locus_tag LOCUS_09040 121934 123397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 123457 124194 gene locus_tag LOCUS_09050 123457 124194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 124333 125328 gene locus_tag LOCUS_09060 124333 125328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 125791 125438 gene locus_tag LOCUS_09070 125791 125438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 128546 125877 gene locus_tag LOCUS_09080 128546 125877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 129306 128854 gene locus_tag LOCUS_09090 129306 128854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 129712 130947 gene locus_tag LOCUS_09100 129712 130947 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031728.1 protein_id gnl|my_center|LOCUS_09100 131742 130975 gene locus_tag LOCUS_09110 131742 130975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 132421 131750 gene locus_tag LOCUS_09120 132421 131750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_09120 134652 132637 gene locus_tag LOCUS_09130 134652 132637 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_09130 135428 134649 gene locus_tag LOCUS_09140 135428 134649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 137797 135425 gene locus_tag LOCUS_09150 gene mrcB 137797 135425 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_09150 139093 138305 gene locus_tag LOCUS_09160 139093 138305 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 protein_id gnl|my_center|LOCUS_09160 140088 139090 gene locus_tag LOCUS_09170 140088 139090 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_09170 140174 140935 gene locus_tag LOCUS_09180 140174 140935 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706235.1 protein_id gnl|my_center|LOCUS_09180 141602 141027 gene locus_tag LOCUS_09190 141602 141027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 141762 142550 gene locus_tag LOCUS_09200 gene cbiQ 141762 142550 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626426.1 protein_id gnl|my_center|LOCUS_09200 142534 143256 gene locus_tag LOCUS_09210 142534 143256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626425.1 protein_id gnl|my_center|LOCUS_09210 143435 143860 gene locus_tag LOCUS_09220 143435 143860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 144068 144817 gene locus_tag LOCUS_09230 144068 144817 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206673.1 protein_id gnl|my_center|LOCUS_09230 145016 146137 gene locus_tag LOCUS_09240 145016 146137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 146148 146489 gene locus_tag LOCUS_09250 146148 146489 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037899.1 protein_id gnl|my_center|LOCUS_09250 147336 146545 gene locus_tag LOCUS_09260 147336 146545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 147834 147376 gene locus_tag LOCUS_09270 147834 147376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 148830 147886 gene locus_tag LOCUS_09280 148830 147886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 148714 148950 gene locus_tag LOCUS_09290 148714 148950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 150410 148968 gene locus_tag LOCUS_09300 gene mgtE 150410 148968 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085996.1 protein_id gnl|my_center|LOCUS_09300 151546 150590 gene locus_tag LOCUS_09310 151546 150590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 154215 151543 gene locus_tag LOCUS_09320 154215 151543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 154448 154212 gene locus_tag LOCUS_09330 154448 154212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 154925 154850 gene locus_tag LOCUS_t00120 154925 154850 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 155072 154997 gene locus_tag LOCUS_t00130 155072 154997 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 155213 155137 gene locus_tag LOCUS_t00140 155213 155137 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 155347 155271 gene locus_tag LOCUS_t00150 155347 155271 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 155541 156395 gene locus_tag LOCUS_09340 gene folD 155541 156395 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087898.1 protein_id gnl|my_center|LOCUS_09340 157271 156435 gene locus_tag LOCUS_09350 157271 156435 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390532.1 protein_id gnl|my_center|LOCUS_09350 159045 157273 gene locus_tag LOCUS_09360 159045 157273 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390531.1 protein_id gnl|my_center|LOCUS_09360 159357 160505 gene locus_tag LOCUS_09370 gene nifV 159357 160505 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_09370 160555 160899 gene locus_tag LOCUS_09380 160555 160899 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389923.1 protein_id gnl|my_center|LOCUS_09380 160883 161356 gene locus_tag LOCUS_09390 160883 161356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 161353 162234 gene locus_tag LOCUS_09400 161353 162234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 162908 162462 gene locus_tag LOCUS_09410 162908 162462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 164729 163164 gene locus_tag LOCUS_09420 164729 163164 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338253.1 protein_id gnl|my_center|LOCUS_09420 164967 164785 gene locus_tag LOCUS_09430 164967 164785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 164970 165197 gene locus_tag LOCUS_09440 164970 165197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 165314 165865 gene locus_tag LOCUS_09450 165314 165865 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036208.1 protein_id gnl|my_center|LOCUS_09450 165908 166462 gene locus_tag LOCUS_09460 165908 166462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 169245 166459 gene locus_tag LOCUS_09470 gene rapA 169245 166459 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117038.1 protein_id gnl|my_center|LOCUS_09470 169551 169285 gene locus_tag LOCUS_09480 169551 169285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 171469 170384 gene locus_tag LOCUS_09490 gene alr 171469 170384 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403944.1 protein_id gnl|my_center|LOCUS_09490 174139 171674 gene locus_tag LOCUS_09500 gene hypF 174139 171674 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338264.1 protein_id gnl|my_center|LOCUS_09500 174286 175152 gene locus_tag LOCUS_09510 174286 175152 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_09510 179195 175221 gene locus_tag LOCUS_09520 gene hrpA 179195 175221 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214608.1 protein_id gnl|my_center|LOCUS_09520 181431 179413 gene locus_tag LOCUS_09530 181431 179413 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275209.1 protein_id gnl|my_center|LOCUS_09530 182578 181574 gene locus_tag LOCUS_09540 182578 181574 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_09540 183413 182733 gene locus_tag LOCUS_09550 183413 182733 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_09550 184441 183410 gene locus_tag LOCUS_09560 gene rluC 184441 183410 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619727.1 protein_id gnl|my_center|LOCUS_09560 185090 188305 gene locus_tag LOCUS_09570 gene rne 185090 188305 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895645.1 protein_id gnl|my_center|LOCUS_09570 188951 188403 gene locus_tag LOCUS_09580 188951 188403 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_09580 189330 190766 gene locus_tag LOCUS_09590 189330 190766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 190798 192966 gene locus_tag LOCUS_09600 190798 192966 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 protein_id gnl|my_center|LOCUS_09600 192975 193832 gene locus_tag LOCUS_09610 192975 193832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 193872 194774 gene locus_tag LOCUS_09620 193872 194774 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_09620 194855 196867 gene locus_tag LOCUS_09630 194855 196867 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616027.1 protein_id gnl|my_center|LOCUS_09630 196889 197857 gene locus_tag LOCUS_09640 196889 197857 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119289.1 protein_id gnl|my_center|LOCUS_09640 198726 197944 gene locus_tag LOCUS_09650 198726 197944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 204335 198780 gene locus_tag LOCUS_09660 204335 198780 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391582.1 protein_id gnl|my_center|LOCUS_09660 205081 204494 gene locus_tag LOCUS_09670 205081 204494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480904.1 protein_id gnl|my_center|LOCUS_09670 205292 205939 gene locus_tag LOCUS_09680 205292 205939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 206684 206262 gene locus_tag LOCUS_09690 206684 206262 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939272.1 protein_id gnl|my_center|LOCUS_09690 207394 206864 gene locus_tag LOCUS_09700 207394 206864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 209177 207456 gene locus_tag LOCUS_09710 gene cydC 209177 207456 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974886.1 protein_id gnl|my_center|LOCUS_09710 211003 209174 gene locus_tag LOCUS_09720 gene cydD 211003 209174 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941872.1 protein_id gnl|my_center|LOCUS_09720 211758 211213 gene locus_tag LOCUS_09730 211758 211213 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039192.1 protein_id gnl|my_center|LOCUS_09730 212474 211755 gene locus_tag LOCUS_09740 212474 211755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 213274 212471 gene locus_tag LOCUS_09750 213274 212471 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_09750 213896 213267 gene locus_tag LOCUS_09760 213896 213267 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942967.1 protein_id gnl|my_center|LOCUS_09760 214196 214870 gene locus_tag LOCUS_09770 214196 214870 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330705.1 protein_id gnl|my_center|LOCUS_09770 215362 215051 gene locus_tag LOCUS_09780 gene fdxB 215362 215051 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_09780 215783 215550 gene locus_tag LOCUS_09790 215783 215550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 216424 215951 gene locus_tag LOCUS_09800 216424 215951 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 protein_id gnl|my_center|LOCUS_09800 216888 216421 gene locus_tag LOCUS_09810 216888 216421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 217373 216885 gene locus_tag LOCUS_09820 217373 216885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 218953 217547 gene locus_tag LOCUS_09830 gene nifN 218953 217547 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084555.1 protein_id gnl|my_center|LOCUS_09830 220406 218946 gene locus_tag LOCUS_09840 gene nifE 220406 218946 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 protein_id gnl|my_center|LOCUS_09840 221662 220760 gene locus_tag LOCUS_09850 221662 220760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 222998 221667 gene locus_tag LOCUS_09860 222998 221667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 223703 223050 gene locus_tag LOCUS_09870 223703 223050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 224959 223799 gene locus_tag LOCUS_09880 224959 223799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 225648 224911 gene locus_tag LOCUS_09890 gene ftsE 225648 224911 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763638.1 protein_id gnl|my_center|LOCUS_09890 226597 225797 gene locus_tag LOCUS_09900 226597 225797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 227039 227308 gene locus_tag LOCUS_09910 227039 227308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 228908 227484 gene locus_tag LOCUS_09920 228908 227484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 229826 229272 gene locus_tag LOCUS_09930 229826 229272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 230897 232126 gene locus_tag LOCUS_09940 230897 232126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 234333 232762 gene locus_tag LOCUS_09950 234333 232762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 234948 235949 gene locus_tag LOCUS_09960 234948 235949 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_09960 235933 237768 gene locus_tag LOCUS_09970 235933 237768 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389545.1 protein_id gnl|my_center|LOCUS_09970 237779 238894 gene locus_tag LOCUS_09980 237779 238894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 238907 240028 gene locus_tag LOCUS_09990 238907 240028 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_09990 240193 243051 gene locus_tag LOCUS_10000 240193 243051 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103493.1 protein_id gnl|my_center|LOCUS_10000 243076 243699 gene locus_tag LOCUS_10010 243076 243699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 243835 244101 gene locus_tag LOCUS_10020 243835 244101 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_10020 244098 244496 gene locus_tag LOCUS_10030 244098 244496 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_10030 244493 244675 gene locus_tag LOCUS_10040 244493 244675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10040 244715 244909 gene locus_tag LOCUS_10050 244715 244909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10050 245455 245751 gene locus_tag LOCUS_10060 245455 245751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 246357 245854 gene locus_tag LOCUS_10070 246357 245854 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258364.1 protein_id gnl|my_center|LOCUS_10070 246489 247604 gene locus_tag LOCUS_10080 246489 247604 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930782.1 protein_id gnl|my_center|LOCUS_10080 247637 249811 gene locus_tag LOCUS_10090 247637 249811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 249924 250415 gene locus_tag LOCUS_10100 249924 250415 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109277682.1 protein_id gnl|my_center|LOCUS_10100 250523 250996 gene locus_tag LOCUS_10110 250523 250996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 255465 251083 gene locus_tag LOCUS_10120 255465 251083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 255824 256519 gene locus_tag LOCUS_10130 255824 256519 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025631.1 protein_id gnl|my_center|LOCUS_10130 256536 258212 gene locus_tag LOCUS_10140 256536 258212 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399950.1 protein_id gnl|my_center|LOCUS_10140 259412 258294 gene locus_tag LOCUS_10150 259412 258294 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_10150 261499 259613 gene locus_tag LOCUS_10160 gene parE 261499 259613 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195318.1 protein_id gnl|my_center|LOCUS_10160 263274 261775 gene locus_tag LOCUS_10170 263274 261775 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529087.1 protein_id gnl|my_center|LOCUS_10170 263605 264444 gene locus_tag LOCUS_10180 263605 264444 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_10180 264664 265107 gene locus_tag LOCUS_10190 264664 265107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 265263 265349 gene locus_tag LOCUS_t00160 265263 265349 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 268602 265459 gene locus_tag LOCUS_10200 268602 265459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 269705 271876 gene locus_tag LOCUS_10210 269705 271876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 272091 271927 gene locus_tag LOCUS_10220 272091 271927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 274172 272331 gene locus_tag LOCUS_10230 274172 272331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 274451 274176 gene locus_tag LOCUS_10240 274451 274176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 274756 274448 gene locus_tag LOCUS_10250 274756 274448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 274949 274761 gene locus_tag LOCUS_10260 274949 274761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10260 275474 274980 gene locus_tag LOCUS_10270 275474 274980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10270 275669 275511 gene locus_tag LOCUS_10280 275669 275511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 276129 275869 gene locus_tag LOCUS_10290 276129 275869 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766946.1 protein_id gnl|my_center|LOCUS_10290 276395 276150 gene locus_tag LOCUS_10300 276395 276150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 277695 276670 gene locus_tag LOCUS_10310 277695 276670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence004 570 352 gene locus_tag LOCUS_10320 570 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1834 1004 gene locus_tag LOCUS_10330 1834 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 3628 1922 gene locus_tag LOCUS_10340 3628 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3783 4286 gene locus_tag LOCUS_10350 3783 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 6096 5257 gene locus_tag LOCUS_10360 6096 5257 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217633758.1 protein_id gnl|my_center|LOCUS_10360 6919 6203 gene locus_tag LOCUS_10370 6919 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355475.1 protein_id gnl|my_center|LOCUS_10370 7167 7799 gene locus_tag LOCUS_10380 7167 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10380 7963 9081 gene locus_tag LOCUS_10390 7963 9081 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118153.1 protein_id gnl|my_center|LOCUS_10390 9575 9375 gene locus_tag LOCUS_10400 9575 9375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 9925 9572 gene locus_tag LOCUS_10410 9925 9572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 9953 10747 gene locus_tag LOCUS_10420 9953 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 11114 11995 gene locus_tag LOCUS_10430 11114 11995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 12079 12426 gene locus_tag LOCUS_10440 12079 12426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 12479 14488 gene locus_tag LOCUS_10450 12479 14488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 14570 14785 gene locus_tag LOCUS_10460 14570 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 15100 17157 gene locus_tag LOCUS_10470 gene metG 15100 17157 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113898.1 protein_id gnl|my_center|LOCUS_10470 17417 17998 gene locus_tag LOCUS_10480 gene rsxA 17417 17998 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380762.1 protein_id gnl|my_center|LOCUS_10480 18012 18584 gene locus_tag LOCUS_10490 gene rsxB 18012 18584 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103780.1 protein_id gnl|my_center|LOCUS_10490 18600 20201 gene locus_tag LOCUS_10500 18600 20201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 20298 21284 gene locus_tag LOCUS_10510 gene rsxD 20298 21284 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231916.1 protein_id gnl|my_center|LOCUS_10510 21281 21928 gene locus_tag LOCUS_10520 gene rsxG 21281 21928 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_10520 21928 22647 gene locus_tag LOCUS_10530 21928 22647 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480817.1 protein_id gnl|my_center|LOCUS_10530 24756 22684 gene locus_tag LOCUS_10540 24756 22684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 24993 25883 gene locus_tag LOCUS_10550 24993 25883 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_10550 25946 26704 gene locus_tag LOCUS_10560 gene rlmJ 25946 26704 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707316.1 protein_id gnl|my_center|LOCUS_10560 27583 26774 gene locus_tag LOCUS_10570 27583 26774 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_10570 28123 27653 gene locus_tag LOCUS_10580 gene ybeY 28123 27653 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367715.1 protein_id gnl|my_center|LOCUS_10580 29167 28151 gene locus_tag LOCUS_10590 29167 28151 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_10590 30537 29164 gene locus_tag LOCUS_10600 gene miaB 30537 29164 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037471.1 protein_id gnl|my_center|LOCUS_10600 31052 33091 gene locus_tag LOCUS_10610 31052 33091 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 protein_id gnl|my_center|LOCUS_10610 33158 33349 gene locus_tag LOCUS_10620 33158 33349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 33454 34143 gene locus_tag LOCUS_10630 33454 34143 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114930.1 protein_id gnl|my_center|LOCUS_10630 34244 35080 gene locus_tag LOCUS_10640 34244 35080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 35177 37660 gene locus_tag LOCUS_10650 35177 37660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_10650 38002 37718 gene locus_tag LOCUS_10660 38002 37718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 38289 40499 gene locus_tag LOCUS_10670 gene plpD 38289 40499 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_10670 40945 40592 gene locus_tag LOCUS_10680 40945 40592 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070872.1 protein_id gnl|my_center|LOCUS_10680 41124 43700 gene locus_tag LOCUS_10690 gene mutS 41124 43700 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_10690 44561 43761 gene locus_tag LOCUS_10700 44561 43761 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174155.1 protein_id gnl|my_center|LOCUS_10700 45359 44625 gene locus_tag LOCUS_10710 45359 44625 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_10710 45870 45367 gene locus_tag LOCUS_10720 45870 45367 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038715.1 protein_id gnl|my_center|LOCUS_10720 46836 45943 gene locus_tag LOCUS_10730 gene xerD 46836 45943 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266933.1 protein_id gnl|my_center|LOCUS_10730 47318 46836 gene locus_tag LOCUS_10740 47318 46836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 47825 48283 gene locus_tag LOCUS_10750 47825 48283 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530173.1 protein_id gnl|my_center|LOCUS_10750 49628 48255 gene locus_tag LOCUS_10760 gene yegQ 49628 48255 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105560.1 protein_id gnl|my_center|LOCUS_10760 50707 49625 gene locus_tag LOCUS_10770 50707 49625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 51130 53160 gene locus_tag LOCUS_10780 51130 53160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 54321 53308 gene locus_tag LOCUS_10790 gene sohB 54321 53308 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210624.1 protein_id gnl|my_center|LOCUS_10790 55275 54436 gene locus_tag LOCUS_10800 55275 54436 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776901.1 protein_id gnl|my_center|LOCUS_10800 56829 55279 gene locus_tag LOCUS_10810 gene gpmI 56829 55279 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_10810 57548 58807 gene locus_tag LOCUS_10820 gene glgC 57548 58807 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544940.1 protein_id gnl|my_center|LOCUS_10820 58823 59707 gene locus_tag LOCUS_10830 58823 59707 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_10830 60881 59763 gene locus_tag LOCUS_10840 60881 59763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 61202 60888 gene locus_tag LOCUS_10850 61202 60888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 62663 61272 gene locus_tag LOCUS_10860 gene cobB 62663 61272 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_10860 64018 62768 gene locus_tag LOCUS_10870 gene hmeB 64018 62768 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_10870 64765 64040 gene locus_tag LOCUS_10880 gene hmeA 64765 64040 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_10880 65313 64840 gene locus_tag LOCUS_10890 65313 64840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 67295 65331 gene locus_tag LOCUS_10900 67295 65331 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932535.1 protein_id gnl|my_center|LOCUS_10900 68976 67444 gene locus_tag LOCUS_10910 68976 67444 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_10910 69740 69009 gene locus_tag LOCUS_10920 gene dsrM 69740 69009 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878008.1 protein_id gnl|my_center|LOCUS_10920 70154 69816 gene locus_tag LOCUS_10930 70154 69816 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_10930 70491 70183 gene locus_tag LOCUS_10940 gene tusB 70491 70183 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_10940 70910 70500 gene locus_tag LOCUS_10950 70910 70500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 71315 70923 gene locus_tag LOCUS_10960 gene tusD 71315 70923 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209692.1 protein_id gnl|my_center|LOCUS_10960 72441 71371 gene locus_tag LOCUS_10970 gene dsrB 72441 71371 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_10970 73829 72576 gene locus_tag LOCUS_10980 gene dsrA 73829 72576 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_10980 74313 75278 gene locus_tag LOCUS_10990 74313 75278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 75425 75616 gene locus_tag LOCUS_11000 75425 75616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 75639 76367 gene locus_tag LOCUS_11010 75639 76367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 76387 77088 gene locus_tag LOCUS_11020 76387 77088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 77337 77675 gene locus_tag LOCUS_11030 77337 77675 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932532.1 protein_id gnl|my_center|LOCUS_11030 78593 77787 gene locus_tag LOCUS_11040 78593 77787 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679851.1 protein_id gnl|my_center|LOCUS_11040 79051 78623 gene locus_tag LOCUS_11050 79051 78623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 79260 79523 gene locus_tag LOCUS_11060 79260 79523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 79510 82044 gene locus_tag LOCUS_11070 79510 82044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 82055 82360 gene locus_tag LOCUS_11080 82055 82360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 82457 83668 gene locus_tag LOCUS_11090 82457 83668 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546257.1 protein_id gnl|my_center|LOCUS_11090 84426 84061 gene locus_tag LOCUS_11100 gene tnpA 84426 84061 CDS product IS200/IS605-like element IS609 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604912.1 protein_id gnl|my_center|LOCUS_11100 84530 85696 gene locus_tag LOCUS_11110 84530 85696 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826423.1 protein_id gnl|my_center|LOCUS_11110 86772 87419 gene locus_tag LOCUS_11120 gene afsQ1 86772 87419 CDS product two-component system response regulator AfsQ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974066.1 protein_id gnl|my_center|LOCUS_11120 87641 88810 gene locus_tag LOCUS_11130 87641 88810 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037833.1 protein_id gnl|my_center|LOCUS_11130 88821 94736 gene locus_tag LOCUS_11140 88821 94736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 96228 95110 gene locus_tag LOCUS_11150 96228 95110 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545765.1 protein_id gnl|my_center|LOCUS_11150 96586 98070 gene locus_tag LOCUS_11160 96586 98070 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086915.1 protein_id gnl|my_center|LOCUS_11160 98236 98424 gene locus_tag LOCUS_11170 98236 98424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 99100 98489 gene locus_tag LOCUS_11180 99100 98489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626606.1 protein_id gnl|my_center|LOCUS_11180 99984 99199 gene locus_tag LOCUS_11190 99984 99199 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391248.1 protein_id gnl|my_center|LOCUS_11190 100338 100613 gene locus_tag LOCUS_11200 100338 100613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 100694 102334 gene locus_tag LOCUS_11210 100694 102334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 102430 102777 gene locus_tag LOCUS_11220 102430 102777 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_11220 102893 103297 gene locus_tag LOCUS_11230 102893 103297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 105064 103637 gene locus_tag LOCUS_11240 105064 103637 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388376.1 protein_id gnl|my_center|LOCUS_11240 105779 105621 gene locus_tag LOCUS_11250 105779 105621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 105947 105807 gene locus_tag LOCUS_11260 105947 105807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 106218 106024 gene locus_tag LOCUS_11270 106218 106024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 106374 106231 gene locus_tag LOCUS_11280 106374 106231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 107514 107356 gene locus_tag LOCUS_11290 107514 107356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 107682 107542 gene locus_tag LOCUS_11300 107682 107542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 107953 107759 gene locus_tag LOCUS_11310 107953 107759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 108109 107966 gene locus_tag LOCUS_11320 108109 107966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 109333 108860 gene locus_tag LOCUS_11330 109333 108860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 110009 109542 gene locus_tag LOCUS_11340 gene bfr 110009 109542 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614296.1 protein_id gnl|my_center|LOCUS_11340 110532 110068 gene locus_tag LOCUS_11350 gene bfr 110532 110068 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554851.1 protein_id gnl|my_center|LOCUS_11350 110870 111169 gene locus_tag LOCUS_11360 110870 111169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 112485 111412 gene locus_tag LOCUS_11370 112485 111412 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389542.1 protein_id gnl|my_center|LOCUS_11370 112910 115564 gene locus_tag LOCUS_11380 gene ndvB 112910 115564 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_11380 115863 116258 gene locus_tag LOCUS_11390 115863 116258 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105017.1 protein_id gnl|my_center|LOCUS_11390 117358 116333 gene locus_tag LOCUS_11400 117358 116333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_11400 118268 117387 gene locus_tag LOCUS_11410 118268 117387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705176.1 protein_id gnl|my_center|LOCUS_11410 118502 119392 gene locus_tag LOCUS_11420 118502 119392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 119733 120389 gene locus_tag LOCUS_11430 119733 120389 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 protein_id gnl|my_center|LOCUS_11430 120409 123033 gene locus_tag LOCUS_11440 120409 123033 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_11440 124504 123155 gene locus_tag LOCUS_11450 gene gdhA 124504 123155 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941959.1 protein_id gnl|my_center|LOCUS_11450 126081 124768 gene locus_tag LOCUS_11460 126081 124768 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552292.1 protein_id gnl|my_center|LOCUS_11460 127526 126084 gene locus_tag LOCUS_11470 127526 126084 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187957.1 protein_id gnl|my_center|LOCUS_11470 129008 127626 gene locus_tag LOCUS_11480 129008 127626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 130990 129005 gene locus_tag LOCUS_11490 gene dxs 130990 129005 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102816.1 protein_id gnl|my_center|LOCUS_11490 132511 131213 gene locus_tag LOCUS_11500 132511 131213 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644929.1 protein_id gnl|my_center|LOCUS_11500 132705 133118 gene locus_tag LOCUS_11510 132705 133118 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945967.1 protein_id gnl|my_center|LOCUS_11510 134610 133192 gene locus_tag LOCUS_11520 gene mucD 134610 133192 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_11520 135140 134676 gene locus_tag LOCUS_11530 135140 134676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 136121 135156 gene locus_tag LOCUS_11540 136121 135156 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144922.1 protein_id gnl|my_center|LOCUS_11540 136683 136105 gene locus_tag LOCUS_11550 136683 136105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 137439 136861 gene locus_tag LOCUS_11560 gene rpoE 137439 136861 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_11560 137713 139356 gene locus_tag LOCUS_11570 gene nadB 137713 139356 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114182.1 protein_id gnl|my_center|LOCUS_11570 139625 142000 gene locus_tag LOCUS_11580 gene ppsA 139625 142000 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098065.1 protein_id gnl|my_center|LOCUS_11580 142422 143279 gene locus_tag LOCUS_11590 142422 143279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 143276 143929 gene locus_tag LOCUS_11600 143276 143929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 143926 146091 gene locus_tag LOCUS_11610 143926 146091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 150338 146124 gene locus_tag LOCUS_11620 150338 146124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 152785 150335 gene locus_tag LOCUS_11630 152785 150335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 153094 152933 gene locus_tag LOCUS_11640 153094 152933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 154703 153198 gene locus_tag LOCUS_11650 154703 153198 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_11650 154929 156662 gene locus_tag LOCUS_11660 154929 156662 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114562.1 protein_id gnl|my_center|LOCUS_11660 156955 156692 gene locus_tag LOCUS_11670 156955 156692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 157376 157876 gene locus_tag LOCUS_11680 157376 157876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 158517 158176 gene locus_tag LOCUS_11690 158517 158176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 158434 159627 gene locus_tag LOCUS_11700 158434 159627 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958298.1 protein_id gnl|my_center|LOCUS_11700 159627 160265 gene locus_tag LOCUS_11710 159627 160265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 160331 160600 gene locus_tag LOCUS_11720 160331 160600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 160667 161938 gene locus_tag LOCUS_11730 160667 161938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 162973 163338 gene locus_tag LOCUS_11740 162973 163338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11740 163550 163419 gene locus_tag LOCUS_11750 163550 163419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 164623 163589 gene locus_tag LOCUS_11760 gene holA 164623 163589 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_11760 165127 164648 gene locus_tag LOCUS_11770 165127 164648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 167904 165253 gene locus_tag LOCUS_11780 gene leuS 167904 165253 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 protein_id gnl|my_center|LOCUS_11780 168134 168673 gene locus_tag LOCUS_11790 168134 168673 CDS product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483489.1 protein_id gnl|my_center|LOCUS_11790 169256 170356 gene locus_tag LOCUS_11800 gene gcvT 169256 170356 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114049.1 protein_id gnl|my_center|LOCUS_11800 170444 170836 gene locus_tag LOCUS_11810 gene gcvH 170444 170836 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703428.1 protein_id gnl|my_center|LOCUS_11810 171035 172402 gene locus_tag LOCUS_11820 gene gcvPA 171035 172402 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945877.1 protein_id gnl|my_center|LOCUS_11820 172570 173067 gene locus_tag LOCUS_11830 gene tpx 172570 173067 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402767.1 protein_id gnl|my_center|LOCUS_11830 173222 174673 gene locus_tag LOCUS_11840 gene gcvPB 173222 174673 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945875.1 protein_id gnl|my_center|LOCUS_11840 174689 175060 gene locus_tag LOCUS_11850 174689 175060 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682922.1 protein_id gnl|my_center|LOCUS_11850 175159 175710 gene locus_tag LOCUS_11860 gene hslV 175159 175710 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769770.1 protein_id gnl|my_center|LOCUS_11860 175881 177212 gene locus_tag LOCUS_11870 gene hslU 175881 177212 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707776.1 protein_id gnl|my_center|LOCUS_11870 177266 177628 gene locus_tag LOCUS_11880 177266 177628 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_11880 177901 178650 gene locus_tag LOCUS_11890 gene ubiE 177901 178650 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227958.1 protein_id gnl|my_center|LOCUS_11890 178647 179288 gene locus_tag LOCUS_11900 178647 179288 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_11900 179285 180946 gene locus_tag LOCUS_11910 gene ubiB 179285 180946 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 protein_id gnl|my_center|LOCUS_11910 181005 181988 gene locus_tag LOCUS_11920 gene gshB 181005 181988 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316740.1 protein_id gnl|my_center|LOCUS_11920 182256 183353 gene locus_tag LOCUS_11930 182256 183353 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140332.1 protein_id gnl|my_center|LOCUS_11930 183362 184417 gene locus_tag LOCUS_11940 183362 184417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 184951 184556 gene locus_tag LOCUS_11950 184951 184556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 185264 184944 gene locus_tag LOCUS_11960 185264 184944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 185616 186179 gene locus_tag LOCUS_11970 185616 186179 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100947.1 protein_id gnl|my_center|LOCUS_11970 186274 186693 gene locus_tag LOCUS_11980 gene ruvX 186274 186693 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084575.1 protein_id gnl|my_center|LOCUS_11980 186690 187277 gene locus_tag LOCUS_11990 gene pyrR 186690 187277 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_11990 187274 188281 gene locus_tag LOCUS_12000 187274 188281 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084569.1 protein_id gnl|my_center|LOCUS_12000 188274 189617 gene locus_tag LOCUS_12010 188274 189617 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_12010 189688 191118 gene locus_tag LOCUS_12020 gene hldE 189688 191118 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404685.1 protein_id gnl|my_center|LOCUS_12020 191174 192454 gene locus_tag LOCUS_12030 gene waaA 191174 192454 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_12030 193189 192602 gene locus_tag LOCUS_12040 193189 192602 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_12040 193693 193373 gene locus_tag LOCUS_12050 193693 193373 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_12050 194410 193745 gene locus_tag LOCUS_12060 194410 193745 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185654.1 protein_id gnl|my_center|LOCUS_12060 194592 196013 gene locus_tag LOCUS_12070 194592 196013 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403679.1 protein_id gnl|my_center|LOCUS_12070 197467 196136 gene locus_tag LOCUS_12080 197467 196136 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339198.1 protein_id gnl|my_center|LOCUS_12080 197962 199836 gene locus_tag LOCUS_12090 197962 199836 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080084.1 protein_id gnl|my_center|LOCUS_12090 200025 200879 gene locus_tag LOCUS_12100 200025 200879 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388754.1 protein_id gnl|my_center|LOCUS_12100 201449 200922 gene locus_tag LOCUS_12110 gene purE 201449 200922 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_12110 202600 201446 gene locus_tag LOCUS_12120 gene purK 202600 201446 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081519.1 protein_id gnl|my_center|LOCUS_12120 202773 205592 gene locus_tag LOCUS_12130 202773 205592 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_12130 205606 205947 gene locus_tag LOCUS_12140 205606 205947 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_12140 205944 207491 gene locus_tag LOCUS_12150 205944 207491 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_12150 207488 207982 gene locus_tag LOCUS_12160 207488 207982 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_12160 207976 208245 gene locus_tag LOCUS_12170 207976 208245 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_12170 208376 208780 gene locus_tag LOCUS_12180 208376 208780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 208788 210752 gene locus_tag LOCUS_12190 208788 210752 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_12190 210962 212149 gene locus_tag LOCUS_12200 210962 212149 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044393593.1 protein_id gnl|my_center|LOCUS_12200 212902 212279 gene locus_tag LOCUS_12210 gene mlaC 212902 212279 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369502.1 protein_id gnl|my_center|LOCUS_12210 213288 213728 gene locus_tag LOCUS_12220 213288 213728 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_12220 214543 213848 gene locus_tag LOCUS_12230 gene urtE 214543 213848 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149319367.1 protein_id gnl|my_center|LOCUS_12230 215626 214781 gene locus_tag LOCUS_12240 gene urtD 215626 214781 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376420.1 protein_id gnl|my_center|LOCUS_12240 216753 215623 gene locus_tag LOCUS_12250 gene urtC 216753 215623 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976303.1 protein_id gnl|my_center|LOCUS_12250 218524 216935 gene locus_tag LOCUS_12260 gene urtB 218524 216935 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976304.1 protein_id gnl|my_center|LOCUS_12260 219970 218669 gene locus_tag LOCUS_12270 gene urtA 219970 218669 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529436.1 protein_id gnl|my_center|LOCUS_12270 221128 220772 gene locus_tag LOCUS_12280 221128 220772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 222329 221349 gene locus_tag LOCUS_12290 222329 221349 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_12290 223750 222581 gene locus_tag LOCUS_12300 223750 222581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 224433 223990 gene locus_tag LOCUS_12310 224433 223990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 224730 224470 gene locus_tag LOCUS_12320 224730 224470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 225234 224917 gene locus_tag LOCUS_12330 225234 224917 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927225.1 protein_id gnl|my_center|LOCUS_12330 225635 225240 gene locus_tag LOCUS_12340 gene hisI 225635 225240 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105339.1 protein_id gnl|my_center|LOCUS_12340 226589 225849 gene locus_tag LOCUS_12350 gene hisA 226589 225849 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 protein_id gnl|my_center|LOCUS_12350 227294 226674 gene locus_tag LOCUS_12360 227294 226674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 227957 227331 gene locus_tag LOCUS_12370 227957 227331 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809593.1 protein_id gnl|my_center|LOCUS_12370 228844 228215 gene locus_tag LOCUS_12380 gene pdxH 228844 228215 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_12380 229076 230404 gene locus_tag LOCUS_12390 gene aceA 229076 230404 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 protein_id gnl|my_center|LOCUS_12390 230950 230495 gene locus_tag LOCUS_12400 230950 230495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 230910 234218 gene locus_tag LOCUS_12410 230910 234218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 234386 234889 gene locus_tag LOCUS_12420 gene rraA 234386 234889 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765718.1 protein_id gnl|my_center|LOCUS_12420 235082 236884 gene locus_tag LOCUS_12430 gene aceK 235082 236884 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525974.1 protein_id gnl|my_center|LOCUS_12430 237213 238271 gene locus_tag LOCUS_12440 237213 238271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 239474 238563 gene locus_tag LOCUS_12450 239474 238563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 241490 239907 gene locus_tag LOCUS_12460 241490 239907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 242637 241873 gene locus_tag LOCUS_12470 242637 241873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 243856 242708 gene locus_tag LOCUS_12480 243856 242708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389361.1 protein_id gnl|my_center|LOCUS_12480 244770 244096 gene locus_tag LOCUS_12490 gene lexA 244770 244096 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403693.1 protein_id gnl|my_center|LOCUS_12490 244902 245597 gene locus_tag LOCUS_12500 gene nth 244902 245597 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948566.1 protein_id gnl|my_center|LOCUS_12500 245691 246140 gene locus_tag LOCUS_12510 245691 246140 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814061.1 protein_id gnl|my_center|LOCUS_12510 246435 246866 gene locus_tag LOCUS_12520 246435 246866 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061418.1 protein_id gnl|my_center|LOCUS_12520 247004 248401 gene locus_tag LOCUS_12530 gene sthA 247004 248401 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120816.1 protein_id gnl|my_center|LOCUS_12530 250007 248415 gene locus_tag LOCUS_12540 gene gshA 250007 248415 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_12540 250299 250823 gene locus_tag LOCUS_12550 250299 250823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 253143 251044 gene locus_tag LOCUS_12560 253143 251044 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 protein_id gnl|my_center|LOCUS_12560 253812 253309 gene locus_tag LOCUS_12570 gene def 253812 253309 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_12570 254337 253816 gene locus_tag LOCUS_12580 254337 253816 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_12580 255130 254330 gene locus_tag LOCUS_12590 gene pgeF 255130 254330 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_12590 256170 255121 gene locus_tag LOCUS_12600 gene rluD 256170 255121 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094686.1 protein_id gnl|my_center|LOCUS_12600 256231 257058 gene locus_tag LOCUS_12610 256231 257058 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687645.1 protein_id gnl|my_center|LOCUS_12610 257531 257193 gene locus_tag LOCUS_12620 gene glnB 257531 257193 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073353.1 protein_id gnl|my_center|LOCUS_12620 259314 257671 gene locus_tag LOCUS_12630 259314 257671 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957853.1 protein_id gnl|my_center|LOCUS_12630 260257 259385 gene locus_tag LOCUS_12640 gene sucD 260257 259385 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771707.1 protein_id gnl|my_center|LOCUS_12640 261447 260254 gene locus_tag LOCUS_12650 gene sucC 261447 260254 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087425.1 protein_id gnl|my_center|LOCUS_12650 261635 263302 gene locus_tag LOCUS_12660 261635 263302 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 protein_id gnl|my_center|LOCUS_12660 263517 264890 gene locus_tag LOCUS_12670 gene pilR 263517 264890 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_12670 264912 266303 gene locus_tag LOCUS_12680 gene argA 264912 266303 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096265.1 protein_id gnl|my_center|LOCUS_12680 266493 270032 gene locus_tag LOCUS_12690 266493 270032 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615508.1 protein_id gnl|my_center|LOCUS_12690 270208 270029 gene locus_tag LOCUS_12700 270208 270029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence005 989 525 gene locus_tag LOCUS_12710 989 525 CDS product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275395.1 protein_id gnl|my_center|LOCUS_12710 1303 986 gene locus_tag LOCUS_12720 1303 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3160 2114 gene locus_tag LOCUS_12730 3160 2114 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063858.1 protein_id gnl|my_center|LOCUS_12730 4201 3989 gene locus_tag LOCUS_12740 4201 3989 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 protein_id gnl|my_center|LOCUS_12740 4443 4198 gene locus_tag LOCUS_12750 4443 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 4809 4639 gene locus_tag LOCUS_12760 4809 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 5336 4809 gene locus_tag LOCUS_12770 5336 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 6309 5797 gene locus_tag LOCUS_12780 6309 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 6746 7582 gene locus_tag LOCUS_12790 6746 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 7909 8373 gene locus_tag LOCUS_12800 7909 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 8599 9528 gene locus_tag LOCUS_12810 8599 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 12754 9626 gene locus_tag LOCUS_12820 12754 9626 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057001.1 protein_id gnl|my_center|LOCUS_12820 13396 12776 gene locus_tag LOCUS_12830 13396 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 14433 13393 gene locus_tag LOCUS_12840 14433 13393 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_12840 14882 14490 gene locus_tag LOCUS_12850 14882 14490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 15016 16944 gene locus_tag LOCUS_12860 15016 16944 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_12860 16941 18566 gene locus_tag LOCUS_12870 16941 18566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 18566 19219 gene locus_tag LOCUS_12880 gene narL 18566 19219 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_12880 19316 19780 gene locus_tag LOCUS_12890 19316 19780 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932524.1 protein_id gnl|my_center|LOCUS_12890 20892 19846 gene locus_tag LOCUS_12900 gene tsaD 20892 19846 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369630.1 protein_id gnl|my_center|LOCUS_12900 22073 20958 gene locus_tag LOCUS_12910 gene thiO 22073 20958 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_12910 23014 22070 gene locus_tag LOCUS_12920 gene ispH 23014 22070 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036355.1 protein_id gnl|my_center|LOCUS_12920 23645 23133 gene locus_tag LOCUS_12930 gene fkpB 23645 23133 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704645.1 