>Feature sequence001 538 1314 gene locus_tag LOCUS_00010 538 1314 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241770.1 protein_id gnl|my_center|LOCUS_00010 1293 2117 gene locus_tag LOCUS_00020 1293 2117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399677.1 protein_id gnl|my_center|LOCUS_00020 >Feature sequence002 <1 592 gene locus_tag LOCUS_00030 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_113850176.1:DEAD/DEAH box helicase >Feature sequence003 >Feature sequence004 >Feature sequence005 >Feature sequence006 >Feature sequence007 >Feature sequence008 >Feature sequence009 >Feature sequence010 204 374 gene locus_tag LOCUS_00040 204 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 >Feature sequence011 585 734 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence012 >Feature sequence013 178 372 gene locus_tag LOCUS_00050 178 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 526 1203 gene locus_tag LOCUS_00060 526 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 1227 1535 gene locus_tag LOCUS_00070 1227 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 3347 1590 gene locus_tag LOCUS_00080 3347 1590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254194.1 protein_id gnl|my_center|LOCUS_00080 5074 3347 gene locus_tag LOCUS_00090 5074 3347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254193.1 protein_id gnl|my_center|LOCUS_00090 5535 5071 gene locus_tag LOCUS_00100 5535 5071 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701464.1 protein_id gnl|my_center|LOCUS_00100 >Feature sequence014 <1373 317 gene locus_tag LOCUS_00110 <1373 317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989988.1:cysteine desulfurase >Feature sequence015 >Feature sequence016 >Feature sequence017 >Feature sequence018 >Feature sequence019 >Feature sequence020 >Feature sequence021 >Feature sequence022 >Feature sequence023 >Feature sequence024 >Feature sequence025 >Feature sequence026 >Feature sequence027 >Feature sequence028 >Feature sequence029 >Feature sequence030 >Feature sequence031 234 242 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence032 >Feature sequence033 >Feature sequence034 >Feature sequence035 >Feature sequence036 >Feature sequence037 >Feature sequence038 >Feature sequence039 >Feature sequence040 >Feature sequence041 >Feature sequence042 1471 623 gene locus_tag LOCUS_00120 gene accD 1471 623 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025022359.1 protein_id gnl|my_center|LOCUS_00120 2840 1458 gene locus_tag LOCUS_00130 gene accC 2840 1458 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475767.1 protein_id gnl|my_center|LOCUS_00130 3276 2842 gene locus_tag LOCUS_00140 gene fabZ 3276 2842 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699740.1 protein_id gnl|my_center|LOCUS_00140 3751 3278 gene locus_tag LOCUS_00150 gene accB 3751 3278 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707112.1 protein_id gnl|my_center|LOCUS_00150 >Feature sequence043 >Feature sequence044 >Feature sequence045 >Feature sequence046 696 175 gene locus_tag LOCUS_00160 696 175 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549693.1 protein_id gnl|my_center|LOCUS_00160 866 1585 gene locus_tag LOCUS_00170 gene rsmG 866 1585 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_00170 1604 2428 gene locus_tag LOCUS_00180 gene noc 1604 2428 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254588.1 protein_id gnl|my_center|LOCUS_00180 2430 3209 gene locus_tag LOCUS_00190 2430 3209 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 protein_id gnl|my_center|LOCUS_00190 >Feature sequence047 >Feature sequence048 >Feature sequence049 <1 946 gene locus_tag LOCUS_00200 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254144.1:DNA mismatch repair protein MutS >Feature sequence050 2000 594 gene locus_tag LOCUS_00210 2000 594 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086774.1 protein_id gnl|my_center|LOCUS_00210 2923 2189 gene locus_tag LOCUS_00220 2923 2189 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547578.1 protein_id gnl|my_center|LOCUS_00220 >Feature sequence051 435 130 gene locus_tag LOCUS_00230 435 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389409.1 protein_id gnl|my_center|LOCUS_00230 1540 773 gene locus_tag LOCUS_00240 gene fetB 1540 773 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254483.1 protein_id gnl|my_center|LOCUS_00240 2175 1537 gene locus_tag LOCUS_00250 2175 1537 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548243.1 protein_id gnl|my_center|LOCUS_00250 2497 2291 gene locus_tag LOCUS_00260 2497 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00260 3139 2516 gene locus_tag LOCUS_00270 3139 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00270 3238 4050 gene locus_tag LOCUS_00280 3238 4050 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254202.1 protein_id gnl|my_center|LOCUS_00280 4127 4294 gene locus_tag LOCUS_00290 4127 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 4476 4402 gene locus_tag LOCUS_t00010 4476 4402 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4732 4571 gene locus_tag LOCUS_00300 4732 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 5135 5063 gene locus_tag LOCUS_t00020 5135 5063 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5451 5227 gene locus_tag LOCUS_00310 5451 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 5598 6122 gene locus_tag LOCUS_00320 5598 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00320 6236 6754 gene locus_tag LOCUS_00330 6236 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00330 6953 7312 gene locus_tag LOCUS_00340 6953 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 <8082 7379 gene locus_tag LOCUS_00350 <8082 7379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549341.1:replicative DNA helicase >Feature sequence052 >Feature sequence053 263 706 gene locus_tag LOCUS_00360 263 706 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549083.1 protein_id gnl|my_center|LOCUS_00360 693 1445 gene locus_tag LOCUS_00370 gene rlmB 693 1445 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254123.1 protein_id gnl|my_center|LOCUS_00370 >Feature sequence054 3310 521 gene locus_tag LOCUS_00380 3310 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 4520 3573 gene locus_tag LOCUS_00390 4520 3573 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254020.1 protein_id gnl|my_center|LOCUS_00390 <5093 4561 gene locus_tag LOCUS_00400 <5093 4561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549080.1:DNA repair protein RadA >Feature sequence055 1817 1005 gene locus_tag LOCUS_00410 1817 1005 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546636.1 protein_id gnl|my_center|LOCUS_00410 3271 1919 gene locus_tag LOCUS_00420 gene glmM 3271 1919 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546635.1 protein_id gnl|my_center|LOCUS_00420 4248 3298 gene locus_tag LOCUS_00430 4248 3298 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546633.1 protein_id gnl|my_center|LOCUS_00430 >Feature sequence056 >Feature sequence057 207 374 gene locus_tag LOCUS_00440 207 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 >Feature sequence058 >Feature sequence059 1 852 gene locus_tag LOCUS_00450 1 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 1558 902 gene locus_tag LOCUS_00460 1558 902 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549496.1 protein_id gnl|my_center|LOCUS_00460 >Feature sequence060 1088 354 gene locus_tag LOCUS_00470 1088 354 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286317.1 protein_id gnl|my_center|LOCUS_00470 2305 1226 gene locus_tag LOCUS_00480 gene rpoD 2305 1226 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254377.1 protein_id gnl|my_center|LOCUS_00480 3520 2399 gene locus_tag LOCUS_00490 gene rpoD 3520 2399 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254377.1 protein_id gnl|my_center|LOCUS_00490 4686 3568 gene locus_tag LOCUS_00500 gene rpoD 4686 3568 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254377.1 protein_id gnl|my_center|LOCUS_00500 5086 4655 gene locus_tag LOCUS_00510 5086 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 >Feature sequence061 <1 564 gene locus_tag LOCUS_00520 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254281.1:PTS sugar transporter subunit IIC 607 1989 gene locus_tag LOCUS_00530 607 1989 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102004.1 protein_id gnl|my_center|LOCUS_00530 2924 2151 gene locus_tag LOCUS_00540 gene proC 2924 2151 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922105.1 protein_id gnl|my_center|LOCUS_00540 >Feature sequence062 >Feature sequence063 36 203 gene locus_tag LOCUS_00550 36 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 >Feature sequence064 <1 1052 gene locus_tag LOCUS_00560 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836742.1:accessory Sec system protein translocase subunit SecY2 1071 2633 gene locus_tag LOCUS_00570 gene asp1 1071 2633 CDS product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468347.1 protein_id gnl|my_center|LOCUS_00570 2634 4187 gene locus_tag LOCUS_00580 gene asp2 2634 4187 CDS product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836744.1 protein_id gnl|my_center|LOCUS_00580 4191 4808 gene locus_tag LOCUS_00590 4191 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 4814 7201 gene locus_tag LOCUS_00600 gene secA2 4814 7201 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836745.1 protein_id gnl|my_center|LOCUS_00600 7194 7403 gene locus_tag LOCUS_00610 7194 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 7414 8922 gene locus_tag LOCUS_00620 gene gtfA 7414 8922 CDS product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437882.1 protein_id gnl|my_center|LOCUS_00620 8915 10258 gene locus_tag LOCUS_00630 gene gtfB 8915 10258 CDS product accessory Sec system glycosylation chaperone GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571763.1 protein_id gnl|my_center|LOCUS_00630 >Feature sequence065 1112 1930 gene locus_tag LOCUS_00640 1112 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 >Feature sequence066 >Feature sequence067 695 150 gene locus_tag LOCUS_00650 695 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254564.1 protein_id gnl|my_center|LOCUS_00650 922 725 gene locus_tag LOCUS_00660 922 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 1205 1011 gene locus_tag LOCUS_00670 1205 1011 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982695.1 protein_id gnl|my_center|LOCUS_00670 1705 1208 gene locus_tag LOCUS_00680 1705 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 1879 2316 gene locus_tag LOCUS_00690 1879 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 2442 2876 gene locus_tag LOCUS_00700 2442 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 3585 2932 gene locus_tag LOCUS_00710 3585 2932 CDS product HXXEE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120095.1 protein_id gnl|my_center|LOCUS_00710 4251 3610 gene locus_tag LOCUS_00720 4251 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 4361 4948 gene locus_tag LOCUS_00730 4361 4948 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009986.1 protein_id gnl|my_center|LOCUS_00730 5319 5110 gene locus_tag LOCUS_00740 5319 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00740 5597 5319 gene locus_tag LOCUS_00750 5597 5319 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548066.1 protein_id gnl|my_center|LOCUS_00750 6366 5875 gene locus_tag LOCUS_00760 6366 5875 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549820.1 protein_id gnl|my_center|LOCUS_00760 7082 6369 gene locus_tag LOCUS_00770 7082 6369 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549818.1 protein_id gnl|my_center|LOCUS_00770 8719 7175 gene locus_tag LOCUS_00780 8719 7175 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549817.1 protein_id gnl|my_center|LOCUS_00780 9111 8734 gene locus_tag LOCUS_00790 9111 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 9950 9231 gene locus_tag LOCUS_00800 9950 9231 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254200.1 protein_id gnl|my_center|LOCUS_00800 11197 9995 gene locus_tag LOCUS_00810 11197 9995 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613327.1 protein_id gnl|my_center|LOCUS_00810 >Feature sequence068 3032 774 gene locus_tag LOCUS_00820 gene pcrA 3032 774 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546275.1 protein_id gnl|my_center|LOCUS_00820 3765 3112 gene locus_tag LOCUS_00830 3765 3112 CDS product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546273.1 protein_id gnl|my_center|LOCUS_00830 4396 3779 gene locus_tag LOCUS_00840 4396 3779 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254627.1 protein_id gnl|my_center|LOCUS_00840 4600 4514 gene locus_tag LOCUS_t00030 4600 4514 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence069 >Feature sequence070 747 190 gene locus_tag LOCUS_00850 747 190 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546513.1 protein_id gnl|my_center|LOCUS_00850 1912 740 gene locus_tag LOCUS_00860 1912 740 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546511.1 protein_id gnl|my_center|LOCUS_00860 2302 1922 gene locus_tag LOCUS_00870 2302 1922 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546509.1 protein_id gnl|my_center|LOCUS_00870 2467 3477 gene locus_tag LOCUS_00880 2467 3477 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546505.1 protein_id gnl|my_center|LOCUS_00880 3488 4327 gene locus_tag LOCUS_00890 3488 4327 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645539.1 protein_id gnl|my_center|LOCUS_00890 4401 4589 gene locus_tag LOCUS_00900 4401 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 <5430 4664 gene locus_tag LOCUS_00910 <5430 4664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546500.1:RluA family pseudouridine synthase >Feature sequence071 >Feature sequence072 1471 422 gene locus_tag LOCUS_00920 1471 422 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550128.1 protein_id gnl|my_center|LOCUS_00920 2633 1464 gene locus_tag LOCUS_00930 2633 1464 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550126.1 protein_id gnl|my_center|LOCUS_00930 2832 2748 gene locus_tag LOCUS_t00040 2832 2748 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2935 2849 gene locus_tag LOCUS_t00050 2935 2849 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence073 1140 643 gene locus_tag LOCUS_00940 1140 643 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550097.1 protein_id gnl|my_center|LOCUS_00940 1736 1140 gene locus_tag LOCUS_00950 1736 1140 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550094.1 protein_id gnl|my_center|LOCUS_00950 >Feature sequence074 >Feature sequence075 <2160 1353 gene locus_tag LOCUS_00960 <2160 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547066.1:bifunctional UDP-sugar hydrolase/5'-nucleotidase >Feature sequence076 219 494 gene locus_tag LOCUS_00970 gene yidD 219 494 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564982.1 protein_id gnl|my_center|LOCUS_00970 507 734 gene locus_tag LOCUS_00980 507 734 CDS product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546751.1 protein_id gnl|my_center|LOCUS_00980 759 1949 gene locus_tag LOCUS_00990 759 1949 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546752.1 protein_id gnl|my_center|LOCUS_00990 2665 2018 gene locus_tag LOCUS_01000 2665 2018 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475595.1 protein_id gnl|my_center|LOCUS_01000 <3662 2671 gene locus_tag LOCUS_01010 <3662 2671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475594.1:ABC transporter