protein_id gnl|my_center|LOCUS_12930 24415 23642 gene locus_tag LOCUS_12940 24415 23642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 25593 24982 gene locus_tag LOCUS_12950 25593 24982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 25677 26993 gene locus_tag LOCUS_12960 gene rimO 25677 26993 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064698.1 protein_id gnl|my_center|LOCUS_12960 27340 27140 gene locus_tag LOCUS_12970 27340 27140 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720756.1 protein_id gnl|my_center|LOCUS_12970 27632 29257 gene locus_tag LOCUS_12980 27632 29257 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932512.1 protein_id gnl|my_center|LOCUS_12980 30148 29273 gene locus_tag LOCUS_12990 30148 29273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 31331 30270 gene locus_tag LOCUS_13000 gene dusA 31331 30270 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707399.1 protein_id gnl|my_center|LOCUS_13000 32723 31347 gene locus_tag LOCUS_13010 gene gorA 32723 31347 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704063.1 protein_id gnl|my_center|LOCUS_13010 33546 32812 gene locus_tag LOCUS_13020 33546 32812 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495223.1 protein_id gnl|my_center|LOCUS_13020 33860 34318 gene locus_tag LOCUS_13030 33860 34318 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_13030 34299 34745 gene locus_tag LOCUS_13040 34299 34745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 34826 35431 gene locus_tag LOCUS_13050 34826 35431 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948431.1 protein_id gnl|my_center|LOCUS_13050 37831 35762 gene locus_tag LOCUS_13060 gene brxL 37831 35762 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 protein_id gnl|my_center|LOCUS_13060 40144 37835 gene locus_tag LOCUS_13070 gene pglZ 40144 37835 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_13070 40551 40141 gene locus_tag LOCUS_13080 40551 40141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 41752 40907 gene locus_tag LOCUS_13090 41752 40907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 43134 41749 gene locus_tag LOCUS_13100 43134 41749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 46661 43131 gene locus_tag LOCUS_13110 46661 43131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 47257 46754 gene locus_tag LOCUS_13120 47257 46754 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533488.1 protein_id gnl|my_center|LOCUS_13120 47577 47254 gene locus_tag LOCUS_13130 47577 47254 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705366.1 protein_id gnl|my_center|LOCUS_13130 51090 47680 gene locus_tag LOCUS_13140 gene brxC 51090 47680 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_13140 51653 51093 gene locus_tag LOCUS_13150 51653 51093 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_13150 52422 51640 gene locus_tag LOCUS_13160 52422 51640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 52578 52503 gene locus_tag LOCUS_t00170 52578 52503 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 52722 53681 gene locus_tag LOCUS_13170 gene arsS 52722 53681 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_13170 53833 54471 gene locus_tag LOCUS_13180 53833 54471 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839307.1 protein_id gnl|my_center|LOCUS_13180 55385 54573 gene locus_tag LOCUS_13190 gene ccsA 55385 54573 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765867.1 protein_id gnl|my_center|LOCUS_13190 55630 57036 gene locus_tag LOCUS_13200 gene ffh 55630 57036 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209456.1 protein_id gnl|my_center|LOCUS_13200 57132 57058 gene locus_tag LOCUS_t00180 57132 57058 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 57403 58713 gene locus_tag LOCUS_13210 57403 58713 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086024044.1 protein_id gnl|my_center|LOCUS_13210 58824 59627 gene locus_tag LOCUS_13220 gene panB 58824 59627 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_13220 59689 60555 gene locus_tag LOCUS_13230 gene panC 59689 60555 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071159.1 protein_id gnl|my_center|LOCUS_13230 60797 61177 gene locus_tag LOCUS_13240 60797 61177 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 protein_id gnl|my_center|LOCUS_13240 62788 61235 gene locus_tag LOCUS_13250 gene glgA 62788 61235 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389900.1 protein_id gnl|my_center|LOCUS_13250 62902 64377 gene locus_tag LOCUS_13260 gene zwf 62902 64377 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141170.1 protein_id gnl|my_center|LOCUS_13260 64441 66087 gene locus_tag LOCUS_13270 gene pgi 64441 66087 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704176.1 protein_id gnl|my_center|LOCUS_13270 66491 68413 gene locus_tag LOCUS_13280 66491 68413 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 protein_id gnl|my_center|LOCUS_13280 68517 69788 gene locus_tag LOCUS_13290 68517 69788 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169266.1 protein_id gnl|my_center|LOCUS_13290 69785 71275 gene locus_tag LOCUS_13300 69785 71275 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402050.1 protein_id gnl|my_center|LOCUS_13300 71340 73028 gene locus_tag LOCUS_13310 71340 73028 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986802.1 protein_id gnl|my_center|LOCUS_13310 74382 73069 gene locus_tag LOCUS_13320 74382 73069 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766740.1 protein_id gnl|my_center|LOCUS_13320 74451 75518 gene locus_tag LOCUS_13330 gene mtnA 74451 75518 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091449.1 protein_id gnl|my_center|LOCUS_13330 76759 75587 gene locus_tag LOCUS_13340 gene dapE 76759 75587 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705377.1 protein_id gnl|my_center|LOCUS_13340 77103 76759 gene locus_tag LOCUS_13350 77103 76759 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631925.1 protein_id gnl|my_center|LOCUS_13350 77929 77108 gene locus_tag LOCUS_13360 gene dapD 77929 77108 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 protein_id gnl|my_center|LOCUS_13360 78150 77926 gene locus_tag LOCUS_13370 78150 77926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 79240 78047 gene locus_tag LOCUS_13380 gene dapC 79240 78047 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_13380 79509 79892 gene locus_tag LOCUS_13390 79509 79892 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528522.1 protein_id gnl|my_center|LOCUS_13390 80524 80012 gene locus_tag LOCUS_13400 80524 80012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 83255 80562 gene locus_tag LOCUS_13410 83255 80562 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_13410 84046 83276 gene locus_tag LOCUS_13420 gene map 84046 83276 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092395.1 protein_id gnl|my_center|LOCUS_13420 84480 85232 gene locus_tag LOCUS_13430 gene rpsB 84480 85232 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 protein_id gnl|my_center|LOCUS_13430 85365 86252 gene locus_tag LOCUS_13440 gene tsf 85365 86252 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_13440 86343 87065 gene locus_tag LOCUS_13450 gene pyrH 86343 87065 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_13450 87067 87624 gene locus_tag LOCUS_13460 gene frr 87067 87624 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_13460 87727 88443 gene locus_tag LOCUS_13470 gene uppS 87727 88443 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765985.1 protein_id gnl|my_center|LOCUS_13470 88443 89285 gene locus_tag LOCUS_13480 88443 89285 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036560.1 protein_id gnl|my_center|LOCUS_13480 89282 90475 gene locus_tag LOCUS_13490 gene ispC 89282 90475 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 protein_id gnl|my_center|LOCUS_13490 90658 92022 gene locus_tag LOCUS_13500 gene rseP 90658 92022 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098594.1 protein_id gnl|my_center|LOCUS_13500 92103 94436 gene locus_tag LOCUS_13510 gene bamA 92103 94436 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266976.1 protein_id gnl|my_center|LOCUS_13510 94449 94967 gene locus_tag LOCUS_13520 94449 94967 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_13520 94984 96030 gene locus_tag LOCUS_13530 gene lpxD 94984 96030 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_13530 96032 96541 gene locus_tag LOCUS_13540 gene fabZ 96032 96541 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_13540 96538 97308 gene locus_tag LOCUS_13550 gene lpxA 96538 97308 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193051.1 protein_id gnl|my_center|LOCUS_13550 97308 98447 gene locus_tag LOCUS_13560 gene lpxB 97308 98447 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113865.1 protein_id gnl|my_center|LOCUS_13560 98609 99190 gene locus_tag LOCUS_13570 gene rnhB 98609 99190 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063751.1 protein_id gnl|my_center|LOCUS_13570 99261 101354 gene locus_tag LOCUS_13580 99261 101354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 101527 102156 gene locus_tag LOCUS_13590 gene parA 101527 102156 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_13590 102153 102377 gene locus_tag LOCUS_13600 102153 102377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 104522 102519 gene locus_tag LOCUS_13610 gene rep 104522 102519 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102994.1 protein_id gnl|my_center|LOCUS_13610 105160 105510 gene locus_tag LOCUS_13620 105160 105510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 105568 106179 gene locus_tag LOCUS_13630 105568 106179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 106133 107557 gene locus_tag LOCUS_13640 106133 107557 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_13640 107940 107560 gene locus_tag LOCUS_13650 107940 107560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 111129 108409 gene locus_tag LOCUS_13660 gene polA 111129 108409 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114123.1 protein_id gnl|my_center|LOCUS_13660 111819 111250 gene locus_tag LOCUS_13670 111819 111250 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084272.1 protein_id gnl|my_center|LOCUS_13670 113799 111868 gene locus_tag LOCUS_13680 113799 111868 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880333.1 protein_id gnl|my_center|LOCUS_13680 114140 115549 gene locus_tag LOCUS_13690 114140 115549 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_13690 115563 116525 gene locus_tag LOCUS_13700 115563 116525 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_13700 116522 117415 gene locus_tag LOCUS_13710 116522 117415 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257878.1 protein_id gnl|my_center|LOCUS_13710 117886 117464 gene locus_tag LOCUS_13720 gene nikR 117886 117464 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380787.1 protein_id gnl|my_center|LOCUS_13720 118084 118737 gene locus_tag LOCUS_13730 gene cbiM 118084 118737 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391247.1 protein_id gnl|my_center|LOCUS_13730 118881 119969 gene locus_tag LOCUS_13740 118881 119969 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626382.1 protein_id gnl|my_center|LOCUS_13740 120138 120914 gene locus_tag LOCUS_13750 120138 120914 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_13750 120911 121936 gene locus_tag LOCUS_13760 120911 121936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 122297 122112 gene locus_tag LOCUS_13770 122297 122112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 122842 123174 gene locus_tag LOCUS_13780 122842 123174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 124098 123433 gene locus_tag LOCUS_13790 124098 123433 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114764.1 protein_id gnl|my_center|LOCUS_13790 124281 125255 gene locus_tag LOCUS_13800 gene glk 124281 125255 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_13800 125357 125563 gene locus_tag LOCUS_13810 125357 125563 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889077.1 protein_id gnl|my_center|LOCUS_13810 125713 126537 gene locus_tag LOCUS_13820 125713 126537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 127224 126616 gene locus_tag LOCUS_13830 127224 126616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 127644 129476 gene locus_tag LOCUS_13840 127644 129476 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819691.1 protein_id gnl|my_center|LOCUS_13840 129473 133486 gene locus_tag LOCUS_13850 129473 133486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 133483 134400 gene locus_tag LOCUS_13860 133483 134400 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_13860 134422 135411 gene locus_tag LOCUS_13870 134422 135411 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527322.1 protein_id gnl|my_center|LOCUS_13870 135870 136250 gene locus_tag LOCUS_13880 gene sdhC 135870 136250 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688393.1 protein_id gnl|my_center|LOCUS_13880 136247 136591 gene locus_tag LOCUS_13890 136247 136591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 136599 138362 gene locus_tag LOCUS_13900 gene sdhA 136599 138362 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946277.1 protein_id gnl|my_center|LOCUS_13900 138628 139320 gene locus_tag LOCUS_13910 138628 139320 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187935.1 protein_id gnl|my_center|LOCUS_13910 139328 139639 gene locus_tag LOCUS_13920 139328 139639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 139679 140140 gene locus_tag LOCUS_13930 139679 140140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 141118 140195 gene locus_tag LOCUS_13940 gene hisG 141118 140195 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_13940 141451 142392 gene locus_tag LOCUS_13950 141451 142392 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525382.1 protein_id gnl|my_center|LOCUS_13950 142389 143213 gene locus_tag LOCUS_13960 142389 143213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 143457 143876 gene locus_tag LOCUS_13970 143457 143876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 144527 145189 gene locus_tag LOCUS_13980 144527 145189 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190826.1 protein_id gnl|my_center|LOCUS_13980 145230 146030 gene locus_tag LOCUS_13990 gene modA 145230 146030 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 protein_id gnl|my_center|LOCUS_13990 146038 146727 gene locus_tag LOCUS_14000 gene modB 146038 146727 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_14000 146718 147839 gene locus_tag LOCUS_14010 gene modC 146718 147839 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_14010 148241 149266 gene locus_tag LOCUS_14020 148241 149266 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109525.1 protein_id gnl|my_center|LOCUS_14020 149924 149313 gene locus_tag LOCUS_14030 149924 149313 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228914.1 protein_id gnl|my_center|LOCUS_14030 150621 150385 gene locus_tag LOCUS_14040 150621 150385 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868932.1 protein_id gnl|my_center|LOCUS_14040 151977 150655 gene locus_tag LOCUS_14050 151977 150655 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_14050 152660 152169 gene locus_tag LOCUS_14060 152660 152169 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927067.1 protein_id gnl|my_center|LOCUS_14060 153054 153485 gene locus_tag LOCUS_14070 gene ybgC 153054 153485 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201529.1 protein_id gnl|my_center|LOCUS_14070 153482 154156 gene locus_tag LOCUS_14080 gene tolQ 153482 154156 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483599.1 protein_id gnl|my_center|LOCUS_14080 154177 154623 gene locus_tag LOCUS_14090 gene tolR 154177 154623 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126827401.1 protein_id gnl|my_center|LOCUS_14090 154641 155948 gene locus_tag LOCUS_14100 154641 155948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 155966 157294 gene locus_tag LOCUS_14110 gene tolB 155966 157294 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_14110 157323 157853 gene locus_tag LOCUS_14120 gene pal 157323 157853 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038133.1 protein_id gnl|my_center|LOCUS_14120 157922 158797 gene locus_tag LOCUS_14130 157922 158797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 159009 159084 gene locus_tag LOCUS_t00190 159009 159084 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 159546 159340 gene locus_tag LOCUS_14140 159546 159340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 159526 160071 gene locus_tag LOCUS_14150 159526 160071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 160058 160384 gene locus_tag LOCUS_14160 160058 160384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 160403 160591 gene locus_tag LOCUS_14170 160403 160591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 160793 160512 gene locus_tag LOCUS_14180 160793 160512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 161091 160924 gene locus_tag LOCUS_14190 161091 160924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 161350 161108 gene locus_tag LOCUS_14200 161350 161108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 161682 161347 gene locus_tag LOCUS_14210 161682 161347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 163062 161764 gene locus_tag LOCUS_14220 163062 161764 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 protein_id gnl|my_center|LOCUS_14220 166445 163800 gene locus_tag LOCUS_14230 166445 163800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 169489 166664 gene locus_tag LOCUS_14240 gene uvrA 169489 166664 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490537.1 protein_id gnl|my_center|LOCUS_14240 169673 171094 gene locus_tag LOCUS_14250 169673 171094 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400420.1 protein_id gnl|my_center|LOCUS_14250 171170 171673 gene locus_tag LOCUS_14260 gene ssb1 171170 171673 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209100.1 protein_id gnl|my_center|LOCUS_14260 173229 172081 gene locus_tag LOCUS_14270 173229 172081 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035313.1 protein_id gnl|my_center|LOCUS_14270 173809 173405 gene locus_tag LOCUS_14280 173809 173405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 174279 174464 gene locus_tag LOCUS_14290 174279 174464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 177854 174855 gene locus_tag LOCUS_14300 177854 174855 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_14300 178371 178177 gene locus_tag LOCUS_14310 178371 178177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 178943 178368 gene locus_tag LOCUS_14320 178943 178368 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081880124.1 protein_id gnl|my_center|LOCUS_14320 179622 178993 gene locus_tag LOCUS_14330 179622 178993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 180936 179623 gene locus_tag LOCUS_14340 180936 179623 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368422.1 protein_id gnl|my_center|LOCUS_14340 182201 180933 gene locus_tag LOCUS_14350 182201 180933 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554539.1 protein_id gnl|my_center|LOCUS_14350 182386 182198 gene locus_tag LOCUS_14360 182386 182198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 184014 182545 gene locus_tag LOCUS_14370 184014 182545 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_14370 186137 184011 gene locus_tag LOCUS_14380 186137 184011 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_14380 187050 186580 gene locus_tag LOCUS_14390 187050 186580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 187748 187050 gene locus_tag LOCUS_14400 187748 187050 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_14400 188097 187765 gene locus_tag LOCUS_14410 188097 187765 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895635.1 protein_id gnl|my_center|LOCUS_14410 188675 189187 gene locus_tag LOCUS_14420 188675 189187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 189795 189436 gene locus_tag LOCUS_tm00010 189795 189436 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 190322 189843 gene locus_tag LOCUS_14430 gene smpB 190322 189843 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948526.1 protein_id gnl|my_center|LOCUS_14430 190642 191415 gene locus_tag LOCUS_14440 gene tpiA 190642 191415 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 protein_id gnl|my_center|LOCUS_14440 191431 191991 gene locus_tag LOCUS_14450 191431 191991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 192004 192088 gene locus_tag LOCUS_t00200 192004 192088 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 192264 192620 gene locus_tag LOCUS_14460 192264 192620 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_14460 192611 193087 gene locus_tag LOCUS_14470 192611 193087 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_14470 193105 193818 gene locus_tag LOCUS_14480 193105 193818 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948476.1 protein_id gnl|my_center|LOCUS_14480 193811 195067 gene locus_tag LOCUS_14490 193811 195067 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078068422.1 protein_id gnl|my_center|LOCUS_14490 195067 195594 gene locus_tag LOCUS_14500 gene nuoE 195067 195594 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_14500 195599 196882 gene locus_tag LOCUS_14510 gene nuoF 195599 196882 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 protein_id gnl|my_center|LOCUS_14510 197144 196914 gene locus_tag LOCUS_14520 197144 196914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 197049 199475 gene locus_tag LOCUS_14530 gene nuoG 197049 199475 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948472.1 protein_id gnl|my_center|LOCUS_14530 199483 200517 gene locus_tag LOCUS_14540 gene nuoH 199483 200517 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948471.1 protein_id gnl|my_center|LOCUS_14540 200532 201023 gene locus_tag LOCUS_14550 gene nuoI 200532 201023 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_14550 201217 201873 gene locus_tag LOCUS_14560 201217 201873 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 protein_id gnl|my_center|LOCUS_14560 201870 202175 gene locus_tag LOCUS_14570 gene nuoK 201870 202175 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_14570 202256 204262 gene locus_tag LOCUS_14580 gene nuoL 202256 204262 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813919.1 protein_id gnl|my_center|LOCUS_14580 204281 205861 gene locus_tag LOCUS_14590 204281 205861 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037648.1 protein_id gnl|my_center|LOCUS_14590 205904 207343 gene locus_tag LOCUS_14600 gene nuoN 205904 207343 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443945.1 protein_id gnl|my_center|LOCUS_14600 207419 208294 gene locus_tag LOCUS_14610 gene dapA 207419 208294 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_14610 208362 209519 gene locus_tag LOCUS_14620 gene bamC 208362 209519 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064176.1 protein_id gnl|my_center|LOCUS_14620 209575 210351 gene locus_tag LOCUS_14630 209575 210351 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_14630 213164 210381 gene locus_tag LOCUS_14640 213164 210381 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_14640 213433 213146 gene locus_tag LOCUS_14650 213433 213146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947734.1 protein_id gnl|my_center|LOCUS_14650 214126 213458 gene locus_tag LOCUS_14660 214126 213458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 214193 214630 gene locus_tag LOCUS_14670 214193 214630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 215381 214683 gene locus_tag LOCUS_14680 215381 214683 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122349.1 protein_id gnl|my_center|LOCUS_14680 217297 215666 gene locus_tag LOCUS_14690 gene groL 217297 215666 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_14690 217642 217355 gene locus_tag LOCUS_14700 gene groES 217642 217355 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770495.1 protein_id gnl|my_center|LOCUS_14700 217888 218730 gene locus_tag LOCUS_14710 gene tcdA 217888 218730 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482313.1 protein_id gnl|my_center|LOCUS_14710 219683 218769 gene locus_tag LOCUS_14720 219683 218769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 219716 219901 gene locus_tag LOCUS_14730 219716 219901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 220493 219870 gene locus_tag LOCUS_14740 220493 219870 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869276.1 protein_id gnl|my_center|LOCUS_14740 221380 221030 gene locus_tag LOCUS_14750 221380 221030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 222035 221766 gene locus_tag LOCUS_14760 222035 221766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 222775 222086 gene locus_tag LOCUS_14770 gene menH 222775 222086 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819179.1 protein_id gnl|my_center|LOCUS_14770 223674 222820 gene locus_tag LOCUS_14780 gene folE2 223674 222820 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_14780 224687 223791 gene locus_tag LOCUS_14790 224687 223791 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_14790 224922 224680 gene locus_tag LOCUS_14800 224922 224680 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037729.1 protein_id gnl|my_center|LOCUS_14800 225217 227808 gene locus_tag LOCUS_14810 225217 227808 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084250.1 protein_id gnl|my_center|LOCUS_14810 229539 227854 gene locus_tag LOCUS_14820 229539 227854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 231304 229637 gene locus_tag LOCUS_14830 gene ettA 231304 229637 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_14830 231455 232015 gene locus_tag LOCUS_14840 231455 232015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 232897 232043 gene locus_tag LOCUS_14850 232897 232043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 233156 233246 gene locus_tag LOCUS_t00210 233156 233246 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 234914 233433 gene locus_tag LOCUS_14860 234914 233433 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929786.1 protein_id gnl|my_center|LOCUS_14860 236128 234926 gene locus_tag LOCUS_14870 gene gltS 236128 234926 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814723.1 protein_id gnl|my_center|LOCUS_14870 236776 236135 gene locus_tag LOCUS_14880 gene queE 236776 236135 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931061.1 protein_id gnl|my_center|LOCUS_14880 237867 236773 gene locus_tag LOCUS_14890 237867 236773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 238582 237869 gene locus_tag LOCUS_14900 gene queC 238582 237869 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_14900 239280 238966 gene locus_tag LOCUS_14910 239280 238966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 240309 239299 gene locus_tag LOCUS_14920 240309 239299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 240678 241214 gene locus_tag LOCUS_14930 gene tsaA 240678 241214 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_14930 241639 241316 gene locus_tag LOCUS_14940 241639 241316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 241819 242049 gene locus_tag LOCUS_14950 241819 242049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200389847.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence006 588 88 gene locus_tag LOCUS_14960 588 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 2153 1896 gene locus_tag LOCUS_14970 2153 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2381 2998 gene locus_tag LOCUS_14980 2381 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 2968 3588 gene locus_tag LOCUS_14990 2968 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 3600 4229 gene locus_tag LOCUS_15000 3600 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 4284 6047 gene locus_tag LOCUS_15010 4284 6047 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071140.1 protein_id gnl|my_center|LOCUS_15010 6532 6152 gene locus_tag LOCUS_15020 6532 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 6790 7227 gene locus_tag LOCUS_15030 gene tppA 6790 7227 CDS product type IVa pilus pseudopilin TppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704652.1 protein_id gnl|my_center|LOCUS_15030 7215 7811 gene locus_tag LOCUS_15040 7215 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 7781 8395 gene locus_tag LOCUS_15050 7781 8395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 8407 9036 gene locus_tag LOCUS_15060 8407 9036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 9097 10386 gene locus_tag LOCUS_15070 9097 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 11528 11767 gene locus_tag LOCUS_15080 11528 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 11736 12908 gene locus_tag LOCUS_15090 11736 12908 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_15090 13509 13799 gene locus_tag LOCUS_15100 13509 13799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 13796 14299 gene locus_tag LOCUS_15110 13796 14299 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404756.1 protein_id gnl|my_center|LOCUS_15110 14892 14527 gene locus_tag LOCUS_15120 14892 14527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 15118 14837 gene locus_tag LOCUS_15130 15118 14837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 15294 15482 gene locus_tag LOCUS_15140 15294 15482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 15773 16012 gene locus_tag LOCUS_15150 15773 16012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 15999 16253 gene locus_tag LOCUS_15160 15999 16253 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389170.1 protein_id gnl|my_center|LOCUS_15160 16598 16762 gene locus_tag LOCUS_15170 16598 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 17640 17293 gene locus_tag LOCUS_15180 gene mazF 17640 17293 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254750.1 protein_id gnl|my_center|LOCUS_15180 17882 17640 gene locus_tag LOCUS_15190 17882 17640 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_15190 18176 17997 gene locus_tag LOCUS_15200 18176 17997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 18441 19244 gene locus_tag LOCUS_15210 18441 19244 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967317.1 protein_id gnl|my_center|LOCUS_15210 20127 19669 gene locus_tag LOCUS_15220 20127 19669 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269020.1 protein_id gnl|my_center|LOCUS_15220 20506 20201 gene locus_tag LOCUS_15230 20506 20201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 20495 20755 gene locus_tag LOCUS_15240 20495 20755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 22570 21353 gene locus_tag LOCUS_15250 22570 21353 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 protein_id gnl|my_center|LOCUS_15250 22988 22656 gene locus_tag LOCUS_15260 22988 22656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 24541 23324 gene locus_tag LOCUS_15270 24541 23324 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 protein_id gnl|my_center|LOCUS_15270 24860 24627 gene locus_tag LOCUS_15280 24860 24627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 25164 25088 gene locus_tag LOCUS_t00220 25164 25088 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27090 25228 gene locus_tag LOCUS_15290 gene rpoD 27090 25228 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704782.1 protein_id gnl|my_center|LOCUS_15290 28938 27172 gene locus_tag LOCUS_15300 gene dnaG 28938 27172 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098776.1 protein_id gnl|my_center|LOCUS_15300 29400 28957 gene locus_tag LOCUS_15310 29400 28957 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038898.1 protein_id gnl|my_center|LOCUS_15310 29775 29560 gene locus_tag LOCUS_15320 gene rpsU 29775 29560 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085057.1 protein_id gnl|my_center|LOCUS_15320 29997 29910 gene locus_tag LOCUS_t00230 29997 29910 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30275 30943 gene locus_tag LOCUS_15330 30275 30943 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095848.1 protein_id gnl|my_center|LOCUS_15330 31013 31198 gene locus_tag LOCUS_15340 31013 31198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 31554 31255 gene locus_tag LOCUS_15350 31554 31255 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199903.1 protein_id gnl|my_center|LOCUS_15350 32026 31691 gene locus_tag LOCUS_15360 32026 31691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 32146 33018 gene locus_tag LOCUS_15370 32146 33018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 32954 33895 gene locus_tag LOCUS_15380 32954 33895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 34038 37763 gene locus_tag LOCUS_15390 34038 37763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 39398 37842 gene locus_tag LOCUS_15400 39398 37842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 40618 39395 gene locus_tag LOCUS_15410 40618 39395 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383637.1 protein_id gnl|my_center|LOCUS_15410 40765 41793 gene locus_tag LOCUS_15420 40765 41793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 42849 41869 gene locus_tag LOCUS_15430 42849 41869 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206713.1 protein_id gnl|my_center|LOCUS_15430 43141 43863 gene locus_tag LOCUS_15440 gene tsaA 43141 43863 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095676.1 protein_id gnl|my_center|LOCUS_15440 44462 43926 gene locus_tag LOCUS_15450 44462 43926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 44349 44630 gene locus_tag LOCUS_15460 44349 44630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 47287 44786 gene locus_tag LOCUS_15470 gene rnr 47287 44786 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076332.1 protein_id gnl|my_center|LOCUS_15470 47258 47344 gene locus_tag LOCUS_t00240 47258 47344 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 47559 47900 gene locus_tag LOCUS_15480 47559 47900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 48899 47928 gene locus_tag LOCUS_15490 gene cbiB 48899 47928 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932620.1 protein_id gnl|my_center|LOCUS_15490 50089 48884 gene locus_tag LOCUS_15500 50089 48884 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_15500 50346 50564 gene locus_tag LOCUS_15510 50346 50564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 50678 53332 gene locus_tag LOCUS_15520 gene aceE 50678 53332 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_15520 53368 55119 gene locus_tag LOCUS_15530 gene aceF 53368 55119 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035790.1 protein_id gnl|my_center|LOCUS_15530 55317 57092 gene locus_tag LOCUS_15540 gene lpdA 55317 57092 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459591.1 protein_id gnl|my_center|LOCUS_15540 57422 57123 gene locus_tag LOCUS_15550 57422 57123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 57973 57419 gene locus_tag LOCUS_15560 57973 57419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 58555 58136 gene locus_tag LOCUS_15570 58555 58136 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_15570 58941 59837 gene locus_tag LOCUS_15580 gene cpdA 58941 59837 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266482.1 protein_id gnl|my_center|LOCUS_15580 60201 59911 gene locus_tag LOCUS_15590 60201 59911 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958585.1 protein_id gnl|my_center|LOCUS_15590 60868 60260 gene locus_tag LOCUS_15600 60868 60260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 61196 61795 gene locus_tag LOCUS_15610 gene wrbA 61196 61795 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363251.1 protein_id gnl|my_center|LOCUS_15610 61798 62589 gene locus_tag LOCUS_15620 gene hda 61798 62589 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072789.1 protein_id gnl|my_center|LOCUS_15620 63198 62638 gene locus_tag LOCUS_15630 63198 62638 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_15630 63394 64467 gene locus_tag LOCUS_15640 gene purM 63394 64467 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112583.1 protein_id gnl|my_center|LOCUS_15640 64460 65134 gene locus_tag LOCUS_15650 gene purN 64460 65134 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_15650 65524 65246 gene locus_tag LOCUS_15660 65524 65246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 66095 65634 gene locus_tag LOCUS_15670 66095 65634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 66342 66656 gene locus_tag LOCUS_15680 66342 66656 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015097.1 protein_id gnl|my_center|LOCUS_15680 66781 67623 gene locus_tag LOCUS_15690 66781 67623 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258710.1 protein_id gnl|my_center|LOCUS_15690 68035 67853 gene locus_tag LOCUS_15700 68035 67853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 68299 69171 gene locus_tag LOCUS_15710 gene hslO 68299 69171 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070560.1 protein_id gnl|my_center|LOCUS_15710 69202 70452 gene locus_tag LOCUS_15720 69202 70452 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_15720 70739 70663 gene locus_tag LOCUS_t00250 70739 70663 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 71248 70850 gene locus_tag LOCUS_15730 71248 70850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 73606 71657 gene locus_tag LOCUS_15740 73606 71657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 75711 73933 gene locus_tag LOCUS_15750 75711 73933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 77277 76003 gene locus_tag LOCUS_15760 gene serS 77277 76003 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104505.1 protein_id gnl|my_center|LOCUS_15760 77591 77271 gene locus_tag LOCUS_15770 77591 77271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 77962 77588 gene locus_tag LOCUS_15780 gene crcB 77962 77588 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_15780 78601 78020 gene locus_tag LOCUS_15790 78601 78020 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477331.1 protein_id gnl|my_center|LOCUS_15790 79246 78632 gene locus_tag LOCUS_15800 79246 78632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124702.1 protein_id gnl|my_center|LOCUS_15800 79979 79257 gene locus_tag LOCUS_15810 79979 79257 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_15810 81278 79992 gene locus_tag LOCUS_15820 gene glgC 81278 79992 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154339.1 protein_id gnl|my_center|LOCUS_15820 82228 81440 gene locus_tag LOCUS_15830 gene pdxJ 82228 81440 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370292.1 protein_id gnl|my_center|LOCUS_15830 83088 82327 gene locus_tag LOCUS_15840 gene recO 83088 82327 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378472.1 protein_id gnl|my_center|LOCUS_15840 84012 83098 gene locus_tag LOCUS_15850 gene era 84012 83098 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363707.1 protein_id gnl|my_center|LOCUS_15850 84697 84005 gene locus_tag LOCUS_15860 gene rnc 84697 84005 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071557.1 protein_id gnl|my_center|LOCUS_15860 85091 84708 gene locus_tag LOCUS_15870 85091 84708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 85961 85134 gene locus_tag LOCUS_15880 gene lepB 85961 85134 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363711.1 protein_id gnl|my_center|LOCUS_15880 87920 86115 gene locus_tag LOCUS_15890 gene lepA 87920 86115 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085555.1 protein_id gnl|my_center|LOCUS_15890 89261 88140 gene locus_tag LOCUS_15900 89261 88140 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170771.1 protein_id gnl|my_center|LOCUS_15900 89713 90198 gene locus_tag LOCUS_15910 89713 90198 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545903.1 protein_id gnl|my_center|LOCUS_15910 90336 90899 gene locus_tag LOCUS_15920 90336 90899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 91547 90981 gene locus_tag LOCUS_15930 91547 90981 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038838.1 protein_id gnl|my_center|LOCUS_15930 91817 92035 gene locus_tag LOCUS_15940 91817 92035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 93133 92087 gene locus_tag LOCUS_15950 93133 92087 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044885.1 protein_id gnl|my_center|LOCUS_15950 94937 93237 gene locus_tag LOCUS_15960 94937 93237 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_15960 95511 96926 gene locus_tag LOCUS_15970 95511 96926 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_15970 97073 97417 gene locus_tag LOCUS_15980 97073 97417 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_15980 98288 97995 gene locus_tag LOCUS_15990 98288 97995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 98368 100230 gene locus_tag LOCUS_16000 98368 100230 CDS product CsoS2 family carboxysome shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124706.1 protein_id gnl|my_center|LOCUS_16000 100309 102012 gene locus_tag LOCUS_16010 100309 102012 CDS product carboxysome shell carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124707.1 protein_id gnl|my_center|LOCUS_16010 102014 102304 gene locus_tag LOCUS_16020 102014 102304 CDS product carboxysome peptide A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124708.1 protein_id gnl|my_center|LOCUS_16020 102270 102647 gene locus_tag LOCUS_16030 102270 102647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 102771 103076 gene locus_tag LOCUS_16040 102771 103076 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_16040 103163 103471 gene locus_tag LOCUS_16050 103163 103471 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_16050 103527 104003 gene locus_tag LOCUS_16060 gene bfr 103527 104003 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895015.1 protein_id gnl|my_center|LOCUS_16060 104016 104318 gene locus_tag LOCUS_16070 104016 104318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 104644 105654 gene locus_tag LOCUS_16080 104644 105654 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_16080 106944 105709 gene locus_tag LOCUS_16090 106944 105709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 109448 106941 gene locus_tag LOCUS_16100 109448 106941 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161963454.1 protein_id gnl|my_center|LOCUS_16100 109692 110702 gene locus_tag LOCUS_16110 109692 110702 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_16110 110953 111525 gene locus_tag LOCUS_16120 110953 111525 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_16120 111629 112150 gene locus_tag LOCUS_16130 111629 112150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 112173 113372 gene locus_tag LOCUS_16140 112173 113372 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933556.1 protein_id gnl|my_center|LOCUS_16140 113427 114047 gene locus_tag LOCUS_16150 113427 114047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 114080 114649 gene locus_tag LOCUS_16160 114080 114649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 115105 114680 gene locus_tag LOCUS_16170 gene dksA 115105 114680 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920436.1 protein_id gnl|my_center|LOCUS_16170 115815 117455 gene locus_tag LOCUS_16180 115815 117455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881423.1 protein_id gnl|my_center|LOCUS_16180 117546 118448 gene locus_tag LOCUS_16190 117546 118448 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_16190 118445 119047 gene locus_tag LOCUS_16200 118445 119047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 119041 119838 gene locus_tag LOCUS_16210 119041 119838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 120513 119935 gene locus_tag LOCUS_16220 120513 119935 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_16220 120738 122237 gene locus_tag LOCUS_16230 gene putP 120738 122237 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_16230 122234 122434 gene locus_tag LOCUS_16240 122234 122434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 122583 123269 gene locus_tag LOCUS_16250 gene phoB 122583 123269 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_16250 123308 124675 gene locus_tag LOCUS_16260 gene phoR 123308 124675 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704551.1 protein_id gnl|my_center|LOCUS_16260 125170 124829 gene locus_tag LOCUS_16270 gene ihfB 125170 124829 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705691.1 protein_id gnl|my_center|LOCUS_16270 126937 125258 gene locus_tag LOCUS_16280 gene rpsA 126937 125258 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_16280 127759 127082 gene locus_tag LOCUS_16290 gene cmk 127759 127082 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705689.1 protein_id gnl|my_center|LOCUS_16290 129105 127759 gene locus_tag LOCUS_16300 129105 127759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 129252 129554 gene locus_tag LOCUS_16310 gene yhbY 129252 129554 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036888.1 protein_id gnl|my_center|LOCUS_16310 130639 129674 gene locus_tag LOCUS_16320 130639 129674 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_16320 132591 130747 gene locus_tag LOCUS_16330 132591 130747 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_16330 134852 132840 gene locus_tag LOCUS_16340 134852 132840 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072991.1 protein_id gnl|my_center|LOCUS_16340 135837 134839 gene locus_tag LOCUS_16350 135837 134839 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_16350 136426 135902 gene locus_tag LOCUS_16360 136426 135902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 137360 136389 gene locus_tag LOCUS_16370 137360 136389 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948544.1 protein_id gnl|my_center|LOCUS_16370 138479 137430 gene locus_tag LOCUS_16380 138479 137430 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_16380 139291 138605 gene locus_tag LOCUS_16390 139291 138605 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025687389.1 protein_id gnl|my_center|LOCUS_16390 140050 139403 gene locus_tag LOCUS_16400 140050 139403 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528606.1 protein_id gnl|my_center|LOCUS_16400 140666 141577 gene locus_tag LOCUS_16410 gene nhaR 140666 141577 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_16410 142118 141813 gene locus_tag LOCUS_16420 142118 141813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 142967 142215 gene locus_tag LOCUS_16430 gene pssA 142967 142215 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_16430 143254 143748 gene locus_tag LOCUS_16440 gene hoxE 143254 143748 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257070.1 protein_id gnl|my_center|LOCUS_16440 143748 145358 gene locus_tag LOCUS_16450 143748 145358 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_16450 145425 146156 gene locus_tag LOCUS_16460 gene hoxU 145425 146156 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_16460 146153 146695 gene locus_tag LOCUS_16470 146153 146695 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_16470 146697 147023 gene locus_tag LOCUS_16480 146697 147023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 147147 148574 gene locus_tag LOCUS_16490 147147 148574 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_16490 148575 149123 gene locus_tag LOCUS_16500 148575 149123 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257075.1 protein_id gnl|my_center|LOCUS_16500 150842 149265 gene locus_tag LOCUS_16510 150842 149265 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_16510 151067 152038 gene locus_tag LOCUS_16520 151067 152038 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141596.1 protein_id gnl|my_center|LOCUS_16520 152132 152926 gene locus_tag LOCUS_16530 gene rsmA 152132 152926 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_16530 152973 155387 gene locus_tag LOCUS_16540 gene lon 152973 155387 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 protein_id gnl|my_center|LOCUS_16540 156289 155339 gene locus_tag LOCUS_16550 156289 155339 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082145856.1 protein_id gnl|my_center|LOCUS_16550 156549 157190 gene locus_tag LOCUS_16560 156549 157190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 157581 157303 gene locus_tag LOCUS_16570 157581 157303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 157746 160604 gene locus_tag LOCUS_16580 gene sucA 157746 160604 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551472.1 protein_id gnl|my_center|LOCUS_16580 160601 161860 gene locus_tag LOCUS_16590 gene odhB 160601 161860 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946280.1 protein_id gnl|my_center|LOCUS_16590 162618 161971 gene locus_tag LOCUS_16600 gene ubiX 162618 161971 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_16600 164055 162661 gene locus_tag LOCUS_16610 gene mpl 164055 162661 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707291.1 protein_id gnl|my_center|LOCUS_16610 164712 164200 gene locus_tag LOCUS_16620 164712 164200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 166453 164918 gene locus_tag LOCUS_16630 gene lnt 166453 164918 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118259.1 protein_id gnl|my_center|LOCUS_16630 167423 166617 gene locus_tag LOCUS_16640 gene gloB 167423 166617 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036190.1 protein_id gnl|my_center|LOCUS_16640 167586 170111 gene locus_tag LOCUS_16650 167586 170111 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228865.1 protein_id gnl|my_center|LOCUS_16650 170104 170550 gene locus_tag LOCUS_16660 170104 170550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 170641 171861 gene locus_tag LOCUS_16670 170641 171861 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_16670 173196 172036 gene locus_tag LOCUS_16680 173196 172036 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_16680 173684 173193 gene locus_tag LOCUS_16690 173684 173193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 174860 173760 gene locus_tag LOCUS_16700 gene hemH 174860 173760 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073218.1 protein_id gnl|my_center|LOCUS_16700 175499 174945 gene locus_tag LOCUS_16710 175499 174945 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262566.1 protein_id gnl|my_center|LOCUS_16710 177705 175945 gene locus_tag LOCUS_16720 177705 175945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 