permease >Feature sequence077 1486 968 gene locus_tag LOCUS_01020 1486 968 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583259.1 protein_id gnl|my_center|LOCUS_01020 3190 1787 gene locus_tag LOCUS_01030 3190 1787 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965834.1 protein_id gnl|my_center|LOCUS_01030 <3931 3370 gene locus_tag LOCUS_01040 <3931 3370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254594.1:peroxide stress protein YaaA >Feature sequence078 448 855 gene locus_tag LOCUS_01050 448 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 953 1585 gene locus_tag LOCUS_01060 gene cmk 953 1585 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_01060 1672 2877 gene locus_tag LOCUS_01070 gene rpsA 1672 2877 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547091.1 protein_id gnl|my_center|LOCUS_01070 2989 4296 gene locus_tag LOCUS_01080 gene der 2989 4296 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254303.1 protein_id gnl|my_center|LOCUS_01080 4500 4775 gene locus_tag LOCUS_01090 4500 4775 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547110.1 protein_id gnl|my_center|LOCUS_01090 4901 6154 gene locus_tag LOCUS_01100 4901 6154 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547113.1 protein_id gnl|my_center|LOCUS_01100 6277 9150 gene locus_tag LOCUS_01110 6277 9150 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476245.1 protein_id gnl|my_center|LOCUS_01110 10143 9208 gene locus_tag LOCUS_01120 10143 9208 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645746.1 protein_id gnl|my_center|LOCUS_01120 10513 11418 gene locus_tag LOCUS_01130 10513 11418 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102188.1 protein_id gnl|my_center|LOCUS_01130 12090 11404 gene locus_tag LOCUS_01140 12090 11404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 >Feature sequence079 >Feature sequence080 >Feature sequence081 1392 373 gene locus_tag LOCUS_01150 1392 373 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475456.1 protein_id gnl|my_center|LOCUS_01150 2243 1548 gene locus_tag LOCUS_01160 gene rplA 2243 1548 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549096.1 protein_id gnl|my_center|LOCUS_01160 2669 2325 gene locus_tag LOCUS_01170 gene rplK 2669 2325 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549095.1 protein_id gnl|my_center|LOCUS_01170 3427 2873 gene locus_tag LOCUS_01180 gene nusG 3427 2873 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549094.1 protein_id gnl|my_center|LOCUS_01180 3686 3516 gene locus_tag LOCUS_01190 gene secE 3686 3516 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549093.1 protein_id gnl|my_center|LOCUS_01190 3842 3693 gene locus_tag LOCUS_01200 gene rpmG 3842 3693 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549092.1 protein_id gnl|my_center|LOCUS_01200 >Feature sequence082 <1 926 gene locus_tag LOCUS_01210 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549477.1:ABC transporter permease >Feature sequence083 >Feature sequence084 544 47 gene locus_tag LOCUS_01220 544 47 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546424.1 protein_id gnl|my_center|LOCUS_01220 1456 659 gene locus_tag LOCUS_01230 1456 659 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254200.1 protein_id gnl|my_center|LOCUS_01230 2124 1465 gene locus_tag LOCUS_01240 2124 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 2942 2754 gene locus_tag LOCUS_01250 2942 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 4039 3020 gene locus_tag LOCUS_01260 4039 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 4853 4179 gene locus_tag LOCUS_01270 4853 4179 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254590.1 protein_id gnl|my_center|LOCUS_01270 >Feature sequence085 >Feature sequence086 <1 960 gene locus_tag LOCUS_01280 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003643977.1:amino acid ABC transporter substrate-binding protein/permease 980 1726 gene locus_tag LOCUS_01290 980 1726 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699922.1 protein_id gnl|my_center|LOCUS_01290 >Feature sequence087 >Feature sequence088 749 456 gene locus_tag LOCUS_01300 gene rpsF 749 456 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549370.1 protein_id gnl|my_center|LOCUS_01300 >Feature sequence089 >Feature sequence090 <1 2008 gene locus_tag LOCUS_01310 <1 2008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546517.1:DNA translocase FtsK >Feature sequence091 486 1574 gene locus_tag LOCUS_01320 486 1574 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548727.1 protein_id gnl|my_center|LOCUS_01320 >Feature sequence092 >Feature sequence093 <1211 543 gene locus_tag LOCUS_01330 <1211 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549287.1:AI-2E family transporter >Feature sequence094 270 1556 gene locus_tag LOCUS_01340 gene pepT 270 1556 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548288.1 protein_id gnl|my_center|LOCUS_01340 1669 2697 gene locus_tag LOCUS_01350 gene dusB 1669 2697 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254106.1 protein_id gnl|my_center|LOCUS_01350 2714 4237 gene locus_tag LOCUS_01360 gene lysS 2714 4237 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254107.1 protein_id gnl|my_center|LOCUS_01360 >Feature sequence095 1528 539 gene locus_tag LOCUS_01370 1528 539 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896952.1 protein_id gnl|my_center|LOCUS_01370 1639 2535 gene locus_tag LOCUS_01380 1639 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 >Feature sequence096 >Feature sequence097 1590 1324 gene locus_tag LOCUS_01390 1590 1324 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 protein_id gnl|my_center|LOCUS_01390 1898 1698 gene locus_tag LOCUS_01400 1898 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 >Feature sequence098 398 189 gene locus_tag LOCUS_01410 398 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 >Feature sequence099 <1 665 gene locus_tag LOCUS_01420 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003641795.1:phosphoglycerate dehydrogenase 1613 732 gene locus_tag LOCUS_01430 1613 732 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254353.1 protein_id gnl|my_center|LOCUS_01430 1795 3486 gene locus_tag LOCUS_01440 1795 3486 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547519.1 protein_id gnl|my_center|LOCUS_01440 >Feature sequence100 >Feature sequence101 >Feature sequence102 >Feature sequence103 441 962 gene locus_tag LOCUS_01450 441 962 CDS product amino acid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644492.1 protein_id gnl|my_center|LOCUS_01450 989 2269 gene locus_tag LOCUS_01460 gene aroA 989 2269 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644491.1 protein_id gnl|my_center|LOCUS_01460 2304 3389 gene locus_tag LOCUS_01470 2304 3389 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644490.1 protein_id gnl|my_center|LOCUS_01470 4368 3451 gene locus_tag LOCUS_01480 4368 3451 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254505.1 protein_id gnl|my_center|LOCUS_01480 5117 4494 gene locus_tag LOCUS_01490 gene pyrE 5117 4494 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548040.1 protein_id gnl|my_center|LOCUS_01490 >Feature sequence104 3083 1137 gene locus_tag LOCUS_01500 3083 1137 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475494.1 protein_id gnl|my_center|LOCUS_01500 3356 4813 gene locus_tag LOCUS_01510 3356 4813 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549147.1 protein_id gnl|my_center|LOCUS_01510 >Feature sequence105 802 1761 gene locus_tag LOCUS_01520 gene pfkA 802 1761 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547070.1 protein_id gnl|my_center|LOCUS_01520 1801 3570 gene locus_tag LOCUS_01530 gene pyk 1801 3570 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547072.1 protein_id gnl|my_center|LOCUS_01530 4583 3861 gene locus_tag LOCUS_01540 gene ssuB 4583 3861 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704897.1 protein_id gnl|my_center|LOCUS_01540 5378 4596 gene locus_tag LOCUS_01550 5378 4596 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674904.1 protein_id gnl|my_center|LOCUS_01550 6374 5394 gene locus_tag LOCUS_01560 6374 5394 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567455.1 protein_id gnl|my_center|LOCUS_01560 7914 6382 gene locus_tag LOCUS_01570 7914 6382 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674903.1 protein_id gnl|my_center|LOCUS_01570 9083 7911 gene locus_tag LOCUS_01580 9083 7911 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596134.1 protein_id gnl|my_center|LOCUS_01580 9272 10150 gene locus_tag LOCUS_01590 9272 10150 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254300.1 protein_id gnl|my_center|LOCUS_01590 10143 11039 gene locus_tag LOCUS_01600 gene xerD 10143 11039 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547075.1 protein_id gnl|my_center|LOCUS_01600 11036 11413 gene locus_tag LOCUS_01610 11036 11413 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254301.1 protein_id gnl|my_center|LOCUS_01610 11415 12134 gene locus_tag LOCUS_01620 11415 12134 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547078.1 protein_id gnl|my_center|LOCUS_01620 12124 12726 gene locus_tag LOCUS_01630 gene scpB 12124 12726 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547080.1 protein_id gnl|my_center|LOCUS_01630 12726 13442 gene locus_tag LOCUS_01640 12726 13442 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547082.1 protein_id gnl|my_center|LOCUS_01640 >Feature sequence106 1626 31 gene locus_tag LOCUS_01650 1626 31 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_01650 3337 1619 gene locus_tag LOCUS_01660 3337 1619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_01660 3738 4349 gene locus_tag LOCUS_01670 3738 4349 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692076.1 protein_id gnl|my_center|LOCUS_01670 4794 4573 gene locus_tag LOCUS_01680 4794 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 5824 4904 gene locus_tag LOCUS_01690 5824 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 6333 5902 gene locus_tag LOCUS_01700 6333 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 6893 6357 gene locus_tag LOCUS_01710 6893 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 7416 6886 gene locus_tag LOCUS_01720 7416 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 8106 7795 gene locus_tag LOCUS_01730 8106 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 8788 8129 gene locus_tag LOCUS_01740 8788 8129 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_01740 9209 8781 gene locus_tag LOCUS_01750 9209 8781 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963521.1 protein_id gnl|my_center|LOCUS_01750 9268 9396 gene locus_tag LOCUS_01760 9268 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 10208 9549 gene locus_tag LOCUS_01770 10208 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 10873 10511 gene locus_tag LOCUS_01780 10873 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 <11454 10878 gene locus_tag LOCUS_01790 <11454 10878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963416.1:2-hydroxyacid dehydrogenase >Feature sequence107 735 298 gene locus_tag LOCUS_01800 735 298 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548425.1 protein_id gnl|my_center|LOCUS_01800 840 1580 gene locus_tag LOCUS_01810 840 1580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548423.1 protein_id gnl|my_center|LOCUS_01810 1573 2796 gene locus_tag LOCUS_01820 1573 2796 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613400.1 protein_id gnl|my_center|LOCUS_01820 2871 3530 gene locus_tag LOCUS_01830 gene trmB 2871 3530 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548419.1 protein_id gnl|my_center|LOCUS_01830 3609 3929 gene locus_tag LOCUS_01840 3609 3929 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254504.1 protein_id gnl|my_center|LOCUS_01840 3952 4599 gene locus_tag LOCUS_01850 3952 4599 CDS product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548415.1 protein_id gnl|my_center|LOCUS_01850 4718 6037 gene locus_tag LOCUS_01860 gene murC 4718 6037 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548413.1 protein_id gnl|my_center|LOCUS_01860 6088 6765 gene locus_tag LOCUS_01870 6088 6765 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003606146.1 protein_id gnl|my_center|LOCUS_01870 6771 8105 gene locus_tag LOCUS_01880 6771 8105 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596410.1 protein_id gnl|my_center|LOCUS_01880 8298 8915 gene locus_tag LOCUS_01890 8298 8915 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674972.1 protein_id gnl|my_center|LOCUS_01890 8920 10728 gene locus_tag LOCUS_01900 8920 10728 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254405.1 protein_id gnl|my_center|LOCUS_01900 10729 11559 gene locus_tag LOCUS_01910 10729 11559 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645539.1 protein_id gnl|my_center|LOCUS_01910 >Feature sequence108 244 319 gene locus_tag LOCUS_t00060 244 319 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence109 <1 1033 gene locus_tag LOCUS_01920 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476657.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase 1923 1153 gene locus_tag LOCUS_01930 1923 1153 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964820.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence110 >Feature sequence111 1515 961 gene locus_tag LOCUS_01940 1515 961 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254121.1 protein_id gnl|my_center|LOCUS_01940 1622 1909 gene locus_tag LOCUS_01950 1622 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 1991 3340 gene locus_tag LOCUS_01960 gene pepC 1991 3340 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549077.1 protein_id gnl|my_center|LOCUS_01960 3485 4777 gene locus_tag LOCUS_01970 3485 4777 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254333.1 protein_id gnl|my_center|LOCUS_01970 4758 5036 gene locus_tag LOCUS_01980 4758 5036 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588503.1 protein_id gnl|my_center|LOCUS_01980 6976 5123 gene locus_tag LOCUS_01990 6976 5123 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187364788.1 protein_id gnl|my_center|LOCUS_01990 7258 8868 gene locus_tag LOCUS_02000 7258 8868 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254631.1 protein_id gnl|my_center|LOCUS_02000 8880 9449 gene locus_tag LOCUS_02010 8880 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 >Feature sequence112 156 85 gene locus_tag LOCUS_t00070 156 85 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence113 64 151 gene locus_tag LOCUS_t00080 64 151 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 159 234 gene locus_tag LOCUS_t00090 159 234 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 236 311 gene locus_tag LOCUS_t00100 236 311 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 316 390 gene locus_tag LOCUS_t00110 316 390 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence114 400 969 gene locus_tag LOCUS_02020 400 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02020 903 1586 gene locus_tag LOCUS_02030 903 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02030 1670 2149 gene locus_tag LOCUS_02040 1670 2149 CDS product DUF3955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775247.1 protein_id gnl|my_center|LOCUS_02040 2542 3657 gene locus_tag LOCUS_02050 2542 3657 CDS product vitamin B12 independent methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102105.1 protein_id gnl|my_center|LOCUS_02050 4652 3723 gene locus_tag LOCUS_02060 4652 3723 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549336.1 protein_id gnl|my_center|LOCUS_02060 5276 4734 gene locus_tag LOCUS_02070 5276 4734 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643718.1 protein_id gnl|my_center|LOCUS_02070 5385 6407 gene locus_tag LOCUS_02080 5385 6407 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228883.1 protein_id gnl|my_center|LOCUS_02080 6518 6859 gene locus_tag LOCUS_02090 6518 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 7097 8089 gene locus_tag LOCUS_02100 gene add 7097 8089 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548323.1 protein_id gnl|my_center|LOCUS_02100 9105 8182 gene locus_tag LOCUS_02110 gene cysK 9105 8182 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700922.1 protein_id gnl|my_center|LOCUS_02110 9907 9095 gene locus_tag LOCUS_02120 9907 9095 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476536.1 protein_id gnl|my_center|LOCUS_02120 11588 10212 gene locus_tag LOCUS_02130 11588 10212 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673958.1 protein_id gnl|my_center|LOCUS_02130 14080 11702 gene locus_tag LOCUS_02140 14080 11702 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548011.1 protein_id gnl|my_center|LOCUS_02140 14285 14358 gene locus_tag LOCUS_t00120 14285 14358 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14543 16681 gene locus_tag LOCUS_02150 14543 16681 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222029.1 protein_id gnl|my_center|LOCUS_02150 16873 18189 gene locus_tag LOCUS_02160 16873 18189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 18340 18831 gene locus_tag LOCUS_02170 gene purE 18340 18831 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548377.1 protein_id gnl|my_center|LOCUS_02170 >Feature sequence115 >Feature sequence116 832 431 gene locus_tag LOCUS_02180 gene spxA 832 431 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254213.1 protein_id gnl|my_center|LOCUS_02180 >Feature sequence117 >Feature sequence118 >Feature sequence119 427 536 gene locus_tag LOCUS_r00010 427 536 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 577 648 gene locus_tag LOCUS_t00130 577 648 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 677 752 gene locus_tag LOCUS_t00140 677 752 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 753 827 gene locus_tag LOCUS_t00150 753 827 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 831 902 gene locus_tag LOCUS_t00160 831 902 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 928 1003 gene locus_tag LOCUS_t00170 928 1003 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1208 1582 gene locus_tag LOCUS_02190 1208 1582 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_02190 1569 2474 gene locus_tag LOCUS_02200 1569 2474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_02200 2521 4224 gene locus_tag LOCUS_02210 2521 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 4332 5717 gene locus_tag LOCUS_02220 4332 5717 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102117.1 protein_id gnl|my_center|LOCUS_02220 5930 6790 gene locus_tag LOCUS_02230 5930 6790 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528922.1 protein_id gnl|my_center|LOCUS_02230 6809 7369 gene locus_tag LOCUS_02240 6809 7369 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547026.1 protein_id gnl|my_center|LOCUS_02240 7381 9099 gene locus_tag LOCUS_02250 7381 9099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547024.1 protein_id gnl|my_center|LOCUS_02250 9092 9919 gene locus_tag LOCUS_02260 9092 9919 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547023.1 protein_id gnl|my_center|LOCUS_02260 9953 10132 gene locus_tag LOCUS_02270 9953 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 10116 10331 gene locus_tag LOCUS_02280 10116 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 10324 11718 gene locus_tag LOCUS_02290 10324 11718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 11877 12380 gene locus_tag LOCUS_02300 11877 12380 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869997.1 protein_id gnl|my_center|LOCUS_02300 <14064 12408 gene locus_tag LOCUS_02310 <14064 12408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000180853.1:sensor domain-containing diguanylate cyclase >Feature sequence120 865 101 gene locus_tag LOCUS_02320 865 101 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549277.1 protein_id gnl|my_center|LOCUS_02320 1754 858 gene locus_tag LOCUS_02330 1754 858 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642727.1 protein_id gnl|my_center|LOCUS_02330 2758 1778 gene locus_tag LOCUS_02340 gene trpX 2758 1778 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101821.1 protein_id gnl|my_center|LOCUS_02340 >Feature sequence121 >Feature sequence122 290 940 gene locus_tag LOCUS_02350 290 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549674.1 protein_id gnl|my_center|LOCUS_02350 1035 2246 gene locus_tag LOCUS_02360 1035 2246 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549671.1 protein_id gnl|my_center|LOCUS_02360 2712 2527 gene locus_tag LOCUS_02370 2712 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 3420 2788 gene locus_tag LOCUS_02380 3420 2788 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702509.1 protein_id gnl|my_center|LOCUS_02380 6081 3550 gene locus_tag LOCUS_02390 6081 3550 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549665.1 protein_id gnl|my_center|LOCUS_02390 6374 7129 gene locus_tag LOCUS_02400 6374 7129 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546400.1 protein_id gnl|my_center|LOCUS_02400 7140 7514 gene locus_tag LOCUS_02410 7140 7514 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546398.1 protein_id gnl|my_center|LOCUS_02410 7553 8374 gene locus_tag LOCUS_02420 7553 8374 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101369.1 protein_id gnl|my_center|LOCUS_02420 8647 9219 gene locus_tag LOCUS_02430 8647 9219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 9370 10317 gene locus_tag LOCUS_02440 9370 10317 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547030.1 protein_id gnl|my_center|LOCUS_02440 10592 12124 gene locus_tag LOCUS_02450 10592 12124 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101518.1 protein_id gnl|my_center|LOCUS_02450 13697 12279 gene locus_tag LOCUS_02460 13697 12279 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641299.1 protein_id gnl|my_center|LOCUS_02460 15128 13725 gene locus_tag LOCUS_02470 15128 13725 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546995.1 protein_id gnl|my_center|LOCUS_02470 15801 16718 gene locus_tag LOCUS_02480 15801 16718 CDS product cytochrome C5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549662.1 protein_id gnl|my_center|LOCUS_02480 17012 16773 gene locus_tag LOCUS_02490 17012 16773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 17614 17114 gene locus_tag LOCUS_02500 17614 17114 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038291.1 protein_id gnl|my_center|LOCUS_02500 18396 17614 gene locus_tag LOCUS_02510 18396 17614 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549621.1 protein_id gnl|my_center|LOCUS_02510 19266 18508 gene locus_tag LOCUS_02520 19266 18508 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549621.1 protein_id gnl|my_center|LOCUS_02520 20800 19292 gene locus_tag LOCUS_02530 gene glpK 20800 19292 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549614.1 protein_id gnl|my_center|LOCUS_02530 20996 21664 gene locus_tag LOCUS_02540 20996 21664 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573114.1 protein_id gnl|my_center|LOCUS_02540 21793 22029 gene locus_tag LOCUS_02550 21793 22029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703180.1 protein_id gnl|my_center|LOCUS_02550 22154 24244 gene locus_tag LOCUS_02560 22154 24244 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475490.1 protein_id gnl|my_center|LOCUS_02560 >Feature sequence123 470 399 gene locus_tag LOCUS_t00180 470 399 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 653 578 gene locus_tag LOCUS_t00190 653 578 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 727 656 gene locus_tag LOCUS_t00200 727 656 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 <1954 840 gene locus_tag LOCUS_02570 <1954 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101818.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase >Feature sequence124 1637 462 gene locus_tag LOCUS_02580 1637 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 2432 1704 gene locus_tag LOCUS_02590 2432 1704 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546523.1 protein_id gnl|my_center|LOCUS_02590 <3593 2429 gene locus_tag LOCUS_02600 <3593 2429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546521.1:pitrilysin family protein >Feature sequence125 422 607 gene locus_tag LOCUS_02610 422 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 609 794 gene locus_tag LOCUS_02620 609 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 >Feature sequence126 2118 625 gene locus_tag LOCUS_02630 2118 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 2568 2155 gene locus_tag LOCUS_02640 2568 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 3981 2704 gene locus_tag LOCUS_02650 gene eno 3981 2704 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546959.1 protein_id gnl|my_center|LOCUS_02650 4267 5136 gene locus_tag LOCUS_02660 4267 5136 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546960.1 protein_id gnl|my_center|LOCUS_02660 5811 5224 gene locus_tag LOCUS_02670 5811 5224 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546962.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence127 <1 546 gene locus_tag LOCUS_02680 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006995243.1:ABC transporter ATP-binding protein/permease >Feature sequence128 1631 39 gene locus_tag LOCUS_02690 1631 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 2508 1807 gene locus_tag LOCUS_02700 2508 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 3656 2742 gene locus_tag LOCUS_02710 3656 2742 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775137.1 protein_id gnl|my_center|LOCUS_02710 3792 4916 gene locus_tag LOCUS_02720 3792 4916 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475538.1 protein_id gnl|my_center|LOCUS_02720 5084 6022 gene locus_tag LOCUS_02730 5084 6022 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_02730 6048 6890 gene locus_tag LOCUS_02740 6048 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 8489 7047 gene locus_tag LOCUS_02750 8489 7047 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102053.1 protein_id gnl|my_center|LOCUS_02750 8591 9508 gene locus_tag LOCUS_02760 8591 9508 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102052.1 protein_id gnl|my_center|LOCUS_02760 10503 9580 gene locus_tag LOCUS_02770 10503 9580 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547001.1 protein_id gnl|my_center|LOCUS_02770 <12001 11201 gene locus_tag LOCUS_02780 <12001 11201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288985.1:MFS transporter >Feature sequence129 26 619 gene locus_tag LOCUS_02790 gene ruvA 26 619 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549165.1 protein_id gnl|my_center|LOCUS_02790 635 1645 gene locus_tag LOCUS_02800 gene ruvB 635 1645 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549167.1 protein_id gnl|my_center|LOCUS_02800 >Feature sequence130 >Feature sequence131 694 215 gene locus_tag LOCUS_02810 694 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 >Feature sequence132 451 1290 gene locus_tag LOCUS_02820 gene dprA 451 1290 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547135.1 protein_id gnl|my_center|LOCUS_02820 1418 3598 gene locus_tag LOCUS_02830 gene topA 1418 3598 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547140.1 protein_id gnl|my_center|LOCUS_02830 3739 5058 gene locus_tag LOCUS_02840 gene trmFO 3739 5058 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547141.1 protein_id gnl|my_center|LOCUS_02840 5059 5949 gene locus_tag LOCUS_02850 5059 5949 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547143.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence133 1188 268 gene locus_tag LOCUS_02860 1188 268 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102188.1 protein_id gnl|my_center|LOCUS_02860 1371 2306 gene locus_tag LOCUS_02870 1371 2306 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703273.1 protein_id gnl|my_center|LOCUS_02870 2398 3618 gene locus_tag LOCUS_02880 2398 3618 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704390.1 protein_id gnl|my_center|LOCUS_02880 3646 4404 gene locus_tag LOCUS_02890 gene aroD 3646 4404 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102187.1 protein_id gnl|my_center|LOCUS_02890 4611 4790 gene locus_tag LOCUS_02900 4611 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 6358 4871 gene locus_tag LOCUS_02910 6358 4871 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546937.1 protein_id gnl|my_center|LOCUS_02910 <8235 6495 gene locus_tag LOCUS_02920 <8235 6495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262843.1:beta-glucoside-specific PTS transporter subunit IIABC >Feature sequence134 642 1304 gene locus_tag LOCUS_02930 642 1304 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549467.1 protein_id gnl|my_center|LOCUS_02930 1326 2024 gene locus_tag LOCUS_02940 1326 2024 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549464.1 protein_id gnl|my_center|LOCUS_02940 3535 2162 gene locus_tag LOCUS_02950 3535 2162 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460717.1 protein_id gnl|my_center|LOCUS_02950 3957 3709 gene locus_tag LOCUS_02960 3957 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 6815 4692 gene locus_tag LOCUS_02970 6815 4692 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070650885.1 protein_id gnl|my_center|LOCUS_02970 7170 6976 gene locus_tag LOCUS_02980 7170 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 7337 7957 gene locus_tag LOCUS_02990 gene lexA 7337 7957 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930693.1 protein_id gnl|my_center|LOCUS_02990 >Feature sequence135 577 266 gene locus_tag LOCUS_03000 gene trxA 577 266 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 protein_id gnl|my_center|LOCUS_03000 >Feature sequence136 1759 350 gene locus_tag LOCUS_03010 1759 350 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254152.1 protein_id gnl|my_center|LOCUS_03010 2101 1769 gene locus_tag LOCUS_03020 2101 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613308.1 protein_id gnl|my_center|LOCUS_03020 3209 2208 gene locus_tag LOCUS_03030 3209 2208 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549214.1 protein_id gnl|my_center|LOCUS_03030 3363 4469 gene locus_tag LOCUS_03040 3363 4469 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549213.1 protein_id gnl|my_center|LOCUS_03040 4925 4530 gene locus_tag LOCUS_03050 4925 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549212.1 protein_id gnl|my_center|LOCUS_03050 5367 4942 gene locus_tag LOCUS_03060 5367 4942 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549209.1 protein_id gnl|my_center|LOCUS_03060 5496 6344 gene locus_tag LOCUS_03070 5496 6344 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824481.1 protein_id gnl|my_center|LOCUS_03070 7007 6387 gene locus_tag LOCUS_03080 7007 6387 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549206.1 protein_id gnl|my_center|LOCUS_03080 >Feature sequence137 1386 457 gene locus_tag LOCUS_03090 gene arcC 1386 457 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074342.1 protein_id gnl|my_center|LOCUS_03090 2406 1405 gene locus_tag LOCUS_03100 gene argF 2406 1405 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793622.1 protein_id gnl|my_center|LOCUS_03100 2717 3586 gene locus_tag LOCUS_03110 2717 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 3657 4376 gene locus_tag LOCUS_03120 3657 4376 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837175.1 protein_id gnl|my_center|LOCUS_03120 5040 4435 gene locus_tag LOCUS_03130 5040 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence138 >Feature sequence139 2068 491 gene locus_tag LOCUS_03140 2068 491 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546143.1 protein_id gnl|my_center|LOCUS_03140 <3071 2231 gene locus_tag LOCUS_03150 <3071 2231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546997.1:flavocytochrome c >Feature sequence140 1867 662 gene locus_tag LOCUS_03160 1867 662 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548436.1 protein_id gnl|my_center|LOCUS_03160 2225 1872 gene locus_tag LOCUS_03170 2225 1872 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548438.1 protein_id gnl|my_center|LOCUS_03170 <3754 2266 gene locus_tag LOCUS_03180 <3754 2266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548440.1:PBP1A family penicillin-binding protein >Feature sequence141 <1 1466 gene locus_tag LOCUS_03190 <1 1466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546900.1:SH3-like domain-containing protein >Feature sequence142 2136 1780 gene locus_tag LOCUS_03200 gene ftsL 2136 1780 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254255.1 protein_id gnl|my_center|LOCUS_03200 3092 2148 gene locus_tag LOCUS_03210 gene rsmH 3092 2148 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546789.1 protein_id gnl|my_center|LOCUS_03210 3526 3095 gene locus_tag LOCUS_03220 gene mraZ 3526 3095 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 protein_id gnl|my_center|LOCUS_03220 3987 3658 gene locus_tag LOCUS_03230 3987 3658 CDS product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254254.1 protein_id gnl|my_center|LOCUS_03230 4099 4221 gene locus_tag LOCUS_03240 4099 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 >Feature sequence143 <1 947 gene locus_tag LOCUS_03250 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546797.