178167 177784 gene locus_tag LOCUS_16730 178167 177784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 179822 178224 gene locus_tag LOCUS_16740 179822 178224 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169689.1 protein_id gnl|my_center|LOCUS_16740 181225 179840 gene locus_tag LOCUS_16750 gene thrC 181225 179840 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_16750 181715 181972 gene locus_tag LOCUS_16760 181715 181972 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_16760 181986 183791 gene locus_tag LOCUS_16770 181986 183791 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_16770 183969 185834 gene locus_tag LOCUS_16780 183969 185834 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720742.1 protein_id gnl|my_center|LOCUS_16780 185904 186521 gene locus_tag LOCUS_16790 185904 186521 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014261.1 protein_id gnl|my_center|LOCUS_16790 186822 188768 gene locus_tag LOCUS_16800 gene acs 186822 188768 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 protein_id gnl|my_center|LOCUS_16800 188891 189724 gene locus_tag LOCUS_16810 188891 189724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 189746 191461 gene locus_tag LOCUS_16820 gene pilB 189746 191461 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_16820 191473 192720 gene locus_tag LOCUS_16830 191473 192720 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_16830 192766 193650 gene locus_tag LOCUS_16840 192766 193650 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770019.1 protein_id gnl|my_center|LOCUS_16840 193664 194308 gene locus_tag LOCUS_16850 gene coaE 193664 194308 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209319.1 protein_id gnl|my_center|LOCUS_16850 194925 196447 gene locus_tag LOCUS_r00010 194925 196447 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 196526 196602 gene locus_tag LOCUS_t00260 196526 196602 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 196626 196701 gene locus_tag LOCUS_t00270 196626 196701 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 196870 199755 gene locus_tag LOCUS_r00020 196870 199755 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 199845 199955 gene locus_tag LOCUS_r00030 199845 199955 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 200476 200114 gene locus_tag LOCUS_16860 200476 200114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 202524 200770 gene locus_tag LOCUS_16870 202524 200770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 202894 203583 gene locus_tag LOCUS_16880 202894 203583 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943739.1 protein_id gnl|my_center|LOCUS_16880 203755 204312 gene locus_tag LOCUS_16890 203755 204312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 206081 204378 gene locus_tag LOCUS_16900 gene ureC 206081 204378 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269033.1 protein_id gnl|my_center|LOCUS_16900 206398 206078 gene locus_tag LOCUS_16910 206398 206078 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720474.1 protein_id gnl|my_center|LOCUS_16910 206810 206508 gene locus_tag LOCUS_16920 gene ureA 206810 206508 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317023.1 protein_id gnl|my_center|LOCUS_16920 208067 207210 gene locus_tag LOCUS_16930 208067 207210 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098766.1 protein_id gnl|my_center|LOCUS_16930 210115 208130 gene locus_tag LOCUS_16940 210115 208130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 211873 210650 gene locus_tag LOCUS_16950 211873 210650 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 protein_id gnl|my_center|LOCUS_16950 214120 211889 gene locus_tag LOCUS_16960 gene pta 214120 211889 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_16960 215231 214200 gene locus_tag LOCUS_16970 215231 214200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 215997 215452 gene locus_tag LOCUS_16980 gene nudE 215997 215452 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017765235.1 protein_id gnl|my_center|LOCUS_16980 216014 216766 gene locus_tag LOCUS_16990 gene yrfG 216014 216766 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_16990 218434 216875 gene locus_tag LOCUS_17000 gene rhlB 218434 216875 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038857.1 protein_id gnl|my_center|LOCUS_17000 218683 219009 gene locus_tag LOCUS_17010 gene trxA 218683 219009 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence007 138 386 gene locus_tag LOCUS_17020 138 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 422 1789 gene locus_tag LOCUS_17030 422 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1981 3447 gene locus_tag LOCUS_17040 1981 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 3444 3866 gene locus_tag LOCUS_17050 3444 3866 CDS product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071519.1 protein_id gnl|my_center|LOCUS_17050 3863 4279 gene locus_tag LOCUS_17060 3863 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 6825 4438 gene locus_tag LOCUS_17070 6825 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 6751 7074 gene locus_tag LOCUS_17080 6751 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 7075 7284 gene locus_tag LOCUS_17090 7075 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 8367 7513 gene locus_tag LOCUS_17100 8367 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 9033 8401 gene locus_tag LOCUS_17110 9033 8401 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170954.1 protein_id gnl|my_center|LOCUS_17110 9288 9052 gene locus_tag LOCUS_17120 9288 9052 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073163.1 protein_id gnl|my_center|LOCUS_17120 10060 9548 gene locus_tag LOCUS_17130 10060 9548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 10347 10898 gene locus_tag LOCUS_17140 10347 10898 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263183.1 protein_id gnl|my_center|LOCUS_17140 10967 11707 gene locus_tag LOCUS_17150 10967 11707 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_17150 11807 12583 gene locus_tag LOCUS_17160 11807 12583 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 protein_id gnl|my_center|LOCUS_17160 14766 12658 gene locus_tag LOCUS_17170 14766 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 15404 17164 gene locus_tag LOCUS_17180 15404 17164 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_17180 18619 17174 gene locus_tag LOCUS_17190 18619 17174 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275393.1 protein_id gnl|my_center|LOCUS_17190 19711 18779 gene locus_tag LOCUS_17200 19711 18779 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533906.1 protein_id gnl|my_center|LOCUS_17200 19956 22634 gene locus_tag LOCUS_17210 19956 22634 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040039036.1 protein_id gnl|my_center|LOCUS_17210 24299 22758 gene locus_tag LOCUS_17220 24299 22758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 25008 24481 gene locus_tag LOCUS_17230 25008 24481 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 protein_id gnl|my_center|LOCUS_17230 27194 25254 gene locus_tag LOCUS_17240 gene ftsH 27194 25254 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 protein_id gnl|my_center|LOCUS_17240 27561 27343 gene locus_tag LOCUS_17250 27561 27343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 27524 28417 gene locus_tag LOCUS_17260 27524 28417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 29021 28482 gene locus_tag LOCUS_17270 29021 28482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 29231 30307 gene locus_tag LOCUS_17280 gene nagZ 29231 30307 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118092.1 protein_id gnl|my_center|LOCUS_17280 30304 30855 gene locus_tag LOCUS_17290 30304 30855 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957989.1 protein_id gnl|my_center|LOCUS_17290 31072 31542 gene locus_tag LOCUS_17300 31072 31542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 31668 32417 gene locus_tag LOCUS_17310 31668 32417 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_17310 32499 33656 gene locus_tag LOCUS_17320 32499 33656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 34460 33927 gene locus_tag LOCUS_17330 34460 33927 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996506.1 protein_id gnl|my_center|LOCUS_17330 34985 35443 gene locus_tag LOCUS_17340 gene rimP 34985 35443 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456065.1 protein_id gnl|my_center|LOCUS_17340 35526 37028 gene locus_tag LOCUS_17350 gene nusA 35526 37028 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707075.1 protein_id gnl|my_center|LOCUS_17350 37046 39937 gene locus_tag LOCUS_17360 37046 39937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 39942 40352 gene locus_tag LOCUS_17370 gene rbfA 39942 40352 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377505.1 protein_id gnl|my_center|LOCUS_17370 40336 41253 gene locus_tag LOCUS_17380 gene truB 40336 41253 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958222.1 protein_id gnl|my_center|LOCUS_17380 41370 41639 gene locus_tag LOCUS_17390 gene rpsO 41370 41639 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_17390 41805 43904 gene locus_tag LOCUS_17400 gene pnp 41805 43904 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037640.1 protein_id gnl|my_center|LOCUS_17400 44026 44769 gene locus_tag LOCUS_17410 44026 44769 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814179.1 protein_id gnl|my_center|LOCUS_17410 45679 44900 gene locus_tag LOCUS_17420 45679 44900 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_17420 46413 45676 gene locus_tag LOCUS_17430 46413 45676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 protein_id gnl|my_center|LOCUS_17430 47519 46410 gene locus_tag LOCUS_17440 47519 46410 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920485.1 protein_id gnl|my_center|LOCUS_17440 48235 47534 gene locus_tag LOCUS_17450 48235 47534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 48830 48405 gene locus_tag LOCUS_17460 48830 48405 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957854.1 protein_id gnl|my_center|LOCUS_17460 48923 50338 gene locus_tag LOCUS_17470 gene gltX 48923 50338 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707206.1 protein_id gnl|my_center|LOCUS_17470 50436 51914 gene locus_tag LOCUS_17480 gene glgA 50436 51914 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_17480 51948 53768 gene locus_tag LOCUS_17490 51948 53768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 54211 54423 gene locus_tag LOCUS_17500 54211 54423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 54441 54872 gene locus_tag LOCUS_17510 54441 54872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 54952 55089 gene locus_tag LOCUS_17520 54952 55089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 55111 55275 gene locus_tag LOCUS_17530 55111 55275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 55648 56079 gene locus_tag LOCUS_17540 55648 56079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 57733 56354 gene locus_tag LOCUS_17550 57733 56354 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_17550 59621 57825 gene locus_tag LOCUS_17560 59621 57825 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_17560 60267 59626 gene locus_tag LOCUS_17570 60267 59626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 60781 60425 gene locus_tag LOCUS_17580 60781 60425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 61274 60825 gene locus_tag LOCUS_17590 61274 60825 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869272.1 protein_id gnl|my_center|LOCUS_17590 63292 61370 gene locus_tag LOCUS_17600 63292 61370 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_17600 64405 63335 gene locus_tag LOCUS_17610 64405 63335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 64793 64476 gene locus_tag LOCUS_17620 64793 64476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 66636 65038 gene locus_tag LOCUS_17630 66636 65038 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035422.1 protein_id gnl|my_center|LOCUS_17630 67385 66633 gene locus_tag LOCUS_17640 67385 66633 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035421.1 protein_id gnl|my_center|LOCUS_17640 67920 67519 gene locus_tag LOCUS_17650 67920 67519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 68075 70210 gene locus_tag LOCUS_17660 68075 70210 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943374.1 protein_id gnl|my_center|LOCUS_17660 70286 71125 gene locus_tag LOCUS_17670 70286 71125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 72134 71166 gene locus_tag LOCUS_17680 72134 71166 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947351.1 protein_id gnl|my_center|LOCUS_17680 72382 73719 gene locus_tag LOCUS_17690 72382 73719 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946436.1 protein_id gnl|my_center|LOCUS_17690 73723 74823 gene locus_tag LOCUS_17700 gene aroC 73723 74823 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706197.1 protein_id gnl|my_center|LOCUS_17700 74877 76040 gene locus_tag LOCUS_17710 74877 76040 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_17710 76208 78298 gene locus_tag LOCUS_17720 gene glgX 76208 78298 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021995.1 protein_id gnl|my_center|LOCUS_17720 78428 79651 gene locus_tag LOCUS_17730 78428 79651 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 protein_id gnl|my_center|LOCUS_17730 79707 80789 gene locus_tag LOCUS_17740 79707 80789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 81044 80871 gene locus_tag LOCUS_17750 81044 80871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 81273 81581 gene locus_tag LOCUS_17760 81273 81581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 82080 81724 gene locus_tag LOCUS_17770 82080 81724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 82256 84433 gene locus_tag LOCUS_17780 82256 84433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 84913 84590 gene locus_tag LOCUS_17790 84913 84590 CDS product DUF1840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463615.1 protein_id gnl|my_center|LOCUS_17790 85325 86998 gene locus_tag LOCUS_17800 85325 86998 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113586.1 protein_id gnl|my_center|LOCUS_17800 86995 87573 gene locus_tag LOCUS_17810 86995 87573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 87634 88263 gene locus_tag LOCUS_17820 87634 88263 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002761477.1 protein_id gnl|my_center|LOCUS_17820 89727 88342 gene locus_tag LOCUS_17830 gene glrR 89727 88342 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 protein_id gnl|my_center|LOCUS_17830 90455 89724 gene locus_tag LOCUS_17840 90455 89724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 91948 90452 gene locus_tag LOCUS_17850 gene qseE 91948 90452 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309666.1 protein_id gnl|my_center|LOCUS_17850 92048 91964 gene locus_tag LOCUS_t00280 92048 91964 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 93062 92379 gene locus_tag LOCUS_17860 gene soxX 93062 92379 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228665.1 protein_id gnl|my_center|LOCUS_17860 93935 93093 gene locus_tag LOCUS_17870 93935 93093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 94438 96192 gene locus_tag LOCUS_17880 gene soxB 94438 96192 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_17880 96552 96860 gene locus_tag LOCUS_17890 96552 96860 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388394.1 protein_id gnl|my_center|LOCUS_17890 96857 98590 gene locus_tag LOCUS_17900 96857 98590 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388393.1 protein_id gnl|my_center|LOCUS_17900 98842 100008 gene locus_tag LOCUS_17910 98842 100008 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771029.1 protein_id gnl|my_center|LOCUS_17910 101090 100212 gene locus_tag LOCUS_17920 101090 100212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 102002 102937 gene locus_tag LOCUS_17930 102002 102937 CDS product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_17930 102934 106422 gene locus_tag LOCUS_17940 102934 106422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 protein_id gnl|my_center|LOCUS_17940 106415 107221 gene locus_tag LOCUS_17950 106415 107221 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_17950 107379 109583 gene locus_tag LOCUS_17960 107379 109583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 109583 111232 gene locus_tag LOCUS_17970 109583 111232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 111232 116673 gene locus_tag LOCUS_17980 111232 116673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 116737 117546 gene locus_tag LOCUS_17990 116737 117546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 117543 118754 gene locus_tag LOCUS_18000 117543 118754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 118747 120057 gene locus_tag LOCUS_18010 118747 120057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 120054 121568 gene locus_tag LOCUS_18020 120054 121568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 121579 123765 gene locus_tag LOCUS_18030 121579 123765 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068365407.1 protein_id gnl|my_center|LOCUS_18030 123784 124053 gene locus_tag LOCUS_18040 123784 124053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 124050 124931 gene locus_tag LOCUS_18050 124050 124931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 125027 129520 gene locus_tag LOCUS_18060 125027 129520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 129561 130727 gene locus_tag LOCUS_18070 129561 130727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 130724 133564 gene locus_tag LOCUS_18080 130724 133564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 133790 135028 gene locus_tag LOCUS_18090 133790 135028 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 protein_id gnl|my_center|LOCUS_18090 135087 137729 gene locus_tag LOCUS_18100 135087 137729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 138866 137850 gene locus_tag LOCUS_18110 138866 137850 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_18110 142638 139030 gene locus_tag LOCUS_18120 gene nifJ 142638 139030 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_18120 142993 144576 gene locus_tag LOCUS_18130 142993 144576 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403632.1 protein_id gnl|my_center|LOCUS_18130 145120 144599 gene locus_tag LOCUS_18140 gene rimI 145120 144599 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_18140 145472 147052 gene locus_tag LOCUS_18150 145472 147052 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037984.1 protein_id gnl|my_center|LOCUS_18150 147258 147503 gene locus_tag LOCUS_18160 147258 147503 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073688.1 protein_id gnl|my_center|LOCUS_18160 148598 147594 gene locus_tag LOCUS_18170 148598 147594 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210074.1 protein_id gnl|my_center|LOCUS_18170 150301 148763 gene locus_tag LOCUS_18180 150301 148763 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064992.1 protein_id gnl|my_center|LOCUS_18180 150670 150746 gene locus_tag LOCUS_t00290 150670 150746 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 150867 152786 gene locus_tag LOCUS_18190 gene thrS 150867 152786 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443963.1 protein_id gnl|my_center|LOCUS_18190 152919 153380 gene locus_tag LOCUS_18200 gene infC 152919 153380 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072302.1 protein_id gnl|my_center|LOCUS_18200 153531 153728 gene locus_tag LOCUS_18210 gene rpmI 153531 153728 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811096.1 protein_id gnl|my_center|LOCUS_18210 153766 154122 gene locus_tag LOCUS_18220 gene rplT 153766 154122 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948412.1 protein_id gnl|my_center|LOCUS_18220 154204 155280 gene locus_tag LOCUS_18230 gene pheS 154204 155280 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_18230 155458 157836 gene locus_tag LOCUS_18240 gene pheT 155458 157836 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114408.1 protein_id gnl|my_center|LOCUS_18240 157841 158140 gene locus_tag LOCUS_18250 gene ihfA 157841 158140 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 protein_id gnl|my_center|LOCUS_18250 158121 158495 gene locus_tag LOCUS_18260 158121 158495 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995911.1 protein_id gnl|my_center|LOCUS_18260 158533 158609 gene locus_tag LOCUS_t00300 158533 158609 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 158952 160142 gene locus_tag LOCUS_18270 158952 160142 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946051.1 protein_id gnl|my_center|LOCUS_18270 161034 160225 gene locus_tag LOCUS_18280 161034 160225 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101003.1 protein_id gnl|my_center|LOCUS_18280 161402 163300 gene locus_tag LOCUS_18290 161402 163300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 163321 168318 gene locus_tag LOCUS_18300 163321 168318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 168369 171563 gene locus_tag LOCUS_18310 168369 171563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 171560 174325 gene locus_tag LOCUS_18320 171560 174325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 174322 175080 gene locus_tag LOCUS_18330 174322 175080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 175059 176012 gene locus_tag LOCUS_18340 175059 176012 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121324.1 protein_id gnl|my_center|LOCUS_18340 176110 176829 gene locus_tag LOCUS_18350 176110 176829 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence008 360 1475 gene locus_tag LOCUS_18360 360 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1915 1529 gene locus_tag LOCUS_18370 1915 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 3198 3683 gene locus_tag LOCUS_18380 3198 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 3753 4901 gene locus_tag LOCUS_18390 3753 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 5123 6685 gene locus_tag LOCUS_18400 5123 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 6744 7559 gene locus_tag LOCUS_18410 6744 7559 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061715.1 protein_id gnl|my_center|LOCUS_18410 8168 7842 gene locus_tag LOCUS_18420 8168 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18420 8708 10051 gene locus_tag LOCUS_18430 8708 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 10812 12017 gene locus_tag LOCUS_18440 10812 12017 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089037.1 protein_id gnl|my_center|LOCUS_18440 12049 13119 gene locus_tag LOCUS_18450 12049 13119 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205352220.1 protein_id gnl|my_center|LOCUS_18450 14074 15219 gene locus_tag LOCUS_18460 14074 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 15339 16652 gene locus_tag LOCUS_18470 15339 16652 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222478.1 protein_id gnl|my_center|LOCUS_18470 17564 16716 gene locus_tag LOCUS_18480 17564 16716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 17895 18344 gene locus_tag LOCUS_18490 17895 18344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 18474 19631 gene locus_tag LOCUS_18500 18474 19631 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_18500 20403 19666 gene locus_tag LOCUS_18510 20403 19666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 20904 23300 gene locus_tag LOCUS_18520 20904 23300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 23705 24829 gene locus_tag LOCUS_18530 23705 24829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 24993 25835 gene locus_tag LOCUS_18540 24993 25835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 25938 26402 gene locus_tag LOCUS_18550 25938 26402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 27569 26598 gene locus_tag LOCUS_18560 27569 26598 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205164.1 protein_id gnl|my_center|LOCUS_18560 28598 27603 gene locus_tag LOCUS_18570 28598 27603 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305130.1 protein_id gnl|my_center|LOCUS_18570 29591 28620 gene locus_tag LOCUS_18580 29591 28620 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706514.1 protein_id gnl|my_center|LOCUS_18580 29875 33732 gene locus_tag LOCUS_18590 29875 33732 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815152.1 protein_id gnl|my_center|LOCUS_18590 34325 33780 gene locus_tag LOCUS_18600 34325 33780 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809303.1 protein_id gnl|my_center|LOCUS_18600 34921 34322 gene locus_tag LOCUS_18610 34921 34322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 35801 34914 gene locus_tag LOCUS_18620 35801 34914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 36310 37602 gene locus_tag LOCUS_18630 gene hcp 36310 37602 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391685.1 protein_id gnl|my_center|LOCUS_18630 37874 38695 gene locus_tag LOCUS_18640 37874 38695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 38815 41280 gene locus_tag LOCUS_18650 38815 41280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 41280 42914 gene locus_tag LOCUS_18660 41280 42914 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967728.1 protein_id gnl|my_center|LOCUS_18660 42925 45090 gene locus_tag LOCUS_18670 gene pbpC 42925 45090 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494094.1 protein_id gnl|my_center|LOCUS_18670 45234 45734 gene locus_tag LOCUS_18680 45234 45734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 46783 45908 gene locus_tag LOCUS_18690 46783 45908 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037344.1 protein_id gnl|my_center|LOCUS_18690 47083 47859 gene locus_tag LOCUS_18700 47083 47859 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 protein_id gnl|my_center|LOCUS_18700 47856 48941 gene locus_tag LOCUS_18710 gene cobD 47856 48941 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_18710 49295 49738 gene locus_tag LOCUS_18720 49295 49738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 50414 49671 gene locus_tag LOCUS_18730 50414 49671 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258597.1 protein_id gnl|my_center|LOCUS_18730 52640 50478 gene locus_tag LOCUS_18740 gene rlmKL 52640 50478 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_18740 55378 52811 gene locus_tag LOCUS_18750 gene hrpB 55378 52811 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_18750 55550 56323 gene locus_tag LOCUS_18760 55550 56323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 56673 56470 gene locus_tag LOCUS_18770 56673 56470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 57164 56811 gene locus_tag LOCUS_18780 57164 56811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 58104 57244 gene locus_tag LOCUS_18790 58104 57244 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_18790 59143 58172 gene locus_tag LOCUS_18800 59143 58172 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550079.1 protein_id gnl|my_center|LOCUS_18800 59464 60294 gene locus_tag LOCUS_18810 59464 60294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 protein_id gnl|my_center|LOCUS_18810 60459 64058 gene locus_tag LOCUS_18820 60459 64058 CDS product rhamnan synthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184046094.1 protein_id gnl|my_center|LOCUS_18820 64066 64995 gene locus_tag LOCUS_18830 64066 64995 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331295.1 protein_id gnl|my_center|LOCUS_18830 65041 66408 gene locus_tag LOCUS_18840 65041 66408 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534035.1 protein_id gnl|my_center|LOCUS_18840 66408 67457 gene locus_tag LOCUS_18850 66408 67457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 67497 70538 gene locus_tag LOCUS_18860 67497 70538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 70649 72010 gene locus_tag LOCUS_18870 70649 72010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 72014 73180 gene locus_tag LOCUS_18880 72014 73180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 73177 74976 gene locus_tag LOCUS_18890 73177 74976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 75106 76944 gene locus_tag LOCUS_18900 gene asnB 75106 76944 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_18900 78856 76949 gene locus_tag LOCUS_18910 78856 76949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 79725 78853 gene locus_tag LOCUS_18920 79725 78853 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_18920 80423 79722 gene locus_tag LOCUS_18930 80423 79722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 82312 80420 gene locus_tag LOCUS_18940 gene asnB 82312 80420 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_18940 84416 82431 gene locus_tag LOCUS_18950 84416 82431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 84847 85974 gene locus_tag LOCUS_18960 84847 85974 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_18960 85974 87143 gene locus_tag LOCUS_18970 85974 87143 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808458.1 protein_id gnl|my_center|LOCUS_18970 87160 89130 gene locus_tag LOCUS_18980 gene asnB 87160 89130 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_18980 89139 90281 gene locus_tag LOCUS_18990 89139 90281 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 protein_id gnl|my_center|LOCUS_18990 90378 91655 gene locus_tag LOCUS_19000 90378 91655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 92019 94229 gene locus_tag LOCUS_19010 92019 94229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 94637 96766 gene locus_tag LOCUS_19020 94637 96766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 96884 98989 gene locus_tag LOCUS_19030 96884 98989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 98992 100038 gene locus_tag LOCUS_19040 98992 100038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 101065 100076 gene locus_tag LOCUS_19050 101065 100076 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_19050 101087 102043 gene locus_tag LOCUS_19060 101087 102043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_19060 102286 104544 gene locus_tag LOCUS_19070 gene parC 102286 104544 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_19070 104919 104575 gene locus_tag LOCUS_19080 104919 104575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 105089 105772 gene locus_tag LOCUS_19090 105089 105772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257318.1 protein_id gnl|my_center|LOCUS_19090 106243 105767 gene locus_tag LOCUS_19100 106243 105767 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948332.1 protein_id gnl|my_center|LOCUS_19100 106370 107662 gene locus_tag LOCUS_19110 106370 107662 CDS product PqiA/YebS family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820402.1 protein_id gnl|my_center|LOCUS_19110 107610 109295 gene locus_tag LOCUS_19120 107610 109295 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522112.1 protein_id gnl|my_center|LOCUS_19120 109292 109969 gene locus_tag LOCUS_19130 109292 109969 CDS product PqiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940386.1 protein_id gnl|my_center|LOCUS_19130 110410 110108 gene locus_tag LOCUS_19140 110410 110108 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_19140 111272 110493 gene locus_tag LOCUS_19150 111272 110493 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219159941.1 protein_id gnl|my_center|LOCUS_19150 111551 112225 gene locus_tag LOCUS_19160 111551 112225 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_19160 112231 113109 gene locus_tag LOCUS_19170 112231 113109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 113916 113170 gene locus_tag LOCUS_19180 113916 113170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 114287 115174 gene locus_tag LOCUS_19190 114287 115174 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_19190 115184 115807 gene locus_tag LOCUS_19200 115184 115807 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229052.1 protein_id gnl|my_center|LOCUS_19200 115878 116549 gene locus_tag LOCUS_19210 115878 116549 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_19210 116566 117783 gene locus_tag LOCUS_19220 116566 117783 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356903.1 protein_id gnl|my_center|LOCUS_19220 117909 118730 gene locus_tag LOCUS_19230 117909 118730 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404131.1 protein_id gnl|my_center|LOCUS_19230 118723 119469 gene locus_tag LOCUS_19240 118723 119469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 119592 120497 gene locus_tag LOCUS_19250 gene rluB 119592 120497 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072841.1 protein_id gnl|my_center|LOCUS_19250 120618 121919 gene locus_tag LOCUS_19260 120618 121919 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_19260 122000 123106 gene locus_tag LOCUS_19270 122000 123106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 123639 123157 gene locus_tag LOCUS_19280 gene ybaK 123639 123157 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943709.1 protein_id gnl|my_center|LOCUS_19280 124399 123749 gene locus_tag LOCUS_19290 124399 123749 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_19290 124543 125880 gene locus_tag LOCUS_19300 124543 125880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 125914 126522 gene locus_tag LOCUS_19310 125914 126522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 126662 127438 gene locus_tag LOCUS_19320 126662 127438 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403012.1 protein_id gnl|my_center|LOCUS_19320 128810 127533 gene locus_tag LOCUS_19330 128810 127533 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_19330 128892 129389 gene locus_tag LOCUS_19340 128892 129389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 129386 130024 gene locus_tag LOCUS_19350 129386 130024 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_19350 130536 130186 gene locus_tag LOCUS_19360 gene folB 130536 130186 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369633.1 protein_id gnl|my_center|LOCUS_19360 130642 131229 gene locus_tag LOCUS_19370 gene plsY 130642 131229 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021296.1 protein_id gnl|my_center|LOCUS_19370 132741 131317 gene locus_tag LOCUS_19380 gene cysG 132741 131317 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_19380 132838 133149 gene locus_tag LOCUS_19390 132838 133149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 133335 133565 gene locus_tag LOCUS_19400 133335 133565 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932528.1 protein_id gnl|my_center|LOCUS_19400 133627 134109 gene locus_tag LOCUS_19410 133627 134109 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_19410 135578 134337 gene locus_tag LOCUS_19420 135578 134337 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938840.1 protein_id gnl|my_center|LOCUS_19420 136230 136036 gene locus_tag LOCUS_19430 136230 136036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 136144 136977 gene locus_tag LOCUS_19440 136144 136977 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_19440 137133 137489 gene locus_tag LOCUS_19450 137133 137489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 137486 138556 gene locus_tag LOCUS_19460 137486 138556 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_19460 138577 139683 gene locus_tag LOCUS_19470 138577 139683 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_19470 140174 139917 gene locus_tag LOCUS_19480 140174 139917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 140662 140318 gene locus_tag LOCUS_19490 140662 140318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 141423 140743 gene locus_tag LOCUS_19500 141423 140743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 142574 141450 gene locus_tag LOCUS_19510 142574 141450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 142986 142911 gene locus_tag LOCUS_t00310 142986 142911 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 143426 143650 gene locus_tag LOCUS_19520 143426 143650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 143675 143929 gene locus_tag LOCUS_19530 143675 143929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 143943 145826 gene locus_tag LOCUS_19540 gene uvrC 143943 145826 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_19540 145830 146399 gene locus_tag LOCUS_19550 gene pgsA 145830 146399 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_19550 146471 146546 gene locus_tag LOCUS_t00320 146471 146546 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence009 1536 316 gene locus_tag LOCUS_19560 gene tyrS 1536 316 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_19560 2425 2078 gene locus_tag LOCUS_19570 gene erpA 2425 2078 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_19570 3132 5294 gene locus_tag LOCUS_19580 gene uvrD 3132 5294 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070819.1 protein_id gnl|my_center|LOCUS_19580 5371 6591 gene locus_tag LOCUS_19590 5371 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 6656 7744 gene locus_tag LOCUS_19600 gene dctP 6656 7744 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_19600 7741 8979 gene locus_tag LOCUS_19610 gene hemW 7741 8979 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 protein_id gnl|my_center|LOCUS_19610 9067 9324 gene locus_tag LOCUS_19620 gene rpmE 9067 9324 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768737.1 protein_id gnl|my_center|LOCUS_19620 9795 10745 gene locus_tag LOCUS_19630 gene mdh 9795 10745 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_19630 10926 12221 gene locus_tag LOCUS_19640 gene gltA 10926 12221 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389475.1 protein_id gnl|my_center|LOCUS_19640 12950 12324 gene locus_tag LOCUS_19650 12950 12324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 13185 14258 gene locus_tag LOCUS_19660 13185 14258 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_19660 14259 14906 gene locus_tag LOCUS_19670 14259 14906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 14928 15530 gene locus_tag LOCUS_19680 gene pilO 14928 15530 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_19680 15530 16066 gene locus_tag LOCUS_19690 15530 16066 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_19690 16155 18437 gene locus_tag LOCUS_19700 gene pilQ 16155 18437 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_19700 18614 19138 gene locus_tag LOCUS_19710 gene aroK 18614 19138 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245596.1 protein_id gnl|my_center|LOCUS_19710 19202 20284 gene locus_tag LOCUS_19720 gene aroB 19202 20284 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114574.1 protein_id gnl|my_center|LOCUS_19720 20766 25421 gene locus_tag LOCUS_19730 gene gltB 20766 25421 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066927.1 protein_id gnl|my_center|LOCUS_19730 25414 26880 gene locus_tag LOCUS_19740 25414 26880 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_19740 27106 28323 gene locus_tag LOCUS_19750 27106 28323 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990431.1 protein_id gnl|my_center|LOCUS_19750 28336 29391 gene locus_tag LOCUS_19760 28336 29391 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_19760 31752 29575 gene locus_tag LOCUS_19770 gene gspD 31752 29575 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394575.1 protein_id gnl|my_center|LOCUS_19770 32411 31794 gene locus_tag LOCUS_19780 32411 31794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 33016 32408 gene locus_tag LOCUS_19790 33016 32408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 33807 33013 gene locus_tag LOCUS_19800 33807 33013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 33964 34200 gene locus_tag LOCUS_19810 33964 34200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 35309 34383 gene locus_tag LOCUS_19820 35309 34383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 36025 35306 gene locus_tag LOCUS_19830 36025 35306 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_244625321.1 protein_id gnl|my_center|LOCUS_19830 36522 36112 gene locus_tag LOCUS_19840 36522 36112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 37011 36538 gene locus_tag LOCUS_19850 37011 36538 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088759.1 protein_id gnl|my_center|LOCUS_19850 37465 37037 gene locus_tag LOCUS_19860 gene gspG 37465 37037 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_19860 38777 37572 gene locus_tag LOCUS_19870 38777 37572 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035901.1 protein_id gnl|my_center|LOCUS_19870 40763 38895 gene locus_tag LOCUS_19880 gene gspE 40763 38895 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 protein_id gnl|my_center|LOCUS_19880 41901 40858 gene locus_tag LOCUS_19890 41901 40858 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186499.1 protein_id gnl|my_center|LOCUS_19890 42557 42111 gene locus_tag LOCUS_19900 42557 42111 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_19900 42447 42749 gene locus_tag LOCUS_19910 42447 42749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 44097 42736 gene locus_tag LOCUS_19920 gene cptA 44097 42736 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_19920 45728 44499 gene locus_tag LOCUS_19930 45728 44499 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_19930 45959 46360 gene locus_tag LOCUS_19940 45959 46360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 46530 46958 gene locus_tag LOCUS_19950 46530 46958 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208978.1 protein_id gnl|my_center|LOCUS_19950 47150 47650 gene locus_tag LOCUS_19960 gene secB 47150 47650 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003370.1 protein_id gnl|my_center|LOCUS_19960 47659 48657 gene locus_tag LOCUS_19970 gene gpsA 47659 48657 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 protein_id gnl|my_center|LOCUS_19970 49236 48748 gene locus_tag LOCUS_19980 49236 48748 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035465.1 protein_id gnl|my_center|LOCUS_19980 49419 49643 gene locus_tag LOCUS_19990 49419 49643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 50199 49795 gene locus_tag LOCUS_20000 50199 49795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 51752 50325 gene locus_tag LOCUS_20010 gene ntrC 51752 50325 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_20010 52827 51745 gene locus_tag LOCUS_20020 gene ntrB 52827 51745 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_20020 53751 53224 gene locus_tag LOCUS_20030 53751 53224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 55284 53881 gene locus_tag LOCUS_20040 gene glnA 55284 53881 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811164.1 protein_id gnl|my_center|LOCUS_20040 56966 55836 gene locus_tag LOCUS_20050 56966 55836 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958179.1 protein_id gnl|my_center|LOCUS_20050 57236 58156 gene locus_tag LOCUS_20060 gene glyQ 57236 58156 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039156.1 protein_id gnl|my_center|LOCUS_20060 58153 60258 gene locus_tag LOCUS_20070 gene glyS 58153 60258 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693270.1 protein_id gnl|my_center|LOCUS_20070 60275 60820 gene locus_tag LOCUS_20080 gene gmhB 60275 60820 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120688.1 protein_id gnl|my_center|LOCUS_20080 60813 61601 gene locus_tag LOCUS_20090 60813 61601 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_20090 64010 61605 gene locus_tag LOCUS_20100 gene gyrB 64010 61605 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220005.1 protein_id gnl|my_center|LOCUS_20100 65921 64812 gene locus_tag LOCUS_20110 gene recF 65921 64812 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260900.1 protein_id gnl|my_center|LOCUS_20110 67034 65934 gene locus_tag LOCUS_20120 gene dnaN 67034 65934 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097262.1 protein_id gnl|my_center|LOCUS_20120 68671 67229 gene locus_tag LOCUS_20130 gene dnaA 68671 67229 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945763.1 protein_id gnl|my_center|LOCUS_20130 69384 69620 gene locus_tag LOCUS_20140 gene yidD 69384 69620 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 protein_id gnl|my_center|LOCUS_20140 69613 71301 gene locus_tag LOCUS_20150 gene yidC 69613 71301 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114648.1 protein_id gnl|my_center|LOCUS_20150 71332 72672 gene locus_tag LOCUS_20160 gene mnmE 71332 72672 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244945.1 protein_id gnl|my_center|LOCUS_20160 73381 72776 gene locus_tag LOCUS_20170 73381 72776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 73478 75586 gene locus_tag LOCUS_20180 73478 75586 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_20180 76938 75667 gene locus_tag LOCUS_20190 76938 75667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 79016 77055 gene locus_tag LOCUS_20200 79016 77055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 79289 84199 gene locus_tag LOCUS_20210 79289 84199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 84734 84405 gene locus_tag LOCUS_20220 84734 84405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 84945 85181 gene locus_tag LOCUS_20230 gene rpmB 84945 85181 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002809459.1 protein_id gnl|my_center|LOCUS_20230 85196 85363 gene locus_tag LOCUS_20240 gene rpmG 85196 85363 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307500.1 protein_id gnl|my_center|LOCUS_20240 87338 85518 gene locus_tag LOCUS_20250 87338 85518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 88840 87362 gene locus_tag LOCUS_20260 88840 87362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 89868 88837 gene locus_tag LOCUS_20270 89868 88837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 90908 89865 gene locus_tag LOCUS_20280 90908 89865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 91532 90918 gene locus_tag LOCUS_20290 91532 90918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 92464 91547 gene locus_tag LOCUS_20300 92464 91547 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318876.1 protein_id gnl|my_center|LOCUS_20300 93438 92482 gene locus_tag LOCUS_20310 93438 92482 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_20310 95105 94311 gene locus_tag LOCUS_20320 95105 94311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 95138 96163 gene locus_tag LOCUS_20330 95138 96163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 96283 98718 gene locus_tag LOCUS_20340 96283 98718 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057914.1 protein_id gnl|my_center|LOCUS_20340 99399 99839 gene locus_tag LOCUS_20350 99399 99839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 100794 100042 gene locus_tag LOCUS_20360 100794 100042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 100991 101296 gene locus_tag LOCUS_20370 100991 101296 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940838.1 protein_id gnl|my_center|LOCUS_20370 101278 101646 gene locus_tag LOCUS_20380 101278 101646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 101838 102038 gene locus_tag LOCUS_20390 101838 102038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 102049 104793 gene locus_tag LOCUS_20400 102049 104793 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092687825.1 protein_id gnl|my_center|LOCUS_20400 104790 105158 gene locus_tag LOCUS_20410 104790 105158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 105282 106754 gene locus_tag LOCUS_20420 105282 106754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 107279 108418 gene locus_tag LOCUS_20430 gene wecA 107279 108418 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176219.1 protein_id gnl|my_center|LOCUS_20430 109219 108407 gene locus_tag LOCUS_20440 109219 108407 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099684015.1 protein_id gnl|my_center|LOCUS_20440 111057 109369 gene locus_tag LOCUS_20450 111057 109369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 111554 113332 gene locus_tag LOCUS_20460 111554 113332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 114014 113358 gene locus_tag LOCUS_20470 114014 113358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 115469 114162 gene locus_tag LOCUS_20480 115469 114162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133511689.1 protein_id gnl|my_center|LOCUS_20480 117861 115516 gene locus_tag LOCUS_20490 gene vpsO 117861 115516 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_20490 118699 117911 gene locus_tag LOCUS_20500 118699 117911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 119639 118965 gene locus_tag LOCUS_20510 119639 118965 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208589.1 protein_id gnl|my_center|LOCUS_20510 120647 119778 gene locus_tag LOCUS_20520 120647 119778 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_20520 121297 120668 gene locus_tag LOCUS_20530 121297 120668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 122721 121294 gene locus_tag LOCUS_20540 122721 121294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 123479 122727 gene locus_tag LOCUS_20550 123479 122727 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144051.1 protein_id gnl|my_center|LOCUS_20550 124638 123499 gene locus_tag LOCUS_20560 124638 123499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 126140 124998 gene locus_tag LOCUS_20570 126140 124998 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296763.1 protein_id gnl|my_center|LOCUS_20570 127402 126284 gene locus_tag LOCUS_20580 127402 126284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 128543 127437 gene locus_tag LOCUS_20590 128543 127437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 129581 128853 gene locus_tag LOCUS_20600 129581 128853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 130571 129660 gene locus_tag LOCUS_20610 130571 129660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 131304 130612 gene locus_tag LOCUS_20620 131304 130612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 131687 131304 gene locus_tag LOCUS_20630 131687 131304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 132771 131824 gene locus_tag LOCUS_20640 132771 131824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 133739 132768 gene locus_tag LOCUS_20650 133739 132768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 134746 133736 gene locus_tag LOCUS_20660 134746 133736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 135819 134743 gene locus_tag LOCUS_20670 135819 134743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 136745 135816 gene locus_tag LOCUS_20680 136745 135816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 138058 137045 gene locus_tag LOCUS_20690 138058 137045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 139154 138132 gene locus_tag LOCUS_20700 139154 138132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 139912 139154 gene locus_tag LOCUS_20710 139912 139154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 141153 139933 gene locus_tag LOCUS_20720 141153 139933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 142100 141147 gene locus_tag LOCUS_20730 142100 141147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 143375 142104 gene locus_tag LOCUS_20740 143375 142104 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257983.1 protein_id gnl|my_center|LOCUS_20740 144551 143805 gene locus_tag LOCUS_20750 144551 143805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 145659 144613 gene locus_tag LOCUS_20760 145659 144613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 147781 145925 gene locus_tag LOCUS_20770 147781 145925 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_20770 148169 147786 gene locus_tag LOCUS_20780 148169 147786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 150105 149356 gene locus_tag LOCUS_20790 150105 149356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 150954 150595 gene locus_tag LOCUS_20800 150954 150595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 152632 151511 gene locus_tag LOCUS_20810 152632 151511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 153129 152632 gene locus_tag LOCUS_20820 153129 152632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 155138 153129 gene locus_tag LOCUS_20830 155138 153129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 156183 155188 gene locus_tag LOCUS_20840 156183 155188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 156503 156180 gene locus_tag LOCUS_20850 156503 156180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 156848 156633 gene locus_tag LOCUS_20860 156848 156633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 157594 156995 gene locus_tag LOCUS_20870 157594 156995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 158717 158382 gene locus_tag LOCUS_20880 158717 158382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 159300 158824 gene locus_tag LOCUS_20890 159300 158824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 160067 159297 gene locus_tag LOCUS_20900 160067 159297 CDS product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929490.1 protein_id gnl|my_center|LOCUS_20900 160415 160218 gene locus_tag LOCUS_20910 160415 160218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 160766 160563 gene locus_tag LOCUS_20920 160766 160563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 161541 160834 gene locus_tag LOCUS_20930 161541 160834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence010 1457 648 gene locus_tag LOCUS_20940 1457 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 1493 1732 gene locus_tag LOCUS_20950 1493 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1660 1938 gene locus_tag LOCUS_20960 1660 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2171 2467 gene locus_tag LOCUS_20970 2171 2467 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390829.1 protein_id gnl|my_center|LOCUS_20970 2471 2776 gene locus_tag LOCUS_20980 2471 2776 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057517.1 protein_id gnl|my_center|LOCUS_20980 3686 3291 gene locus_tag LOCUS_20990 gene rplQ 3686 3291 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036134.1 protein_id gnl|my_center|LOCUS_20990 4733 3723 gene locus_tag LOCUS_21000 gene rpoA 4733 3723 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 protein_id gnl|my_center|LOCUS_21000 5376 4756 gene locus_tag LOCUS_21010 gene rpsD 5376 4756 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218949.1 protein_id gnl|my_center|LOCUS_21010 5785 5396 gene locus_tag LOCUS_21020 gene rpsK 5785 5396 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555466.1 protein_id gnl|my_center|LOCUS_21020 6178 5822 gene locus_tag LOCUS_21030 gene rpsM 6178 5822 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648406.1 protein_id gnl|my_center|LOCUS_21030 7758 6406 gene locus_tag LOCUS_21040 gene secY 7758 6406 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070629.1 protein_id gnl|my_center|LOCUS_21040 8231 7788 gene locus_tag LOCUS_21050 gene rplO 8231 7788 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391411.1 protein_id gnl|my_center|LOCUS_21050 8424 8218 gene locus_tag LOCUS_21060 gene rpmD 8424 8218 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093696.1 protein_id gnl|my_center|LOCUS_21060 8934 8428 gene locus_tag LOCUS_21070 gene rpsE 8934 8428 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 protein_id gnl|my_center|LOCUS_21070 9301 8945 gene locus_tag LOCUS_21080 gene rplR 9301 8945 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358092.1 protein_id gnl|my_center|LOCUS_21080 9847 9314 gene locus_tag LOCUS_21090 gene rplF 9847 9314 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_21090 10254 9859 gene locus_tag LOCUS_21100 gene rpsH 10254 9859 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644434.1 protein_id gnl|my_center|LOCUS_21100 10712 10407 gene locus_tag LOCUS_21110 gene rpsN 10712 10407 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555476.1 protein_id gnl|my_center|LOCUS_21110 11262 10723 gene locus_tag LOCUS_21120 gene rplE 11262 10723 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625881.1 protein_id gnl|my_center|LOCUS_21120 11596 11279 gene locus_tag LOCUS_21130 gene rplX 11596 11279 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806917.1 protein_id gnl|my_center|LOCUS_21130 11975 11607 gene locus_tag LOCUS_21140 gene rplN 11975 11607 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 protein_id gnl|my_center|LOCUS_21140 12388 12128 gene locus_tag LOCUS_21150 gene rpsQ 12388 12128 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070622.1 protein_id gnl|my_center|LOCUS_21150 12585 12385 gene locus_tag LOCUS_21160 gene rpmC 12585 12385 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379576.1 protein_id gnl|my_center|LOCUS_21160 12998 12585 gene locus_tag LOCUS_21170 gene rplP 12998 12585 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555482.1 protein_id gnl|my_center|LOCUS_21170 13679 13002 gene locus_tag LOCUS_21180 gene rpsC 13679 13002 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_21180 14022 13690 gene locus_tag LOCUS_21190 gene rplV 14022 13690 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704314.1 protein_id gnl|my_center|LOCUS_21190 14313 14035 gene locus_tag LOCUS_21200 gene rpsS 14313 14035 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093734.1 protein_id gnl|my_center|LOCUS_21200 15160 14333 gene locus_tag LOCUS_21210 gene rplB 15160 14333 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103878.1 protein_id gnl|my_center|LOCUS_21210 15489 15193 gene locus_tag LOCUS_21220 gene rplW 15489 15193 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093736.1 protein_id gnl|my_center|LOCUS_21220 16097 15486 gene locus_tag LOCUS_21230 gene rplD 16097 15486 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379556.1 protein_id gnl|my_center|LOCUS_21230 16754 16104 gene locus_tag LOCUS_21240 gene rplC 16754 16104 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579663.1 protein_id gnl|my_center|LOCUS_21240 17078 16767 gene locus_tag LOCUS_21250 gene rpsJ 17078 16767 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 protein_id gnl|my_center|LOCUS_21250 18273 17083 gene locus_tag LOCUS_21260 gene tuf 18273 17083 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806883.1 protein_id gnl|my_center|LOCUS_21260 20350 18296 gene locus_tag LOCUS_21270 gene fusA 20350 18296 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957451.1 protein_id gnl|my_center|LOCUS_21270 20907 20437 gene locus_tag LOCUS_21280 gene rpsG 20907 20437 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070613.1 protein_id gnl|my_center|LOCUS_21280 21388 21014 gene locus_tag LOCUS_21290 gene rpsL 21388 21014 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 protein_id gnl|my_center|LOCUS_21290 25892 21675 gene locus_tag LOCUS_21300 gene rpoC 25892 21675 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_21300 30275 26103 gene locus_tag LOCUS_21310 gene rpoB 30275 26103 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_21310 31086 30706 gene locus_tag LOCUS_21320 gene rplL 31086 30706 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_21320 31668 31141 gene locus_tag LOCUS_21330 gene rplJ 31668 31141 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023073.1 protein_id gnl|my_center|LOCUS_21330 32631 31936 gene locus_tag LOCUS_21340 gene rplA 32631 31936 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400443.1 protein_id gnl|my_center|LOCUS_21340 33065 32631 gene locus_tag LOCUS_21350 gene rplK 33065 32631 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093751.1 protein_id gnl|my_center|LOCUS_21350 33765 33238 gene locus_tag LOCUS_21360 gene nusG 33765 33238 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108028.1 protein_id gnl|my_center|LOCUS_21360 34150 33773 gene locus_tag LOCUS_21370 gene secE 34150 33773 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004704671.1 protein_id gnl|my_center|LOCUS_21370 34258 34183 gene locus_tag LOCUS_t00330 34258 34183 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 35520 34330 gene locus_tag LOCUS_21380 gene tuf 35520 34330 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806883.1 protein_id gnl|my_center|LOCUS_21380 35694 35619 gene locus_tag LOCUS_t00340 35694 35619 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 35897 35824 gene locus_tag LOCUS_t00350 35897 35824 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 35997 35913 gene locus_tag LOCUS_t00360 35997 35913 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 36280 37620 gene locus_tag LOCUS_21390 36280 37620 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 protein_id gnl|my_center|LOCUS_21390 39170 37677 gene locus_tag LOCUS_21400 39170 37677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 40298 39708 gene locus_tag LOCUS_21410 gene pth 40298 39708 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 protein_id gnl|my_center|LOCUS_21410 41136 40528 gene locus_tag LOCUS_21420 41136 40528 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266730.1 protein_id gnl|my_center|LOCUS_21420 42177 41224 gene locus_tag LOCUS_21430 42177 41224 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_21430 42528 42454 gene locus_tag LOCUS_t00370 42528 42454 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 43480 42602 gene locus_tag LOCUS_21440 gene ispE 43480 42602 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266731.1 protein_id gnl|my_center|LOCUS_21440 45261 43477 gene locus_tag LOCUS_21450 45261 43477 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074907579.1 protein_id gnl|my_center|LOCUS_21450 45444 46718 gene locus_tag LOCUS_21460 gene hemA 45444 46718 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 protein_id gnl|my_center|LOCUS_21460 46715 47794 gene locus_tag LOCUS_21470 gene prfA 46715 47794 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772919.1 protein_id gnl|my_center|LOCUS_21470 47787 48725 gene locus_tag LOCUS_21480 gene prmC 47787 48725 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103431.1 protein_id gnl|my_center|LOCUS_21480 48820 49797 gene locus_tag LOCUS_21490 48820 49797 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064705.1 protein_id gnl|my_center|LOCUS_21490 50034 50465 gene locus_tag LOCUS_21500 gene lysM 50034 50465 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096210.1 protein_id gnl|my_center|LOCUS_21500 50585 50872 gene locus_tag LOCUS_21510 50585 50872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 51573 50779 gene locus_tag LOCUS_21520 51573 50779 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_21520 53597 51840 gene locus_tag LOCUS_21530 53597 51840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 54806 53610 gene locus_tag LOCUS_21540 54806 53610 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705473.1 protein_id gnl|my_center|LOCUS_21540 55181 55681 gene locus_tag LOCUS_21550 55181 55681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 55709 56977 gene locus_tag LOCUS_21560 55709 56977 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629647.1 protein_id gnl|my_center|LOCUS_21560 57849 57154 gene locus_tag LOCUS_21570 57849 57154 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_21570 58058 57849 gene locus_tag LOCUS_21580 58058 57849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 59477 58125 gene locus_tag LOCUS_21590 59477 58125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 59801 59550 gene locus_tag LOCUS_21600 59801 59550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 60145 60468 gene locus_tag LOCUS_21610 60145 60468 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089812.1 protein_id gnl|my_center|LOCUS_21610 60817 60554 gene locus_tag LOCUS_21620 60817 60554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 61519 60929 gene locus_tag LOCUS_21630 61519 60929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 62173 61823 gene locus_tag LOCUS_21640 62173 61823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 62889 62539 gene locus_tag LOCUS_21650 62889 62539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 63161 63472 gene locus_tag LOCUS_21660 63161 63472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 63678 63917 gene locus_tag LOCUS_21670 63678 63917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21670 63914 64060 gene locus_tag LOCUS_21680 63914 64060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 68909 64155 gene locus_tag LOCUS_21690 68909 64155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 69324 68926 gene locus_tag LOCUS_21700 69324 68926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 70134 71027 gene locus_tag LOCUS_21710 70134 71027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 72232 72993 gene locus_tag LOCUS_21720 72232 72993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21720 72975 73448 gene locus_tag LOCUS_21730 72975 73448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 73528 74808 gene locus_tag LOCUS_21740 73528 74808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 75430 75230 gene locus_tag LOCUS_21750 75430 75230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 75350 75529 gene locus_tag LOCUS_21760 75350 75529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 75765 75547 gene locus_tag LOCUS_21770 75765 75547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 76744 76484 gene locus_tag LOCUS_21780 76744 76484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 76712 77167 gene locus_tag LOCUS_21790 76712 77167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 77459 78232 gene locus_tag LOCUS_21800 77459 78232 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 protein_id gnl|my_center|LOCUS_21800 79029 78505 gene locus_tag LOCUS_21810 79029 78505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21810 79636 79854 gene locus_tag LOCUS_21820 79636 79854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 80500 80225 gene locus_tag LOCUS_21830 80500 80225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 80847 80623 gene locus_tag LOCUS_21840 80847 80623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200389847.1 protein_id gnl|my_center|LOCUS_21840 82920 80947 gene locus_tag LOCUS_21850 82920 80947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 84965 82920 gene locus_tag LOCUS_21860 84965 82920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 86904 85522 gene locus_tag LOCUS_21870 86904 85522 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058062.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21870 87182 86901 gene locus_tag LOCUS_21880 87182 86901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 87551 87186 gene locus_tag LOCUS_21890 87551 87186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21890 88195 87548 gene locus_tag LOCUS_21900 88195 87548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 89145 89891 gene locus_tag LOCUS_21910 89145 89891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 92007 90007 gene locus_tag LOCUS_21920 92007 90007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 92249 92515 gene locus_tag LOCUS_21930 92249 92515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 92825 93262 gene locus_tag LOCUS_21940 92825 93262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 93426 94433 gene locus_tag LOCUS_21950 93426 94433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 95658 94567 gene locus_tag LOCUS_21960 95658 94567 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036508.1 protein_id gnl|my_center|LOCUS_21960 96579 95746 gene locus_tag LOCUS_21970 96579 95746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 96995 96576 gene locus_tag LOCUS_21980 96995 96576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 97588 97013 gene locus_tag LOCUS_21990 97588 97013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 98375 97569 gene locus_tag LOCUS_22000 98375 97569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 98872 98372 gene locus_tag LOCUS_22010 98872 98372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 100029 99475 gene locus_tag LOCUS_22020 100029 99475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 100438 100259 gene locus_tag LOCUS_22030 100438 100259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 100450 100647 gene locus_tag LOCUS_22040 100450 100647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 100794 101219 gene locus_tag LOCUS_22050 gene umuD 100794 101219 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219995814.1 protein_id gnl|my_center|LOCUS_22050 102178 101636 gene locus_tag LOCUS_22060 102178 101636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 102970 102278 gene locus_tag LOCUS_22070 102970 102278 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_22070 103171 102992 gene locus_tag LOCUS_22080 103171 102992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 103326 103538 gene locus_tag LOCUS_22090 103326 103538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 103811 104104 gene locus_tag LOCUS_22100 103811 104104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 104104 104340 gene locus_tag LOCUS_22110 104104 104340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 104684 104454 gene locus_tag LOCUS_22120 104684 104454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 105031 105744 gene locus_tag LOCUS_22130 105031 105744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 105737 106111 gene locus_tag LOCUS_22140 105737 106111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 106641 106126 gene locus_tag LOCUS_22150 106641 106126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 106710 107006 gene locus_tag LOCUS_22160 106710 107006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 107359 108543 gene locus_tag LOCUS_22170 107359 108543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 108658 109785 gene locus_tag LOCUS_22180 108658 109785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 110302 109865 gene locus_tag LOCUS_22190 110302 109865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 110952 110299 gene locus_tag LOCUS_22200 110952 110299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 110951 111133 gene locus_tag LOCUS_22210 110951 111133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 111700 113054 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtccggacacctacctgatgaagaaggtattgagac 113513 113379 gene locus_tag LOCUS_22220 113513 113379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 114453 115598 gene locus_tag LOCUS_22230 114453 115598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 115635 116903 gene locus_tag LOCUS_22240 gene cmr1 115635 116903 CDS product type III-B CRISPR module RAMP protein Cmr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229142.1 protein_id gnl|my_center|LOCUS_22240 116907 118718 gene locus_tag LOCUS_22250 gene cas10 116907 118718 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229144.1 protein_id gnl|my_center|LOCUS_22250 118715 120016 gene locus_tag LOCUS_22260 118715 120016 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229143.1 protein_id gnl|my_center|LOCUS_22260 120055 120948 gene locus_tag LOCUS_22270 gene cmr4 120055 120948 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 protein_id gnl|my_center|LOCUS_22270 120945 121355 gene locus_tag LOCUS_22280 120945 121355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 121367 122443 gene locus_tag LOCUS_22290 121367 122443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 122499 123722 gene locus_tag LOCUS_22300 gene csx2 122499 123722 CDS product TIGR02221 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582979.1 protein_id gnl|my_center|LOCUS_22300 123871 124320 gene locus_tag LOCUS_22310 123871 124320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 124411 124704 gene locus_tag LOCUS_22320 124411 124704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 124750 125730 gene locus_tag LOCUS_22330 124750 125730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 125822 126919 gene locus_tag LOCUS_22340 125822 126919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 127023 127577 gene locus_tag LOCUS_22350 127023 127577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 127636 127920 gene locus_tag LOCUS_22360 127636 127920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 127964 128290 gene locus_tag LOCUS_22370 127964 128290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 128287 129285 gene locus_tag LOCUS_22380 gene cas1 128287 129285 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259223.1 protein_id gnl|my_center|LOCUS_22380 129282 130151 gene locus_tag LOCUS_22390 129282 130151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 130229 131654 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtccggacacctacctgatgaagaaggtattgagac 132222 133298 gene locus_tag LOCUS_22400 gene cas6 132222 133298 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_22400 133345 133728 gene locus_tag LOCUS_22410 133345 133728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 133728 133910 gene locus_tag LOCUS_22420 133728 133910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 134016 135300 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcggtaaagagacccgacttgaggggattgagac 135716 135582 gene locus_tag LOCUS_22430 135716 135582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 135750 135938 gene locus_tag LOCUS_22440 135750 135938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 135943 137763 gene locus_tag LOCUS_22450 135943 137763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 138737 139492 gene locus_tag LOCUS_22460 138737 139492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 139504 142452 gene locus_tag LOCUS_22470 139504 142452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 142652 144457 gene locus_tag LOCUS_22480 142652 144457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 144480 146537 gene locus_tag LOCUS_22490 144480 146537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 146579 147619 gene locus_tag LOCUS_22500 146579 147619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 147724 148029 gene locus_tag LOCUS_22510 147724 148029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence011 376 29 gene locus_tag LOCUS_22520 376 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 1179 928 gene locus_tag LOCUS_22530 1179 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2261 1176 gene locus_tag LOCUS_22540 2261 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 3304 2411 gene locus_tag LOCUS_22550 3304 2411 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932075.1 protein_id gnl|my_center|LOCUS_22550 5533 3413 gene locus_tag LOCUS_22560 5533 3413 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_22560 5800 6996 gene locus_tag LOCUS_22570 5800 6996 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763607.1 protein_id gnl|my_center|LOCUS_22570 7173 7787 gene locus_tag LOCUS_22580 7173 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 8094 7819 gene locus_tag LOCUS_22590 gene minE 8094 7819 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091581.1 protein_id gnl|my_center|LOCUS_22590 8895 8098 gene locus_tag LOCUS_22600 gene minD 8895 8098 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072528.1 protein_id gnl|my_center|LOCUS_22600 9754 8957 gene locus_tag LOCUS_22610 gene minC 9754 8957 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104763.1 protein_id gnl|my_center|LOCUS_22610 10110 9766 gene locus_tag LOCUS_22620 10110 9766 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_22620 10851 10255 gene locus_tag LOCUS_22630 gene recR 10851 10255 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095898.1 protein_id gnl|my_center|LOCUS_22630 11266 10865 gene locus_tag LOCUS_22640 11266 10865 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706069.1 protein_id gnl|my_center|LOCUS_22640 13101 11365 gene locus_tag LOCUS_22650 13101 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 13600 14859 gene locus_tag LOCUS_22660 13600 14859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 14910 15725 gene locus_tag LOCUS_22670 14910 15725 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922304.1 protein_id gnl|my_center|LOCUS_22670 16330 15794 gene locus_tag LOCUS_22680 16330 15794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 18730 17297 gene locus_tag LOCUS_22690 gene cysS 18730 17297 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225718.1 protein_id gnl|my_center|LOCUS_22690 19060 19593 gene locus_tag LOCUS_22700 19060 19593 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_22700 19653 20441 gene locus_tag LOCUS_22710 gene lpxH 19653 20441 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704629.1 protein_id gnl|my_center|LOCUS_22710 20438 20806 gene locus_tag LOCUS_22720 20438 20806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 21691 21137 gene locus_tag LOCUS_22730 21691 21137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 22352 22837 gene locus_tag LOCUS_22740 22352 22837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 22834 24162 gene locus_tag LOCUS_22750 22834 24162 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 protein_id gnl|my_center|LOCUS_22750 24155 25711 gene locus_tag LOCUS_22760 24155 25711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 25715 26344 gene locus_tag LOCUS_22770 25715 26344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 27012 27593 gene locus_tag LOCUS_22780 27012 27593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 28863 28021 gene locus_tag LOCUS_22790 28863 28021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 31721 31350 gene locus_tag LOCUS_22800 31721 31350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 31896 31735 gene locus_tag LOCUS_22810 31896 31735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 32204 31956 gene locus_tag LOCUS_22820 32204 31956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22820 33206 33943 gene locus_tag LOCUS_22830 33206 33943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22830 34397 35170 gene locus_tag LOCUS_22840 34397 35170 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288211.1 protein_id gnl|my_center|LOCUS_22840 35247 36833 gene locus_tag LOCUS_22850 35247 36833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 36940 39351 gene locus_tag LOCUS_22860 36940 39351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 40205 39423 gene locus_tag LOCUS_22870 40205 39423 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061715.1 protein_id gnl|my_center|LOCUS_22870 41413 41583 gene locus_tag LOCUS_22880 41413 41583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 42268 42528 gene locus_tag LOCUS_22890 42268 42528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 44415 43108 gene locus_tag LOCUS_22900 44415 43108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 47873 46512 gene locus_tag LOCUS_22910 gene prsR 47873 46512 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_22910 49994 47898 gene locus_tag LOCUS_22920 gene prsK 49994 47898 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_22920 50447 50232 gene locus_tag LOCUS_22930 50447 50232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 51600 50929 gene locus_tag LOCUS_22940 51600 50929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 52808 53401 gene locus_tag LOCUS_22950 52808 53401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 54500 53607 gene locus_tag LOCUS_22960 gene cysM 54500 53607 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_22960 54676 55047 gene locus_tag LOCUS_22970 54676 55047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 55214 56773 gene locus_tag LOCUS_22980 55214 56773 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327950.1 protein_id gnl|my_center|LOCUS_22980 57905 56943 gene locus_tag LOCUS_22990 57905 56943 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192895.1 protein_id gnl|my_center|LOCUS_22990 58502 58017 gene locus_tag LOCUS_23000 58502 58017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 59391 58687 gene locus_tag LOCUS_23010 gene phoU 59391 58687 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259745.1 protein_id gnl|my_center|LOCUS_23010 59598 61151 gene locus_tag LOCUS_23020 gene pap 59598 61151 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091935.1 protein_id gnl|my_center|LOCUS_23020 61528 61190 gene locus_tag LOCUS_23030 61528 61190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 61643 61927 gene locus_tag LOCUS_23040 61643 61927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 61927 62451 gene locus_tag LOCUS_23050 61927 62451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 63495 62635 gene locus_tag LOCUS_23060 63495 62635 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 protein_id gnl|my_center|LOCUS_23060 63884 63504 gene locus_tag LOCUS_23070 63884 63504 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_23070 65020 63995 gene locus_tag LOCUS_23080 65020 63995 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_23080 65691 65017 gene locus_tag LOCUS_23090 gene tmk 65691 65017 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770616.1 protein_id gnl|my_center|LOCUS_23090 66689 65688 gene locus_tag LOCUS_23100 gene mltG 66689 65688 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_23100 67477 66686 gene locus_tag LOCUS_23110 gene pabC 67477 66686 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 protein_id gnl|my_center|LOCUS_23110 68816 67596 gene locus_tag LOCUS_23120 gene fabF 68816 67596 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104132.1 protein_id gnl|my_center|LOCUS_23120 69188 68952 gene locus_tag LOCUS_23130 gene acpP 69188 68952 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_23130 70082 69342 gene locus_tag LOCUS_23140 gene fabG 70082 69342 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091137.1 protein_id gnl|my_center|LOCUS_23140 71019 70069 gene locus_tag LOCUS_23150 gene fabD 71019 70069 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930934.1 protein_id gnl|my_center|LOCUS_23150 71987 71031 gene locus_tag LOCUS_23160 71987 71031 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_23160 72982 71987 gene locus_tag LOCUS_23170 gene plsX 72982 71987 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_23170 73266 73090 gene locus_tag LOCUS_23180 gene rpmF 73266 73090 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947121.1 protein_id gnl|my_center|LOCUS_23180 73627 73436 gene locus_tag LOCUS_23190 73627 73436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 73565 73954 gene locus_tag LOCUS_23200 73565 73954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 75424 74291 gene locus_tag LOCUS_23210 75424 74291 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_23210 77227 75428 gene locus_tag LOCUS_23220 gene oadA 77227 75428 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_23220 77626 77348 gene locus_tag LOCUS_23230 77626 77348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 78937 77642 gene locus_tag LOCUS_23240 78937 77642 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_23240 80142 78946 gene locus_tag LOCUS_23250 80142 78946 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095644.1 protein_id gnl|my_center|LOCUS_23250 80371 80189 gene locus_tag LOCUS_23260 80371 80189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 81501 80635 gene locus_tag LOCUS_23270 gene hflC 81501 80635 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_23270 82682 81498 gene locus_tag LOCUS_23280 gene hflK 82682 81498 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 protein_id gnl|my_center|LOCUS_23280 84266 82959 gene locus_tag LOCUS_23290 gene hflX 84266 82959 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113930.1 protein_id gnl|my_center|LOCUS_23290 84556 84305 gene locus_tag LOCUS_23300 gene hfq 84556 84305 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036893.1 protein_id gnl|my_center|LOCUS_23300 85890 84919 gene locus_tag LOCUS_23310 gene miaA 85890 84919 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113929.1 protein_id gnl|my_center|LOCUS_23310 87808 85949 gene locus_tag LOCUS_23320 gene mutL 87808 85949 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_23320 89266 87953 gene locus_tag LOCUS_23330 gene amiB 89266 87953 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_23330 89908 89435 gene locus_tag LOCUS_23340 gene tsaE 89908 89435 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704860.1 protein_id gnl|my_center|LOCUS_23340 91607 90024 gene locus_tag LOCUS_23350 91607 90024 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148264.1 protein_id gnl|my_center|LOCUS_23350 91875 92993 gene locus_tag LOCUS_23360 gene queG 91875 92993 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_23360 93595 93047 gene locus_tag LOCUS_23370 gene orn 93595 93047 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_23370 94039 93770 gene locus_tag LOCUS_23380 94039 93770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 93981 94274 gene locus_tag LOCUS_23390 93981 94274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 94279 95307 gene locus_tag LOCUS_23400 gene rsgA 94279 95307 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 protein_id gnl|my_center|LOCUS_23400 95339 95824 gene locus_tag LOCUS_23410 95339 95824 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_23410 96164 95808 gene locus_tag LOCUS_23420 96164 95808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 97559 96237 gene locus_tag LOCUS_23430 gene bioA 97559 96237 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931741.1 protein_id gnl|my_center|LOCUS_23430 98989 97556 gene locus_tag LOCUS_23440 98989 97556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 101511 98989 gene locus_tag LOCUS_23450 101511 98989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 102028 104106 gene locus_tag LOCUS_23460 gene glgX 102028 104106 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021995.1 protein_id gnl|my_center|LOCUS_23460 104286 105827 gene locus_tag LOCUS_23470 gene zwf 104286 105827 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141170.1 protein_id gnl|my_center|LOCUS_23470 105874 106089 gene locus_tag LOCUS_23480 105874 106089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 106509 107447 gene locus_tag LOCUS_23490 106509 107447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_23490 107440 110340 gene locus_tag LOCUS_23500 107440 110340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 110344 111441 gene locus_tag LOCUS_23510 110344 111441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 112819 111503 gene locus_tag LOCUS_23520 112819 111503 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_23520 114102 112900 gene locus_tag LOCUS_23530 gene alaC 114102 112900 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 protein_id gnl|my_center|LOCUS_23530 114898 114278 gene locus_tag LOCUS_23540 114898 114278 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_23540 117140 115050 gene locus_tag LOCUS_23550 117140 115050 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_23550 117565 117152 gene locus_tag LOCUS_23560 117565 117152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 117651 117977 gene locus_tag LOCUS_23570 117651 117977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 118095 118979 gene locus_tag LOCUS_23580 118095 118979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 121529 119088 gene locus_tag LOCUS_23590 121529 119088 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266375.1 protein_id gnl|my_center|LOCUS_23590 121854 122927 gene locus_tag LOCUS_23600 121854 122927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 123024 126218 gene locus_tag LOCUS_23610 123024 126218 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_23610 128039 126342 gene locus_tag LOCUS_23620 128039 126342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 129295 128036 gene locus_tag LOCUS_23630 129295 128036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 130160 129369 gene locus_tag LOCUS_23640 130160 129369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 130752 130210 gene locus_tag LOCUS_23650 130752 130210 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266582.1 protein_id gnl|my_center|LOCUS_23650 131136 131555 gene locus_tag LOCUS_23660 131136 131555 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946364.1 protein_id gnl|my_center|LOCUS_23660 132631 131612 gene locus_tag LOCUS_23670 132631 131612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 133214 133125 gene locus_tag LOCUS_t00380 133214 133125 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 134492 133491 gene locus_tag LOCUS_23680 134492 133491 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889319.1 protein_id gnl|my_center|LOCUS_23680 134754 135077 gene locus_tag LOCUS_23690 134754 135077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 135275 137146 gene locus_tag LOCUS_23700 gene ilvD 135275 137146 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819105.1 protein_id gnl|my_center|LOCUS_23700 137186 137809 gene locus_tag LOCUS_23710 137186 137809 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186100.1 protein_id gnl|my_center|LOCUS_23710 137878 138651 gene locus_tag LOCUS_23720 137878 138651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 138833 139168 gene locus_tag LOCUS_23730 138833 139168 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_23730 140369 139272 gene locus_tag LOCUS_23740 gene ychF 140369 139272 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948354.1 protein_id gnl|my_center|LOCUS_23740 142443 140578 gene locus_tag LOCUS_23750 142443 140578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 <145838 142738 gene locus_tag LOCUS_23760 <145838 142738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140422.1:SdrD B-like domain-containing protein >Feature sequence012 3 1748 gene locus_tag LOCUS_23770 3 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 1799 2647 gene locus_tag LOCUS_23780 gene truA 1799 2647 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091390.1 protein_id gnl|my_center|LOCUS_23780 2673 3302 gene locus_tag LOCUS_23790 2673 3302 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_23790 3283 4536 gene locus_tag LOCUS_23800 gene trpB 3283 4536 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_23800 4533 5354 gene locus_tag LOCUS_23810 gene trpA 4533 5354 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_23810 5344 6363 gene locus_tag LOCUS_23820 gene accD 5344 6363 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460141.1 protein_id gnl|my_center|LOCUS_23820 6381 7658 gene locus_tag LOCUS_23830 gene folC 6381 7658 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036164.1 protein_id gnl|my_center|LOCUS_23830 7843 8493 gene locus_tag LOCUS_23840 7843 8493 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957873.1 protein_id gnl|my_center|LOCUS_23840 8678 9175 gene locus_tag LOCUS_23850 8678 9175 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318487.1 protein_id gnl|my_center|LOCUS_23850 9344 10858 gene locus_tag LOCUS_23860 gene purF 9344 10858 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347797.1 protein_id gnl|my_center|LOCUS_23860 10830 12098 gene locus_tag LOCUS_23870 10830 12098 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_23870 12605 12225 gene locus_tag LOCUS_23880 12605 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 13749 12691 gene locus_tag LOCUS_23890 13749 12691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 14547 13762 gene locus_tag LOCUS_23900 14547 13762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 15275 14541 gene locus_tag LOCUS_23910 15275 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 15586 16173 gene locus_tag LOCUS_23920 15586 16173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 17241 16309 gene locus_tag LOCUS_23930 17241 16309 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_23930 17670 18023 gene locus_tag LOCUS_23940 17670 18023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 18731 18030 gene locus_tag LOCUS_23950 18731 18030 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_23950 18990 19919 gene locus_tag LOCUS_23960 18990 19919 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_23960 20681 19950 gene locus_tag LOCUS_23970 gene mtgA 20681 19950 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037989.1 protein_id gnl|my_center|LOCUS_23970 21728 20766 gene locus_tag LOCUS_23980 21728 20766 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088921.1 protein_id gnl|my_center|LOCUS_23980 21823 22422 gene locus_tag LOCUS_23990 21823 22422 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 protein_id gnl|my_center|LOCUS_23990 22478 23359 gene locus_tag LOCUS_24000 22478 23359 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_24000 24035 23520 gene locus_tag LOCUS_24010 gene fabA 24035 23520 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706133.1 protein_id gnl|my_center|LOCUS_24010 25976 24252 gene locus_tag LOCUS_24020 25976 24252 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 protein_id gnl|my_center|LOCUS_24020 26133 27254 gene locus_tag LOCUS_24030 26133 27254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 27623 29410 gene locus_tag LOCUS_24040 27623 29410 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185769.1 protein_id gnl|my_center|LOCUS_24040 29441 29932 gene locus_tag LOCUS_24050 gene ilvN 29441 29932 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_24050 30115 31206 gene locus_tag LOCUS_24060 gene ilvC 30115 31206 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 protein_id gnl|my_center|LOCUS_24060 34769 31278 gene locus_tag LOCUS_24070 34769 31278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 35461 34823 gene locus_tag LOCUS_24080 gene folE 35461 34823 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871165.1 protein_id gnl|my_center|LOCUS_24080 35847 37622 gene locus_tag LOCUS_24090 35847 37622 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975341.1 protein_id gnl|my_center|LOCUS_24090 37642 39363 gene locus_tag LOCUS_24100 gene ngg 37642 39363 CDS product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111433.1 protein_id gnl|my_center|LOCUS_24100 39371 40480 gene locus_tag LOCUS_24110 39371 40480 CDS product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389740.1 protein_id gnl|my_center|LOCUS_24110 40534 40905 gene locus_tag LOCUS_24120 40534 40905 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390179.1 protein_id gnl|my_center|LOCUS_24120 40898 41632 gene locus_tag LOCUS_24130 40898 41632 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258956.1 protein_id gnl|my_center|LOCUS_24130 41978 41784 gene locus_tag LOCUS_24140 41978 41784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 43248 42334 gene locus_tag LOCUS_24150 43248 42334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 43463 43903 gene locus_tag LOCUS_24160 43463 43903 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939520.1 protein_id gnl|my_center|LOCUS_24160 43991 44581 gene locus_tag LOCUS_24170 43991 44581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 45590 44640 gene locus_tag LOCUS_24180 45590 44640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 46775 45606 gene locus_tag LOCUS_24190 gene dacB 46775 45606 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408519.1 protein_id gnl|my_center|LOCUS_24190 47746 47009 gene locus_tag LOCUS_24200 gene bioD 47746 47009 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103336.1 protein_id gnl|my_center|LOCUS_24200 48653 47766 gene locus_tag LOCUS_24210 gene bioC 48653 47766 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_24210 49492 48650 gene locus_tag LOCUS_24220 gene bioH 49492 48650 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260983.1 protein_id gnl|my_center|LOCUS_24220 50712 49489 gene locus_tag LOCUS_24230 gene bioF 50712 49489 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113248.1 protein_id gnl|my_center|LOCUS_24230 51442 50687 gene locus_tag LOCUS_24240 51442 50687 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245137.1 protein_id gnl|my_center|LOCUS_24240 52385 51534 gene locus_tag LOCUS_24250 gene hpnD 52385 51534 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193159.1 protein_id gnl|my_center|LOCUS_24250 53155 52388 gene locus_tag LOCUS_24260 53155 52388 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_24260 53404 54645 gene locus_tag LOCUS_24270 53404 54645 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207236.1 protein_id gnl|my_center|LOCUS_24270 54646 55158 gene locus_tag LOCUS_24280 gene nrdR 54646 55158 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_24280 55155 56336 gene locus_tag LOCUS_24290 gene ribD 55155 56336 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707100.1 protein_id gnl|my_center|LOCUS_24290 56379 57065 gene locus_tag LOCUS_24300 56379 57065 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_24300 57267 58481 gene locus_tag LOCUS_24310 gene ribBA 57267 58481 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 protein_id gnl|my_center|LOCUS_24310 58478 58948 gene locus_tag LOCUS_24320 gene ribE 58478 58948 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_24320 58950 59441 gene locus_tag LOCUS_24330 gene nusB 58950 59441 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_24330 59463 60470 gene locus_tag LOCUS_24340 gene thiL 59463 60470 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_24340 60445 60969 gene locus_tag LOCUS_24350 60445 60969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 61615 61145 gene locus_tag LOCUS_24360 61615 61145 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958580.1 protein_id gnl|my_center|LOCUS_24360 65320 61811 gene locus_tag LOCUS_24370 65320 61811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 66303 65326 gene locus_tag LOCUS_24380 66303 65326 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140179.1 protein_id gnl|my_center|LOCUS_24380 66724 66311 gene locus_tag LOCUS_24390 66724 66311 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552611.1 protein_id gnl|my_center|LOCUS_24390 66816 67265 gene locus_tag LOCUS_24400 66816 67265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 67823 67341 gene locus_tag LOCUS_24410 67823 67341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 67822 68004 gene locus_tag LOCUS_24420 67822 68004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 68029 69273 gene locus_tag LOCUS_24430 68029 69273 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525896.1 protein_id gnl|my_center|LOCUS_24430 69408 69611 gene locus_tag LOCUS_24440 69408 69611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 69595 70149 gene locus_tag LOCUS_24450 69595 70149 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_24450 70396 70830 gene locus_tag LOCUS_24460 70396 70830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 70846 71082 gene locus_tag LOCUS_24470 gene rpsR 70846 71082 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_24470 71168 72100 gene locus_tag LOCUS_24480 71168 72100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095630.1 protein_id gnl|my_center|LOCUS_24480 72215 72664 gene locus_tag LOCUS_24490 gene rplI 72215 72664 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196060.1 protein_id gnl|my_center|LOCUS_24490 72964 72815 gene locus_tag LOCUS_24500 72964 72815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 72938 74284 gene locus_tag LOCUS_24510 gene dnaB 72938 74284 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946475.1 protein_id gnl|my_center|LOCUS_24510 76213 74399 gene locus_tag LOCUS_24520 76213 74399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 77704 76595 gene locus_tag LOCUS_24530 77704 76595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 77859 79235 gene locus_tag LOCUS_24540 gene radA 77859 79235 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094867.1 protein_id gnl|my_center|LOCUS_24540 80679 79366 gene locus_tag LOCUS_24550 80679 79366 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340990.1 protein_id gnl|my_center|LOCUS_24550 80865 81884 gene locus_tag LOCUS_24560 gene rdgC 80865 81884 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 protein_id gnl|my_center|LOCUS_24560 83236 82001 gene locus_tag LOCUS_24570 83236 82001 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087760.1 protein_id gnl|my_center|LOCUS_24570 84258 83251 gene locus_tag LOCUS_24580 84258 83251 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057042.1 protein_id gnl|my_center|LOCUS_24580 85962 84283 gene locus_tag LOCUS_24590 gene recN 85962 84283 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194023.1 protein_id gnl|my_center|LOCUS_24590 86925 85984 gene locus_tag LOCUS_24600 gene nadK 86925 85984 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071702.1 protein_id gnl|my_center|LOCUS_24600 87233 88360 gene locus_tag LOCUS_24610 gene hrcA 87233 88360 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_24610 88438 89043 gene locus_tag LOCUS_24620 gene grpE 88438 89043 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706782.1 protein_id gnl|my_center|LOCUS_24620 89146 91083 gene locus_tag LOCUS_24630 gene dnaK 