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase 950 2059 gene locus_tag LOCUS_03260 gene murG 950 2059 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254256.1 protein_id gnl|my_center|LOCUS_03260 2076 2921 gene locus_tag LOCUS_03270 2076 2921 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546801.1 protein_id gnl|my_center|LOCUS_03270 2980 4362 gene locus_tag LOCUS_03280 gene ftsA 2980 4362 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254257.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence144 >Feature sequence145 >Feature sequence146 >Feature sequence147 2692 1280 gene locus_tag LOCUS_03290 gene pepV 2692 1280 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547162.1 protein_id gnl|my_center|LOCUS_03290 3590 2835 gene locus_tag LOCUS_03300 3590 2835 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439904.1 protein_id gnl|my_center|LOCUS_03300 4414 3668 gene locus_tag LOCUS_03310 4414 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 >Feature sequence148 1305 670 gene locus_tag LOCUS_03320 1305 670 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662275.1 protein_id gnl|my_center|LOCUS_03320 1656 2837 gene locus_tag LOCUS_03330 1656 2837 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563507.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence149 >Feature sequence150 1676 594 gene locus_tag LOCUS_03340 gene serC 1676 594 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475514.1 protein_id gnl|my_center|LOCUS_03340 2007 2630 gene locus_tag LOCUS_03350 2007 2630 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646364.1 protein_id gnl|my_center|LOCUS_03350 <3374 2681 gene locus_tag LOCUS_03360 <3374 2681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476508.1:ABC transporter permease >Feature sequence151 1176 433 gene locus_tag LOCUS_03370 1176 433 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254533.1 protein_id gnl|my_center|LOCUS_03370 2982 1387 gene locus_tag LOCUS_03380 2982 1387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 protein_id gnl|my_center|LOCUS_03380 3128 4195 gene locus_tag LOCUS_03390 3128 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence152 >Feature sequence153 464 835 gene locus_tag LOCUS_03400 464 835 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101943.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence154 >Feature sequence155 1648 794 gene locus_tag LOCUS_03410 1648 794 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262269.1 protein_id gnl|my_center|LOCUS_03410 1863 2699 gene locus_tag LOCUS_03420 1863 2699 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547157.1 protein_id gnl|my_center|LOCUS_03420 2742 3308 gene locus_tag LOCUS_03430 gene lepB 2742 3308 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547598.1 protein_id gnl|my_center|LOCUS_03430 3367 3936 gene locus_tag LOCUS_03440 gene lepB 3367 3936 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547598.1 protein_id gnl|my_center|LOCUS_03440 4005 4190 gene locus_tag LOCUS_03450 4005 4190 CDS product LBP_cg2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547599.1 protein_id gnl|my_center|LOCUS_03450 5790 4552 gene locus_tag LOCUS_03460 gene pepT 5790 4552 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547606.1 protein_id gnl|my_center|LOCUS_03460 6630 5830 gene locus_tag LOCUS_03470 6630 5830 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547612.1 protein_id gnl|my_center|LOCUS_03470 7319 6627 gene locus_tag LOCUS_03480 7319 6627 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547613.1 protein_id gnl|my_center|LOCUS_03480 7466 7906 gene locus_tag LOCUS_03490 7466 7906 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547614.1 protein_id gnl|my_center|LOCUS_03490 7906 8745 gene locus_tag LOCUS_03500 7906 8745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 9123 8782 gene locus_tag LOCUS_03510 9123 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 9686 9120 gene locus_tag LOCUS_03520 9686 9120 CDS product Ada metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814142.1 protein_id gnl|my_center|LOCUS_03520 10125 9988 gene locus_tag LOCUS_03530 10125 9988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 10617 10153 gene locus_tag LOCUS_03540 10617 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 11448 10828 gene locus_tag LOCUS_03550 11448 10828 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181527.1 protein_id gnl|my_center|LOCUS_03550 13331 11601 gene locus_tag LOCUS_03560 13331 11601 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460619.1 protein_id gnl|my_center|LOCUS_03560 13459 14331 gene locus_tag LOCUS_03570 13459 14331 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002280228.1 protein_id gnl|my_center|LOCUS_03570 14690 14463 gene locus_tag LOCUS_03580 14690 14463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 15710 14877 gene locus_tag LOCUS_03590 15710 14877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 16088 17533 gene locus_tag LOCUS_03600 16088 17533 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546921.1 protein_id gnl|my_center|LOCUS_03600 18013 17603 gene locus_tag LOCUS_03610 18013 17603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286333.1 protein_id gnl|my_center|LOCUS_03610 18579 18010 gene locus_tag LOCUS_03620 18579 18010 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643707.1 protein_id gnl|my_center|LOCUS_03620 20079 18595 gene locus_tag LOCUS_03630 20079 18595 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286329.1 protein_id gnl|my_center|LOCUS_03630 20734 20171 gene locus_tag LOCUS_03640 20734 20171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 >Feature sequence156 613 167 gene locus_tag LOCUS_03650 613 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence157 2569 1031 gene locus_tag LOCUS_03660 2569 1031 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549809.1 protein_id gnl|my_center|LOCUS_03660 4057 2822 gene locus_tag LOCUS_03670 4057 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549986.1 protein_id gnl|my_center|LOCUS_03670 4909 4328 gene locus_tag LOCUS_03680 4909 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 6137 5340 gene locus_tag LOCUS_03690 6137 5340 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613417.1 protein_id gnl|my_center|LOCUS_03690 6793 6137 gene locus_tag LOCUS_03700 6793 6137 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254570.1 protein_id gnl|my_center|LOCUS_03700 7603 6803 gene locus_tag LOCUS_03710 7603 6803 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262234.1 protein_id gnl|my_center|LOCUS_03710 9810 7831 gene locus_tag LOCUS_03720 9810 7831 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549797.1 protein_id gnl|my_center|LOCUS_03720 10755 9841 gene locus_tag LOCUS_03730 gene pfkB 10755 9841 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549796.1 protein_id gnl|my_center|LOCUS_03730 11378 10755 gene locus_tag LOCUS_03740 11378 10755 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549794.1 protein_id gnl|my_center|LOCUS_03740 12392 11643 gene locus_tag LOCUS_03750 12392 11643 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549723.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence158 2537 1278 gene locus_tag LOCUS_03760 gene lysA 2537 1278 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254268.1 protein_id gnl|my_center|LOCUS_03760 2790 2717 gene locus_tag LOCUS_t00210 2790 2717 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3589 2918 gene locus_tag LOCUS_03770 3589 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 >Feature sequence159 736 503 gene locus_tag LOCUS_03780 736 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03780 839 1678 gene locus_tag LOCUS_03790 839 1678 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254274.1 protein_id gnl|my_center|LOCUS_03790 1865 2749 gene locus_tag LOCUS_03800 1865 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 2767 3138 gene locus_tag LOCUS_03810 2767 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 3650 3192 gene locus_tag LOCUS_03820 3650 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 4013 4582 gene locus_tag LOCUS_03830 4013 4582 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547302.1 protein_id gnl|my_center|LOCUS_03830 4592 5041 gene locus_tag LOCUS_03840 4592 5041 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254323.1 protein_id gnl|my_center|LOCUS_03840 5145 5723 gene locus_tag LOCUS_03850 5145 5723 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898317.1 protein_id gnl|my_center|LOCUS_03850 5878 6579 gene locus_tag LOCUS_03860 5878 6579 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905450.1 protein_id gnl|my_center|LOCUS_03860 6945 6625 gene locus_tag LOCUS_03870 6945 6625 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641143.1 protein_id gnl|my_center|LOCUS_03870 7194 7574 gene locus_tag LOCUS_03880 7194 7574 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625774.1 protein_id gnl|my_center|LOCUS_03880 8522 7623 gene locus_tag LOCUS_03890 8522 7623 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549454.1 protein_id gnl|my_center|LOCUS_03890 10176 8557 gene locus_tag LOCUS_03900 10176 8557 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254631.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence160 >Feature sequence161 1150 215 gene locus_tag LOCUS_03910 1150 215 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549076.1 protein_id gnl|my_center|LOCUS_03910 1722 1264 gene locus_tag LOCUS_03920 gene fabZ 1722 1264 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563897.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence162 895 215 gene locus_tag LOCUS_03930 895 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence163 1436 2002 gene locus_tag LOCUS_03940 1436 2002 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_03940 >Feature sequence164 <1 1258 gene locus_tag LOCUS_03950 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476479.1:branched-chain amino acid transport system II carrier protein <2572 1346 gene locus_tag LOCUS_03960 <2572 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147181188.1:bifunctional diguanylate cyclase/phosphodiesterase >Feature sequence165 >Feature sequence166 151 930 gene locus_tag LOCUS_03970 gene dapB 151 930 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546885.1 protein_id gnl|my_center|LOCUS_03970 975 2156 gene locus_tag LOCUS_03980 975 2156 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546886.1 protein_id gnl|my_center|LOCUS_03980 2254 2841 gene locus_tag LOCUS_03990 2254 2841 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547484.1 protein_id gnl|my_center|LOCUS_03990 2863 3411 gene locus_tag LOCUS_04000 2863 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 3701 4258 gene locus_tag LOCUS_04010 3701 4258 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 protein_id gnl|my_center|LOCUS_04010 5274 4501 gene locus_tag LOCUS_04020 5274 4501 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922406.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence167 <571 49 gene locus_tag LOCUS_04030 <571 49 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548611.1:AraC family transcriptional regulator >Feature sequence168 <1 561 gene locus_tag LOCUS_04040 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102003.1:PTS sugar transporter subunit IIC 618 923 gene locus_tag LOCUS_04050 618 923 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639489.1 protein_id gnl|my_center|LOCUS_04050 >Feature sequence169 <1 970 gene locus_tag LOCUS_04060 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674698.1:C69 family dipeptidase >Feature sequence170 777 256 gene locus_tag LOCUS_04070 777 256 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130536.1 protein_id gnl|my_center|LOCUS_04070 2215 875 gene locus_tag LOCUS_04080 2215 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 2980 2426 gene locus_tag LOCUS_04090 2980 2426 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702912.1 protein_id gnl|my_center|LOCUS_04090 4167 3235 gene locus_tag LOCUS_04100 4167 3235 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152580630.1 protein_id gnl|my_center|LOCUS_04100 >Feature sequence171 >Feature sequence172 874 443 gene locus_tag LOCUS_04110 874 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 1247 810 gene locus_tag LOCUS_04120 1247 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence173 >Feature sequence174 659 255 gene locus_tag LOCUS_04130 659 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 1653 838 gene locus_tag LOCUS_04140 1653 838 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770966.1 protein_id gnl|my_center|LOCUS_04140 <2624 1744 gene locus_tag LOCUS_04150 <2624 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969832.1:pca operon transcription factor PcaQ >Feature sequence175 >Feature sequence176 >Feature sequence177 >Feature sequence178 1475 672 gene locus_tag LOCUS_04160 1475 672 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285030.1 protein_id gnl|my_center|LOCUS_04160 2130 1588 gene locus_tag LOCUS_04170 2130 1588 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546590.1 protein_id gnl|my_center|LOCUS_04170 <3482 2226 gene locus_tag LOCUS_04180 <3482 2226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546588.1:excinuclease ABC subunit UvrA >Feature sequence179 996 1790 gene locus_tag LOCUS_04190 gene thiM 996 1790 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100886.1 protein_id gnl|my_center|LOCUS_04190 1787 2584 gene locus_tag LOCUS_04200 gene thiD 1787 2584 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646310.1 protein_id gnl|my_center|LOCUS_04200 2593 3237 gene locus_tag LOCUS_04210 gene thiE 2593 3237 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100887.1 protein_id gnl|my_center|LOCUS_04210 3258 3935 gene locus_tag LOCUS_04220 gene tenA 3258 3935 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674045.1 protein_id gnl|my_center|LOCUS_04220 >Feature sequence180 1398 871 gene locus_tag LOCUS_04230 gene dhaS 1398 871 CDS product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704309.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence181 596 1309 gene locus_tag LOCUS_04240 596 1309 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 protein_id gnl|my_center|LOCUS_04240 1446 2645 gene locus_tag LOCUS_04250 1446 2645 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254190.1 protein_id gnl|my_center|LOCUS_04250 2823 3197 gene locus_tag LOCUS_04260 2823 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 3540 3250 gene locus_tag LOCUS_04270 3540 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 <4126 3544 gene locus_tag LOCUS_04280 <4126 3544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538116.1:GGDEF domain-containing phosphodiesterase >Feature sequence182 >Feature sequence183 1836 1558 gene locus_tag LOCUS_04290 1836 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 2210 1836 gene locus_tag LOCUS_04300 2210 1836 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549440.1 protein_id gnl|my_center|LOCUS_04300 2647 2204 gene locus_tag LOCUS_04310 2647 2204 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549441.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence184 344 1054 gene locus_tag LOCUS_04320 gene budA 344 1054 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475570.1 protein_id gnl|my_center|LOCUS_04320 1588 3486 gene locus_tag LOCUS_04330 gene glgB 1588 3486 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254224.1 protein_id gnl|my_center|LOCUS_04330 3534 4682 gene locus_tag LOCUS_04340 3534 4682 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546570.1 protein_id gnl|my_center|LOCUS_04340 4684 5811 gene locus_tag LOCUS_04350 gene glgD 4684 5811 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546573.1 protein_id gnl|my_center|LOCUS_04350 5827 7257 gene locus_tag LOCUS_04360 gene glgA 5827 7257 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546574.1 protein_id gnl|my_center|LOCUS_04360 7283 9733 gene locus_tag LOCUS_04370 7283 9733 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546577.1 protein_id gnl|my_center|LOCUS_04370 9743 11545 gene locus_tag LOCUS_04380 9743 11545 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254225.1 protein_id gnl|my_center|LOCUS_04380 11560 13281 gene locus_tag LOCUS_04390 11560 13281 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546584.1 protein_id gnl|my_center|LOCUS_04390 >Feature sequence185 256 954 gene locus_tag LOCUS_04400 256 954 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613281.1 protein_id gnl|my_center|LOCUS_04400 1312 941 gene locus_tag LOCUS_04410 1312 941 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548679.1 protein_id gnl|my_center|LOCUS_04410 >Feature sequence186 >Feature sequence187 >Feature sequence188 >Feature sequence189 <1 616 gene locus_tag LOCUS_04420 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548688.1:alpha/beta hydrolase 634 2097 gene locus_tag LOCUS_04430 gene cls 634 2097 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548687.1 protein_id gnl|my_center|LOCUS_04430 >Feature sequence190 >Feature sequence191 >Feature sequence192 >Feature sequence193 >Feature sequence194 4 79 gene locus_tag LOCUS_t00220 4 79 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 147 219 gene locus_tag LOCUS_t00230 147 219 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence195 >Feature sequence196 <3097 494 gene locus_tag LOCUS_04440 <3097 494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254318.1:YSIRK-type signal peptide-containing protein >Feature sequence197 >Feature sequence198 >Feature sequence199 >Feature sequence200 >Feature sequence201 >Feature sequence202 1156 518 gene locus_tag LOCUS_04450 1156 518 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703424.1 protein_id gnl|my_center|LOCUS_04450 1928 1215 gene locus_tag LOCUS_04460 1928 1215 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079808.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence203 >Feature sequence204 >Feature sequence205 >Feature sequence206 >Feature sequence207 >Feature sequence208 >Feature sequence209 >Feature sequence210 >Feature sequence211 >Feature sequence212 >Feature sequence213 >Feature sequence214 >Feature sequence215 >Feature sequence216 1860 340 gene locus_tag LOCUS_04470 1860 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 2601 1870 gene locus_tag LOCUS_04480 2601 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 2773 4524 gene locus_tag LOCUS_04490 2773 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 4632 5060 gene locus_tag LOCUS_04500 4632 5060 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642569.1 protein_id gnl|my_center|LOCUS_04500 5072 5515 gene locus_tag LOCUS_04510 5072 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 5596 7257 gene locus_tag LOCUS_04520 5596 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476454.1 protein_id gnl|my_center|LOCUS_04520 >Feature sequence217 <697 39 gene locus_tag LOCUS_04530 <697 39 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546408.1:patatin family protein >Feature sequence218 >Feature sequence219 >Feature sequence220 >Feature sequence221 617 1543 gene locus_tag LOCUS_04540 617 1543 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565583.1 protein_id gnl|my_center|LOCUS_04540 1560 2216 gene locus_tag LOCUS_04550 1560 2216 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549229.1 protein_id gnl|my_center|LOCUS_04550 2876 2268 gene locus_tag LOCUS_04560 2876 2268 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254154.1 protein_id gnl|my_center|LOCUS_04560 3643 2873 gene locus_tag LOCUS_04570 3643 2873 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549224.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence222 1171 263 gene locus_tag LOCUS_04580 1171 263 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548290.1 protein_id gnl|my_center|LOCUS_04580 1895 1359 gene locus_tag LOCUS_04590 1895 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence223 >Feature sequence224 <1 553 gene locus_tag LOCUS_04600 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003563089.1:ABC transporter ATP-binding protein 689 1840 gene locus_tag LOCUS_04610 689 1840 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053275.1 protein_id gnl|my_center|LOCUS_04610 1868 2995 gene locus_tag LOCUS_04620 1868 2995 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101860.1 protein_id gnl|my_center|LOCUS_04620 3392 3036 gene locus_tag LOCUS_04630 3392 3036 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254429.1 protein_id gnl|my_center|LOCUS_04630 3633 3944 gene locus_tag LOCUS_04640 gene rplU 3633 3944 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_04640 3960 4259 gene locus_tag LOCUS_04650 gene rpmA 3960 4259 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254420.1 protein_id gnl|my_center|LOCUS_04650 4404 5510 gene locus_tag LOCUS_04660 4404 5510 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547949.1 protein_id gnl|my_center|LOCUS_04660 5587 6147 gene locus_tag LOCUS_04670 gene efp 5587 6147 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 protein_id gnl|my_center|LOCUS_04670 6167 6601 gene locus_tag LOCUS_04680 6167 6601 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547946.1 protein_id gnl|my_center|LOCUS_04680 6601 6999 gene locus_tag LOCUS_04690 gene nusB 6601 6999 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547945.1 protein_id gnl|my_center|LOCUS_04690 7045 7896 gene locus_tag LOCUS_04700 7045 7896 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547942.1 protein_id gnl|my_center|LOCUS_04700 >Feature sequence225 1395 655 gene locus_tag LOCUS_04710 1395 655 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546366.1 protein_id gnl|my_center|LOCUS_04710 1965 2621 gene locus_tag LOCUS_04720 gene udk 1965 2621 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 protein_id gnl|my_center|LOCUS_04720 2621 3247 gene locus_tag LOCUS_04730 gene udk 2621 3247 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 protein_id gnl|my_center|LOCUS_04730 3448 3317 gene locus_tag LOCUS_04740 3448 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 4155 3586 gene locus_tag LOCUS_04750 4155 3586 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546364.1 protein_id gnl|my_center|LOCUS_04750 4204 4365 gene locus_tag LOCUS_04760 4204 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 <5077 4362 gene locus_tag LOCUS_04770 <5077 4362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546357.1:M42 family peptidase >Feature sequence226 484 729 gene locus_tag LOCUS_04780 484 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence227 288 1181 gene locus_tag LOCUS_04790 288 1181 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102052.1 protein_id gnl|my_center|LOCUS_04790 1272 3374 gene locus_tag LOCUS_04800 1272 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 >Feature sequence228 >Feature sequence229 >Feature sequence230 >Feature sequence231 1681 992 gene locus_tag LOCUS_04810 1681 992 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548802.1 protein_id gnl|my_center|LOCUS_04810 >Feature sequence232 >Feature sequence233 1847 612 gene locus_tag LOCUS_04820 1847 612 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546440.1 protein_id gnl|my_center|LOCUS_04820 >Feature sequence234 <1 949 gene locus_tag LOCUS_04830 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101979.1:subtype B tannase >Feature sequence235 1110 556 gene locus_tag LOCUS_04840 1110 556 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254459.1 protein_id gnl|my_center|LOCUS_04840 >Feature sequence236 >Feature sequence237 >Feature sequence238 >Feature sequence239 38 1462 gene locus_tag LOCUS_04850 38 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 1788 1603 gene locus_tag LOCUS_04860 gene rpmB 1788 1603 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547911.1 protein_id gnl|my_center|LOCUS_04860 1964 2326 gene locus_tag LOCUS_04870 1964 2326 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547910.1 protein_id gnl|my_center|LOCUS_04870 2346 4010 gene locus_tag LOCUS_04880 2346 4010 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547907.1 protein_id gnl|my_center|LOCUS_04880 4010 6052 gene locus_tag LOCUS_04890 gene recG 4010 6052 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254414.1 protein_id gnl|my_center|LOCUS_04890 6077 7069 gene locus_tag LOCUS_04900 gene plsX 6077 7069 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547901.1 protein_id gnl|my_center|LOCUS_04900 7119 7361 gene locus_tag LOCUS_04910 gene acpP 7119 7361 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547899.1 protein_id gnl|my_center|LOCUS_04910 7570 7773 gene locus_tag LOCUS_04920 7570 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023376657.1 protein_id gnl|my_center|LOCUS_04920 7857 9635 gene locus_tag LOCUS_04930 7857 9635 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547891.1 protein_id gnl|my_center|LOCUS_04930 9761 10459 gene locus_tag LOCUS_04940 gene rnc 9761 10459 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547887.1 protein_id gnl|my_center|LOCUS_04940 >Feature sequence240 >Feature sequence241 162 1022 gene locus_tag LOCUS_04950 162 1022 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550089.1 protein_id gnl|my_center|LOCUS_04950 1563 1066 gene locus_tag LOCUS_04960 1563 1066 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254521.1 protein_id gnl|my_center|LOCUS_04960 2251 1580 gene locus_tag LOCUS_04970 2251 1580 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254328.1 protein_id gnl|my_center|LOCUS_04970 >Feature sequence242 112 1668 gene locus_tag LOCUS_04980 112 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 1724 2263 gene locus_tag LOCUS_04990 1724 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 2457 3317 gene locus_tag LOCUS_05000 2457 3317 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563836.1 protein_id gnl|my_center|LOCUS_05000 4232 3384 gene locus_tag LOCUS_05010 4232 3384 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254341.1 protein_id gnl|my_center|LOCUS_05010 5042 4425 gene locus_tag LOCUS_05020 gene lexA 5042 4425 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254404.1 protein_id gnl|my_center|LOCUS_05020 5195 5431 gene locus_tag LOCUS_05030 5195 5431 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547851.1 protein_id gnl|my_center|LOCUS_05030 5544 5768 gene locus_tag LOCUS_05040 5544 5768 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547849.1 protein_id gnl|my_center|LOCUS_05040 5937 7694 gene locus_tag LOCUS_05050 5937 7694 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254403.1 protein_id gnl|my_center|LOCUS_05050 7687 9477 gene locus_tag LOCUS_05060 7687 9477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613381.1 protein_id gnl|my_center|LOCUS_05060 9957 9523 gene locus_tag LOCUS_05070 9957 9523 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674368.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence243 168 1178 gene locus_tag LOCUS_05080 168 1178 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701970.1 protein_id gnl|my_center|LOCUS_05080 1178 2461 gene locus_tag LOCUS_05090 1178 2461 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475572.1 protein_id gnl|my_center|LOCUS_05090 3589 2507 gene locus_tag LOCUS_05100 gene xerS 3589 2507 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547513.1 protein_id gnl|my_center|LOCUS_05100 4115 3558 gene locus_tag LOCUS_05110 4115 3558 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262180.1 protein_id gnl|my_center|LOCUS_05110 4274 4666 gene locus_tag LOCUS_05120 4274 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 4700 5554 gene locus_tag LOCUS_05130 4700 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence244 129 827 gene locus_tag LOCUS_05140 129 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05140 1408 2283 gene locus_tag LOCUS_05150 1408 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 3638 2376 gene locus_tag LOCUS_05160 3638 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548775.1 protein_id gnl|my_center|LOCUS_05160 4691 3732 gene locus_tag LOCUS_05170 4691 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 6232 4838 gene locus_tag LOCUS_05180 6232 4838 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476522.