89146 91083 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770882.1 protein_id gnl|my_center|LOCUS_24630 91445 92575 gene locus_tag LOCUS_24640 gene dnaJ 91445 92575 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_24640 92697 93512 gene locus_tag LOCUS_24650 gene dapB 92697 93512 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095210.1 protein_id gnl|my_center|LOCUS_24650 93638 94441 gene locus_tag LOCUS_24660 93638 94441 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_24660 94482 95648 gene locus_tag LOCUS_24670 94482 95648 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336817.1 protein_id gnl|my_center|LOCUS_24670 95811 97250 gene locus_tag LOCUS_24680 95811 97250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 97368 97444 gene locus_tag LOCUS_t00390 97368 97444 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 98551 98838 gene locus_tag LOCUS_24690 98551 98838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 100798 98810 gene locus_tag LOCUS_24700 100798 98810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 101548 102876 gene locus_tag LOCUS_24710 101548 102876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 103407 103198 gene locus_tag LOCUS_24720 103407 103198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24720 104057 103713 gene locus_tag LOCUS_24730 104057 103713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 104289 104041 gene locus_tag LOCUS_24740 104289 104041 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669263.1 protein_id gnl|my_center|LOCUS_24740 104649 105665 gene locus_tag LOCUS_24750 104649 105665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 108054 105871 gene locus_tag LOCUS_24760 108054 105871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 109366 108104 gene locus_tag LOCUS_24770 109366 108104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 110348 109491 gene locus_tag LOCUS_24780 110348 109491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 110746 110351 gene locus_tag LOCUS_24790 110746 110351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 111125 111685 gene locus_tag LOCUS_24800 111125 111685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 111728 114202 gene locus_tag LOCUS_24810 111728 114202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 116662 114239 gene locus_tag LOCUS_24820 116662 114239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 117341 116670 gene locus_tag LOCUS_24830 117341 116670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 119466 117334 gene locus_tag LOCUS_24840 119466 117334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 120992 119628 gene locus_tag LOCUS_24850 120992 119628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 121662 120997 gene locus_tag LOCUS_24860 121662 120997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 122738 126252 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcatcgcctctaaatcggctctattcgccagac 126351 126782 gene locus_tag LOCUS_24870 gene tnpA 126351 126782 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_24870 126874 132336 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcatcgcctctaaatcggctctattcgccagac 132629 133516 gene locus_tag LOCUS_24880 132629 133516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 133567 134124 gene locus_tag LOCUS_24890 133567 134124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 134137 135084 gene locus_tag LOCUS_24900 gene cas1 134137 135084 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_24900 136123 135113 gene locus_tag LOCUS_24910 136123 135113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 137513 136137 gene locus_tag LOCUS_24920 137513 136137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 138904 137516 gene locus_tag LOCUS_24930 138904 137516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 139969 138917 gene locus_tag LOCUS_24940 139969 138917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence013 210 425 gene locus_tag LOCUS_24950 210 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 3573 427 gene locus_tag LOCUS_24960 3573 427 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976147.1 protein_id gnl|my_center|LOCUS_24960 4690 3578 gene locus_tag LOCUS_24970 4690 3578 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393551.1 protein_id gnl|my_center|LOCUS_24970 5878 4973 gene locus_tag LOCUS_24980 5878 4973 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173331.1 protein_id gnl|my_center|LOCUS_24980 6403 8046 gene locus_tag LOCUS_24990 6403 8046 CDS product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258464.1 protein_id gnl|my_center|LOCUS_24990 9146 8157 gene locus_tag LOCUS_25000 9146 8157 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942983.1 protein_id gnl|my_center|LOCUS_25000 9730 9227 gene locus_tag LOCUS_25010 9730 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 11585 9714 gene locus_tag LOCUS_25020 11585 9714 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_25020 12509 11805 gene locus_tag LOCUS_25030 12509 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 13226 12522 gene locus_tag LOCUS_25040 13226 12522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 13719 13258 gene locus_tag LOCUS_25050 13719 13258 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871651.1 protein_id gnl|my_center|LOCUS_25050 15524 13716 gene locus_tag LOCUS_25060 15524 13716 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_25060 16126 15521 gene locus_tag LOCUS_25070 16126 15521 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_25070 17515 16145 gene locus_tag LOCUS_25080 17515 16145 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_25080 17837 18739 gene locus_tag LOCUS_25090 17837 18739 CDS product DUF6268 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073159.1 protein_id gnl|my_center|LOCUS_25090 18886 21075 gene locus_tag LOCUS_25100 18886 21075 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088793.1 protein_id gnl|my_center|LOCUS_25100 21065 21604 gene locus_tag LOCUS_25110 21065 21604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 21634 22152 gene locus_tag LOCUS_25120 21634 22152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 22264 22626 gene locus_tag LOCUS_25130 22264 22626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 22601 22837 gene locus_tag LOCUS_25140 22601 22837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 23354 23836 gene locus_tag LOCUS_25150 23354 23836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 24192 25241 gene locus_tag LOCUS_25160 24192 25241 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524995.1 protein_id gnl|my_center|LOCUS_25160 25250 27523 gene locus_tag LOCUS_25170 25250 27523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25170 27490 28077 gene locus_tag LOCUS_25180 27490 28077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 28080 29204 gene locus_tag LOCUS_25190 28080 29204 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188525.1 protein_id gnl|my_center|LOCUS_25190 29251 30114 gene locus_tag LOCUS_25200 29251 30114 CDS product ARMT1-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582978.1 protein_id gnl|my_center|LOCUS_25200 30478 30224 gene locus_tag LOCUS_25210 30478 30224 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102761837.1 protein_id gnl|my_center|LOCUS_25210 30858 30388 gene locus_tag LOCUS_25220 30858 30388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 31222 30776 gene locus_tag LOCUS_25230 31222 30776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 31557 32120 gene locus_tag LOCUS_25240 31557 32120 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525069.1 protein_id gnl|my_center|LOCUS_25240 32519 34876 gene locus_tag LOCUS_25250 32519 34876 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968357.1 protein_id gnl|my_center|LOCUS_25250 34867 35601 gene locus_tag LOCUS_25260 34867 35601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 36354 35593 gene locus_tag LOCUS_25270 36354 35593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 37201 37683 gene locus_tag LOCUS_25280 37201 37683 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525069.1 protein_id gnl|my_center|LOCUS_25280 39432 38008 gene locus_tag LOCUS_25290 39432 38008 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039991.1 protein_id gnl|my_center|LOCUS_25290 39880 40689 gene locus_tag LOCUS_25300 39880 40689 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_25300 41790 40885 gene locus_tag LOCUS_25310 41790 40885 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974284.1 protein_id gnl|my_center|LOCUS_25310 43089 42052 gene locus_tag LOCUS_25320 gene pilT 43089 42052 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_25320 44302 43343 gene locus_tag LOCUS_25330 gene draG 44302 43343 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943427.1 protein_id gnl|my_center|LOCUS_25330 44861 44277 gene locus_tag LOCUS_25340 44861 44277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 45213 44866 gene locus_tag LOCUS_25350 45213 44866 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389669.1 protein_id gnl|my_center|LOCUS_25350 45618 45334 gene locus_tag LOCUS_25360 gene fdxC 45618 45334 CDS product ferredoxin FdxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723760.1 protein_id gnl|my_center|LOCUS_25360 47088 45718 gene locus_tag LOCUS_25370 47088 45718 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140334.1 protein_id gnl|my_center|LOCUS_25370 47369 47091 gene locus_tag LOCUS_25380 47369 47091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 48942 47389 gene locus_tag LOCUS_25390 gene nifB 48942 47389 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388749.1 protein_id gnl|my_center|LOCUS_25390 49520 50116 gene locus_tag LOCUS_25400 49520 50116 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 protein_id gnl|my_center|LOCUS_25400 50121 51386 gene locus_tag LOCUS_25410 50121 51386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 51613 52089 gene locus_tag LOCUS_25420 gene ureE 51613 52089 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098769.1 protein_id gnl|my_center|LOCUS_25420 52079 52759 gene locus_tag LOCUS_25430 52079 52759 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 protein_id gnl|my_center|LOCUS_25430 52768 53382 gene locus_tag LOCUS_25440 gene ureG 52768 53382 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021389.1 protein_id gnl|my_center|LOCUS_25440 53998 53522 gene locus_tag LOCUS_25450 gene moaE 53998 53522 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490611.1 protein_id gnl|my_center|LOCUS_25450 54170 54595 gene locus_tag LOCUS_25460 54170 54595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 54920 55168 gene locus_tag LOCUS_25470 54920 55168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 55741 55169 gene locus_tag LOCUS_25480 55741 55169 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396060.1 protein_id gnl|my_center|LOCUS_25480 56263 55787 gene locus_tag LOCUS_25490 56263 55787 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208527.1 protein_id gnl|my_center|LOCUS_25490 58557 56260 gene locus_tag LOCUS_25500 gene glgB 58557 56260 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_25500 58836 60107 gene locus_tag LOCUS_25510 gene glgC 58836 60107 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_25510 60132 60362 gene locus_tag LOCUS_25520 gene thiS 60132 60362 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_25520 60520 61317 gene locus_tag LOCUS_25530 60520 61317 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084517.1 protein_id gnl|my_center|LOCUS_25530 61444 62148 gene locus_tag LOCUS_25540 gene trmB 61444 62148 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974862.1 protein_id gnl|my_center|LOCUS_25540 62159 62935 gene locus_tag LOCUS_25550 gene fetA 62159 62935 CDS product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157546.1 protein_id gnl|my_center|LOCUS_25550 62932 63741 gene locus_tag LOCUS_25560 gene fetB 62932 63741 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_25560 64052 65482 gene locus_tag LOCUS_25570 64052 65482 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854402.1 protein_id gnl|my_center|LOCUS_25570 66716 65652 gene locus_tag LOCUS_25580 gene hemE 66716 65652 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635049.1 protein_id gnl|my_center|LOCUS_25580 67651 66866 gene locus_tag LOCUS_25590 67651 66866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 68733 67702 gene locus_tag LOCUS_25600 gene argC 68733 67702 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 protein_id gnl|my_center|LOCUS_25600 69197 68820 gene locus_tag LOCUS_25610 69197 68820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 70110 69517 gene locus_tag LOCUS_25620 70110 69517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 70289 70125 gene locus_tag LOCUS_25630 70289 70125 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947264.1 protein_id gnl|my_center|LOCUS_25630 70767 71573 gene locus_tag LOCUS_25640 70767 71573 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_25640 71570 72220 gene locus_tag LOCUS_25650 gene thiE 71570 72220 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038371.1 protein_id gnl|my_center|LOCUS_25650 72204 73487 gene locus_tag LOCUS_25660 gene hemL 72204 73487 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 protein_id gnl|my_center|LOCUS_25660 73959 75854 gene locus_tag LOCUS_25670 73959 75854 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_25670 75994 76671 gene locus_tag LOCUS_25680 75994 76671 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085635.1 protein_id gnl|my_center|LOCUS_25680 76813 77700 gene locus_tag LOCUS_25690 gene prpB 76813 77700 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103044.1 protein_id gnl|my_center|LOCUS_25690 77825 78979 gene locus_tag LOCUS_25700 gene prpC 77825 78979 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036232.1 protein_id gnl|my_center|LOCUS_25700 79128 81734 gene locus_tag LOCUS_25710 gene acnD 79128 81734 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188189.1 protein_id gnl|my_center|LOCUS_25710 81741 82934 gene locus_tag LOCUS_25720 gene prpF 81741 82934 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 protein_id gnl|my_center|LOCUS_25720 84029 83259 gene locus_tag LOCUS_25730 84029 83259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 84671 85567 gene locus_tag LOCUS_25740 84671 85567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 85638 86204 gene locus_tag LOCUS_25750 85638 86204 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105248.1 protein_id gnl|my_center|LOCUS_25750 87445 86240 gene locus_tag LOCUS_25760 87445 86240 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_25760 87571 88038 gene locus_tag LOCUS_25770 87571 88038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 88471 88145 gene locus_tag LOCUS_25780 88471 88145 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169602550.1 protein_id gnl|my_center|LOCUS_25780 89170 88751 gene locus_tag LOCUS_25790 89170 88751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 89328 89642 gene locus_tag LOCUS_25800 89328 89642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 90250 89765 gene locus_tag LOCUS_25810 gene sspB 90250 89765 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098964.1 protein_id gnl|my_center|LOCUS_25810 90855 90250 gene locus_tag LOCUS_25820 gene sspA 90855 90250 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210135.1 protein_id gnl|my_center|LOCUS_25820 91825 91091 gene locus_tag LOCUS_25830 91825 91091 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479715.1 protein_id gnl|my_center|LOCUS_25830 93066 91822 gene locus_tag LOCUS_25840 93066 91822 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_25840 93659 93066 gene locus_tag LOCUS_25850 gene petA 93659 93066 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_25850 94645 93893 gene locus_tag LOCUS_25860 94645 93893 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072570.1 protein_id gnl|my_center|LOCUS_25860 96002 94962 gene locus_tag LOCUS_25870 96002 94962 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269130.1 protein_id gnl|my_center|LOCUS_25870 96210 98756 gene locus_tag LOCUS_25880 gene lptD 96210 98756 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113209.1 protein_id gnl|my_center|LOCUS_25880 98737 100071 gene locus_tag LOCUS_25890 98737 100071 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 protein_id gnl|my_center|LOCUS_25890 100068 101075 gene locus_tag LOCUS_25900 gene pdxA 100068 101075 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093001.1 protein_id gnl|my_center|LOCUS_25900 102017 101082 gene locus_tag LOCUS_25910 102017 101082 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_25910 102096 102470 gene locus_tag LOCUS_25920 gene apaG 102096 102470 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 protein_id gnl|my_center|LOCUS_25920 102873 102658 gene locus_tag LOCUS_25930 102873 102658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 102775 103476 gene locus_tag LOCUS_25940 102775 103476 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522249.1 protein_id gnl|my_center|LOCUS_25940 104079 103522 gene locus_tag LOCUS_25950 gene folA 104079 103522 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502023.1 protein_id gnl|my_center|LOCUS_25950 105128 104076 gene locus_tag LOCUS_25960 gene aroG 105128 104076 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_25960 105955 105338 gene locus_tag LOCUS_25970 105955 105338 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_25970 106039 106383 gene locus_tag LOCUS_25980 106039 106383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 106743 106459 gene locus_tag LOCUS_25990 106743 106459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 106696 106983 gene locus_tag LOCUS_26000 106696 106983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 107713 106958 gene locus_tag LOCUS_26010 gene sdhB 107713 106958 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291827.1 protein_id gnl|my_center|LOCUS_26010 109637 107754 gene locus_tag LOCUS_26020 gene sdhA 109637 107754 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122818.1 protein_id gnl|my_center|LOCUS_26020 110266 109634 gene locus_tag LOCUS_26030 110266 109634 CDS product succinate dehydrogenase cytochrome b558 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272241.1 protein_id gnl|my_center|LOCUS_26030 111256 110504 gene locus_tag LOCUS_26040 gene ttcA 111256 110504 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940803.1 protein_id gnl|my_center|LOCUS_26040 111872 111243 gene locus_tag LOCUS_26050 111872 111243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 112874 111876 gene locus_tag LOCUS_26060 112874 111876 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_26060 113024 114598 gene locus_tag LOCUS_26070 113024 114598 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245514.1 protein_id gnl|my_center|LOCUS_26070 115241 114801 gene locus_tag LOCUS_26080 115241 114801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 116782 115238 gene locus_tag LOCUS_26090 116782 115238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 118149 116779 gene locus_tag LOCUS_26100 118149 116779 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_26100 119290 118142 gene locus_tag LOCUS_26110 119290 118142 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258428.1 protein_id gnl|my_center|LOCUS_26110 119020 118921 gene locus_tag LOCUS_t00400 119020 118921 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 120075 119395 gene locus_tag LOCUS_26120 gene cbiC 120075 119395 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999239.1 protein_id gnl|my_center|LOCUS_26120 120688 120059 gene locus_tag LOCUS_26130 120688 120059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 120578 120880 gene locus_tag LOCUS_26140 120578 120880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 121682 120888 gene locus_tag LOCUS_26150 gene cobM 121682 120888 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812298.1 protein_id gnl|my_center|LOCUS_26150 122337 121687 gene locus_tag LOCUS_26160 gene bluB 122337 121687 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence014 322 1095 gene locus_tag LOCUS_26170 322 1095 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_26170 2609 1227 gene locus_tag LOCUS_26180 2609 1227 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122185.1 protein_id gnl|my_center|LOCUS_26180 2733 3836 gene locus_tag LOCUS_26190 2733 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 3833 4804 gene locus_tag LOCUS_26200 3833 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 5065 7710 gene locus_tag LOCUS_26210 gene gyrA 5065 7710 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 protein_id gnl|my_center|LOCUS_26210 7863 8945 gene locus_tag LOCUS_26220 gene serC 7863 8945 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_26220 9172 10359 gene locus_tag LOCUS_26230 9172 10359 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_26230 10359 11459 gene locus_tag LOCUS_26240 gene pheA 10359 11459 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 protein_id gnl|my_center|LOCUS_26240 11630 12742 gene locus_tag LOCUS_26250 gene hisC 11630 12742 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_26250 12739 13611 gene locus_tag LOCUS_26260 12739 13611 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_26260 15032 13698 gene locus_tag LOCUS_26270 15032 13698 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920846.1 protein_id gnl|my_center|LOCUS_26270 15436 15047 gene locus_tag LOCUS_26280 gene queF 15436 15047 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_26280 19040 15645 gene locus_tag LOCUS_26290 19040 15645 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188267.1 protein_id gnl|my_center|LOCUS_26290 19801 21909 gene locus_tag LOCUS_26300 19801 21909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 22141 23397 gene locus_tag LOCUS_26310 22141 23397 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940858.1 protein_id gnl|my_center|LOCUS_26310 25608 23563 gene locus_tag LOCUS_26320 gene fusA 25608 23563 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_26320 26089 26562 gene locus_tag LOCUS_26330 26089 26562 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_26330 28022 26637 gene locus_tag LOCUS_26340 gene ccmI 28022 26637 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705304.1 protein_id gnl|my_center|LOCUS_26340 28519 28019 gene locus_tag LOCUS_26350 28519 28019 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 protein_id gnl|my_center|LOCUS_26350 29088 28516 gene locus_tag LOCUS_26360 29088 28516 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070641.1 protein_id gnl|my_center|LOCUS_26360 31070 29085 gene locus_tag LOCUS_26370 31070 29085 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_26370 31549 31067 gene locus_tag LOCUS_26380 gene ccmE 31549 31067 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_26380 31716 31546 gene locus_tag LOCUS_26390 31716 31546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 32477 31713 gene locus_tag LOCUS_26400 gene ccmC 32477 31713 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_26400 33171 32500 gene locus_tag LOCUS_26410 gene ccmB 33171 32500 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_26410 33795 33178 gene locus_tag LOCUS_26420 gene ccmA 33795 33178 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705297.1 protein_id gnl|my_center|LOCUS_26420 35103 34027 gene locus_tag LOCUS_26430 35103 34027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 35397 35951 gene locus_tag LOCUS_26440 35397 35951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 36663 36049 gene locus_tag LOCUS_26450 36663 36049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 37739 36798 gene locus_tag LOCUS_26460 37739 36798 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348905.1 protein_id gnl|my_center|LOCUS_26460 38038 38649 gene locus_tag LOCUS_26470 38038 38649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 38649 39032 gene locus_tag LOCUS_26480 38649 39032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 39914 39045 gene locus_tag LOCUS_26490 gene mepA 39914 39045 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483061.1 protein_id gnl|my_center|LOCUS_26490 43226 40125 gene locus_tag LOCUS_26500 43226 40125 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_26500 44329 43223 gene locus_tag LOCUS_26510 44329 43223 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640175.1 protein_id gnl|my_center|LOCUS_26510 45179 44718 gene locus_tag LOCUS_26520 45179 44718 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626602.1 protein_id gnl|my_center|LOCUS_26520 45481 45155 gene locus_tag LOCUS_26530 gene iscA 45481 45155 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_26530 46395 45733 gene locus_tag LOCUS_26540 46395 45733 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391457.1 protein_id gnl|my_center|LOCUS_26540 46877 48091 gene locus_tag LOCUS_26550 gene egtB 46877 48091 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_26550 48088 49134 gene locus_tag LOCUS_26560 gene egtD 48088 49134 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967207.1 protein_id gnl|my_center|LOCUS_26560 50121 49519 gene locus_tag LOCUS_26570 50121 49519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 50600 53398 gene locus_tag LOCUS_26580 gene ppc 50600 53398 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207161458.1 protein_id gnl|my_center|LOCUS_26580 53600 54508 gene locus_tag LOCUS_26590 53600 54508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 54601 55800 gene locus_tag LOCUS_26600 54601 55800 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384880.1 protein_id gnl|my_center|LOCUS_26600 56066 56338 gene locus_tag LOCUS_26610 gene rpsP 56066 56338 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092643.1 protein_id gnl|my_center|LOCUS_26610 56389 56898 gene locus_tag LOCUS_26620 gene rimM 56389 56898 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036397.1 protein_id gnl|my_center|LOCUS_26620 56921 57670 gene locus_tag LOCUS_26630 gene trmD 56921 57670 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704631.1 protein_id gnl|my_center|LOCUS_26630 57691 58035 gene locus_tag LOCUS_26640 gene rplS 57691 58035 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417803.1 protein_id gnl|my_center|LOCUS_26640 58090 59544 gene locus_tag LOCUS_26650 gene sbcB 58090 59544 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104954.1 protein_id gnl|my_center|LOCUS_26650 60233 59634 gene locus_tag LOCUS_26660 60233 59634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 60973 60611 gene locus_tag LOCUS_26670 60973 60611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 61438 61028 gene locus_tag LOCUS_26680 61438 61028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 61622 63514 gene locus_tag LOCUS_26690 gene slt 61622 63514 CDS product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_26690 63528 64262 gene locus_tag LOCUS_26700 63528 64262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 65177 64386 gene locus_tag LOCUS_26710 65177 64386 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 protein_id gnl|my_center|LOCUS_26710 65513 66484 gene locus_tag LOCUS_26720 65513 66484 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197236.1 protein_id gnl|my_center|LOCUS_26720 66593 67369 gene locus_tag LOCUS_26730 66593 67369 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404405.1 protein_id gnl|my_center|LOCUS_26730 67455 68927 gene locus_tag LOCUS_26740 gene htrA 67455 68927 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873435.1 protein_id gnl|my_center|LOCUS_26740 68980 69600 gene locus_tag LOCUS_26750 68980 69600 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103182.1 protein_id gnl|my_center|LOCUS_26750 69597 70145 gene locus_tag LOCUS_26760 69597 70145 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103818.1 protein_id gnl|my_center|LOCUS_26760 70142 70849 gene locus_tag LOCUS_26770 gene mtnC 70142 70849 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147428.1 protein_id gnl|my_center|LOCUS_26770 73137 70786 gene locus_tag LOCUS_26780 73137 70786 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 protein_id gnl|my_center|LOCUS_26780 74010 73243 gene locus_tag LOCUS_26790 74010 73243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 74377 74057 gene locus_tag LOCUS_26800 74377 74057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 74832 78236 gene locus_tag LOCUS_26810 74832 78236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 78597 78343 gene locus_tag LOCUS_26820 gene moaD 78597 78343 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705488.1 protein_id gnl|my_center|LOCUS_26820 80062 78752 gene locus_tag LOCUS_26830 80062 78752 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103964.1 protein_id gnl|my_center|LOCUS_26830 80589 80059 gene locus_tag LOCUS_26840 gene moaB 80589 80059 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036101.1 protein_id gnl|my_center|LOCUS_26840 80826 81788 gene locus_tag LOCUS_26850 gene msrP 80826 81788 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401748.1 protein_id gnl|my_center|LOCUS_26850 81859 82488 gene locus_tag LOCUS_26860 gene msrQ 81859 82488 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036769.1 protein_id gnl|my_center|LOCUS_26860 85730 82647 gene locus_tag LOCUS_26870 85730 82647 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772627.1 protein_id gnl|my_center|LOCUS_26870 86818 85727 gene locus_tag LOCUS_26880 86818 85727 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958004.1 protein_id gnl|my_center|LOCUS_26880 88114 86933 gene locus_tag LOCUS_26890 88114 86933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 88409 89776 gene locus_tag LOCUS_26900 88409 89776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 89883 90968 gene locus_tag LOCUS_26910 89883 90968 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_26910 91894 91241 gene locus_tag LOCUS_26920 gene cysC 91894 91241 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332129.1 protein_id gnl|my_center|LOCUS_26920 92429 92031 gene locus_tag LOCUS_26930 92429 92031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 92766 92449 gene locus_tag LOCUS_26940 92766 92449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 94061 92943 gene locus_tag LOCUS_26950 94061 92943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_26950 95691 94045 gene locus_tag LOCUS_26960 95691 94045 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_26960 96855 95827 gene locus_tag LOCUS_26970 96855 95827 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_26970 97511 98956 gene locus_tag LOCUS_26980 gene sufB 97511 98956 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946338.1 protein_id gnl|my_center|LOCUS_26980 99174 99929 gene locus_tag LOCUS_26990 gene sufC 99174 99929 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 protein_id gnl|my_center|LOCUS_26990 99926 101248 gene locus_tag LOCUS_27000 gene sufD 99926 101248 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_27000 101365 101769 gene locus_tag LOCUS_27010 101365 101769 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919725.1 protein_id gnl|my_center|LOCUS_27010 102971 101781 gene locus_tag LOCUS_27020 102971 101781 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082008.1 protein_id gnl|my_center|LOCUS_27020 104000 103188 gene locus_tag LOCUS_27030 104000 103188 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479178.1 protein_id gnl|my_center|LOCUS_27030 104798 104097 gene locus_tag LOCUS_27040 104798 104097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 104912 105301 gene locus_tag LOCUS_27050 104912 105301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 105411 107783 gene locus_tag LOCUS_27060 105411 107783 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099617780.1 protein_id gnl|my_center|LOCUS_27060 107755 108162 gene locus_tag LOCUS_27070 107755 108162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 108228 109460 gene locus_tag LOCUS_27080 108228 109460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 109457 112606 gene locus_tag LOCUS_27090 109457 112606 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_27090 114591 112654 gene locus_tag LOCUS_27100 114591 112654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 116737 115148 gene locus_tag LOCUS_27110 116737 115148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 117511 117002 gene locus_tag LOCUS_27120 117511 117002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 120259 117728 gene locus_tag LOCUS_27130 120259 117728 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404082.1 protein_id gnl|my_center|LOCUS_27130 120969 120259 gene locus_tag LOCUS_27140 120969 120259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942828.1 protein_id gnl|my_center|LOCUS_27140 121229 120990 gene locus_tag LOCUS_27150 121229 120990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence015 218 832 gene locus_tag LOCUS_27160 218 832 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444207.1 protein_id gnl|my_center|LOCUS_27160 881 1447 gene locus_tag LOCUS_27170 881 1447 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228531.1 protein_id gnl|my_center|LOCUS_27170 1896 1498 gene locus_tag LOCUS_27180 1896 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 3140 2451 gene locus_tag LOCUS_27190 3140 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 4074 4988 gene locus_tag LOCUS_27200 4074 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 5362 7509 gene locus_tag LOCUS_27210 5362 7509 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_27210 7749 8516 gene locus_tag LOCUS_27220 7749 8516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 8535 9689 gene locus_tag LOCUS_27230 8535 9689 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927132.1 protein_id gnl|my_center|LOCUS_27230 10227 9808 gene locus_tag LOCUS_27240 10227 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 10510 10767 gene locus_tag LOCUS_27250 10510 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 10928 12454 gene locus_tag LOCUS_27260 10928 12454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 13256 12495 gene locus_tag LOCUS_27270 13256 12495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 14692 13415 gene locus_tag LOCUS_27280 gene menC 14692 13415 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_27280 16721 14670 gene locus_tag LOCUS_27290 16721 14670 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528676.1 protein_id gnl|my_center|LOCUS_27290 17031 18512 gene locus_tag LOCUS_27300 17031 18512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 18559 22437 gene locus_tag LOCUS_27310 18559 22437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 23291 22467 gene locus_tag LOCUS_27320 23291 22467 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_27320 24698 23439 gene locus_tag LOCUS_27330 24698 23439 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_27330 25524 24673 gene locus_tag LOCUS_27340 25524 24673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 26296 25529 gene locus_tag LOCUS_27350 gene olsB 26296 25529 CDS product L-ornithine N(alpha)-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093970.1 protein_id gnl|my_center|LOCUS_27350 26528 28765 gene locus_tag LOCUS_27360 26528 28765 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118645.1 protein_id gnl|my_center|LOCUS_27360 29885 28863 gene locus_tag LOCUS_27370 29885 28863 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228684.1 protein_id gnl|my_center|LOCUS_27370 30345 29896 gene locus_tag LOCUS_27380 30345 29896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 30747 30553 gene locus_tag LOCUS_27390 30747 30553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 32031 31111 gene locus_tag LOCUS_27400 32031 31111 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_27400 32216 34819 gene locus_tag LOCUS_27410 gene clpB 32216 34819 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 protein_id gnl|my_center|LOCUS_27410 34833 35804 gene locus_tag LOCUS_27420 34833 35804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 37540 35849 gene locus_tag LOCUS_27430 37540 35849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 39258 37537 gene locus_tag LOCUS_27440 39258 37537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 40754 39255 gene locus_tag LOCUS_27450 40754 39255 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967807.1 protein_id gnl|my_center|LOCUS_27450 42190 40751 gene locus_tag LOCUS_27460 42190 40751 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090055.1 protein_id gnl|my_center|LOCUS_27460 42479 42183 gene locus_tag LOCUS_27470 42479 42183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 43156 42476 gene locus_tag LOCUS_27480 43156 42476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 43443 43153 gene locus_tag LOCUS_27490 43443 43153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 43748 43440 gene locus_tag LOCUS_27500 43748 43440 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_27500 44012 43749 gene locus_tag LOCUS_27510 44012 43749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 44595 44050 gene locus_tag LOCUS_27520 44595 44050 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_27520 45156 45851 gene locus_tag LOCUS_27530 45156 45851 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168989238.1 protein_id gnl|my_center|LOCUS_27530 45886 47019 gene locus_tag LOCUS_27540 45886 47019 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_27540 48431 47139 gene locus_tag LOCUS_27550 48431 47139 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_27550 49070 48453 gene locus_tag LOCUS_27560 49070 48453 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483578.1 protein_id gnl|my_center|LOCUS_27560 50228 49245 gene locus_tag LOCUS_27570 50228 49245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 50817 50260 gene locus_tag LOCUS_27580 50817 50260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 52302 51232 gene locus_tag LOCUS_27590 gene nadA 52302 51232 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072333.1 protein_id gnl|my_center|LOCUS_27590 53882 52338 gene locus_tag LOCUS_27600 53882 52338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 54330 55481 gene locus_tag LOCUS_27610 54330 55481 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837901.1 protein_id gnl|my_center|LOCUS_27610 55582 59511 gene locus_tag LOCUS_27620 55582 59511 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_27620 60418 61215 gene locus_tag LOCUS_27630 60418 61215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 61331 61963 gene locus_tag LOCUS_27640 gene parA 61331 61963 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022836937.1 protein_id gnl|my_center|LOCUS_27640 62299 62844 gene locus_tag LOCUS_27650 62299 62844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 62888 63865 gene locus_tag LOCUS_27660 62888 63865 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_27660 65670 63862 gene locus_tag LOCUS_27670 65670 63862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 66895 65825 gene locus_tag LOCUS_27680 gene epmB 66895 65825 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_27680 66930 67502 gene locus_tag LOCUS_27690 gene efp 66930 67502 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_27690 67558 68547 gene locus_tag LOCUS_27700 gene epmA 67558 68547 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 protein_id gnl|my_center|LOCUS_27700 69229 68603 gene locus_tag LOCUS_27710 69229 68603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 70483 69386 gene locus_tag LOCUS_27720 gene bioB 70483 69386 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_27720 70786 71325 gene locus_tag LOCUS_27730 70786 71325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 71417 72889 gene locus_tag LOCUS_27740 71417 72889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 73148 73624 gene locus_tag LOCUS_27750 73148 73624 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813017.1 protein_id gnl|my_center|LOCUS_27750 73693 74475 gene locus_tag LOCUS_27760 73693 74475 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_27760 74485 75687 gene locus_tag LOCUS_27770 74485 75687 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406662.1 protein_id gnl|my_center|LOCUS_27770 75691 76779 gene locus_tag LOCUS_27780 gene zapE 75691 76779 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707598.1 protein_id gnl|my_center|LOCUS_27780 76877 77632 gene locus_tag LOCUS_27790 gene ubiG 76877 77632 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529456.1 protein_id gnl|my_center|LOCUS_27790 78799 77660 gene locus_tag LOCUS_27800 78799 77660 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_27800 80520 78802 gene locus_tag LOCUS_27810 80520 78802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 80843 82705 gene locus_tag LOCUS_27820 gene mdoH 80843 82705 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038607.1 protein_id gnl|my_center|LOCUS_27820 82721 83560 gene locus_tag LOCUS_27830 82721 83560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 83557 84582 gene locus_tag LOCUS_27840 83557 84582 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 protein_id gnl|my_center|LOCUS_27840 84637 85047 gene locus_tag LOCUS_27850 84637 85047 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031076.1 protein_id gnl|my_center|LOCUS_27850 85050 86114 gene locus_tag LOCUS_27860 85050 86114 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168117700.1 protein_id gnl|my_center|LOCUS_27860 86107 86973 gene locus_tag LOCUS_27870 86107 86973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 88022 87036 gene locus_tag LOCUS_27880 88022 87036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 88300 89724 gene locus_tag LOCUS_27890 88300 89724 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706283.1 protein_id gnl|my_center|LOCUS_27890 89866 90582 gene locus_tag LOCUS_27900 gene dnr 89866 90582 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_27900 91391 90594 gene locus_tag LOCUS_27910 91391 90594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 92317 91391 gene locus_tag LOCUS_27920 gene hemC 92317 91391 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114031.1 protein_id gnl|my_center|LOCUS_27920 97650 92494 gene locus_tag LOCUS_27930 97650 92494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 98362 97748 gene locus_tag LOCUS_27940 98362 97748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 99514 98480 gene locus_tag LOCUS_27950 99514 98480 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_27950 99545 100432 gene locus_tag LOCUS_27960 99545 100432 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_27960 100645 101055 gene locus_tag LOCUS_27970 100645 101055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 101116 101442 gene locus_tag LOCUS_27980 101116 101442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 101850 102131 gene locus_tag LOCUS_27990 101850 102131 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_27990 103738 102254 gene locus_tag LOCUS_28000 gene ubiD 103738 102254 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768425.1 protein_id gnl|my_center|LOCUS_28000 105802 103769 gene locus_tag LOCUS_28010 gene prlC 105802 103769 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 protein_id gnl|my_center|LOCUS_28010 106754 106113 gene locus_tag LOCUS_28020 106754 106113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 107259 106774 gene locus_tag LOCUS_28030 107259 106774 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173947.1 protein_id gnl|my_center|LOCUS_28030 107522 107761 gene locus_tag LOCUS_28040 107522 107761 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545287.1 protein_id gnl|my_center|LOCUS_28040 108309 107854 gene locus_tag LOCUS_28050 108309 107854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 108498 109313 gene locus_tag LOCUS_28060 108498 109313 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120310.1 protein_id gnl|my_center|LOCUS_28060 109583 110680 gene locus_tag LOCUS_28070 109583 110680 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269378.1 protein_id gnl|my_center|LOCUS_28070 110954 111250 gene locus_tag LOCUS_28080 110954 111250 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926341.1 protein_id gnl|my_center|LOCUS_28080 111263 112663 gene locus_tag LOCUS_28090 111263 112663 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390030.1 protein_id gnl|my_center|LOCUS_28090 114105 112801 gene locus_tag LOCUS_28100 114105 112801 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384908.1 protein_id gnl|my_center|LOCUS_28100 115028 114171 gene locus_tag LOCUS_28110 gene folP 115028 114171 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337038.1 protein_id gnl|my_center|LOCUS_28110 115217 115564 gene locus_tag LOCUS_28120 115217 115564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 >Feature sequence016 1424 558 gene locus_tag LOCUS_28130 1424 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 2776 1622 gene locus_tag LOCUS_28140 2776 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 3554 2790 gene locus_tag LOCUS_28150 3554 2790 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937996.1 protein_id gnl|my_center|LOCUS_28150 6062 3579 gene locus_tag LOCUS_28160 6062 3579 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272623.1 protein_id gnl|my_center|LOCUS_28160 7072 6143 gene locus_tag LOCUS_28170 7072 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 7871 8674 gene locus_tag LOCUS_28180 gene phnD 7871 8674 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255931.1 protein_id gnl|my_center|LOCUS_28180 8671 10101 gene locus_tag LOCUS_28190 8671 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 10098 11396 gene locus_tag LOCUS_28200 10098 11396 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842237.1 protein_id gnl|my_center|LOCUS_28200 12792 11518 gene locus_tag LOCUS_28210 12792 11518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 14575 12794 gene locus_tag LOCUS_28220 14575 12794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 14746 15054 gene locus_tag LOCUS_28230 14746 15054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 15092 15790 gene locus_tag LOCUS_28240 15092 15790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 18239 15801 gene locus_tag LOCUS_28250 18239 15801 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113604.1 protein_id gnl|my_center|LOCUS_28250 19388 18456 gene locus_tag LOCUS_28260 19388 18456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932592.1 protein_id gnl|my_center|LOCUS_28260 20169 19558 gene locus_tag LOCUS_28270 20169 19558 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707254.1 protein_id gnl|my_center|LOCUS_28270 21209 20295 gene locus_tag LOCUS_28280 21209 20295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 23915 21456 gene locus_tag LOCUS_28290 23915 21456 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_28290 24294 25259 gene locus_tag LOCUS_28300 24294 25259 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388043.1 protein_id gnl|my_center|LOCUS_28300 25970 25323 gene locus_tag LOCUS_28310 25970 25323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 26438 26794 gene locus_tag LOCUS_28320 26438 26794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 27443 27568 gene locus_tag LOCUS_28330 27443 27568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 27751 28548 gene locus_tag LOCUS_28340 27751 28548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 29717 28818 gene locus_tag LOCUS_28350 29717 28818 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202112.1 protein_id gnl|my_center|LOCUS_28350 30256 29900 gene locus_tag LOCUS_28360 30256 29900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 31102 30368 gene locus_tag LOCUS_28370 31102 30368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 32155 31631 gene locus_tag LOCUS_28380 32155 31631 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_28380 32500 32796 gene locus_tag LOCUS_28390 gene lsrG 32500 32796 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098845.1 protein_id gnl|my_center|LOCUS_28390 32798 33994 gene locus_tag LOCUS_28400 32798 33994 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_28400 34441 35952 gene locus_tag LOCUS_28410 gene glpK 34441 35952 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_28410 35957 37627 gene locus_tag LOCUS_28420 gene glpD 35957 37627 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994115.1 protein_id gnl|my_center|LOCUS_28420 37819 38553 gene locus_tag LOCUS_28430 37819 38553 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189870.1 protein_id gnl|my_center|LOCUS_28430 38595 40385 gene locus_tag LOCUS_28440 38595 40385 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148771775.1 protein_id gnl|my_center|LOCUS_28440 40585 42171 gene locus_tag LOCUS_28450 40585 42171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 42469 42672 gene locus_tag LOCUS_28460 42469 42672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 42672 45323 gene locus_tag LOCUS_28470 42672 45323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_28470 45649 47034 gene locus_tag LOCUS_28480 gene mgtE 45649 47034 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404919.1 protein_id gnl|my_center|LOCUS_28480 47314 47703 gene locus_tag LOCUS_28490 47314 47703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 48368 47769 gene locus_tag LOCUS_28500 48368 47769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202392502.1 protein_id gnl|my_center|LOCUS_28500 49140 48646 gene locus_tag LOCUS_28510 49140 48646 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 protein_id gnl|my_center|LOCUS_28510 51852 49495 gene locus_tag LOCUS_28520 51852 49495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 53077 52550 gene locus_tag LOCUS_28530 53077 52550 CDS product RES domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525336.1 protein_id gnl|my_center|LOCUS_28530 53442 53074 gene locus_tag LOCUS_28540 53442 53074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509401.1 protein_id gnl|my_center|LOCUS_28540 53909 54538 gene locus_tag LOCUS_28550 53909 54538 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552423.1 protein_id gnl|my_center|LOCUS_28550 55532 54585 gene locus_tag LOCUS_28560 55532 54585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 56320 57795 gene locus_tag LOCUS_28570 56320 57795 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095207.1 