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence245 >Feature sequence246 <900 221 gene locus_tag LOCUS_05190 <900 221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476577.1:DegV family protein >Feature sequence247 >Feature sequence248 649 170 gene locus_tag LOCUS_05200 649 170 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547404.1 protein_id gnl|my_center|LOCUS_05200 1367 1062 gene locus_tag LOCUS_05210 1367 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 1333 1479 gene locus_tag LOCUS_05220 1333 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 1652 1476 gene locus_tag LOCUS_05230 1652 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence249 1569 868 gene locus_tag LOCUS_05240 1569 868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549550.1 protein_id gnl|my_center|LOCUS_05240 1834 2409 gene locus_tag LOCUS_05250 1834 2409 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476510.1 protein_id gnl|my_center|LOCUS_05250 2986 2468 gene locus_tag LOCUS_05260 2986 2468 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817398.1 protein_id gnl|my_center|LOCUS_05260 >Feature sequence250 1009 77 gene locus_tag LOCUS_05270 gene whiA 1009 77 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546596.1 protein_id gnl|my_center|LOCUS_05270 <2021 1017 gene locus_tag LOCUS_05280 <2021 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546595.1:YvcK family protein >Feature sequence251 151 1524 gene locus_tag LOCUS_05290 gene nhaC 151 1524 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546295.1 protein_id gnl|my_center|LOCUS_05290 2725 1598 gene locus_tag LOCUS_05300 2725 1598 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588846.1 protein_id gnl|my_center|LOCUS_05300 3982 2768 gene locus_tag LOCUS_05310 3982 2768 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089891.1 protein_id gnl|my_center|LOCUS_05310 4153 4530 gene locus_tag LOCUS_05320 4153 4530 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476515.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence252 739 1239 gene locus_tag LOCUS_05330 739 1239 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549510.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence253 4592 927 gene locus_tag LOCUS_05340 4592 927 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254108.1 protein_id gnl|my_center|LOCUS_05340 5147 4803 gene locus_tag LOCUS_05350 5147 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 7731 5275 gene locus_tag LOCUS_05360 7731 5275 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549016.1 protein_id gnl|my_center|LOCUS_05360 8095 7754 gene locus_tag LOCUS_05370 8095 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 >Feature sequence254 3245 1128 gene locus_tag LOCUS_05380 3245 1128 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548080.1 protein_id gnl|my_center|LOCUS_05380 3379 3467 gene locus_tag LOCUS_t00240 3379 3467 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3975 3646 gene locus_tag LOCUS_05390 3975 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 4876 3977 gene locus_tag LOCUS_05400 4876 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 5291 4866 gene locus_tag LOCUS_05410 5291 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 5596 5288 gene locus_tag LOCUS_05420 5596 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 6033 5602 gene locus_tag LOCUS_05430 6033 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 6157 5993 gene locus_tag LOCUS_05440 6157 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 6635 6168 gene locus_tag LOCUS_05450 6635 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 10196 6714 gene locus_tag LOCUS_05460 10196 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 12606 10210 gene locus_tag LOCUS_05470 12606 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 14472 12616 gene locus_tag LOCUS_05480 14472 12616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 19487 14490 gene locus_tag LOCUS_05490 19487 14490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 19660 19502 gene locus_tag LOCUS_05500 19660 19502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 20097 19708 gene locus_tag LOCUS_05510 20097 19708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 20877 20212 gene locus_tag LOCUS_05520 20877 20212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 21269 20892 gene locus_tag LOCUS_05530 21269 20892 CDS product DUF806 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475656.1 protein_id gnl|my_center|LOCUS_05530 21667 21266 gene locus_tag LOCUS_05540 21667 21266 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905382.1 protein_id gnl|my_center|LOCUS_05540 21977 21660 gene locus_tag LOCUS_05550 21977 21660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 22317 21982 gene locus_tag LOCUS_05560 22317 21982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 23551 22331 gene locus_tag LOCUS_05570 23551 22331 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475652.1 protein_id gnl|my_center|LOCUS_05570 24301 23567 gene locus_tag LOCUS_05580 24301 23567 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080656303.1 protein_id gnl|my_center|LOCUS_05580 25412 24264 gene locus_tag LOCUS_05590 25412 24264 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475650.1 protein_id gnl|my_center|LOCUS_05590 25609 25430 gene locus_tag LOCUS_05600 25609 25430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 27480 25606 gene locus_tag LOCUS_05610 27480 25606 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475648.1 protein_id gnl|my_center|LOCUS_05610 27944 27477 gene locus_tag LOCUS_05620 27944 27477 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475647.1 protein_id gnl|my_center|LOCUS_05620 28659 28090 gene locus_tag LOCUS_05630 28659 28090 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475646.1 protein_id gnl|my_center|LOCUS_05630 28877 28698 gene locus_tag LOCUS_05640 28877 28698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 29188 28880 gene locus_tag LOCUS_05650 29188 28880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 29367 29188 gene locus_tag LOCUS_05660 29367 29188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023376657.1 protein_id gnl|my_center|LOCUS_05660 29656 29504 gene locus_tag LOCUS_05670 29656 29504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 30908 30462 gene locus_tag LOCUS_05680 30908 30462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 31502 30909 gene locus_tag LOCUS_05690 31502 30909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 31876 31502 gene locus_tag LOCUS_05700 31876 31502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 32308 31889 gene locus_tag LOCUS_05710 32308 31889 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047623.1 protein_id gnl|my_center|LOCUS_05710 32772 32365 gene locus_tag LOCUS_05720 32772 32365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 33106 32774 gene locus_tag LOCUS_05730 33106 32774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 33671 33159 gene locus_tag LOCUS_05740 gene ssb 33671 33159 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288368.1 protein_id gnl|my_center|LOCUS_05740 >Feature sequence255 3588 592 gene locus_tag LOCUS_05750 3588 592 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548819.1 protein_id gnl|my_center|LOCUS_05750 4284 3667 gene locus_tag LOCUS_05760 4284 3667 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548818.1 protein_id gnl|my_center|LOCUS_05760 <4921 4287 gene locus_tag LOCUS_05770 <4921 4287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548816.1:LCP family protein >Feature sequence256 1401 565 gene locus_tag LOCUS_05780 1401 565 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645673.1 protein_id gnl|my_center|LOCUS_05780 1623 2555 gene locus_tag LOCUS_05790 1623 2555 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703273.1 protein_id gnl|my_center|LOCUS_05790 2814 2596 gene locus_tag LOCUS_05800 2814 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3016 2807 gene locus_tag LOCUS_05810 3016 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 3626 3009 gene locus_tag LOCUS_05820 3626 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence257 >Feature sequence258 15 386 gene locus_tag LOCUS_05830 15 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 592 1686 gene locus_tag LOCUS_05840 592 1686 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 protein_id gnl|my_center|LOCUS_05840 2951 1737 gene locus_tag LOCUS_05850 2951 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 3510 3079 gene locus_tag LOCUS_05860 3510 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 4376 3624 gene locus_tag LOCUS_05870 4376 3624 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254200.1 protein_id gnl|my_center|LOCUS_05870 5625 4390 gene locus_tag LOCUS_05880 5625 4390 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613327.1 protein_id gnl|my_center|LOCUS_05880 6083 5673 gene locus_tag LOCUS_05890 6083 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 6142 7182 gene locus_tag LOCUS_05900 6142 7182 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989529.1 protein_id gnl|my_center|LOCUS_05900 7278 7874 gene locus_tag LOCUS_05910 7278 7874 CDS product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674689.1 protein_id gnl|my_center|LOCUS_05910 8058 9155 gene locus_tag LOCUS_05920 8058 9155 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 protein_id gnl|my_center|LOCUS_05920 >Feature sequence259 334 1566 gene locus_tag LOCUS_05930 334 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 >Feature sequence260 >Feature sequence261 >Feature sequence262 539 339 gene locus_tag LOCUS_05940 539 339 CDS product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254299.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence263 <1 1025 gene locus_tag LOCUS_05950 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547524.1:carbamoyl phosphate synthase small subunit 1025 4213 gene locus_tag LOCUS_05960 1025 4213 CDS product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254355.1 protein_id gnl|my_center|LOCUS_05960 4282 4563 gene locus_tag LOCUS_05970 4282 4563 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703119.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence264 >Feature sequence265 1050 337 gene locus_tag LOCUS_05980 1050 337 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254285.1 protein_id gnl|my_center|LOCUS_05980 2102 1047 gene locus_tag LOCUS_05990 2102 1047 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546989.1 protein_id gnl|my_center|LOCUS_05990 2996 2136 gene locus_tag LOCUS_06000 2996 2136 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254284.1 protein_id gnl|my_center|LOCUS_06000 5824 3404 gene locus_tag LOCUS_06010 5824 3404 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546985.1 protein_id gnl|my_center|LOCUS_06010 6233 5850 gene locus_tag LOCUS_06020 6233 5850 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546982.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence266 41 181 gene locus_tag LOCUS_06030 41 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence267 >Feature sequence268 >Feature sequence269 2081 246 gene locus_tag LOCUS_06040 gene aspS 2081 246 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547039.1 protein_id gnl|my_center|LOCUS_06040 3383 2097 gene locus_tag LOCUS_06050 gene hisS 3383 2097 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547037.1 protein_id gnl|my_center|LOCUS_06050 5054 3678 gene locus_tag LOCUS_06060 5054 3678 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674302.1 protein_id gnl|my_center|LOCUS_06060 5644 5207 gene locus_tag LOCUS_06070 gene dtd 5644 5207 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 protein_id gnl|my_center|LOCUS_06070 <6306 5675 gene locus_tag LOCUS_06080 <6306 5675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254292.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence270 >Feature sequence271 2295 520 gene locus_tag LOCUS_06090 2295 520 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254424.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence272 <1 570 gene locus_tag LOCUS_06100 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015919.1:class I SAM-dependent methyltransferase 3808 608 gene locus_tag LOCUS_06110 gene carB 3808 608 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862003.1 protein_id gnl|my_center|LOCUS_06110 4877 3801 gene locus_tag LOCUS_06120 gene carA 4877 3801 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_06120 5837 5322 gene locus_tag LOCUS_06130 5837 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6068 6793 gene locus_tag LOCUS_06140 6068 6793 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_06140 8259 6922 gene locus_tag LOCUS_06150 8259 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 8353 9090 gene locus_tag LOCUS_06160 8353 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 9278 9808 gene locus_tag LOCUS_06170 9278 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 9820 10140 gene locus_tag LOCUS_06180 9820 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 10446 11099 gene locus_tag LOCUS_06190 10446 11099 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290383.1 protein_id gnl|my_center|LOCUS_06190 12178 11297 gene locus_tag LOCUS_06200 12178 11297 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101944.1 protein_id gnl|my_center|LOCUS_06200 12436 13266 gene locus_tag LOCUS_06210 12436 13266 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence273 409 1701 gene locus_tag LOCUS_06220 409 1701 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548915.1 protein_id gnl|my_center|LOCUS_06220 3334 1850 gene locus_tag LOCUS_06230 3334 1850 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431416.1 protein_id gnl|my_center|LOCUS_06230 3760 3416 gene locus_tag LOCUS_06240 3760 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434963.1 protein_id gnl|my_center|LOCUS_06240 4175 3777 gene locus_tag LOCUS_06250 4175 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence274 804 2129 gene locus_tag LOCUS_06260 804 2129 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_06260 >Feature sequence275 684 223 gene locus_tag LOCUS_06270 684 223 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964044.1 protein_id gnl|my_center|LOCUS_06270 893 1384 gene locus_tag LOCUS_06280 893 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 1392 2174 gene locus_tag LOCUS_06290 1392 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 2158 3438 gene locus_tag LOCUS_06300 2158 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 5114 3486 gene locus_tag LOCUS_06310 5114 3486 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254071.1 protein_id gnl|my_center|LOCUS_06310 6037 5489 gene locus_tag LOCUS_06320 6037 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 6765 6400 gene locus_tag LOCUS_06330 gene rplL 6765 6400 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254128.1 protein_id gnl|my_center|LOCUS_06330 7327 6818 gene locus_tag LOCUS_06340 gene rplJ 7327 6818 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549105.1 protein_id gnl|my_center|LOCUS_06340 7592 7993 gene locus_tag LOCUS_06350 7592 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 >Feature sequence276 2853 1234 gene locus_tag LOCUS_06360 2853 1234 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254085.1 protein_id gnl|my_center|LOCUS_06360 3557 2970 gene locus_tag LOCUS_06370 gene rpoE 3557 2970 CDS product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548904.1 protein_id gnl|my_center|LOCUS_06370 4001 3603 gene locus_tag LOCUS_06380 4001 3603 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548902.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence277 >Feature sequence278 >Feature sequence279 >Feature sequence280 1611 340 gene locus_tag LOCUS_06390 1611 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1947 1660 gene locus_tag LOCUS_06400 1947 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 6565 2345 gene locus_tag LOCUS_06410 6565 2345 CDS product MucBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989917.1 protein_id gnl|my_center|LOCUS_06410 10269 6868 gene locus_tag LOCUS_06420 10269 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 10292 10777 gene locus_tag LOCUS_06430 10292 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 13914 11512 gene locus_tag LOCUS_06440 13914 11512 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254199.1 protein_id gnl|my_center|LOCUS_06440 14823 14101 gene locus_tag LOCUS_06450 14823 14101 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546381.1 protein_id gnl|my_center|LOCUS_06450 15766 14831 gene locus_tag LOCUS_06460 15766 14831 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546379.1 protein_id gnl|my_center|LOCUS_06460 16556 15864 gene locus_tag LOCUS_06470 gene rpiA 16556 15864 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254196.1 protein_id gnl|my_center|LOCUS_06470 17219 16569 gene locus_tag LOCUS_06480 gene rpe 17219 16569 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547914.1 protein_id gnl|my_center|LOCUS_06480 18155 17235 gene locus_tag LOCUS_06490 gene rbsK 18155 17235 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254195.1 protein_id gnl|my_center|LOCUS_06490 18726 18223 gene locus_tag LOCUS_06500 18726 18223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546371.1 protein_id gnl|my_center|LOCUS_06500 19786 18869 gene locus_tag LOCUS_06510 19786 18869 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546370.1 protein_id gnl|my_center|LOCUS_06510 >Feature sequence281 <1 732 gene locus_tag LOCUS_06520 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546779.1:rod shape-determining protein MreC >Feature sequence282 166 654 gene locus_tag LOCUS_06530 gene coaD 166 654 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546847.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence283 848 255 gene locus_tag LOCUS_06540 gene yqeK 848 255 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548313.1 protein_id gnl|my_center|LOCUS_06540 1479 841 gene locus_tag LOCUS_06550 1479 841 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548315.1 protein_id gnl|my_center|LOCUS_06550 2620 1490 gene locus_tag LOCUS_06560 gene yqeH 2620 1490 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548317.1 protein_id gnl|my_center|LOCUS_06560 3066 2710 gene locus_tag LOCUS_06570 gene rplT 3066 2710 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548326.1 protein_id gnl|my_center|LOCUS_06570 3311 3111 gene locus_tag LOCUS_06580 gene rpmI 3311 3111 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548328.1 protein_id gnl|my_center|LOCUS_06580 3853 3332 gene locus_tag LOCUS_06590 gene infC 3853 3332 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075917325.1 protein_id gnl|my_center|LOCUS_06590 4394 4080 gene locus_tag LOCUS_06600 4394 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 4733 4407 gene locus_tag LOCUS_06610 4733 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5398 4748 gene locus_tag LOCUS_06620 5398 4748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571333.1 protein_id gnl|my_center|LOCUS_06620 7384 5408 gene locus_tag LOCUS_06630 7384 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 7912 7580 gene locus_tag LOCUS_06640 7912 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 8053 9453 gene locus_tag LOCUS_06650 8053 9453 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020109.1 protein_id gnl|my_center|LOCUS_06650 11482 9551 gene locus_tag LOCUS_06660 gene thrS 11482 9551 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548338.1 protein_id gnl|my_center|LOCUS_06660 12705 11782 gene locus_tag LOCUS_06670 gene dnaI 12705 11782 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254494.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence284 >Feature sequence285 >Feature sequence286 18 932 gene locus_tag LOCUS_06680 18 932 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548309.1 protein_id gnl|my_center|LOCUS_06680 932 1492 gene locus_tag LOCUS_06690 932 1492 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548307.1 protein_id gnl|my_center|LOCUS_06690 1674 2387 gene locus_tag LOCUS_06700 1674 2387 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548305.1 protein_id gnl|my_center|LOCUS_06700 2380 3981 gene locus_tag LOCUS_06710 2380 3981 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254489.1 protein_id gnl|my_center|LOCUS_06710 5005 4031 gene locus_tag LOCUS_06720 gene yidC 5005 4031 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254488.1 protein_id gnl|my_center|LOCUS_06720 5311 5039 gene locus_tag LOCUS_06730 5311 5039 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548299.1 protein_id gnl|my_center|LOCUS_06730 5377 6141 gene locus_tag LOCUS_06740 5377 6141 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 protein_id gnl|my_center|LOCUS_06740 6223 6573 gene locus_tag LOCUS_06750 6223 6573 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254487.1 protein_id gnl|my_center|LOCUS_06750 6854 7903 gene locus_tag LOCUS_06760 gene pheS 6854 7903 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548296.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence287 <1 621 gene locus_tag LOCUS_06770 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254202.1:Cof-type HAD-IIB family hydrolase 709 1263 gene locus_tag LOCUS_06780 709 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 4169 1320 gene locus_tag LOCUS_06790 gene rpoC 4169 1320 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254109.1 protein_id gnl|my_center|LOCUS_06790 3379 3464 gene locus_tag LOCUS_t00250 3379 3464 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence288 >Feature sequence289 <1 712 gene locus_tag LOCUS_06800 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476405.1:C39 family peptidase >Feature sequence290 2979 1327 gene locus_tag LOCUS_06810 gene treC 2979 1327 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476387.1 protein_id gnl|my_center|LOCUS_06810 3696 2989 gene locus_tag LOCUS_06820 gene treR 3696 2989 CDS product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547196.1 protein_id gnl|my_center|LOCUS_06820 3909 5774 gene locus_tag LOCUS_06830 3909 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence291 2652 808 gene locus_tag LOCUS_06840 gene dnaK 2652 808 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547791.1 protein_id gnl|my_center|LOCUS_06840 3314 2709 gene locus_tag LOCUS_06850 gene grpE 3314 2709 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547792.1 protein_id gnl|my_center|LOCUS_06850 4405 3326 gene locus_tag LOCUS_06860 gene hrcA 4405 3326 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547794.1 protein_id gnl|my_center|LOCUS_06860 5446 4508 gene locus_tag LOCUS_06870 gene ribF 5446 4508 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547803.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence292 905 1834 gene locus_tag LOCUS_06880 905 1834 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254443.1 protein_id gnl|my_center|LOCUS_06880 >Feature sequence293 >Feature sequence294 773 447 gene locus_tag LOCUS_06890 773 447 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549116.1 protein_id gnl|my_center|LOCUS_06890 1423 785 gene locus_tag LOCUS_06900 gene tmk 1423 785 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254134.1 protein_id gnl|my_center|LOCUS_06900 1787 1551 gene locus_tag LOCUS_06910 1787 1551 CDS product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549114.1 protein_id gnl|my_center|LOCUS_06910 2389 1790 gene locus_tag LOCUS_06920 gene recR 2389 1790 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549113.1 protein_id gnl|my_center|LOCUS_06920 2720 2391 gene locus_tag LOCUS_06930 2720 2391 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549112.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence295 <1 574 gene locus_tag LOCUS_06940 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102086.1:neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein >Feature sequence296 >Feature sequence297 >Feature sequence298 260 345 gene locus_tag LOCUS_t00260 260 345 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence299 <1 506 gene locus_tag LOCUS_06950 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010922164.1:bifunctional metallophosphatase/5'-nucleotidase >Feature sequence300 >Feature sequence301 <1 597 gene locus_tag LOCUS_06960 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254482.1:RNA-guided endonuclease TnpB family protein >Feature sequence302 <1 2983 gene locus_tag LOCUS_06970 <1 2983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207215633.1:MucBP domain-containing protein 3427 3011 gene locus_tag LOCUS_06980 3427 3011 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273897.1 protein_id gnl|my_center|LOCUS_06980 4196 3525 gene locus_tag LOCUS_06990 4196 3525 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674825.1 protein_id gnl|my_center|LOCUS_06990 4422 5249 gene locus_tag LOCUS_07000 4422 5249 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728098.1 protein_id gnl|my_center|LOCUS_07000 5706 5251 gene locus_tag LOCUS_07010 5706 5251 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563458.1 protein_id gnl|my_center|LOCUS_07010 5820 6827 gene locus_tag LOCUS_07020 5820 6827 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303808.1 protein_id gnl|my_center|LOCUS_07020 6868 7596 gene locus_tag LOCUS_07030 6868 7596 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359155.1 protein_id gnl|my_center|LOCUS_07030 8139 7693 gene locus_tag LOCUS_07040 8139 7693 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_07040 8245 8619 gene locus_tag LOCUS_07050 8245 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07050 8616 8981 gene locus_tag LOCUS_07060 8616 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07060 9242 9072 gene locus_tag LOCUS_07070 9242 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 10189 9296 gene locus_tag LOCUS_07080 10189 9296 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040354.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence303 187 381 gene locus_tag LOCUS_07090 187 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 >Feature sequence304 255 1982 gene locus_tag LOCUS_07100 255 1982 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681715.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence305 529 257 gene locus_tag LOCUS_07110 529 257 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547110.1 protein_id gnl|my_center|LOCUS_07110 1692 673 gene locus_tag LOCUS_07120 1692 673 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102084.1 protein_id gnl|my_center|LOCUS_07120 <2415 1703 gene locus_tag LOCUS_07130 <2415 1703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102085.1:beta-glucoside-specific PTS transporter subunit IIABC >Feature sequence306 1023 439 gene locus_tag LOCUS_07140 1023 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 1882 1472 gene locus_tag LOCUS_07150 1882 1472 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475537.1 protein_id gnl|my_center|LOCUS_07150 2006 2878 gene locus_tag LOCUS_07160 2006 2878 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475551.1 protein_id gnl|my_center|LOCUS_07160 2951 3136 gene locus_tag LOCUS_07170 2951 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3624 3211 gene locus_tag LOCUS_07180 3624 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence307 >Feature sequence308 <1 659 gene locus_tag LOCUS_07190 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549701.1:ParB/RepB/Spo0J family partition protein 652 915 gene locus_tag LOCUS_07200 652 915 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549703.1 protein_id gnl|my_center|LOCUS_07200 989 2089 gene locus_tag LOCUS_07210 gene ychF 989 2089 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549709.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence309 1007 837 gene locus_tag LOCUS_07220 1007 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 1179 1106 gene locus_tag LOCUS_t00270 1179 1106 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1780 1289 gene locus_tag LOCUS_07230 1780 1289 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263276.1 protein_id gnl|my_center|LOCUS_07230 1884 3053 gene locus_tag LOCUS_07240 1884 3053 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037401.1 protein_id gnl|my_center|LOCUS_07240 3736 3113 gene locus_tag LOCUS_07250 3736 3113 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935569.1 protein_id gnl|my_center|LOCUS_07250 5482 3851 gene locus_tag LOCUS_07260 5482 3851 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476525.1 protein_id gnl|my_center|LOCUS_07260 6183 5701 gene locus_tag LOCUS_07270 6183 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549088.1 protein_id gnl|my_center|LOCUS_07270 6423 6229 gene locus_tag LOCUS_07280 6423 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 7085 6420 gene locus_tag LOCUS_07290 7085 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 7840 7445 gene locus_tag LOCUS_07300 gene rpsI 7840 7445 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 protein_id gnl|my_center|LOCUS_07300 8296 7853 gene locus_tag LOCUS_07310 gene rplM 8296 7853 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549054.1 protein_id gnl|my_center|LOCUS_07310 9190 8402 gene locus_tag LOCUS_07320 gene truA 9190 8402 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549053.1 protein_id gnl|my_center|LOCUS_07320 9987 9190 gene locus_tag LOCUS_07330 9987 9190 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549052.1 protein_id gnl|my_center|LOCUS_07330 10843 9980 gene locus_tag LOCUS_07340 10843 9980 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549051.1 protein_id gnl|my_center|LOCUS_07340 11667 10819 gene locus_tag LOCUS_07350 11667 10819 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549050.1 protein_id gnl|my_center|LOCUS_07350 12240 11857 gene locus_tag LOCUS_07360 gene rplQ 12240 11857 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549049.1 protein_id gnl|my_center|LOCUS_07360 13205 12267 gene locus_tag LOCUS_07370 13205 12267 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549048.1 protein_id gnl|my_center|LOCUS_07370 13638 13249 gene locus_tag LOCUS_07380 gene rpsK 13638 13249 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613292.1 protein_id gnl|my_center|LOCUS_07380 14018 13668 gene locus_tag LOCUS_07390 gene rpsM 14018 13668 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549046.1 protein_id gnl|my_center|LOCUS_07390 14396 14175 gene locus_tag LOCUS_07400 gene infA 14396 14175 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878178.1 protein_id gnl|my_center|LOCUS_07400 15125 14472 gene locus_tag LOCUS_07410 15125 14472 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549045.1 protein_id gnl|my_center|LOCUS_07410 16431 15136 gene locus_tag LOCUS_07420 gene secY 16431 15136 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549044.1 protein_id gnl|my_center|LOCUS_07420 16871 16431 gene locus_tag LOCUS_07430 gene rplO 16871 16431 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549043.1 protein_id gnl|my_center|LOCUS_07430 17077 16892 gene locus_tag LOCUS_07440 gene rpmD 17077 16892 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549042.1 protein_id gnl|my_center|LOCUS_07440 17601 17089 gene locus_tag LOCUS_07450 gene rpsE 17601 17089 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549041.1 protein_id gnl|my_center|LOCUS_07450 17977 17618 gene locus_tag LOCUS_07460 gene rplR 17977 