protein_id gnl|my_center|LOCUS_28570 58002 58868 gene locus_tag LOCUS_28580 58002 58868 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_28580 58882 59139 gene locus_tag LOCUS_28590 58882 59139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 60205 59369 gene locus_tag LOCUS_28600 60205 59369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 61451 60213 gene locus_tag LOCUS_28610 61451 60213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 62080 61448 gene locus_tag LOCUS_28620 62080 61448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 65780 62073 gene locus_tag LOCUS_28630 65780 62073 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073731.1 protein_id gnl|my_center|LOCUS_28630 66637 65849 gene locus_tag LOCUS_28640 66637 65849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142942.1 protein_id gnl|my_center|LOCUS_28640 67472 67269 gene locus_tag LOCUS_28650 67472 67269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 67807 68007 gene locus_tag LOCUS_28660 67807 68007 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087471.1 protein_id gnl|my_center|LOCUS_28660 68169 69584 gene locus_tag LOCUS_28670 68169 69584 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 protein_id gnl|my_center|LOCUS_28670 69684 70667 gene locus_tag LOCUS_28680 69684 70667 CDS product quinoprotein relay system zinc metallohydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966742.1 protein_id gnl|my_center|LOCUS_28680 70777 71643 gene locus_tag LOCUS_28690 gene aroE 70777 71643 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973723.1 protein_id gnl|my_center|LOCUS_28690 73166 71820 gene locus_tag LOCUS_28700 73166 71820 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228947.1 protein_id gnl|my_center|LOCUS_28700 74301 73435 gene locus_tag LOCUS_28710 74301 73435 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_28710 74505 74849 gene locus_tag LOCUS_28720 74505 74849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28720 75631 75272 gene locus_tag LOCUS_28730 75631 75272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 78193 77558 gene locus_tag LOCUS_28740 78193 77558 CDS product DUF1109 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205048.1 protein_id gnl|my_center|LOCUS_28740 78770 78204 gene locus_tag LOCUS_28750 78770 78204 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034199428.1 protein_id gnl|my_center|LOCUS_28750 79021 79326 gene locus_tag LOCUS_28760 79021 79326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 79378 80241 gene locus_tag LOCUS_28770 79378 80241 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665800.1 protein_id gnl|my_center|LOCUS_28770 80238 81020 gene locus_tag LOCUS_28780 80238 81020 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931205.1 protein_id gnl|my_center|LOCUS_28780 81023 81550 gene locus_tag LOCUS_28790 81023 81550 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931206.1 protein_id gnl|my_center|LOCUS_28790 82028 83425 gene locus_tag LOCUS_28800 82028 83425 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263053.1 protein_id gnl|my_center|LOCUS_28800 84474 83614 gene locus_tag LOCUS_28810 84474 83614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 84860 85612 gene locus_tag LOCUS_28820 84860 85612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28820 85612 86073 gene locus_tag LOCUS_28830 85612 86073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28830 86074 86220 gene locus_tag LOCUS_28840 86074 86220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 86254 86502 gene locus_tag LOCUS_28850 86254 86502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 87184 86912 gene locus_tag LOCUS_28860 87184 86912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28860 87268 88344 gene locus_tag LOCUS_28870 87268 88344 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826413.1 protein_id gnl|my_center|LOCUS_28870 88573 89580 gene locus_tag LOCUS_28880 88573 89580 CDS product ISAs1-like element ISEc5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421020.1 protein_id gnl|my_center|LOCUS_28880 90852 89848 gene locus_tag LOCUS_28890 90852 89848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 91766 91047 gene locus_tag LOCUS_28900 91766 91047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 92084 91824 gene locus_tag LOCUS_28910 92084 91824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 92105 92356 gene locus_tag LOCUS_28920 92105 92356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 92759 92286 gene locus_tag LOCUS_28930 92759 92286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 93404 92985 gene locus_tag LOCUS_28940 93404 92985 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141677.1 protein_id gnl|my_center|LOCUS_28940 93637 93401 gene locus_tag LOCUS_28950 93637 93401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 94237 93995 gene locus_tag LOCUS_28960 94237 93995 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_28960 94922 94536 gene locus_tag LOCUS_28970 94922 94536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 95297 94998 gene locus_tag LOCUS_28980 95297 94998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 95828 96079 gene locus_tag LOCUS_28990 95828 96079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 96386 96171 gene locus_tag LOCUS_29000 96386 96171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 96640 96371 gene locus_tag LOCUS_29010 96640 96371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 96866 98137 gene locus_tag LOCUS_29020 96866 98137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 98858 98439 gene locus_tag LOCUS_29030 98858 98439 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153443186.1 protein_id gnl|my_center|LOCUS_29030 99081 98845 gene locus_tag LOCUS_29040 99081 98845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 100346 99846 gene locus_tag LOCUS_29050 100346 99846 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086970.1 protein_id gnl|my_center|LOCUS_29050 100919 101284 gene locus_tag LOCUS_29060 100919 101284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 101331 101660 gene locus_tag LOCUS_29070 101331 101660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 101843 103177 gene locus_tag LOCUS_29080 101843 103177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 103357 104469 gene locus_tag LOCUS_29090 103357 104469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 104888 104571 gene locus_tag LOCUS_29100 104888 104571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 105207 104881 gene locus_tag LOCUS_29110 105207 104881 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_29110 106113 106319 gene locus_tag LOCUS_29120 106113 106319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 106300 106563 gene locus_tag LOCUS_29130 106300 106563 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_29130 107906 106860 gene locus_tag LOCUS_29140 107906 106860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 108784 108518 gene locus_tag LOCUS_29150 108784 108518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence017 565 107 gene locus_tag LOCUS_29160 565 107 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174550.1 protein_id gnl|my_center|LOCUS_29160 2109 691 gene locus_tag LOCUS_29170 2109 691 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036911.1 protein_id gnl|my_center|LOCUS_29170 2726 2253 gene locus_tag LOCUS_29180 2726 2253 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104801.1 protein_id gnl|my_center|LOCUS_29180 3422 2877 gene locus_tag LOCUS_29190 3422 2877 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086267.1 protein_id gnl|my_center|LOCUS_29190 4132 3560 gene locus_tag LOCUS_29200 4132 3560 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_29200 4450 5469 gene locus_tag LOCUS_29210 4450 5469 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 protein_id gnl|my_center|LOCUS_29210 5478 6746 gene locus_tag LOCUS_29220 gene arsJ 5478 6746 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798948.1 protein_id gnl|my_center|LOCUS_29220 7111 6794 gene locus_tag LOCUS_29230 gene bolA 7111 6794 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 protein_id gnl|my_center|LOCUS_29230 7327 7689 gene locus_tag LOCUS_29240 7327 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 8427 7870 gene locus_tag LOCUS_29250 8427 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 9960 8587 gene locus_tag LOCUS_29260 gene trkA 9960 8587 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_29260 11350 9980 gene locus_tag LOCUS_29270 11350 9980 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941477.1 protein_id gnl|my_center|LOCUS_29270 13537 11354 gene locus_tag LOCUS_29280 13537 11354 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807333.1 protein_id gnl|my_center|LOCUS_29280 14121 13534 gene locus_tag LOCUS_29290 14121 13534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 15383 14118 gene locus_tag LOCUS_29300 gene rsmB 15383 14118 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704264.1 protein_id gnl|my_center|LOCUS_29300 16437 15466 gene locus_tag LOCUS_29310 gene fmt 16437 15466 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266132.1 protein_id gnl|my_center|LOCUS_29310 17005 16472 gene locus_tag LOCUS_29320 gene def 17005 16472 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709217.1 protein_id gnl|my_center|LOCUS_29320 17195 18400 gene locus_tag LOCUS_29330 17195 18400 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_29330 18447 19598 gene locus_tag LOCUS_29340 gene dprA 18447 19598 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 protein_id gnl|my_center|LOCUS_29340 19691 20167 gene locus_tag LOCUS_29350 19691 20167 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070451.1 protein_id gnl|my_center|LOCUS_29350 20701 23010 gene locus_tag LOCUS_29360 gene topA 20701 23010 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958589.1 protein_id gnl|my_center|LOCUS_29360 24002 23016 gene locus_tag LOCUS_29370 gene moaA 24002 23016 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388276.1 protein_id gnl|my_center|LOCUS_29370 24972 24088 gene locus_tag LOCUS_29380 24972 24088 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 protein_id gnl|my_center|LOCUS_29380 25363 25749 gene locus_tag LOCUS_29390 25363 25749 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_29390 25884 27044 gene locus_tag LOCUS_29400 gene mltB 25884 27044 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705439.1 protein_id gnl|my_center|LOCUS_29400 27084 29174 gene locus_tag LOCUS_29410 gene recG 27084 29174 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 protein_id gnl|my_center|LOCUS_29410 29425 29826 gene locus_tag LOCUS_29420 29425 29826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 30817 29861 gene locus_tag LOCUS_29430 30817 29861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 31530 31171 gene locus_tag LOCUS_29440 31530 31171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 34794 31681 gene locus_tag LOCUS_29450 34794 31681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 36059 34791 gene locus_tag LOCUS_29460 gene urtA 36059 34791 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889579.1 protein_id gnl|my_center|LOCUS_29460 37551 36289 gene locus_tag LOCUS_29470 37551 36289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 39622 37664 gene locus_tag LOCUS_29480 39622 37664 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_29480 39880 40668 gene locus_tag LOCUS_29490 39880 40668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 40743 42194 gene locus_tag LOCUS_29500 gene cls 40743 42194 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034050559.1 protein_id gnl|my_center|LOCUS_29500 43138 42320 gene locus_tag LOCUS_29510 43138 42320 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922721.1 protein_id gnl|my_center|LOCUS_29510 44399 43353 gene locus_tag LOCUS_29520 44399 43353 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_29520 45446 44541 gene locus_tag LOCUS_29530 gene rimK 45446 44541 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 protein_id gnl|my_center|LOCUS_29530 45925 45443 gene locus_tag LOCUS_29540 gene lspA 45925 45443 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946027.1 protein_id gnl|my_center|LOCUS_29540 48830 45999 gene locus_tag LOCUS_29550 gene ileS 48830 45999 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488695.1 protein_id gnl|my_center|LOCUS_29550 50008 49031 gene locus_tag LOCUS_29560 gene ribF 50008 49031 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 protein_id gnl|my_center|LOCUS_29560 51623 50088 gene locus_tag LOCUS_29570 gene murJ 51623 50088 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948335.1 protein_id gnl|my_center|LOCUS_29570 51784 52047 gene locus_tag LOCUS_29580 gene rpsT 51784 52047 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094744.1 protein_id gnl|my_center|LOCUS_29580 53013 52171 gene locus_tag LOCUS_29590 gene lgt 53013 52171 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772080.1 protein_id gnl|my_center|LOCUS_29590 53872 53150 gene locus_tag LOCUS_29600 53872 53150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 54179 54400 gene locus_tag LOCUS_29610 54179 54400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 57093 54322 gene locus_tag LOCUS_29620 gene ppdK 57093 54322 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_29620 59134 57260 gene locus_tag LOCUS_29630 59134 57260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 59897 59142 gene locus_tag LOCUS_29640 59897 59142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 60365 59904 gene locus_tag LOCUS_29650 60365 59904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 60923 60444 gene locus_tag LOCUS_29660 60923 60444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 62047 60938 gene locus_tag LOCUS_29670 62047 60938 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_29670 62478 65405 gene locus_tag LOCUS_29680 62478 65405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 66777 65674 gene locus_tag LOCUS_29690 66777 65674 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_29690 70139 66954 gene locus_tag LOCUS_29700 70139 66954 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393549.1 protein_id gnl|my_center|LOCUS_29700 71416 70139 gene locus_tag LOCUS_29710 71416 70139 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393551.1 protein_id gnl|my_center|LOCUS_29710 71904 72842 gene locus_tag LOCUS_29720 gene ubiA 71904 72842 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460372.1 protein_id gnl|my_center|LOCUS_29720 73558 73019 gene locus_tag LOCUS_29730 73558 73019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 74372 73569 gene locus_tag LOCUS_29740 74372 73569 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_29740 74838 74428 gene locus_tag LOCUS_29750 74838 74428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 75073 75855 gene locus_tag LOCUS_29760 75073 75855 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_29760 76976 75897 gene locus_tag LOCUS_29770 76976 75897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 77051 77530 gene locus_tag LOCUS_29780 gene rlmH 77051 77530 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701620.1 protein_id gnl|my_center|LOCUS_29780 77536 78177 gene locus_tag LOCUS_29790 77536 78177 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813200.1 protein_id gnl|my_center|LOCUS_29790 78247 79749 gene locus_tag LOCUS_29800 gene rng 78247 79749 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_29800 79796 83902 gene locus_tag LOCUS_29810 79796 83902 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037738.1 protein_id gnl|my_center|LOCUS_29810 84025 84849 gene locus_tag LOCUS_29820 84025 84849 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_29820 84961 86409 gene locus_tag LOCUS_29830 gene tldD 84961 86409 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931196.1 protein_id gnl|my_center|LOCUS_29830 86461 87810 gene locus_tag LOCUS_29840 gene pmbA 86461 87810 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 protein_id gnl|my_center|LOCUS_29840 87910 88185 gene locus_tag LOCUS_29850 87910 88185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 88330 89694 gene locus_tag LOCUS_29860 88330 89694 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163651105.1 protein_id gnl|my_center|LOCUS_29860 89691 90458 gene locus_tag LOCUS_29870 89691 90458 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_29870 90458 91684 gene locus_tag LOCUS_29880 90458 91684 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337264.1 protein_id gnl|my_center|LOCUS_29880 91747 92991 gene locus_tag LOCUS_29890 gene serB 91747 92991 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931867.1 protein_id gnl|my_center|LOCUS_29890 93025 94329 gene locus_tag LOCUS_29900 93025 94329 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933141.1 protein_id gnl|my_center|LOCUS_29900 94561 94485 gene locus_tag LOCUS_t00410 94561 94485 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 95559 94591 gene locus_tag LOCUS_29910 gene ispB 95559 94591 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_29910 96066 96380 gene locus_tag LOCUS_29920 gene rplU 96066 96380 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417305.1 protein_id gnl|my_center|LOCUS_29920 96396 96674 gene locus_tag LOCUS_29930 gene rpmA 96396 96674 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434222.1 protein_id gnl|my_center|LOCUS_29930 96765 97880 gene locus_tag LOCUS_29940 gene cgtA 96765 97880 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551973.1 protein_id gnl|my_center|LOCUS_29940 97910 99034 gene locus_tag LOCUS_29950 gene proB 97910 99034 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_29950 100322 99189 gene locus_tag LOCUS_29960 100322 99189 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947153.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence018 360 755 gene locus_tag LOCUS_29970 360 755 CDS product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810229.1 protein_id gnl|my_center|LOCUS_29970 781 1020 gene locus_tag LOCUS_29980 781 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 1360 1749 gene locus_tag LOCUS_29990 1360 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 1930 1856 gene locus_tag LOCUS_t00420 1930 1856 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2446 3744 gene locus_tag LOCUS_30000 gene rlmD 2446 3744 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036471.1 protein_id gnl|my_center|LOCUS_30000 3747 4235 gene locus_tag LOCUS_30010 3747 4235 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_30010 4257 4760 gene locus_tag LOCUS_30020 gene elsL 4257 4760 CDS product cell wall-recycling L,D-carboxypeptidase ElsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_30020 5383 4922 gene locus_tag LOCUS_30030 5383 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 5804 5373 gene locus_tag LOCUS_30040 gene hslR 5804 5373 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660483.1 protein_id gnl|my_center|LOCUS_30040 6060 5797 gene locus_tag LOCUS_30050 6060 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 6463 9126 gene locus_tag LOCUS_30060 gene pepN 6463 9126 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_30060 9300 10442 gene locus_tag LOCUS_30070 gene lptF 9300 10442 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305138.1 protein_id gnl|my_center|LOCUS_30070 11187 10384 gene locus_tag LOCUS_30080 11187 10384 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_30080 12092 11184 gene locus_tag LOCUS_30090 gene potH 12092 11184 CDS product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097370.1 protein_id gnl|my_center|LOCUS_30090 13270 12134 gene locus_tag LOCUS_30100 13270 12134 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530249.1 protein_id gnl|my_center|LOCUS_30100 14414 13311 gene locus_tag LOCUS_30110 14414 13311 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269272.1 protein_id gnl|my_center|LOCUS_30110 14654 15691 gene locus_tag LOCUS_30120 14654 15691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 15789 17375 gene locus_tag LOCUS_30130 15789 17375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 17391 18317 gene locus_tag LOCUS_30140 17391 18317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 18910 19776 gene locus_tag LOCUS_30150 18910 19776 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761242.1 protein_id gnl|my_center|LOCUS_30150 19901 24835 gene locus_tag LOCUS_30160 19901 24835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 24914 26272 gene locus_tag LOCUS_30170 gene rsxC 24914 26272 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082948.1 protein_id gnl|my_center|LOCUS_30170 26279 27328 gene locus_tag LOCUS_30180 26279 27328 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_30180 27333 28043 gene locus_tag LOCUS_30190 gene rsxG 27333 28043 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_30190 28089 28751 gene locus_tag LOCUS_30200 28089 28751 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_30200 28741 29331 gene locus_tag LOCUS_30210 gene rsxA 28741 29331 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133179.1 protein_id gnl|my_center|LOCUS_30210 29640 30500 gene locus_tag LOCUS_30220 29640 30500 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142292.1 protein_id gnl|my_center|LOCUS_30220 31207 30599 gene locus_tag LOCUS_30230 31207 30599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 31794 31348 gene locus_tag LOCUS_30240 31794 31348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 31999 33081 gene locus_tag LOCUS_30250 31999 33081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 34155 33244 gene locus_tag LOCUS_30260 gene rfbD 34155 33244 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112614.1 protein_id gnl|my_center|LOCUS_30260 34721 34152 gene locus_tag LOCUS_30270 gene rfbC 34721 34152 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035866.1 protein_id gnl|my_center|LOCUS_30270 35599 34718 gene locus_tag LOCUS_30280 gene rfbA 35599 34718 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439277.1 protein_id gnl|my_center|LOCUS_30280 36669 35596 gene locus_tag LOCUS_30290 gene rfbB 36669 35596 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035864.1 protein_id gnl|my_center|LOCUS_30290 37486 37818 gene locus_tag LOCUS_30300 37486 37818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 37808 38059 gene locus_tag LOCUS_30310 37808 38059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 38295 38714 gene locus_tag LOCUS_30320 38295 38714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 38743 40905 gene locus_tag LOCUS_30330 38743 40905 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390606.1 protein_id gnl|my_center|LOCUS_30330 41313 40969 gene locus_tag LOCUS_30340 41313 40969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 41541 41894 gene locus_tag LOCUS_30350 41541 41894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 42278 43267 gene locus_tag LOCUS_30360 42278 43267 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 protein_id gnl|my_center|LOCUS_30360 43257 46451 gene locus_tag LOCUS_30370 43257 46451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 47321 46503 gene locus_tag LOCUS_30380 47321 46503 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085932.1 protein_id gnl|my_center|LOCUS_30380 48769 47489 gene locus_tag LOCUS_30390 48769 47489 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103332.1 protein_id gnl|my_center|LOCUS_30390 49244 48807 gene locus_tag LOCUS_30400 49244 48807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 49721 50458 gene locus_tag LOCUS_30410 49721 50458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 50542 50781 gene locus_tag LOCUS_30420 50542 50781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 51383 50847 gene locus_tag LOCUS_30430 51383 50847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 51264 51500 gene locus_tag LOCUS_30440 51264 51500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 52797 51793 gene locus_tag LOCUS_30450 gene cmoB 52797 51793 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216623.1 protein_id gnl|my_center|LOCUS_30450 53519 52788 gene locus_tag LOCUS_30460 gene cmoA 53519 52788 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096076.1 protein_id gnl|my_center|LOCUS_30460 53847 56093 gene locus_tag LOCUS_30470 gene ppk1 53847 56093 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943936.1 protein_id gnl|my_center|LOCUS_30470 56184 56948 gene locus_tag LOCUS_30480 56184 56948 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 protein_id gnl|my_center|LOCUS_30480 57103 57390 gene locus_tag LOCUS_30490 57103 57390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 57650 59071 gene locus_tag LOCUS_30500 57650 59071 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011342568.1 protein_id gnl|my_center|LOCUS_30500 60524 59082 gene locus_tag LOCUS_30510 60524 59082 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063882.1 protein_id gnl|my_center|LOCUS_30510 61468 60593 gene locus_tag LOCUS_30520 61468 60593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 63592 61652 gene locus_tag LOCUS_30530 63592 61652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 64032 67970 gene locus_tag LOCUS_30540 gene purL 64032 67970 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819788.1 protein_id gnl|my_center|LOCUS_30540 68097 68519 gene locus_tag LOCUS_30550 gene arfB 68097 68519 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067459.1 protein_id gnl|my_center|LOCUS_30550 68716 68537 gene locus_tag LOCUS_30560 68716 68537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 69295 68804 gene locus_tag LOCUS_30570 69295 68804 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175145.1 protein_id gnl|my_center|LOCUS_30570 70649 69426 gene locus_tag LOCUS_30580 gene ispG 70649 69426 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527159.1 protein_id gnl|my_center|LOCUS_30580 71596 70709 gene locus_tag LOCUS_30590 71596 70709 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_30590 72393 71593 gene locus_tag LOCUS_30600 gene mazG 72393 71593 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_30600 72817 72467 gene locus_tag LOCUS_30610 72817 72467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 73191 73267 gene locus_tag LOCUS_t00430 73191 73267 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 73487 74566 gene locus_tag LOCUS_30620 73487 74566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30620 74639 74968 gene locus_tag LOCUS_30630 74639 74968 CDS product killer suppression protein HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387766.1 protein_id gnl|my_center|LOCUS_30630 74961 76061 gene locus_tag LOCUS_30640 74961 76061 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_30640 76442 76963 gene locus_tag LOCUS_30650 76442 76963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 76978 77244 gene locus_tag LOCUS_30660 76978 77244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 77241 77435 gene locus_tag LOCUS_30670 77241 77435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 77947 77741 gene locus_tag LOCUS_30680 77947 77741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 78754 77969 gene locus_tag LOCUS_30690 78754 77969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 79375 78767 gene locus_tag LOCUS_30700 79375 78767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30700 80313 80567 gene locus_tag LOCUS_30710 80313 80567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 80868 81134 gene locus_tag LOCUS_30720 80868 81134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 >Feature sequence019 229 11 gene locus_tag LOCUS_30730 229 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 1187 486 gene locus_tag LOCUS_30740 1187 486 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020083.1 protein_id gnl|my_center|LOCUS_30740 1304 1543 gene locus_tag LOCUS_30750 1304 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 1674 2024 gene locus_tag LOCUS_30760 1674 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 2253 1912 gene locus_tag LOCUS_30770 2253 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 3572 2256 gene locus_tag LOCUS_30780 3572 2256 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936956.1 protein_id gnl|my_center|LOCUS_30780 4603 3569 gene locus_tag LOCUS_30790 4603 3569 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391607.1 protein_id gnl|my_center|LOCUS_30790 5454 4600 gene locus_tag LOCUS_30800 5454 4600 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459802.1 protein_id gnl|my_center|LOCUS_30800 5988 6815 gene locus_tag LOCUS_30810 5988 6815 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975420.1 protein_id gnl|my_center|LOCUS_30810 6954 7457 gene locus_tag LOCUS_30820 6954 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 7800 7639 gene locus_tag LOCUS_30830 7800 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 8297 7986 gene locus_tag LOCUS_30840 8297 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 8860 8351 gene locus_tag LOCUS_30850 8860 8351 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688300.1 protein_id gnl|my_center|LOCUS_30850 9215 8865 gene locus_tag LOCUS_30860 9215 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 11281 9398 gene locus_tag LOCUS_30870 gene aprA 11281 9398 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_30870 11763 11281 gene locus_tag LOCUS_30880 gene aprB 11763 11281 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_30880 12665 11802 gene locus_tag LOCUS_30890 12665 11802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 13936 13052 gene locus_tag LOCUS_30900 13936 13052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 15753 14206 gene locus_tag LOCUS_30910 15753 14206 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943740.1 protein_id gnl|my_center|LOCUS_30910 16579 15806 gene locus_tag LOCUS_30920 16579 15806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 17628 16576 gene locus_tag LOCUS_30930 17628 16576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 17853 18713 gene locus_tag LOCUS_30940 17853 18713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 18781 19062 gene locus_tag LOCUS_30950 18781 19062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 19106 20356 gene locus_tag LOCUS_30960 gene lysA 19106 20356 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384387.1 protein_id gnl|my_center|LOCUS_30960 20353 21024 gene locus_tag LOCUS_30970 20353 21024 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530054.1 protein_id gnl|my_center|LOCUS_30970 21021 21896 gene locus_tag LOCUS_30980 gene dapF 21021 21896 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704447.1 protein_id gnl|my_center|LOCUS_30980 21907 22635 gene locus_tag LOCUS_30990 21907 22635 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_30990 22632 23555 gene locus_tag LOCUS_31000 gene xerC 22632 23555 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 protein_id gnl|my_center|LOCUS_31000 23651 24313 gene locus_tag LOCUS_31010 23651 24313 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339247.1 protein_id gnl|my_center|LOCUS_31010 25109 24315 gene locus_tag LOCUS_31020 25109 24315 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967317.1 protein_id gnl|my_center|LOCUS_31020 25354 25896 gene locus_tag LOCUS_31030 25354 25896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 25998 26960 gene locus_tag LOCUS_31040 25998 26960 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_31040 28225 27041 gene locus_tag LOCUS_31050 28225 27041 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276374.1 protein_id gnl|my_center|LOCUS_31050 29510 28659 gene locus_tag LOCUS_31060 29510 28659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 30382 29558 gene locus_tag LOCUS_31070 30382 29558 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931044.1 protein_id gnl|my_center|LOCUS_31070 30661 33024 gene locus_tag LOCUS_31080 30661 33024 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_31080 33078 34298 gene locus_tag LOCUS_31090 33078 34298 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_31090 34607 36376 gene locus_tag LOCUS_31100 34607 36376 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122081.1 protein_id gnl|my_center|LOCUS_31100 36525 37646 gene locus_tag LOCUS_31110 36525 37646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_31110 39059 37704 gene locus_tag LOCUS_31120 39059 37704 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393761.1 protein_id gnl|my_center|LOCUS_31120 39660 39223 gene locus_tag LOCUS_31130 39660 39223 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938903.1 protein_id gnl|my_center|LOCUS_31130 41080 39752 gene locus_tag LOCUS_31140 41080 39752 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938906.1 protein_id gnl|my_center|LOCUS_31140 41591 41091 gene locus_tag LOCUS_31150 41591 41091 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_31150 43383 41758 gene locus_tag LOCUS_31160 gene iorA 43383 41758 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_31160 44349 43510 gene locus_tag LOCUS_31170 44349 43510 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142412.1 protein_id gnl|my_center|LOCUS_31170 47502 44368 gene locus_tag LOCUS_31180 47502 44368 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142413.1 protein_id gnl|my_center|LOCUS_31180 47631 48053 gene locus_tag LOCUS_31190 47631 48053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 48865 48074 gene locus_tag LOCUS_31200 48865 48074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065008.1 protein_id gnl|my_center|LOCUS_31200 49966 48869 gene locus_tag LOCUS_31210 49966 48869 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053095240.1 protein_id gnl|my_center|LOCUS_31210 51015 49960 gene locus_tag LOCUS_31220 51015 49960 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082831.1 protein_id gnl|my_center|LOCUS_31220 53235 51022 gene locus_tag LOCUS_31230 53235 51022 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933207.1 protein_id gnl|my_center|LOCUS_31230 53445 53927 gene locus_tag LOCUS_31240 53445 53927 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338279.1 protein_id gnl|my_center|LOCUS_31240 54264 54881 gene locus_tag LOCUS_31250 54264 54881 CDS product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390593.1 protein_id gnl|my_center|LOCUS_31250 55191 56732 gene locus_tag LOCUS_31260 55191 56732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 58205 56808 gene locus_tag LOCUS_31270 58205 56808 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005032135.1 protein_id gnl|my_center|LOCUS_31270 58365 58195 gene locus_tag LOCUS_31280 58365 58195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 60280 58451 gene locus_tag LOCUS_31290 60280 58451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 60427 60825 gene locus_tag LOCUS_31300 60427 60825 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932426.1 protein_id gnl|my_center|LOCUS_31300 61202 60777 gene locus_tag LOCUS_31310 61202 60777 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056339.1 protein_id gnl|my_center|LOCUS_31310 61393 62052 gene locus_tag LOCUS_31320 61393 62052 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_31320 62121 62804 gene locus_tag LOCUS_31330 62121 62804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 63028 66477 gene locus_tag LOCUS_31340 63028 66477 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857980.1 protein_id gnl|my_center|LOCUS_31340 66584 67084 gene locus_tag LOCUS_31350 gene folK 66584 67084 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707280.1 protein_id gnl|my_center|LOCUS_31350 67116 68516 gene locus_tag LOCUS_31360 gene pabB 67116 68516 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819891.1 protein_id gnl|my_center|LOCUS_31360 68634 70856 gene locus_tag LOCUS_31370 68634 70856 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064497.1 protein_id gnl|my_center|LOCUS_31370 72256 70952 gene locus_tag LOCUS_31380 72256 70952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 73755 72253 gene locus_tag LOCUS_31390 73755 72253 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112353.1 protein_id gnl|my_center|LOCUS_31390 74594 73752 gene locus_tag LOCUS_31400 74594 73752 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030564.1 protein_id gnl|my_center|LOCUS_31400 75343 74591 gene locus_tag LOCUS_31410 gene cbiQ 75343 74591 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392734.1 protein_id gnl|my_center|LOCUS_31410 75674 75330 gene locus_tag LOCUS_31420 75674 75330 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030566.1 protein_id gnl|my_center|LOCUS_31420 76405 75671 gene locus_tag LOCUS_31430 76405 75671 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030567.1 protein_id gnl|my_center|LOCUS_31430 <77403 76789 gene locus_tag LOCUS_31440 <77403 76789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082590.1:cobyrinate a,c-diamide synthase >Feature sequence020 1371 1637 gene locus_tag LOCUS_31450 gene dinJ 1371 1637 CDS product type II toxin-antitoxin system antitoxin DinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729709.1 protein_id gnl|my_center|LOCUS_31450 1624 1905 gene locus_tag LOCUS_31460 1624 1905 CDS product type II toxin-antitoxin system mRNA interferase toxin, HP0892 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955518.1 protein_id gnl|my_center|LOCUS_31460 2511 3428 gene locus_tag LOCUS_31470 2511 3428 CDS product IS1595-like element ISXca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037261.1 protein_id gnl|my_center|LOCUS_31470 4902 3865 gene locus_tag LOCUS_31480 4902 3865 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666158.1 protein_id gnl|my_center|LOCUS_31480 5596 4913 gene locus_tag LOCUS_31490 5596 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 5654 6853 gene locus_tag LOCUS_31500 5654 6853 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_31500 7218 6850 gene locus_tag LOCUS_31510 7218 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 7948 7190 gene locus_tag LOCUS_31520 7948 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 8235 9161 gene locus_tag LOCUS_31530 8235 9161 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705524.1 protein_id gnl|my_center|LOCUS_31530 9828 9610 gene locus_tag LOCUS_31540 9828 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 11727 9904 gene locus_tag LOCUS_31550 11727 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102972.1 protein_id gnl|my_center|LOCUS_31550 12194 12457 gene locus_tag LOCUS_31560 12194 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 13238 12528 gene locus_tag LOCUS_31570 13238 12528 CDS product autoinducer binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206379.1 protein_id gnl|my_center|LOCUS_31570 14064 13843 gene locus_tag LOCUS_31580 14064 13843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 14229 14510 gene locus_tag LOCUS_31590 14229 14510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 15457 14711 gene locus_tag LOCUS_31600 15457 14711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 15533 16396 gene locus_tag LOCUS_31610 15533 16396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 16332 18446 gene locus_tag LOCUS_31620 16332 18446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 18443 19549 gene locus_tag LOCUS_31630 18443 19549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 19554 21593 gene locus_tag LOCUS_31640 19554 21593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 22116 22382 gene locus_tag LOCUS_31650 22116 22382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 25725 22558 gene locus_tag LOCUS_31660 25725 22558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 26143 27912 gene locus_tag LOCUS_31670 26143 27912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 27973 30282 gene locus_tag LOCUS_31680 27973 30282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 30279 30893 gene locus_tag LOCUS_31690 gene fixJ 30279 30893 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918644.1 protein_id gnl|my_center|LOCUS_31690 31353 31580 gene locus_tag LOCUS_31700 31353 31580 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391853.1 protein_id gnl|my_center|LOCUS_31700 31654 31812 gene locus_tag LOCUS_31710 31654 31812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 32059 32505 gene locus_tag LOCUS_31720 32059 32505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 32600 33673 gene locus_tag LOCUS_31730 32600 33673 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_31730 33778 34074 gene locus_tag LOCUS_31740 33778 34074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 34559 35281 gene locus_tag LOCUS_31750 34559 35281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113561.1 protein_id gnl|my_center|LOCUS_31750 35806 35423 gene locus_tag LOCUS_31760 35806 35423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 44497 35816 gene locus_tag LOCUS_31770 44497 35816 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538238.1 protein_id gnl|my_center|LOCUS_31770 44904 44545 gene locus_tag LOCUS_31780 44904 44545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 45404 45216 gene locus_tag LOCUS_31790 45404 45216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 45935 47449 gene locus_tag LOCUS_31800 45935 47449 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_31800 48143 47505 gene locus_tag LOCUS_31810 gene nalD 48143 47505 CDS product efflux system transcriptional repressor NalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092152.1 protein_id gnl|my_center|LOCUS_31810 48308 49414 gene locus_tag LOCUS_31820 48308 49414 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_31820 49414 52542 gene locus_tag LOCUS_31830 49414 52542 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_31830 52850 55390 gene locus_tag LOCUS_31840 52850 55390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 57016 55442 gene locus_tag LOCUS_31850 57016 55442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 57630 57274 gene locus_tag LOCUS_31860 57630 57274 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143494.1 protein_id gnl|my_center|LOCUS_31860 57829 57569 gene locus_tag LOCUS_31870 57829 57569 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530040.1 protein_id gnl|my_center|LOCUS_31870 57944 58435 gene locus_tag LOCUS_31880 57944 58435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 61922 58524 gene locus_tag LOCUS_31890 61922 58524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 61855 62172 gene locus_tag LOCUS_31900 61855 62172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 62342 66589 gene locus_tag LOCUS_31910 gene pglW 62342 66589 CDS product BREX system serine/threonine kinase PglW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031052.1 protein_id gnl|my_center|LOCUS_31910 66637 70665 gene locus_tag LOCUS_31920 66637 70665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 71051 70668 gene locus_tag LOCUS_31930 71051 70668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 71425 71048 gene locus_tag LOCUS_31940 71425 71048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 71773 72381 gene locus_tag LOCUS_31950 71773 72381 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_31950 72509 73051 gene locus_tag LOCUS_31960 72509 73051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 protein_id gnl|my_center|LOCUS_31960 73866 74648 gene locus_tag LOCUS_31970 73866 74648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 >Feature sequence021 1322 783 gene locus_tag LOCUS_31980 1322 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 1515 2267 gene locus_tag LOCUS_31990 1515 2267 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920196.1 protein_id gnl|my_center|LOCUS_31990 2396 2941 gene locus_tag LOCUS_32000 2396 2941 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920198.1 protein_id gnl|my_center|LOCUS_32000 3242 4315 gene locus_tag LOCUS_32010 3242 4315 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035674.1 protein_id gnl|my_center|LOCUS_32010 4312 7350 gene locus_tag LOCUS_32020 4312 7350 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 protein_id gnl|my_center|LOCUS_32020 7532 7990 gene locus_tag LOCUS_32030 7532 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 8395 8177 gene locus_tag LOCUS_32040 8395 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 8908 9339 gene locus_tag LOCUS_32050 8908 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 9674 10501 gene locus_tag LOCUS_32060 9674 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528199.1 protein_id gnl|my_center|LOCUS_32060 10981 10418 gene locus_tag LOCUS_32070 10981 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 11502 10978 gene locus_tag LOCUS_32080 11502 10978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 13520 11634 gene locus_tag LOCUS_32090 13520 11634 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929004.1 protein_id gnl|my_center|LOCUS_32090 13999 14556 gene locus_tag LOCUS_32100 13999 14556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32100 14543 14959 gene locus_tag LOCUS_32110 14543 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32110 15134 15958 gene locus_tag LOCUS_32120 gene phnC 15134 15958 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_32120 15955 16794 gene locus_tag LOCUS_32130 gene phnE 15955 16794 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 protein_id gnl|my_center|LOCUS_32130 16794 17609 gene locus_tag LOCUS_32140 gene phnE 16794 17609 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 protein_id gnl|my_center|LOCUS_32140 17934 18989 gene locus_tag LOCUS_32150 gene pstS 17934 18989 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530168.1 protein_id gnl|my_center|LOCUS_32150 19228 20205 gene locus_tag LOCUS_32160 gene pstC 19228 20205 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140449.1 protein_id gnl|my_center|LOCUS_32160 20202 21092 gene locus_tag LOCUS_32170 gene pstA 20202 21092 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_32170 21134 21952 gene locus_tag LOCUS_32180 gene pstB 21134 21952 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_32180 22025 23092 gene locus_tag LOCUS_32190 gene pstS 22025 23092 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530168.1 protein_id gnl|my_center|LOCUS_32190 23203 23856 gene locus_tag LOCUS_32200 23203 23856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 23980 25830 gene locus_tag LOCUS_32210 23980 25830 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 protein_id gnl|my_center|LOCUS_32210 25890 26078 gene locus_tag LOCUS_32220 25890 26078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 26150 26914 gene locus_tag LOCUS_32230 26150 26914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 28041 26995 gene locus_tag LOCUS_32240 gene pstS 28041 26995 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140448.1 protein_id gnl|my_center|LOCUS_32240 28445 28131 gene locus_tag LOCUS_32250 28445 28131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 30580 28541 gene locus_tag LOCUS_32260 30580 28541 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_32260 31598 30648 gene locus_tag LOCUS_32270 31598 30648 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221267088.1 protein_id gnl|my_center|LOCUS_32270 34150 31706 gene locus_tag LOCUS_32280 34150 31706 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086240.1 protein_id gnl|my_center|LOCUS_32280 35013 34234 gene locus_tag LOCUS_32290 gene fabI 35013 34234 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064311.1 protein_id gnl|my_center|LOCUS_32290 36243 35053 gene locus_tag LOCUS_32300 36243 35053 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 protein_id gnl|my_center|LOCUS_32300 37665 36262 gene locus_tag LOCUS_32310 37665 36262 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947970.1 protein_id gnl|my_center|LOCUS_32310 40063 37868 gene locus_tag LOCUS_32320 gene nadN 40063 37868 CDS product NAD nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868956.1 protein_id gnl|my_center|LOCUS_32320 40617 41570 gene locus_tag LOCUS_32330 40617 41570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 42359 43306 gene locus_tag LOCUS_32340 42359 43306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 44502 43774 gene locus_tag LOCUS_32350 44502 43774 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970873.1 protein_id gnl|my_center|LOCUS_32350 45752 44799 gene locus_tag LOCUS_32360 45752 44799 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970872.1 protein_id gnl|my_center|LOCUS_32360 46992 45955 gene locus_tag LOCUS_32370 46992 45955 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109278575.1 protein_id gnl|my_center|LOCUS_32370 50802 47656 gene locus_tag LOCUS_32380 50802 47656 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967993.1 protein_id gnl|my_center|LOCUS_32380 51767 50799 gene locus_tag LOCUS_32390 51767 50799 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035674.1 protein_id gnl|my_center|LOCUS_32390 51727 51984 gene locus_tag LOCUS_32400 51727 51984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 52019 52684 gene locus_tag LOCUS_32410 gene mexL 52019 52684 CDS product efflux system transcriptional repressor MexL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 protein_id gnl|my_center|LOCUS_32410 52911 53915 gene locus_tag LOCUS_32420 52911 53915 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980649.1 protein_id gnl|my_center|LOCUS_32420 54013 55005 gene locus_tag LOCUS_32430 54013 55005 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169775301.1 protein_id gnl|my_center|LOCUS_32430 55261 55698 gene locus_tag LOCUS_32440 55261 55698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 55698 56399 gene locus_tag LOCUS_32450 55698 56399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 58849 56411 gene locus_tag LOCUS_32460 58849 56411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 60119 59025 gene locus_tag LOCUS_32470 60119 59025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 61314 60133 gene locus_tag LOCUS_32480 gene repA 61314 60133 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215636.1 protein_id gnl|my_center|LOCUS_32480 61678 62175 gene locus_tag LOCUS_32490 61678 62175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 62449 62922 gene locus_tag LOCUS_32500 62449 62922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 65221 63035 gene locus_tag LOCUS_32510 gene katG 65221 63035 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 protein_id gnl|my_center|LOCUS_32510 67500 65389 gene locus_tag LOCUS_32520 67500 65389 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031066.1 protein_id gnl|my_center|LOCUS_32520 68921 67608 gene locus_tag LOCUS_32530 gene brxD 68921 67608 CDS product BREX system ATP-binding protein BrxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031065.1 protein_id gnl|my_center|LOCUS_32530 71688 68932 gene locus_tag LOCUS_32540 gene pglZ 71688 68932 CDS product BREX-2 system phosphatase PglZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031062.1 protein_id gnl|my_center|LOCUS_32540 >Feature sequence022 153 494 gene locus_tag LOCUS_32550 153 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 525 1628 gene locus_tag LOCUS_32560 525 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 1855 3288 gene locus_tag LOCUS_32570 gene ccoN 1855 3288 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477654.1 protein_id gnl|my_center|LOCUS_32570 3309 4055 gene locus_tag LOCUS_32580 gene ccoO 3309 4055 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_32580 4048 4263 gene locus_tag LOCUS_32590 4048 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 4250 5164 gene locus_tag LOCUS_32600 gene ccoP 4250 5164 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524999.1 protein_id gnl|my_center|LOCUS_32600 5345 5491 gene locus_tag LOCUS_32610 5345 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 5830 7260 gene locus_tag LOCUS_32620 gene ccoG 5830 7260 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244349.1 protein_id gnl|my_center|LOCUS_32620 7363 7878 gene locus_tag LOCUS_32630 7363 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 7916 10501 gene locus_tag LOCUS_32640 7916 10501 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361687.1 protein_id gnl|my_center|LOCUS_32640 10523 10735 gene locus_tag LOCUS_32650 10523 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 12532 10898 gene locus_tag LOCUS_32660 12532 10898 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_32660 12859 14778 gene locus_tag LOCUS_32670 gene htpG 12859 14778 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706320.1 protein_id gnl|my_center|LOCUS_32670 14915 15574 gene locus_tag LOCUS_32680 gene adk 14915 15574 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_32680 15953 16324 gene locus_tag LOCUS_32690 gene trxA 15953 16324 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 protein_id gnl|my_center|LOCUS_32690 16361 16855 gene locus_tag LOCUS_32700 16361 16855 CDS product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 protein_id gnl|my_center|LOCUS_32700 17160 17591 gene locus_tag LOCUS_32710 17160 17591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 17768 18694 gene locus_tag LOCUS_32720 gene prmB 17768 18694 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457652.1 protein_id gnl|my_center|LOCUS_32720 18691 19023 gene locus_tag LOCUS_32730 18691 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 19087 20472 gene locus_tag LOCUS_32740 gene hemN 19087 20472 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_32740 20754 22049 gene locus_tag LOCUS_32750 gene tig 20754 22049 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460612.1 protein_id gnl|my_center|LOCUS_32750 22258 21989 gene locus_tag LOCUS_32760 22258 21989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 22262 22921 gene locus_tag LOCUS_32770 gene clpP 22262 22921 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098129.1 protein_id gnl|my_center|LOCUS_32770 23269 24543 gene locus_tag LOCUS_32780 gene clpX 23269 24543 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_32780 24731 27190 gene locus_tag LOCUS_32790 gene lon 24731 27190 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367948.1 protein_id gnl|my_center|LOCUS_32790 27390 27815 gene locus_tag LOCUS_32800 27390 27815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 27850 27925 gene locus_tag LOCUS_t00440 27850 27925 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 27933 28009 gene locus_tag LOCUS_t00450 27933 28009 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 28101 30023 gene locus_tag LOCUS_32810 gene ppiD 28101 30023 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071919.1 protein_id gnl|my_center|LOCUS_32810 30888 30112 gene locus_tag LOCUS_32820 gene fabI 30888 30112 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368564.1 protein_id gnl|my_center|LOCUS_32820 31205 33334 gene locus_tag LOCUS_32830 31205 33334 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_32830 33331 34308 gene locus_tag LOCUS_32840 33331 34308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_32840 34349 35410 gene locus_tag LOCUS_32850 34349 35410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32850 35453 35770 gene locus_tag LOCUS_32860 35453 35770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32860 35839 37893 gene locus_tag LOCUS_32870 35839 37893 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_32870 38170 39537 gene locus_tag LOCUS_32880 38170 39537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 40321 40533 gene locus_tag LOCUS_32890 40321 40533 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_32890 41398 40733 gene locus_tag LOCUS_32900 gene mobA 41398 40733 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706868.1 protein_id gnl|my_center|LOCUS_32900 41863 41432 gene locus_tag LOCUS_32910 41863 41432 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072739.1 protein_id gnl|my_center|LOCUS_32910 42476 41961 gene locus_tag LOCUS_32920 42476 41961 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545184.1 protein_id gnl|my_center|LOCUS_32920 42960 42580 gene locus_tag LOCUS_32930 42960 42580 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009455671.1 protein_id gnl|my_center|LOCUS_32930 44419 42980 gene locus_tag LOCUS_32940 44419 42980 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705461.1 protein_id gnl|my_center|LOCUS_32940 44600 45364 gene locus_tag LOCUS_32950 44600 45364 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931355.1 protein_id gnl|my_center|LOCUS_32950 45357 45788 gene locus_tag LOCUS_32960 gene rnhA 45357 45788 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_32960 45850 46572 gene locus_tag LOCUS_32970 gene dnaQ 45850 46572 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770771.1 protein_id gnl|my_center|LOCUS_32970 46542 46826 gene locus_tag LOCUS_32980 46542 46826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 47276 46770 gene locus_tag LOCUS_32990 47276 46770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 47262 47504 gene locus_tag LOCUS_33000 47262 47504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 48129 47737 gene locus_tag LOCUS_33010 48129 47737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 48723 50366 gene locus_tag LOCUS_33020 48723 50366 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377829.1 protein_id gnl|my_center|LOCUS_33020 50363 51199 gene locus_tag LOCUS_33030 gene kdsA 50363 51199 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946916.1 protein_id gnl|my_center|LOCUS_33030 51509 52786 gene locus_tag LOCUS_33040 gene eno 51509 52786 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_33040 52851 53144 gene locus_tag LOCUS_33050 gene ftsB 52851 53144 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073295.1 protein_id gnl|my_center|LOCUS_33050 53141 53860 gene locus_tag LOCUS_33060 gene ispD 53141 53860 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092359.1 protein_id gnl|my_center|LOCUS_33060 54017 54490 gene locus_tag LOCUS_33070 gene ispF 54017 54490 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_33070 54483 55580 gene locus_tag LOCUS_33080 gene truD 54483 55580 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113870.1 protein_id gnl|my_center|LOCUS_33080 56898 55606 gene locus_tag LOCUS_33090 gene der 56898 55606 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947270.1 protein_id gnl|my_center|LOCUS_33090 58334 57009 gene locus_tag LOCUS_33100 gene bamB 58334 57009 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428301.1 protein_id gnl|my_center|LOCUS_33100 58957 58331 gene locus_tag LOCUS_33110 58957 58331 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 protein_id gnl|my_center|LOCUS_33110 60316 59033 gene locus_tag LOCUS_33120 gene hisS 60316 59033 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266910.1 protein_id gnl|my_center|LOCUS_33120 61391 60375 gene locus_tag LOCUS_33130 61391 60375 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073189.1 protein_id gnl|my_center|LOCUS_33130 62155 61388 gene locus_tag LOCUS_33140 gene pilW 62155 61388 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799875.1 protein_id gnl|my_center|LOCUS_33140 63303 62197 gene locus_tag LOCUS_33150 63303 62197 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 protein_id gnl|my_center|LOCUS_33150 63751 63323 gene locus_tag LOCUS_33160 gene ndk 63751 63323 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172605.1 protein_id gnl|my_center|LOCUS_33160 64143 65117 gene locus_tag LOCUS_33170 64143 65117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_33170 66003 65173 gene locus_tag LOCUS_33180 66003 65173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 66407 66003 gene locus_tag LOCUS_33190 66407 66003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 66916 66512 gene locus_tag LOCUS_33200 66916 66512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 67700 66891 gene locus_tag LOCUS_33210 67700 66891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 68150 67731 gene locus_tag LOCUS_33220 68150 67731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 70273 68225 gene locus_tag LOCUS_33230 70273 68225 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815626.1 protein_id gnl|my_center|LOCUS_33230 70977 74288 gene locus_tag LOCUS_33240 70977 74288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 >Feature sequence023 84 1340 gene locus_tag LOCUS_33250 gene rho 84 1340 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769919.1 protein_id gnl|my_center|LOCUS_33250 1546 2613 gene locus_tag LOCUS_33260 1546 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 3009 2677 gene locus_tag LOCUS_33270 3009 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 3626 3006 gene locus_tag LOCUS_33280 3626 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 4238 3684 gene locus_tag LOCUS_33290 4238 3684 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 protein_id gnl|my_center|LOCUS_33290 4390 4962 gene locus_tag LOCUS_33300 4390 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 5429 4986 gene locus_tag LOCUS_33310 gene trxC 5429 4986 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_33310 5703 6563 gene locus_tag LOCUS_33320 gene trxA 5703 6563 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105274.1 protein_id gnl|my_center|LOCUS_33320 7056 6589 gene locus_tag LOCUS_33330 7056 6589 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_33330 7567 7133 gene locus_tag LOCUS_33340 7567 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 8699 7599 gene locus_tag LOCUS_33350 8699 7599 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146623.1 protein_id gnl|my_center|LOCUS_33350 9370 8696 gene locus_tag LOCUS_33360 9370 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 10004 9372 gene locus_tag LOCUS_33370 10004 9372 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080086.1 protein_id gnl|my_center|LOCUS_33370 10916 10017 gene locus_tag LOCUS_33380 10916 10017 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250169.1 protein_id gnl|my_center|LOCUS_33380 12691 10916 gene locus_tag LOCUS_33390 12691 10916 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250170.1 protein_id gnl|my_center|LOCUS_33390 14202 12688 gene locus_tag LOCUS_33400 14202 12688 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289183.1 protein_id gnl|my_center|LOCUS_33400 14579 14199 gene locus_tag LOCUS_33410 14579 14199 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250172.1 protein_id gnl|my_center|LOCUS_33410 15396 14584 gene locus_tag LOCUS_33420 15396 14584 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867828.1 protein_id gnl|my_center|LOCUS_33420 15692 15393 gene locus_tag LOCUS_33430 15692 15393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 16090 15689 gene locus_tag LOCUS_33440 gene mnhG 16090 15689 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250175.1 protein_id gnl|my_center|LOCUS_33440 16339 16091 gene locus_tag LOCUS_33450 16339 16091 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867825.1 protein_id gnl|my_center|LOCUS_33450 16917 17687 gene locus_tag LOCUS_33460 16917 17687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 17687 18208 gene locus_tag LOCUS_33470 17687 18208 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090050.1 protein_id gnl|my_center|LOCUS_33470 18205 18489 gene locus_tag LOCUS_33480 18205 18489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 18476 18772 gene locus_tag LOCUS_33490 18476 18772 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_33490 18763 19143 gene locus_tag LOCUS_33500 18763 19143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 19130 19858 gene locus_tag LOCUS_33510 19130 19858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 19855 20163 gene locus_tag LOCUS_33520 19855 20163 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090054.1 protein_id gnl|my_center|LOCUS_33520 20168 21685 gene locus_tag LOCUS_33530 20168 21685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 21682 23181 gene locus_tag LOCUS_33540 21682 23181 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902375.1 protein_id gnl|my_center|LOCUS_33540 23178 24947 gene locus_tag LOCUS_33550 23178 24947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 25042 25515 gene locus_tag LOCUS_33560 25042 25515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 26034 28988 gene locus_tag LOCUS_33570 26034 28988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 28978 31377 gene locus_tag LOCUS_33580 28978 31377 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_33580 31390 32193 gene locus_tag LOCUS_33590 31390 32193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 33444 32386 gene locus_tag LOCUS_33600 33444 32386 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388253.1 protein_id gnl|my_center|LOCUS_33600 34966 33437 gene locus_tag LOCUS_33610 34966 33437 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_33610 36027 35116 gene locus_tag LOCUS_33620 36027 35116 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388246.1 protein_id gnl|my_center|LOCUS_33620 37947 36100 gene locus_tag LOCUS_33630 37947 36100 CDS product magnesium chelatase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388245.1 protein_id gnl|my_center|LOCUS_33630 38924 37944 gene locus_tag LOCUS_33640 gene bchI 38924 37944 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625950.1 protein_id gnl|my_center|LOCUS_33640 40143 39145 gene locus_tag LOCUS_33650 40143 39145 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932627.1 protein_id gnl|my_center|LOCUS_33650 40219 41517 gene locus_tag LOCUS_33660 40219 41517 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258414.1 protein_id gnl|my_center|LOCUS_33660 41940 42983 gene locus_tag LOCUS_33670 41940 42983 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198213.1 protein_id gnl|my_center|LOCUS_33670 42980 43747 gene locus_tag LOCUS_33680 42980 43747 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_33680 43815 44030 gene locus_tag LOCUS_33690 43815 44030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 44130 45233 gene locus_tag LOCUS_33700 44130 45233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 45249 45707 gene locus_tag LOCUS_33710 gene fabZ 45249 45707 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699740.1 protein_id gnl|my_center|LOCUS_33710 45697 46500 gene locus_tag LOCUS_33720 45697 46500 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328032.1 protein_id gnl|my_center|LOCUS_33720 47103 46435 gene locus_tag LOCUS_33730 47103 46435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 47625 49097 gene locus_tag LOCUS_33740 47625 49097 CDS product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819011.1 protein_id gnl|my_center|LOCUS_33740 49116 50048 gene locus_tag LOCUS_33750 49116 50048 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889319.1 protein_id gnl|my_center|LOCUS_33750 50138 51535 gene locus_tag LOCUS_33760 50138 51535 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_33760 51532 53382 gene locus_tag LOCUS_33770 gene menD 51532 53382 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902775.1 protein_id gnl|my_center|LOCUS_33770 53394 54242 gene locus_tag LOCUS_33780 gene menB 53394 54242 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_33780 54244 55137 gene locus_tag LOCUS_33790 54244 55137 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933177.1 protein_id gnl|my_center|LOCUS_33790 55153 56751 gene locus_tag LOCUS_33800 55153 56751 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_33800 56871 58094 gene locus_tag LOCUS_33810 56871 58094 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726618.1 protein_id gnl|my_center|LOCUS_33810 58560 59246 gene locus_tag LOCUS_33820 58560 59246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 59287 60714 gene locus_tag LOCUS_33830 gene guaD 59287 60714 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086659.1 protein_id gnl|my_center|LOCUS_33830 61881 60877 gene locus_tag LOCUS_33840 gene hflC 61881 60877 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_33840 62936 61878 gene locus_tag LOCUS_33850 gene hflK 62936 61878 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_33850 63359 66820 gene locus_tag LOCUS_33860 63359 66820 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014439.1 protein_id gnl|my_center|LOCUS_33860 68149 66971 gene locus_tag LOCUS_33870 68149 66971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 68527 68189 gene locus_tag LOCUS_33880 68527 68189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 68821 68612 gene locus_tag LOCUS_33890 68821 68612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 69228 69410 gene locus_tag LOCUS_33900 69228 69410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 70005 69502 gene locus_tag LOCUS_33910 70005 69502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 70148 70348 gene locus_tag LOCUS_33920 70148 70348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 70593 70874 gene locus_tag LOCUS_33930 70593 70874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 71580 70930 gene locus_tag LOCUS_33940 gene blaOXA 71580 70930 CDS product OXA-48 family carbapenem-hydrolyzing class D beta-lactamase OXA-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071128.1 protein_id gnl|my_center|LOCUS_33940 71575 71865 gene locus_tag LOCUS_33950 71575 71865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 <72931 71931 gene locus_tag LOCUS_33960 <72931 71931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000343766.1:ISL3-like element ISEc53 family transposase >Feature sequence024 191 910 gene locus_tag LOCUS_33970 191 910 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_33970 2756 1869 gene locus_tag LOCUS_33980 2756 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 3046 2912 gene locus_tag LOCUS_33990 3046 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 3402 3016 gene locus_tag LOCUS_34000 3402 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 4691 3573 gene locus_tag LOCUS_34010 4691 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 5857 4688 gene locus_tag LOCUS_34020 5857 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 6064 5873 gene locus_tag LOCUS_34030 6064 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 6409 7512 gene locus_tag LOCUS_34040 gene apbC 6409 7512 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_34040 7727 8260 gene locus_tag LOCUS_34050 gene dcd 7727 8260 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_34050 8371 9222 gene locus_tag LOCUS_34060 8371 9222 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547542.1 protein_id gnl|my_center|LOCUS_34060 10234 9356 gene locus_tag LOCUS_34070 10234 9356 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813546.1 protein_id gnl|my_center|LOCUS_34070 11601 10411 gene locus_tag LOCUS_34080 11601 10411 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_34080 11826 12128 gene locus_tag LOCUS_34090 11826 12128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 12306 13349 gene locus_tag LOCUS_34100 12306 13349 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_34100 13459 14850 gene locus_tag LOCUS_34110 gene pstC 13459 14850 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_34110 14843 16150 gene locus_tag LOCUS_34120 gene pstA 14843 16150 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_34120 16234 17097 gene locus_tag LOCUS_34130 gene pstB 16234 17097 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467712.1 protein_id gnl|my_center|LOCUS_34130 17097 17861 gene locus_tag LOCUS_34140 gene phoU 17097 17861 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378397.1 protein_id gnl|my_center|LOCUS_34140 18164 18451 gene locus_tag LOCUS_34150 18164 18451 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_34150 18651 18986 gene locus_tag LOCUS_34160 18651 18986 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083363.1 protein_id gnl|my_center|LOCUS_34160 19113 20372 gene locus_tag LOCUS_34170 19113 20372 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_34170 20401 20973 gene locus_tag LOCUS_34180 20401 20973 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412093.1 protein_id gnl|my_center|LOCUS_34180 21172 21684 gene locus_tag LOCUS_34190 21172 21684 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_34190 21681 22382 gene locus_tag LOCUS_34200 21681 22382 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927020.1 protein_id gnl|my_center|LOCUS_34200 22379 23140 gene locus_tag LOCUS_34210 22379 23140 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931160.1 protein_id gnl|my_center|LOCUS_34210 23184 23546 gene locus_tag LOCUS_34220 23184 23546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 23546 24508 gene locus_tag LOCUS_34230 23546 24508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 25830 24535 gene locus_tag LOCUS_34240 25830 24535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 26367 26783 gene locus_tag LOCUS_34250 26367 26783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 27451 27017 gene locus_tag LOCUS_34260 27451 27017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 28363 27656 gene locus_tag LOCUS_34270 28363 27656 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626211.1 protein_id gnl|my_center|LOCUS_34270 28811 30733 gene locus_tag LOCUS_34280 28811 30733 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_34280 30845 31717 gene locus_tag LOCUS_34290 30845 31717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 protein_id gnl|my_center|LOCUS_34290 31816 32973 gene locus_tag LOCUS_34300 31816 32973 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089020.1 protein_id gnl|my_center|LOCUS_34300 33285 33560 gene locus_tag LOCUS_34310 33285 33560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 33825 36728 gene locus_tag LOCUS_34320 33825 36728 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187995.1 protein_id gnl|my_center|LOCUS_34320 36831 37553 gene locus_tag LOCUS_34330 36831 37553 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187972.1 protein_id gnl|my_center|LOCUS_34330 37747 38724 gene locus_tag LOCUS_34340 37747 38724 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188558.1 protein_id gnl|my_center|LOCUS_34340 39072 39440 gene locus_tag LOCUS_34350 39072 39440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 39531 40607 gene locus_tag LOCUS_34360 39531 40607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 40894 42375 gene locus_tag LOCUS_34370 40894 42375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 42401 45823 gene locus_tag LOCUS_34380 42401 45823 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022007.1 protein_id gnl|my_center|LOCUS_34380 45826 46848 gene locus_tag LOCUS_34390 45826 46848 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_34390 46848 47441 gene locus_tag LOCUS_34400 46848 47441 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268476.1 protein_id gnl|my_center|LOCUS_34400 48384 47461 gene locus_tag LOCUS_34410 48384 47461 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269161.1 protein_id gnl|my_center|LOCUS_34410 49826 48435 gene locus_tag LOCUS_34420 49826 48435 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338025.1 protein_id gnl|my_center|LOCUS_34420 50959 49859 gene locus_tag LOCUS_34430 50959 49859 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720294.1 protein_id gnl|my_center|LOCUS_34430 52125 51097 gene locus_tag LOCUS_34440 52125 51097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 52540 54267 gene locus_tag LOCUS_34450 52540 54267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 54902 54333 gene locus_tag LOCUS_34460 54902 54333 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705445.1 protein_id gnl|my_center|LOCUS_34460 55349 57733 gene locus_tag LOCUS_34470 55349 57733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 57987 57829 gene locus_tag LOCUS_34480 57987 57829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 58533 58102 gene locus_tag LOCUS_34490 58533 58102 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723831.1 protein_id gnl|my_center|LOCUS_34490 59410 58754 gene locus_tag LOCUS_34500 59410 58754 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_34500 61068 59407 gene locus_tag LOCUS_34510 61068 59407 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_34510 61436 62086 gene locus_tag LOCUS_34520 61436 62086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 62086 63159 gene locus_tag LOCUS_34530 62086 63159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 63156 64766 gene locus_tag LOCUS_34540 63156 64766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 64910 65914 gene locus_tag LOCUS_34550 64910 65914 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_34550 67103 66213 gene locus_tag LOCUS_34560 67103 66213 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257620.1 protein_id gnl|my_center|LOCUS_34560 67462 67923 gene locus_tag LOCUS_34570 67462 67923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 68638 67976 gene locus_tag LOCUS_34580 68638 67976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 69631 68801 gene locus_tag LOCUS_34590 gene aroE 69631 68801 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111201.1 protein_id gnl|my_center|LOCUS_34590 70681 69668 gene locus_tag LOCUS_34600 gene hemB 70681 69668 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260930.1 protein_id gnl|my_center|LOCUS_34600 70999 71271 gene locus_tag LOCUS_34610 gene trxA 70999 71271 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173768.1 protein_id gnl|my_center|LOCUS_34610 <72634 71480 gene locus_tag LOCUS_34620 <72634 71480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181711674.1:efflux RND transporter permease subunit >Feature sequence025 1197 394 gene locus_tag LOCUS_34630 1197 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 2840 1197 gene locus_tag LOCUS_34640 2840 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 5534 2859 gene locus_tag LOCUS_34650 5534 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 6275 5604 gene locus_tag LOCUS_34660 6275 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 7069 6347 gene locus_tag LOCUS_34670 7069 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 7455 7114 gene locus_tag LOCUS_34680 7455 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 8296 7445 gene locus_tag LOCUS_34690 8296 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 9516 8629 gene locus_tag LOCUS_34700 9516 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 11231 10311 gene locus_tag LOCUS_34710 11231 10311 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136856750.1 protein_id gnl|my_center|LOCUS_34710 11370 11621 gene locus_tag LOCUS_34720 11370 11621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 13447 11696 gene locus_tag LOCUS_34730 13447 11696 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114562.1 protein_id gnl|my_center|LOCUS_34730 13776 14141 gene locus_tag LOCUS_34740 13776 14141 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_34740 15052 14273 gene locus_tag LOCUS_34750 15052 14273 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529680.1 protein_id gnl|my_center|LOCUS_34750 15879 15076 gene locus_tag LOCUS_34760 15879 15076 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088305.1 protein_id gnl|my_center|LOCUS_34760 18670 17219 gene locus_tag LOCUS_34770 18670 17219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 19271 19023 gene locus_tag LOCUS_34780 19271 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 20999 22342 gene locus_tag LOCUS_34790 20999 22342 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_34790 22773 23387 gene locus_tag LOCUS_34800 22773 23387 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921805.1 protein_id gnl|my_center|LOCUS_34800 23432 24514 gene locus_tag LOCUS_34810 gene tal 23432 24514 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_34810 24569 25255 gene locus_tag LOCUS_34820 24569 25255 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_34820 25310 26950 gene locus_tag LOCUS_34830 gene pgi 25310 26950 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_34830 26947 27852 gene locus_tag LOCUS_34840 26947 27852 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_34840 28027 29043 gene locus_tag LOCUS_34850 gene gnd 28027 29043 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_34850 29040 30425 gene locus_tag LOCUS_34860 gene zwf 29040 30425 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_34860 30794 32167 gene locus_tag LOCUS_34870 gene fumC 30794 32167 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990844.1 protein_id gnl|my_center|LOCUS_34870 32284 34077 gene locus_tag LOCUS_34880 32284 34077 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229258.1 protein_id gnl|my_center|LOCUS_34880 34199 34942 gene locus_tag LOCUS_34890 34199 34942 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760113.1 protein_id gnl|my_center|LOCUS_34890 34939 36534 gene locus_tag LOCUS_34900 34939 36534 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_34900 36531 37127 gene locus_tag LOCUS_34910 36531 37127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 37296 39014 gene locus_tag LOCUS_34920 gene poxB 37296 39014 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994147.1 protein_id gnl|my_center|LOCUS_34920 39039 40670 gene locus_tag LOCUS_34930 gene mdlC 39039 40670 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727769.1 protein_id gnl|my_center|LOCUS_34930 41022 41510 gene locus_tag LOCUS_34940 41022 41510 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022604.1 protein_id gnl|my_center|LOCUS_34940 41566 44196 gene locus_tag LOCUS_34950 41566 44196 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_34950 44322 45260 gene locus_tag LOCUS_34960 44322 45260 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057677989.1 protein_id gnl|my_center|LOCUS_34960 45301 45558 gene locus_tag LOCUS_34970 45301 45558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 46035 45478 gene locus_tag LOCUS_34980 46035 45478 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406554.1 protein_id gnl|my_center|LOCUS_34980 48380 46197 gene locus_tag LOCUS_34990 48380 46197 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_34990 48615 49280 gene locus_tag LOCUS_35000 48615 49280 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238395.1 protein_id gnl|my_center|LOCUS_35000 49518 52214 gene locus_tag LOCUS_35010 49518 52214 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786535.1 protein_id gnl|my_center|LOCUS_35010 54934 52484 gene locus_tag LOCUS_35020 54934 52484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 55603 55037 gene locus_tag LOCUS_35030 55603 55037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 55816 55998 gene locus_tag LOCUS_35040 55816 55998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 56311 57321 gene locus_tag LOCUS_35050 56311 57321 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_35050 57398 57721 gene locus_tag LOCUS_35060 57398 57721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 58477 58001 gene locus_tag LOCUS_35070 58477 58001 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920119.1 protein_id gnl|my_center|LOCUS_35070 59425 58730 gene locus_tag LOCUS_35080 59425 58730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 59728 60966 gene locus_tag LOCUS_35090 gene gltS 59728 60966 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468822.1 protein_id gnl|my_center|LOCUS_35090 62862 61027 gene locus_tag LOCUS_35100 62862 61027 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113792.1 protein_id gnl|my_center|LOCUS_35100 >Feature sequence026 264 13 gene locus_tag LOCUS_35110 264 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 953 1558 gene locus_tag LOCUS_35120 953 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 1782 2021 gene locus_tag LOCUS_35130 1782 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 2172 2495 gene locus_tag LOCUS_35140 2172 2495 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228377.1 protein_id gnl|my_center|LOCUS_35140 2482 2700 gene locus_tag LOCUS_35150 2482 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35150 2697 2831 gene locus_tag LOCUS_35160 2697 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 3151 3005 gene locus_tag LOCUS_35170 3151 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 3441 3148 gene locus_tag LOCUS_35180 3441 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 5522 3432 gene locus_tag LOCUS_35190 5522 3432 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_35190 12124 5519 gene locus_tag LOCUS_35200 12124 5519 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937974.1 protein_id gnl|my_center|LOCUS_35200 12581 12255 gene locus_tag LOCUS_35210 12581 12255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 12988 12578 gene locus_tag LOCUS_35220 12988 12578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 14213 13365 gene locus_tag LOCUS_35230 14213 13365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 14913 14200 gene locus_tag LOCUS_35240 14913 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 15710 14910 gene locus_tag LOCUS_35250 15710 14910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 16659 16060 gene locus_tag LOCUS_35260 16659 16060 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_35260 16957 16790 gene locus_tag LOCUS_35270 16957 16790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 17304 17077 gene locus_tag LOCUS_35280 17304 17077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 17653 17294 gene locus_tag LOCUS_35290 17653 17294 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_35290 17951 17643 gene locus_tag LOCUS_35300 17951 17643 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_35300 18132 17932 gene locus_tag LOCUS_35310 18132 17932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 18241 18122 gene locus_tag LOCUS_35320 18241 18122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 18438 18238 gene locus_tag LOCUS_35330 18438 18238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 18691 18443 gene locus_tag LOCUS_35340 18691 18443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 23924 18702 gene locus_tag LOCUS_35350 23924 18702 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229642.1 protein_id gnl|my_center|LOCUS_35350 26800 23921 gene locus_tag LOCUS_35360 26800 23921 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041505.1 protein_id gnl|my_center|LOCUS_35360 27391 27762 gene locus_tag LOCUS_35370 27391 27762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 28462 29532 gene locus_tag LOCUS_35380 28462 29532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 29674 29877 gene locus_tag LOCUS_35390 29674 29877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 30456 29809 gene locus_tag LOCUS_35400 30456 29809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 31038 30478 gene locus_tag LOCUS_35410 31038 30478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 31672 31067 gene locus_tag LOCUS_35420 31672 31067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 32085 33506 gene locus_tag LOCUS_35430 32085 33506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 34221 35276 gene locus_tag LOCUS_35440 34221 35276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 35310 36989 gene locus_tag LOCUS_35450 35310 36989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 36986 38056 gene locus_tag LOCUS_35460 36986 38056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 38437 40407 gene locus_tag LOCUS_35470 38437 40407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 40624 41826 gene locus_tag LOCUS_35480 40624 41826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 41840 43081 gene locus_tag LOCUS_35490 41840 43081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 43170 45425 gene locus_tag LOCUS_35500 43170 45425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 45598 46383 gene locus_tag LOCUS_35510 gene tagT 45598 46383 CDS product type IV secretion associated ABC transporter ATP-binding protein TagT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114657.1 protein_id gnl|my_center|LOCUS_35510 46383 48269 gene locus_tag LOCUS_35520 46383 48269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 48276 50063 gene locus_tag LOCUS_35530 48276 50063 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032711012.1 protein_id gnl|my_center|LOCUS_35530 50035 50943 gene locus_tag LOCUS_35540 50035 50943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 50960 51535 gene locus_tag LOCUS_35550 50960 51535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 51772 52104 gene locus_tag LOCUS_35560 51772 52104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 52105 52662 gene locus_tag LOCUS_35570 52105 52662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 52935 53216 gene locus_tag LOCUS_35580 52935 53216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 53537 54094 gene locus_tag LOCUS_35590 53537 54094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 54167 54424 gene locus_tag LOCUS_35600 54167 54424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 55540 57249 gene locus_tag LOCUS_35610 55540 57249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 57311 59215 gene locus_tag LOCUS_35620 57311 59215 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031064.1 protein_id gnl|my_center|LOCUS_35620 60119 59676 gene locus_tag LOCUS_35630 60119 59676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 60572 60168 gene locus_tag LOCUS_35640 60572 60168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 60760 60939 gene locus_tag LOCUS_35650 60760 60939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 61650 61979 gene locus_tag LOCUS_35660 61650 61979 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_35660 61984 62307 gene locus_tag LOCUS_35670 61984 62307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 62465 62641 gene locus_tag LOCUS_35680 62465 62641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 62642 62845 gene locus_tag LOCUS_35690 62642 62845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 63328 63008 gene locus_tag LOCUS_35700 63328 63008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 >Feature sequence027 444 920 gene locus_tag LOCUS_35710 444 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 1295 1717 gene locus_tag LOCUS_35720 1295 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 2757 3401 gene locus_tag LOCUS_35730 2757 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 4601 3669 gene locus_tag LOCUS_35740 4601 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 5203 5673 gene locus_tag LOCUS_35750 5203 5673 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268700.1 protein_id gnl|my_center|LOCUS_35750 7396 5666 gene locus_tag LOCUS_35760 7396 5666 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_35760 8717 7398 gene locus_tag LOCUS_35770 8717 7398 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880594.1 protein_id gnl|my_center|LOCUS_35770 9376 8714 gene locus_tag LOCUS_35780 9376 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761958.1 protein_id gnl|my_center|LOCUS_35780 10482 9373 gene locus_tag LOCUS_35790 10482 9373 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880596.1 protein_id gnl|my_center|LOCUS_35790 10978 10499 gene locus_tag LOCUS_35800 10978 10499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 12218 11226 gene locus_tag LOCUS_35810 12218 11226 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_35810 12625 15999 gene locus_tag LOCUS_35820 12625 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 16176 17480 gene locus_tag LOCUS_35830 16176 17480 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_35830 17473 18174 gene locus_tag LOCUS_35840 gene lolD 17473 18174 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 protein_id gnl|my_center|LOCUS_35840 18674 18117 gene locus_tag LOCUS_35850 18674 18117 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706585.1 protein_id gnl|my_center|LOCUS_35850 18864 21200 gene locus_tag LOCUS_35860 18864 21200 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104749.1 protein_id gnl|my_center|LOCUS_35860 21280 22275 gene locus_tag LOCUS_35870 21280 22275 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_35870 22272 22952 gene locus_tag LOCUS_35880 gene tsaB 22272 22952 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478795.1 protein_id gnl|my_center|LOCUS_35880 23199 22936 gene locus_tag LOCUS_35890 23199 22936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 23642 24904 gene locus_tag LOCUS_35900 23642 24904 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384388.1 protein_id gnl|my_center|LOCUS_35900 24925 25761 gene locus_tag LOCUS_35910 24925 25761 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 protein_id gnl|my_center|LOCUS_35910 26044 26670 gene locus_tag LOCUS_35920 26044 26670 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_35920 26667 27215 gene locus_tag LOCUS_35930 26667 27215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 27212 29104 gene locus_tag LOCUS_35940 gene msbA 27212 29104 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706583.1 protein_id gnl|my_center|LOCUS_35940 29128 30132 gene locus_tag LOCUS_35950 gene lpxK 29128 30132 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091159.1 protein_id gnl|my_center|LOCUS_35950 30125 30913 gene locus_tag LOCUS_35960 gene kdsB 30125 30913 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007039689.1 protein_id gnl|my_center|LOCUS_35960 31381 30962 gene locus_tag LOCUS_35970 31381 30962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 33043 31520 gene locus_tag LOCUS_35980 gene ppx 33043 31520 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 protein_id gnl|my_center|LOCUS_35980 33278 35494 gene locus_tag LOCUS_35990 gene recQ 33278 35494 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_35990 36981 35569 gene locus_tag LOCUS_36000 36981 35569 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766752.1 protein_id gnl|my_center|LOCUS_36000 38397 37237 gene locus_tag LOCUS_36010 38397 37237 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550279.1 protein_id gnl|my_center|LOCUS_36010 39792 38410 gene locus_tag LOCUS_36020 39792 38410 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_36020 41470 40001 gene locus_tag LOCUS_36030 41470 40001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 42190 41480 gene locus_tag LOCUS_36040 42190 41480 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533115.1 protein_id gnl|my_center|LOCUS_36040 43504 42335 gene locus_tag LOCUS_36050 43504 42335 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261001.1 protein_id gnl|my_center|LOCUS_36050 44938 43751 gene locus_tag LOCUS_36060 44938 43751 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459669.1 protein_id gnl|my_center|LOCUS_36060 46399 45056 gene locus_tag LOCUS_36070 gene tviB 46399 45056 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063859.1 protein_id gnl|my_center|LOCUS_36070 46292 46501 gene locus_tag LOCUS_36080 46292 46501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 48183 46528 gene locus_tag LOCUS_36090 48183 46528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 49162 48350 gene locus_tag LOCUS_36100 49162 48350 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 protein_id gnl|my_center|LOCUS_36100 49783 52113 gene locus_tag LOCUS_36110 49783 52113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 52174 53952 gene locus_tag LOCUS_36120 52174 53952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 54182 55609 gene locus_tag LOCUS_36130 54182 55609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133511689.1 protein_id gnl|my_center|LOCUS_36130 55878 56354 gene locus_tag LOCUS_36140 55878 56354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 56605 57081 gene locus_tag LOCUS_36150 56605 57081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 61484 57399 gene locus_tag LOCUS_36160 61484 57399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 >Feature sequence028 2746 767 gene locus_tag LOCUS_36170 2746 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36170 3884 2832 gene locus_tag LOCUS_36180 3884 2832 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705065.1 protein_id gnl|my_center|LOCUS_36180 5136 4042 gene locus_tag LOCUS_36190 gene ruvB 5136 4042 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086123.1 protein_id gnl|my_center|LOCUS_36190 6638 5148 gene locus_tag LOCUS_36200 gene glcD 6638 5148 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765139.1 protein_id gnl|my_center|LOCUS_36200 6885 6960 gene locus_tag LOCUS_t00460 6885 6960 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7250 7858 gene locus_tag LOCUS_36210 7250 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 7855 8442 gene locus_tag LOCUS_36220 7855 8442 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065384.1 protein_id gnl|my_center|LOCUS_36220 8675 12256 gene locus_tag LOCUS_36230 gene brxC 8675 12256 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459229.1 protein_id gnl|my_center|LOCUS_36230 12311 12526 gene locus_tag LOCUS_36240 12311 12526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 12617 12847 gene locus_tag LOCUS_36250 12617 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 12844 13245 gene locus_tag LOCUS_36260 12844 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 13315 13617 gene locus_tag LOCUS_36270 13315 13617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 13617 14066 gene locus_tag LOCUS_36280 13617 14066 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529815.1 protein_id gnl|my_center|LOCUS_36280 14144 18265 gene locus_tag LOCUS_36290 14144 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 18258 18509 gene locus_tag LOCUS_36300 18258 18509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 18506 18739 gene locus_tag LOCUS_36310 18506 18739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 19352 20596 gene locus_tag LOCUS_36320 19352 20596 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_36320 20798 21325 gene locus_tag LOCUS_36330 20798 21325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 21409 21969 gene locus_tag LOCUS_36340 21409 21969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 21960 24587 gene locus_tag LOCUS_36350 gene pglZ 21960 24587 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939302.1 protein_id gnl|my_center|LOCUS_36350 24646 25008 gene locus_tag LOCUS_36360 24646 25008 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_36360 25045 27063 gene locus_tag LOCUS_36370 gene brxL 25045 27063 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022338.1 protein_id gnl|my_center|LOCUS_36370 27560 27171 gene locus_tag LOCUS_36380 27560 27171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 28177 27557 gene locus_tag LOCUS_36390 28177 27557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 28291 28674 gene locus_tag LOCUS_36400 28291 28674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 28689 28943 gene locus_tag LOCUS_36410 28689 28943 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_36410 28933 29457 gene locus_tag LOCUS_36420 28933 29457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 29805 29605 gene locus_tag LOCUS_36430 29805 29605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 30175 29945 gene locus_tag LOCUS_36440 30175 29945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 30551 30216 gene locus_tag LOCUS_36450 30551 30216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 30810 31109 gene locus_tag LOCUS_36460 30810 31109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 31106 31363 gene locus_tag LOCUS_36470 31106 31363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 32073 32294 gene locus_tag LOCUS_36480 32073 32294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 34480 32501 gene locus_tag LOCUS_36490 34480 32501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 36443 34485 gene locus_tag LOCUS_36500 36443 34485 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679308.1 protein_id gnl|my_center|LOCUS_36500 36893 37333 gene locus_tag LOCUS_36510 36893 37333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 37365 37940 gene locus_tag LOCUS_36520 37365 37940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 38351 38163 gene locus_tag LOCUS_36530 38351 38163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 38596 38348 gene locus_tag LOCUS_36540 38596 38348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 39332 38871 gene locus_tag LOCUS_36550 39332 38871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 39766 39584 gene locus_tag LOCUS_36560 39766 39584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 40377 39763 gene locus_tag LOCUS_36570 40377 39763 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074111.1 protein_id gnl|my_center|LOCUS_36570 40522 40878 gene locus_tag LOCUS_36580 40522 40878 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265694.1 protein_id gnl|my_center|LOCUS_36580 40878 41501 gene locus_tag LOCUS_36590 40878 41501 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313598.1 protein_id gnl|my_center|LOCUS_36590 41562 41900 gene locus_tag LOCUS_36600 41562 41900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 42340 41879 gene locus_tag LOCUS_36610 42340 41879 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966071.1 protein_id gnl|my_center|LOCUS_36610 42632 43342 gene locus_tag LOCUS_36620 42632 43342 CDS product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073732.1 protein_id gnl|my_center|LOCUS_36620 43689 43528 gene locus_tag LOCUS_36630 43689 43528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 43782 44342 gene locus_tag LOCUS_36640 43782 44342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 44528 45031 gene locus_tag LOCUS_36650 44528 45031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 45031 46182 gene locus_tag LOCUS_36660 45031 46182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933801.1 protein_id gnl|my_center|LOCUS_36660 46194 46595 gene locus_tag LOCUS_36670 46194 46595 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764200.1 protein_id gnl|my_center|LOCUS_36670 46764 48113 gene locus_tag LOCUS_36680 46764 48113 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_36680 48229 48564 gene locus_tag LOCUS_36690 48229 48564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 49173 49601 gene locus_tag LOCUS_36700 49173 49601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 49957 49799 gene locus_tag LOCUS_36710 49957 49799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 49898 50089 gene locus_tag LOCUS_36720 49898 50089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 50091 50405 gene locus_tag LOCUS_36730 50091 50405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 >Feature sequence029 595 1773 gene locus_tag LOCUS_36740 595 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 2154 3197 gene locus_tag LOCUS_36750 2154 3197 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308111.1 protein_id gnl|my_center|LOCUS_36750 3300 4139 gene locus_tag LOCUS_36760 gene mreC 3300 4139 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 protein_id gnl|my_center|LOCUS_36760 4136 4624 gene locus_tag LOCUS_36770 gene mreD 4136 4624 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364106.1 protein_id gnl|my_center|LOCUS_36770 4638 6500 gene locus_tag LOCUS_36780 gene mrdA 4638 6500 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_36780 6493 7626 gene locus_tag LOCUS_36790 gene mrdB 6493 7626 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_36790 7988 9025 gene locus_tag LOCUS_36800 gene mltB 7988 9025 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_36800 9125 10309 gene locus_tag LOCUS_36810 9125 10309 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444497.1 protein_id gnl|my_center|LOCUS_36810 10306 10611 gene locus_tag LOCUS_36820 gene ybeD 10306 10611 CDS product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298227.1 protein_id gnl|my_center|LOCUS_36820 10614 11252 gene locus_tag LOCUS_36830 gene lipB 10614 11252 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313884.1 protein_id gnl|my_center|LOCUS_36830 13007 11325 gene locus_tag LOCUS_36840 13007 11325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 14499 13183 gene locus_tag LOCUS_36850 14499 13183 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112779.1 protein_id gnl|my_center|LOCUS_36850 15609 14593 gene locus_tag LOCUS_36860 15609 14593 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_36860 17999 15723 gene locus_tag LOCUS_36870 17999 15723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 19058 18423 gene locus_tag LOCUS_36880 19058 18423 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_36880 19194 19628 gene locus_tag LOCUS_36890 19194 19628 CDS product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871555.1 protein_id gnl|my_center|LOCUS_36890 19625 20074 gene locus_tag LOCUS_36900 19625 20074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 20202 21875 gene locus_tag LOCUS_36910 20202 21875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 22128 21964 gene locus_tag LOCUS_36920 22128 21964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 22494 23093 gene locus_tag LOCUS_36930 22494 23093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 27204 23239 gene locus_tag LOCUS_36940 27204 23239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 30344 27582 gene locus_tag LOCUS_36950 30344 27582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 30636 30358 gene locus_tag LOCUS_36960 gene kaiB 30636 30358 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056333.1 protein_id gnl|my_center|LOCUS_36960 32372 30633 gene locus_tag LOCUS_36970 gene kaiC 32372 30633 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331300.1 protein_id gnl|my_center|LOCUS_36970 35212 32393 gene locus_tag LOCUS_36980 35212 32393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 35718 35209 gene locus_tag LOCUS_36990 35718 35209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 36311 35715 gene locus_tag LOCUS_37000 36311 35715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 38112 36301 gene locus_tag LOCUS_37010 38112 36301 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259629.1 protein_id gnl|my_center|LOCUS_37010 38501 38151 gene locus_tag LOCUS_37020 38501 38151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 40804 38531 gene locus_tag LOCUS_37030 40804 38531 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 protein_id gnl|my_center|LOCUS_37030 42389 40815 gene locus_tag LOCUS_37040 42389 40815 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_37040 43491 42403 gene locus_tag LOCUS_37050 gene cheB 43491 42403 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_37050 45446 43491 gene locus_tag LOCUS_37060 45446 43491 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073766.1 protein_id gnl|my_center|LOCUS_37060 45725 47233 gene locus_tag LOCUS_37070 gene malQ 45725 47233 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_37070 47776 47435 gene locus_tag LOCUS_37080 47776 47435 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_37080 49630 48212 gene locus_tag LOCUS_37090 49630 48212 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 protein_id gnl|my_center|LOCUS_37090 50219 49773 gene locus_tag LOCUS_37100 50219 49773 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635612.1 protein_id gnl|my_center|LOCUS_37100 >Feature sequence030 595 17 gene locus_tag LOCUS_37110 595 17 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930436.1 protein_id gnl|my_center|LOCUS_37110 1371 595 gene locus_tag LOCUS_37120 1371 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 1967 1374 gene locus_tag LOCUS_37130 1967 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 3356 2223 gene locus_tag LOCUS_37140 gene argE 3356 2223 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 protein_id gnl|my_center|LOCUS_37140 3559 4692 gene locus_tag LOCUS_37150 3559 4692 CDS product GNAT family N-acetyltransferase/peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 protein_id gnl|my_center|LOCUS_37150 4872 6365 gene locus_tag LOCUS_37160 4872 6365 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_37160 6359 7831 gene locus_tag LOCUS_37170 6359 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 8051 10057 gene locus_tag LOCUS_37180 8051 10057 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_37180 10563 10829 gene locus_tag LOCUS_37190 10563 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 10816 11097 gene locus_tag LOCUS_37200 10816 11097 CDS product type II toxin-antitoxin system mRNA interferase toxin, HP0892 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955518.1 protein_id gnl|my_center|LOCUS_37200 12585 11500 gene locus_tag LOCUS_37210 gene gmd 12585 11500 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_37210 13662 12676 gene locus_tag LOCUS_37220 13662 12676 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097874.1 protein_id gnl|my_center|LOCUS_37220 16129 13946 gene locus_tag LOCUS_37230 16129 13946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 16315 17121 gene locus_tag LOCUS_37240 16315 17121 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570845.1 protein_id gnl|my_center|LOCUS_37240 19128 17230 gene locus_tag LOCUS_37250 19128 17230 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946701.1 protein_id gnl|my_center|LOCUS_37250 19546 20505 gene locus_tag LOCUS_37260 19546 20505 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_37260 20581 21570 gene locus_tag LOCUS_37270 gene galE 20581 21570 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_37270 21567 21812 gene locus_tag LOCUS_37280 21567 21812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 22023 22289 gene locus_tag LOCUS_37290 22023 22289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 22378 22683 gene locus_tag LOCUS_37300 22378 22683 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_37300 22736 22924 gene locus_tag LOCUS_37310 22736 22924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 23100 23465 gene locus_tag LOCUS_37320 23100 23465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 23980 24330 gene locus_tag LOCUS_37330 23980 24330 CDS product MarR family EPS-associated transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340715.1 protein_id gnl|my_center|LOCUS_37330 24463 25293 gene locus_tag LOCUS_37340 24463 25293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679019.1 protein_id gnl|my_center|LOCUS_37340 25298 26563 gene locus_tag LOCUS_37350 25298 26563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 28297 27923 gene locus_tag LOCUS_37360 28297 27923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 29936 30406 gene locus_tag LOCUS_37370 29936 30406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 >Feature sequence031 95 559 gene locus_tag LOCUS_37380 95 559 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_37380 823 2508 gene locus_tag LOCUS_37390 823 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 2723 5476 gene locus_tag LOCUS_37400 2723 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 5547 6854 gene locus_tag LOCUS_37410 5547 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 6851 7606 gene locus_tag LOCUS_37420 6851 7606 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705455.1 protein_id gnl|my_center|LOCUS_37420 7603 8376 gene locus_tag LOCUS_37430 7603 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 8498 9088 gene locus_tag LOCUS_37440 8498 9088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 9085 10833 gene locus_tag LOCUS_37450 9085 10833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 10827 12035 gene locus_tag LOCUS_37460 10827 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 12032 12445 gene locus_tag LOCUS_37470 12032 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 12442 13248 gene locus_tag LOCUS_37480 12442 13248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 14278 13526 gene locus_tag LOCUS_37490 14278 13526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 16594 14477 gene locus_tag LOCUS_37500 16594 14477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 17707 18515 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctgagctgcctatgcggcagtgaac 19348 18785 gene locus_tag LOCUS_37510 gene cas6f 19348 18785 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350184.1 protein_id gnl|my_center|LOCUS_37510 20396 19353 gene locus_tag LOCUS_37520 gene csy3 20396 19353 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_37520 21464 20415 gene locus_tag LOCUS_37530 gene csy2 21464 20415 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_37530 22770 21454 gene locus_tag LOCUS_37540 gene csy1 22770 21454 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222491.1 protein_id gnl|my_center|LOCUS_37540 23182 22841 gene locus_tag LOCUS_37550 23182 22841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 23475 23266 gene locus_tag LOCUS_37560 23475 23266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 25781 23481 gene locus_tag LOCUS_37570 25781 23481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37570 26877 25696 gene locus_tag LOCUS_37580 26877 25696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37580 27851 26874 gene locus_tag LOCUS_37590 gene cas1f 27851 26874 CDS product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 protein_id gnl|my_center|LOCUS_37590 28457 27978 gene locus_tag LOCUS_37600 28457 27978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 >Feature sequence032 1021 92 gene locus_tag LOCUS_37610 1021 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 2377 1043 gene locus_tag LOCUS_37620 2377 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 4144 2432 gene locus_tag LOCUS_37630 4144 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 4816 4157 gene locus_tag LOCUS_37640 4816 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 7467 4813 gene locus_tag LOCUS_37650 7467 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 8099 7464 gene locus_tag LOCUS_37660 8099 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 9620 8112 gene locus_tag LOCUS_37670 9620 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 9931 9623 gene locus_tag LOCUS_37680 9931 9623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 11282 9990 gene locus_tag LOCUS_37690 11282 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 13565 11430 gene locus_tag LOCUS_37700 13565 11430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 14074 13577 gene locus_tag LOCUS_37710 14074 13577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 15546 14074 gene locus_tag LOCUS_37720 15546 14074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 17080 15557 gene locus_tag LOCUS_37730 17080 15557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 17696 17073 gene locus_tag LOCUS_37740 17696 17073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 19345 17693 gene locus_tag LOCUS_37750 19345 17693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 20146 19634 gene locus_tag LOCUS_37760 20146 19634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 20184 20651 gene locus_tag LOCUS_37770 20184 20651 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_37770 21208 20768 gene locus_tag LOCUS_37780 gene ssb 21208 20768 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114685.1 protein_id gnl|my_center|LOCUS_37780 21688 21266 gene locus_tag LOCUS_37790 21688 21266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 22004 21699 gene locus_tag LOCUS_37800 22004 21699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 23840 22332 gene locus_tag LOCUS_37810 23840 22332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 24570 26447 gene locus_tag LOCUS_37820 24570 26447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37820 26622 27092 gene locus_tag LOCUS_37830 26622 27092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 27515 27946 gene locus_tag LOCUS_37840 gene tnpA 27515 27946 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_37840 >Feature sequence033 717 166 gene locus_tag LOCUS_37850 717 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 758 1516 gene locus_tag LOCUS_37860 758 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 1722 4190 gene locus_tag LOCUS_37870 gene ftsK 1722 4190 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405080.1 protein_id gnl|my_center|LOCUS_37870 4198 4878 gene locus_tag LOCUS_37880 gene lolA 4198 4878 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702312.1 protein_id gnl|my_center|LOCUS_37880 4913 6208 gene locus_tag LOCUS_37890 4913 6208 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_37890 7166 6294 gene locus_tag LOCUS_37900 7166 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 7780 7163 gene locus_tag LOCUS_37910 7780 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 7960 8370 gene locus_tag LOCUS_37920 gene msrB 7960 8370 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090911.1 protein_id gnl|my_center|LOCUS_37920 9160 8471 gene locus_tag LOCUS_37930 9160 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 9497 9970 gene locus_tag LOCUS_37940 9497 9970 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660269.1 protein_id gnl|my_center|LOCUS_37940 10807 9971 gene locus_tag LOCUS_37950 10807 9971 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920648.1 protein_id gnl|my_center|LOCUS_37950 11077 12540 gene locus_tag LOCUS_37960 11077 12540 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 protein_id gnl|my_center|LOCUS_37960 12599 13561 gene locus_tag LOCUS_37970 12599 13561 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_37970 15514 13616 gene locus_tag LOCUS_37980 15514 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 16862 15504 gene locus_tag LOCUS_37990 16862 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 18527 17076 gene locus_tag LOCUS_38000 18527 17076 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070440.1 protein_id gnl|my_center|LOCUS_38000 19170 22745 gene locus_tag LOCUS_38010 gene dnaE 19170 22745 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946697.1 protein_id gnl|my_center|LOCUS_38010 22745 24100 gene locus_tag LOCUS_38020 22745 24100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 24312 25811 gene locus_tag LOCUS_38030 24312 25811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 27334 25973 gene locus_tag LOCUS_38040 27334 25973 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257295.1 protein_id gnl|my_center|LOCUS_38040 28081 28299 gene locus_tag LOCUS_38050 28081 28299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 >Feature sequence034 1126 821 gene locus_tag LOCUS_38060 1126 821 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015575.1 protein_id gnl|my_center|LOCUS_38060 1454 1164 gene locus_tag LOCUS_38070 1454 1164 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_38070 3663 1636 gene locus_tag LOCUS_38080 3663 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 4284 3883 gene locus_tag LOCUS_38090 gene merR 4284 3883 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429838.1 protein_id gnl|my_center|LOCUS_38090 4446 4583 gene locus_tag LOCUS_38100 4446 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 4591 4803 gene locus_tag LOCUS_38110 4591 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 4980 5555 gene locus_tag LOCUS_38120 4980 5555 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_38120 5599 5817 gene locus_tag LOCUS_38130 5599 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 7226 6069 gene locus_tag LOCUS_38140 7226 6069 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_38140 7857 7204 gene locus_tag LOCUS_38150 7857 7204 CDS product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_38150 9237 7909 gene locus_tag LOCUS_38160 9237 7909 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934974.1 protein_id gnl|my_center|LOCUS_38160 9521 9997 gene locus_tag LOCUS_38170 9521 9997 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927167.1 protein_id gnl|my_center|LOCUS_38170 11449 10325 gene locus_tag LOCUS_38180 gene arsB 11449 10325 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440386.1 protein_id gnl|my_center|LOCUS_38180 12482 11781 gene locus_tag LOCUS_38190 12482 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 13030 12479 gene locus_tag LOCUS_38200 13030 12479 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036135.1 protein_id gnl|my_center|LOCUS_38200 14867 13065 gene locus_tag LOCUS_38210 gene arsA 14867 13065 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705614.1 protein_id gnl|my_center|LOCUS_38210 15243 14884 gene locus_tag LOCUS_38220 gene arsD 15243 14884 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817072.1 protein_id gnl|my_center|LOCUS_38220 15673 15302 gene locus_tag LOCUS_38230 15673 15302 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049049137.1 protein_id gnl|my_center|LOCUS_38230 15929 16819 gene locus_tag LOCUS_38240 15929 16819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 16831 17382 gene locus_tag LOCUS_38250 16831 17382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 17590 18564 gene locus_tag LOCUS_38260 gene pstS 17590 18564 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_38260 18760 21057 gene locus_tag LOCUS_38270 18760 21057 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418856.1 protein_id gnl|my_center|LOCUS_38270 21084 22739 gene locus_tag LOCUS_38280 gene pstA 21084 22739 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_38280 22837 23697 gene locus_tag LOCUS_38290 gene pstB 22837 23697 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401255.1 protein_id gnl|my_center|LOCUS_38290 23770 24498 gene locus_tag LOCUS_38300 gene phoU 23770 24498 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334097.1 protein_id gnl|my_center|LOCUS_38300 24806 24645 gene locus_tag LOCUS_38310 24806 24645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 25686 24820 gene locus_tag LOCUS_38320 25686 24820 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_38320 27176 25701 gene locus_tag LOCUS_38330 27176 25701 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_38330 27620 28009 gene locus_tag LOCUS_38340 27620 28009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 >Feature sequence035 672 127 gene locus_tag LOCUS_38350 672 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 2354 780 gene locus_tag LOCUS_38360 2354 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 2774 3340 gene locus_tag LOCUS_38370 2774 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 5704 3443 gene locus_tag LOCUS_38380 gene maeB 5704 3443 CDS product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342644.1 protein_id gnl|my_center|LOCUS_38380 8112 5974 gene locus_tag LOCUS_38390 gene recD 8112 5974 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103277.1 protein_id gnl|my_center|LOCUS_38390 12173 8112 gene locus_tag LOCUS_38400 gene recB 12173 8112 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115861.1 protein_id gnl|my_center|LOCUS_38400 15868 12200 gene locus_tag LOCUS_38410 gene recC 15868 12200 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266563.1 protein_id gnl|my_center|LOCUS_38410 16289 16365 gene locus_tag LOCUS_t00470 16289 16365 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16771 16562 gene locus_tag LOCUS_38420 16771 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 16893 17132 gene locus_tag LOCUS_38430 16893 17132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 17158 17622 gene locus_tag LOCUS_38440 17158 17622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 18834 17665 gene locus_tag LOCUS_38450 18834 17665 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263014.1 protein_id gnl|my_center|LOCUS_38450 >Feature sequence036 1626 775 gene locus_tag LOCUS_38460 1626 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 3245 1902 gene locus_tag LOCUS_38470 3245 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 4520 3393 gene locus_tag LOCUS_38480 4520 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 5769 5930 gene locus_tag LOCUS_38490 5769 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 7281 5896 gene locus_tag LOCUS_38500 7281 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 7944 7294 gene locus_tag LOCUS_38510 7944 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 9683 7941 gene locus_tag LOCUS_38520 9683 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 10018 9680 gene locus_tag LOCUS_38530 10018 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 12091 10364 gene locus_tag LOCUS_38540 12091 10364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838546.1 protein_id gnl|my_center|LOCUS_38540 12489 12214 gene locus_tag LOCUS_38550 12489 12214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 13009 12872 gene locus_tag LOCUS_38560 13009 12872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 13775 13428 gene locus_tag LOCUS_38570 13775 13428 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582526.1 protein_id gnl|my_center|LOCUS_38570 14255 13995 gene locus_tag LOCUS_38580 14255 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 15475 15206 gene locus_tag LOCUS_38590 15475 15206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 15835 15560 gene locus_tag LOCUS_38600 15835 15560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 >Feature sequence037 101 898 gene locus_tag LOCUS_38610 gene elyC 101 898 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704890.1 protein_id gnl|my_center|LOCUS_38610 2310 1066 gene locus_tag LOCUS_38620 2310 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 4165 2303 gene locus_tag LOCUS_38630 4165 2303 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140176.1 protein_id gnl|my_center|LOCUS_38630 4718 4251 gene locus_tag LOCUS_38640 4718 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 4783 4965 gene locus_tag LOCUS_38650 4783 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 5499 6086 gene locus_tag LOCUS_38660 5499 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 6241 6423 gene locus_tag LOCUS_38670 6241 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 6742 8607 gene locus_tag LOCUS_38680 6742 8607 CDS product asparagine synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388575.1 protein_id gnl|my_center|LOCUS_38680 10586 8754 gene locus_tag LOCUS_38690 gene cobT 10586 8754 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384517.1 protein_id gnl|my_center|LOCUS_38690 11636 10674 gene locus_tag LOCUS_38700 gene cobS 11636 10674 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523293.1 protein_id gnl|my_center|LOCUS_38700 12081 11659 gene locus_tag LOCUS_38710 12081 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 12293 13264 gene locus_tag LOCUS_38720 12293 13264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528117.1 protein_id gnl|my_center|LOCUS_38720 13777 13412 gene locus_tag LOCUS_38730 13777 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 13734 13943 gene locus_tag LOCUS_38740 13734 13943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 14433 13963 gene locus_tag LOCUS_38750 14433 13963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 14596 14850 gene locus_tag LOCUS_38760 14596 14850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 15747 16070 gene locus_tag LOCUS_38770 15747 16070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 >Feature sequence038 882 1169 gene locus_tag LOCUS_38780 882 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 1397 1606 gene locus_tag LOCUS_38790 1397 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 1608 1883 gene locus_tag LOCUS_38800 1608 1883 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971059.1 protein_id gnl|my_center|LOCUS_38800 2250 2597 gene locus_tag LOCUS_38810 2250 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 2594 2977 gene locus_tag LOCUS_38820 2594 2977 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393073.1 protein_id gnl|my_center|LOCUS_38820 3174 3449 gene locus_tag LOCUS_38830 3174 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 4374 4778 gene locus_tag LOCUS_38840 4374 4778 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_38840 4916 5266 gene locus_tag LOCUS_38850 4916 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 5263 6804 gene locus_tag LOCUS_38860 5263 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38860 6954 7202 gene locus_tag LOCUS_38870 6954 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 7199 7594 gene locus_tag LOCUS_38880 7199 7594 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_38880 7591 7932 gene locus_tag LOCUS_38890 7591 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38890 7937 8224 gene locus_tag LOCUS_38900 7937 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38900 8858 9718 gene locus_tag LOCUS_38910 8858 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 10580 10831 gene locus_tag LOCUS_38920 10580 10831 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402372.1 protein_id gnl|my_center|LOCUS_38920 10839 11144 gene locus_tag LOCUS_38930 10839 11144 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268681.1 protein_id gnl|my_center|LOCUS_38930 >Feature sequence039 <1 1200 gene locus_tag LOCUS_38940 <1 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815383.1:IS4 family transposase 1896 3347 gene locus_tag LOCUS_38950 gene ltrA 1896 3347 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235893157.1 protein_id gnl|my_center|LOCUS_38950 3795 5336 gene locus_tag LOCUS_38960 gene istA 3795 5336 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_38960 5394 6149 gene locus_tag LOCUS_38970 gene istB 5394 6149 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_38970 6573 6382 gene locus_tag LOCUS_38980 6573 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 6927 7430 gene locus_tag LOCUS_38990 6927 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 8599 7454 gene locus_tag LOCUS_39000 8599 7454 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_39000 9874 9386 gene locus_tag LOCUS_39010 9874 9386 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533488.1 protein_id gnl|my_center|LOCUS_39010 10155 9862 gene locus_tag LOCUS_39020 10155 9862 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970089.1 protein_id gnl|my_center|LOCUS_39020 10872 10600 gene locus_tag LOCUS_39030 10872 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39030 >Feature sequence040 1182 1550 gene locus_tag LOCUS_39040 1182 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 1863 2063 gene locus_tag LOCUS_39050 1863 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 2128 2310 gene locus_tag LOCUS_39060 2128 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 2883 3074 gene locus_tag LOCUS_39070 2883 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 3229 4401 gene locus_tag LOCUS_39080 3229 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 4405 5580 gene locus_tag LOCUS_39090 4405 5580 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202152.1 protein_id gnl|my_center|LOCUS_39090 5577 6749 gene locus_tag LOCUS_39100 5577 6749 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162850918.1 protein_id gnl|my_center|LOCUS_39100 6742 7908 gene locus_tag LOCUS_39110 6742 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 8158 8766 gene locus_tag LOCUS_39120 8158 8766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 8867 10090 gene locus_tag LOCUS_39130 8867 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 10090 10737 gene locus_tag LOCUS_39140 10090 10737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 >Feature sequence041 521 1114 gene locus_tag LOCUS_39150 521 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 1965 2111 gene locus_tag LOCUS_39160 1965 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 2223 2507 gene locus_tag LOCUS_39170 2223 2507 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057607.1 protein_id gnl|my_center|LOCUS_39170 2964 2491 gene locus_tag LOCUS_39180 2964 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986769.1 protein_id gnl|my_center|LOCUS_39180 3696 3025 gene locus_tag LOCUS_39190 3696 3025 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970221.1 protein_id gnl|my_center|LOCUS_39190 3885 4133 gene locus_tag LOCUS_39200 3885 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 4361 4492 gene locus_tag LOCUS_39210 4361 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 5666 6202 gene locus_tag LOCUS_39220 5666 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 6336 6151 gene locus_tag LOCUS_39230 6336 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 8448 6847 gene locus_tag LOCUS_39240 8448 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 9382 8948 gene locus_tag LOCUS_39250 9382 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 >Feature sequence042 516 710 gene locus_tag LOCUS_39260 516 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 703 1047 gene locus_tag LOCUS_39270 703 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 1055 1363 gene locus_tag LOCUS_39280 1055 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 1886 1530 gene locus_tag LOCUS_39290 1886 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 2211 1780 gene locus_tag LOCUS_39300 2211 1780 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120796836.1 protein_id gnl|my_center|LOCUS_39300 2475 2275 gene locus_tag LOCUS_39310 2475 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 2964 2548 gene locus_tag LOCUS_39320 2964 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 3562 3431 gene locus_tag LOCUS_39330 3562 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 4013 3564 gene locus_tag LOCUS_39340 4013 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 4100 4246 gene locus_tag LOCUS_39350 4100 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 5036 5227 gene locus_tag LOCUS_39360 5036 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 5295 5594 gene locus_tag LOCUS_39370 5295 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 5742 6260 gene locus_tag LOCUS_39380 5742 6260 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705062.1 protein_id gnl|my_center|LOCUS_39380 6257 6427 gene locus_tag LOCUS_39390 6257 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 6690 7016 gene locus_tag LOCUS_39400 6690 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 7006 7218 gene locus_tag LOCUS_39410 7006 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681036.1 protein_id gnl|my_center|LOCUS_39410 8332 7955 gene locus_tag LOCUS_39420 8332 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 8940 8329 gene locus_tag LOCUS_39430 8940 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 >Feature sequence043 540 322 gene locus_tag LOCUS_39440 540 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 711 1016 gene locus_tag LOCUS_39450 711 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 1159 956 gene locus_tag LOCUS_39460 1159 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 1136 1408 gene locus_tag LOCUS_39470 1136 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39470 1473 1913 gene locus_tag LOCUS_39480 1473 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 2071 2652 gene locus_tag LOCUS_39490 gene abaI 2071 2652 CDS product acyl-homoserine-lactone synthase AbaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208102.1 protein_id gnl|my_center|LOCUS_39490 2714 3484 gene locus_tag LOCUS_39500 2714 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147333463.1 protein_id gnl|my_center|LOCUS_39500 3493 4287 gene locus_tag LOCUS_39510 3493 4287 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_39510 4320 5513 gene locus_tag LOCUS_39520 4320 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 5620 6357 gene locus_tag LOCUS_39530 5620 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 6425 7225 gene locus_tag LOCUS_39540 6425 7225 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269372.1 protein_id gnl|my_center|LOCUS_39540 7256 7453 gene locus_tag LOCUS_39550 7256 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 7455 7838 gene locus_tag LOCUS_39560 7455 7838 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808978.1 protein_id gnl|my_center|LOCUS_39560 7832 8668 gene locus_tag LOCUS_39570 7832 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 >Feature sequence044 647 417 gene locus_tag LOCUS_39580 647 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200389847.1 protein_id gnl|my_center|LOCUS_39580 837 1103 gene locus_tag LOCUS_39590 837 1103 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927120.1 protein_id gnl|my_center|LOCUS_39590 1538 1897 gene locus_tag LOCUS_39600 1538 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 1894 2223 gene locus_tag LOCUS_39610 1894 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 2476 2952 gene locus_tag LOCUS_39620 gene ssb 2476 2952 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444870.1 protein_id gnl|my_center|LOCUS_39620 3554 5815 gene locus_tag LOCUS_39630 3554 5815 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090828103.1 protein_id gnl|my_center|LOCUS_39630 6309 5875 gene locus_tag LOCUS_39640 6309 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 6323 7117 gene locus_tag LOCUS_39650 6323 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 7307 7969 gene locus_tag LOCUS_39660 7307 7969 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086626.1 protein_id gnl|my_center|LOCUS_39660 8242 8057 gene locus_tag LOCUS_39670 8242 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 >Feature sequence045 <1 836 gene locus_tag LOCUS_39680 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003859582.1:HAD-IIA family hydrolase 963 1367 gene locus_tag LOCUS_39690 963 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 1447 1698 gene locus_tag LOCUS_39700 1447 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 1646 2569 gene locus_tag LOCUS_39710 1646 2569 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083703.1 protein_id gnl|my_center|LOCUS_39710 2745 3530 gene locus_tag LOCUS_39720 2745 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 3527 5041 gene locus_tag LOCUS_39730 3527 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 5689 5306 gene locus_tag LOCUS_39740 5689 5306 CDS product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810229.1 protein_id gnl|my_center|LOCUS_39740 5831 6100 gene locus_tag LOCUS_39750 5831 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 7180 6446 gene locus_tag LOCUS_39760 7180 6446 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_39760 7435 7653 gene locus_tag LOCUS_39770 7435 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 8122 7805 gene locus_tag LOCUS_39780 8122 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 >Feature sequence046 3174 2110 gene locus_tag LOCUS_39790 gene vmeY 3174 2110 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 protein_id gnl|my_center|LOCUS_39790 3679 5520 gene locus_tag LOCUS_39800 3679 5520 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_39800 5711 5784 gene locus_tag LOCUS_t00480 5711 5784 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5901 6980 gene locus_tag LOCUS_39810 gene mutY 5901 6980 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707498.1 protein_id gnl|my_center|LOCUS_39810 6977 7249 gene locus_tag LOCUS_39820 6977 7249 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_39820 >Feature sequence047 357 127 gene locus_tag LOCUS_39830 357 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200389847.1 protein_id gnl|my_center|LOCUS_39830 697 1587 gene locus_tag LOCUS_39840 697 1587 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143505.1 protein_id gnl|my_center|LOCUS_39840 2477 1710 gene locus_tag LOCUS_39850 2477 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39850 3550 2474 gene locus_tag LOCUS_39860 3550 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39860 4015 3557 gene locus_tag LOCUS_39870 4015 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39870 5433 4516 gene locus_tag LOCUS_39880 5433 4516 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017275914.1 protein_id gnl|my_center|LOCUS_39880 5609 5998 gene locus_tag LOCUS_39890 5609 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 6218 6436 gene locus_tag LOCUS_39900 6218 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 >Feature sequence048 <1 575 gene locus_tag LOCUS_39910 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014748796.1:ISL3 family transposase 3219 2203 gene locus_tag LOCUS_39920 3219 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 3843 3502 gene locus_tag LOCUS_39930 3843 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 5055 5483 gene locus_tag LOCUS_39940 5055 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39940 5539 5871 gene locus_tag LOCUS_39950 5539 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 <6516 5972 gene locus_tag LOCUS_39960 <6516 5972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259341.1:Ig-like domain-containing protein >Feature sequence049 <1 888 gene locus_tag LOCUS_39970 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014748796.1:ISL3 family transposase 1302 979 gene locus_tag LOCUS_39980 1302 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 2196 1717 gene locus_tag LOCUS_39990 2196 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 4265 2487 gene locus_tag LOCUS_40000 4265 2487 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_40000 4999 4340 gene locus_tag LOCUS_40010 4999 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 5114 5788 gene locus_tag LOCUS_40020 5114 5788 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150092553.1 protein_id gnl|my_center|LOCUS_40020 >Feature sequence050 316 2061 gene locus_tag LOCUS_40030 316 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 2343 4007 gene locus_tag LOCUS_40040 2343 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 4131 4316 gene locus_tag LOCUS_40050 4131 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 4430 4717 gene locus_tag LOCUS_40060 4430 4717 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_40060 4695 4910 gene locus_tag LOCUS_40070 4695 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 >Feature sequence051 844 452 gene locus_tag LOCUS_40080 844 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 1231 1557 gene locus_tag LOCUS_40090 1231 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 1865 2107 gene locus_tag LOCUS_40100 1865 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 2347 3309 gene locus_tag LOCUS_40110 2347 3309 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_40110 3874 3473 gene locus_tag LOCUS_40120 3874 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 4227 3967 gene locus_tag LOCUS_40130 4227 3967 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_40130 4474 4220 gene locus_tag LOCUS_40140 4474 4220 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388730.1 protein_id gnl|my_center|LOCUS_40140 >Feature sequence052 498 211 gene locus_tag LOCUS_40150 498 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 1432 1193 gene locus_tag LOCUS_40160 1432 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40160 1811 1524 gene locus_tag LOCUS_40170 1811 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40170 2274 1999 gene locus_tag LOCUS_40180 2274 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40180 2570 2412 gene locus_tag LOCUS_40190 2570 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 2615 2953 gene locus_tag LOCUS_40200 2615 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 2950 3303 gene locus_tag LOCUS_40210 gene tnpB 2950 3303 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_40210 3520 3738 gene locus_tag LOCUS_40220 3520 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 3781 4104 gene locus_tag LOCUS_40230 3781 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 4140 4433 gene locus_tag LOCUS_40240 4140 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40240 4430 5428 gene locus_tag LOCUS_40250 4430 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40250 >Feature sequence053 1137 1340 gene locus_tag LOCUS_40260 1137 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 1337 1567 gene locus_tag LOCUS_40270 1337 1567 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141125.1 protein_id gnl|my_center|LOCUS_40270 4004 1776 gene locus_tag LOCUS_40280 4004 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 4078 4230 gene locus_tag LOCUS_40290 4078 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 >Feature sequence054 563 351 gene locus_tag LOCUS_40300 563 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 769 566 gene locus_tag LOCUS_40310 769 566 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_40310 1258 890 gene locus_tag LOCUS_40320 1258 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 2256 1474 gene locus_tag LOCUS_40330 2256 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 2651 2439 gene locus_tag LOCUS_40340 2651 2439 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_40340 3239 2952 gene locus_tag LOCUS_40350 3239 2952 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_40350 >Feature sequence055 542 312 gene locus_tag LOCUS_40360 542 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200389847.1 protein_id gnl|my_center|LOCUS_40360 925 1155 gene locus_tag LOCUS_40370 925 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 1639 1818 gene locus_tag LOCUS_40380 1639 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 2395 3546 gene locus_tag LOCUS_40390 gene murA 2395 3546 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836719.1 protein_id gnl|my_center|LOCUS_40390 >Feature sequence056 29 352 gene locus_tag LOCUS_40400 29 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 371 703 gene locus_tag LOCUS_40410 371 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 843 2915 gene locus_tag LOCUS_40420 843 2915 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967414.1 protein_id gnl|my_center|LOCUS_40420 2919 3947 gene locus_tag LOCUS_40430 2919 3947 CDS product reverse transcriptase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222838200.1 protein_id gnl|my_center|LOCUS_40430 4206 4865 gene locus_tag LOCUS_40440 4206 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 5035 5613 gene locus_tag LOCUS_40450 5035 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40450 5553 6305 gene locus_tag LOCUS_40460 5553 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 >Feature sequence057 274 1125 gene locus_tag LOCUS_40470 274 1125 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838536.1 protein_id gnl|my_center|LOCUS_40470 1878 1997 gene locus_tag LOCUS_40480 1878 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 3279 3148 gene locus_tag LOCUS_40490 3279 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 3448 3305 gene locus_tag LOCUS_40500 3448 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 >Feature sequence058 131 583 gene locus_tag LOCUS_40510 131 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 1051 1323 gene locus_tag LOCUS_40520 1051 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 1310 1756 gene locus_tag LOCUS_40530 1310 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 3215 1785 gene locus_tag LOCUS_40540 3215 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 3581 3799 gene locus_tag LOCUS_40550 3581 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 >Feature sequence059 >Feature sequence060 541 819 gene locus_tag LOCUS_40560 541 819 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_40560 832 1137 gene locus_tag LOCUS_40570 832 1137 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_40570 1884 2915 gene locus_tag LOCUS_40580 1884 2915 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220240.1 protein_id gnl|my_center|LOCUS_40580 >Feature sequence061 2639 3055 gene locus_tag LOCUS_40590 2639 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 >Feature sequence062 >Feature sequence063 1 246 gene locus_tag LOCUS_40600 1 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 675 457 gene locus_tag LOCUS_40610 675 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 2173 2445 gene locus_tag LOCUS_40620 2173 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 >Feature sequence064 1995 265 gene locus_tag LOCUS_40630 1995 265 CDS product IS1182-like element ISCc5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918162.1 protein_id gnl|my_center|LOCUS_40630 >Feature sequence065 1005 1253 gene locus_tag LOCUS_40640 1005 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 >Feature sequence066 974 744 gene locus_tag LOCUS_40650 974 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200389847.1 protein_id gnl|my_center|LOCUS_40650 1496 1972 gene locus_tag LOCUS_40660 1496 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 2166 2384 gene locus_tag LOCUS_40670 2166 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 >Feature sequence067 1482 1342 gene locus_tag LOCUS_40680 1482 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 1444 1644 gene locus_tag LOCUS_40690 1444 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 1956 1726 gene locus_tag LOCUS_40700 1956 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200389847.1 protein_id gnl|my_center|LOCUS_40700 >Feature sequence068 <1 531 gene locus_tag LOCUS_40710 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein >Feature sequence069 390 211 gene locus_tag LOCUS_40720 390 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 1698 781 gene locus_tag LOCUS_40730 1698 781 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017275914.1 protein_id gnl|my_center|LOCUS_40730 >Feature sequence070 321 103 gene locus_tag LOCUS_40740 321 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 1268 1414 gene locus_tag LOCUS_40750 1268 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 1557 1775 gene locus_tag LOCUS_40760 1557 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 >Feature sequence071 >Feature sequence072 >Feature sequence073 233 3 gene locus_tag LOCUS_40770 233 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200389847.1 protein_id gnl|my_center|LOCUS_40770 1349 612 gene locus_tag LOCUS_40780 1349 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 >Feature sequence074 >Feature sequence075 126 1325 gene locus_tag LOCUS_40790 126 1325 CDS product IS4-like element IS1481A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035386.1 protein_id gnl|my_center|LOCUS_40790 >Feature sequence076 >Feature sequence077 >Feature sequence078 >Feature sequence079 >Feature sequence080 >Feature sequence081 >Feature sequence082 >Feature sequence083 652 422 gene locus_tag LOCUS_40800 652 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200389847.1 protein_id gnl|my_center|LOCUS_40800 >Feature sequence084 >Feature sequence085 >Feature sequence086 >Feature sequence087 >Feature sequence088 >Feature sequence089 >Feature sequence090 55 192 gene locus_tag LOCUS_40810 55 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 >Feature sequence091 >Feature sequence092 >Feature sequence093 >Feature sequence094 537 244 gene locus_tag LOCUS_40820 537 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 >Feature sequence095 >Feature sequence096 >Feature sequence097 >Feature sequence098 >Feature sequence099 217 447 gene locus_tag LOCUS_40830 217 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200389847.1 protein_id gnl|my_center|LOCUS_40830 >Feature sequence100 >Feature sequence101 >Feature sequence102 >Feature sequence103 >Feature sequence104 >Feature sequence105 >Feature sequence106 >Feature sequence107 >Feature sequence108 >Feature sequence109 >Feature sequence110 >Feature sequence111 290 30 gene locus_tag LOCUS_40840 290 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 >Feature sequence112 >Feature sequence113 >Feature sequence114