17618 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 protein_id gnl|my_center|LOCUS_07460 18534 18004 gene locus_tag LOCUS_07470 gene rplF 18534 18004 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549039.1 protein_id gnl|my_center|LOCUS_07470 18957 18559 gene locus_tag LOCUS_07480 gene rpsH 18957 18559 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_07480 19165 18980 gene locus_tag LOCUS_07490 19165 18980 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549037.1 protein_id gnl|my_center|LOCUS_07490 19722 19180 gene locus_tag LOCUS_07500 gene rplE 19722 19180 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549036.1 protein_id gnl|my_center|LOCUS_07500 19981 19742 gene locus_tag LOCUS_07510 19981 19742 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549035.1 protein_id gnl|my_center|LOCUS_07510 20366 19998 gene locus_tag LOCUS_07520 gene rplN 20366 19998 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549034.1 protein_id gnl|my_center|LOCUS_07520 20663 20397 gene locus_tag LOCUS_07530 gene rpsQ 20663 20397 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254114.1 protein_id gnl|my_center|LOCUS_07530 20879 20682 gene locus_tag LOCUS_07540 gene rpmC 20879 20682 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549032.1 protein_id gnl|my_center|LOCUS_07540 21312 20869 gene locus_tag LOCUS_07550 gene rplP 21312 20869 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549031.1 protein_id gnl|my_center|LOCUS_07550 21983 21312 gene locus_tag LOCUS_07560 gene rpsC 21983 21312 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254113.1 protein_id gnl|my_center|LOCUS_07560 22350 21997 gene locus_tag LOCUS_07570 gene rplV 22350 21997 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549029.1 protein_id gnl|my_center|LOCUS_07570 22646 22371 gene locus_tag LOCUS_07580 gene rpsS 22646 22371 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356205.1 protein_id gnl|my_center|LOCUS_07580 23500 22664 gene locus_tag LOCUS_07590 gene rplB 23500 22664 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254111.1 protein_id gnl|my_center|LOCUS_07590 23822 23526 gene locus_tag LOCUS_07600 gene rplW 23822 23526 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549026.1 protein_id gnl|my_center|LOCUS_07600 24439 23822 gene locus_tag LOCUS_07610 gene rplD 24439 23822 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549025.1 protein_id gnl|my_center|LOCUS_07610 25083 24454 gene locus_tag LOCUS_07620 gene rplC 25083 24454 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549024.1 protein_id gnl|my_center|LOCUS_07620 25417 25109 gene locus_tag LOCUS_07630 gene rpsJ 25417 25109 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549023.1 protein_id gnl|my_center|LOCUS_07630 27889 25805 gene locus_tag LOCUS_07640 gene fusA 27889 25805 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549022.1 protein_id gnl|my_center|LOCUS_07640 28393 27923 gene locus_tag LOCUS_07650 gene rpsG 28393 27923 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549021.1 protein_id gnl|my_center|LOCUS_07650 28816 28409 gene locus_tag LOCUS_07660 gene rpsL 28816 28409 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549020.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence310 486 1715 gene locus_tag LOCUS_07670 486 1715 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_07670 1797 3590 gene locus_tag LOCUS_07680 1797 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence311 <1 754 gene locus_tag LOCUS_07690 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547031.1:threonine/serine exporter family protein >Feature sequence312 1340 2188 gene locus_tag LOCUS_07700 1340 2188 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182588486.1 protein_id gnl|my_center|LOCUS_07700 2729 2190 gene locus_tag LOCUS_07710 2729 2190 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_07710 2918 3340 gene locus_tag LOCUS_07720 2918 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 3384 3830 gene locus_tag LOCUS_07730 3384 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence313 273 22 gene locus_tag LOCUS_07740 273 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 1301 297 gene locus_tag LOCUS_07750 1301 297 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546711.1 protein_id gnl|my_center|LOCUS_07750 1462 1535 gene locus_tag LOCUS_t00280 1462 1535 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1540 1612 gene locus_tag LOCUS_t00290 1540 1612 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3306 1705 gene locus_tag LOCUS_07760 3306 1705 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476525.1 protein_id gnl|my_center|LOCUS_07760 4819 3479 gene locus_tag LOCUS_07770 4819 3479 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546706.1 protein_id gnl|my_center|LOCUS_07770 5522 4896 gene locus_tag LOCUS_07780 5522 4896 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254238.1 protein_id gnl|my_center|LOCUS_07780 5741 7972 gene locus_tag LOCUS_07790 5741 7972 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546703.1 protein_id gnl|my_center|LOCUS_07790 9560 8022 gene locus_tag LOCUS_07800 9560 8022 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546698.1 protein_id gnl|my_center|LOCUS_07800 10282 9557 gene locus_tag LOCUS_07810 10282 9557 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254236.1 protein_id gnl|my_center|LOCUS_07810 10623 10468 gene locus_tag LOCUS_07820 10623 10468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 11144 10786 gene locus_tag LOCUS_tm00010 11144 10786 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 12398 11211 gene locus_tag LOCUS_07830 12398 11211 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546683.1 protein_id gnl|my_center|LOCUS_07830 13431 12433 gene locus_tag LOCUS_07840 13431 12433 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546680.1 protein_id gnl|my_center|LOCUS_07840 14172 13573 gene locus_tag LOCUS_07850 14172 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 14380 14138 gene locus_tag LOCUS_07860 14380 14138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 14831 14394 gene locus_tag LOCUS_07870 14831 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 15151 14828 gene locus_tag LOCUS_07880 gene comGC 15151 14828 CDS product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546673.1 protein_id gnl|my_center|LOCUS_07880 <16016 15175 gene locus_tag LOCUS_07890 <16016 15175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021721297.1:type II secretion system F family protein >Feature sequence314 1067 324 gene locus_tag LOCUS_07900 1067 324 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262755.1 protein_id gnl|my_center|LOCUS_07900 1697 1236 gene locus_tag LOCUS_07910 1697 1236 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546753.1 protein_id gnl|my_center|LOCUS_07910 2039 1755 gene locus_tag LOCUS_07920 2039 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence315 2108 1380 gene locus_tag LOCUS_07930 2108 1380 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254511.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence316 <1 584 gene locus_tag LOCUS_07940 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003550037.1:prolyl aminopeptidase >Feature sequence317 126 554 gene locus_tag LOCUS_07950 126 554 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547875.1 protein_id gnl|my_center|LOCUS_07950 556 1986 gene locus_tag LOCUS_07960 gene ffh 556 1986 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547873.1 protein_id gnl|my_center|LOCUS_07960 2082 2354 gene locus_tag LOCUS_07970 gene rpsP 2082 2354 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547870.1 protein_id gnl|my_center|LOCUS_07970 2412 2915 gene locus_tag LOCUS_07980 gene rimM 2412 2915 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254408.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence318 2855 3328 gene locus_tag LOCUS_07990 2855 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4659 3841 gene locus_tag LOCUS_08000 4659 3841 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 protein_id gnl|my_center|LOCUS_08000 5061 4987 gene locus_tag LOCUS_t00300 5061 4987 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6462 5173 gene locus_tag LOCUS_08010 6462 5173 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641774.1 protein_id gnl|my_center|LOCUS_08010 6749 7984 gene locus_tag LOCUS_08020 6749 7984 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476517.1 protein_id gnl|my_center|LOCUS_08020 8094 8525 gene locus_tag LOCUS_08030 8094 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 8862 8569 gene locus_tag LOCUS_08040 8862 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 9151 12291 gene locus_tag LOCUS_08050 9151 12291 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149495417.1 protein_id gnl|my_center|LOCUS_08050 12372 13361 gene locus_tag LOCUS_08060 gene galE 12372 13361 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 protein_id gnl|my_center|LOCUS_08060 14291 13449 gene locus_tag LOCUS_08070 14291 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 14485 15855 gene locus_tag LOCUS_08080 14485 15855 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546123.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence319 262 371 gene locus_tag LOCUS_r00020 262 371 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1518 430 gene locus_tag LOCUS_08090 1518 430 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096637.1 protein_id gnl|my_center|LOCUS_08090 2894 1686 gene locus_tag LOCUS_08100 2894 1686 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642438.1 protein_id gnl|my_center|LOCUS_08100 3019 3933 gene locus_tag LOCUS_08110 3019 3933 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642437.1 protein_id gnl|my_center|LOCUS_08110 4167 5864 gene locus_tag LOCUS_08120 gene argS 4167 5864 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475862.1 protein_id gnl|my_center|LOCUS_08120 6106 6579 gene locus_tag LOCUS_08130 6106 6579 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475605.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence320 >Feature sequence321 457 1362 gene locus_tag LOCUS_08140 457 1362 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207505.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence322 827 597 gene locus_tag LOCUS_08150 827 597 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547128.1 protein_id gnl|my_center|LOCUS_08150 1703 831 gene locus_tag LOCUS_08160 1703 831 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254305.1 protein_id gnl|my_center|LOCUS_08160 1809 2471 gene locus_tag LOCUS_08170 1809 2471 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254304.1 protein_id gnl|my_center|LOCUS_08170 3689 2499 gene locus_tag LOCUS_08180 3689 2499 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547116.1 protein_id gnl|my_center|LOCUS_08180 3761 4660 gene locus_tag LOCUS_08190 3761 4660 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547115.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence323 343 1479 gene locus_tag LOCUS_08200 343 1479 CDS product IS630-like element ISMac18 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990809.1 protein_id gnl|my_center|LOCUS_08200 2061 2822 gene locus_tag LOCUS_08210 2061 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2828 2986 gene locus_tag LOCUS_08220 2828 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 2959 3486 gene locus_tag LOCUS_08230 2959 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08230 4068 3868 gene locus_tag LOCUS_08240 4068 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 4308 4664 gene locus_tag LOCUS_08250 4308 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 4821 5822 gene locus_tag LOCUS_08260 4821 5822 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613274.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence324 >Feature sequence325 >Feature sequence326 1877 795 gene locus_tag LOCUS_08270 1877 795 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254368.1 protein_id gnl|my_center|LOCUS_08270 2901 1942 gene locus_tag LOCUS_08280 gene mvaD 2901 1942 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547574.1 protein_id gnl|my_center|LOCUS_08280 3867 2956 gene locus_tag LOCUS_08290 gene mvk 3867 2956 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547572.1 protein_id gnl|my_center|LOCUS_08290 3999 7535 gene locus_tag LOCUS_08300 3999 7535 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254367.1 protein_id gnl|my_center|LOCUS_08300 7562 11245 gene locus_tag LOCUS_08310 gene addA 7562 11245 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254366.1 protein_id gnl|my_center|LOCUS_08310 11274 14072 gene locus_tag LOCUS_08320 11274 14072 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254365.1 protein_id gnl|my_center|LOCUS_08320 14059 14553 gene locus_tag LOCUS_08330 14059 14553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254364.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence327 1297 686 gene locus_tag LOCUS_08340 gene pcp 1297 686 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592791.1 protein_id gnl|my_center|LOCUS_08340 1394 2146 gene locus_tag LOCUS_08350 1394 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 3128 2217 gene locus_tag LOCUS_08360 gene metA 3128 2217 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263079.1 protein_id gnl|my_center|LOCUS_08360 4723 3284 gene locus_tag LOCUS_08370 gene gapN 4723 3284 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262986.1 protein_id gnl|my_center|LOCUS_08370 6458 4938 gene locus_tag LOCUS_08380 6458 4938 CDS product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050337793.1 protein_id gnl|my_center|LOCUS_08380 7383 6460 gene locus_tag LOCUS_08390 7383 6460 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900534.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence328 >Feature sequence329 345 908 gene locus_tag LOCUS_08400 345 908 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227667.1 protein_id gnl|my_center|LOCUS_08400 1044 1757 gene locus_tag LOCUS_08410 1044 1757 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254280.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence330 >Feature sequence331 2926 1835 gene locus_tag LOCUS_08420 2926 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 4052 3141 gene locus_tag LOCUS_08430 4052 3141 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254041.1 protein_id gnl|my_center|LOCUS_08430 4299 4165 gene locus_tag LOCUS_08440 4299 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548644.1 protein_id gnl|my_center|LOCUS_08440 4826 5971 gene locus_tag LOCUS_08450 4826 5971 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254034.1 protein_id gnl|my_center|LOCUS_08450 6100 6654 gene locus_tag LOCUS_08460 6100 6654 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704892.1 protein_id gnl|my_center|LOCUS_08460 6671 7570 gene locus_tag LOCUS_08470 gene htpX 6671 7570 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254032.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence332 >Feature sequence333 95 250 gene locus_tag LOCUS_08480 95 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence334 563 1411 gene locus_tag LOCUS_08490 563 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1524 2438 gene locus_tag LOCUS_08500 1524 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 2698 4065 gene locus_tag LOCUS_08510 2698 4065 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963597.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence335 >Feature sequence336 1051 977 gene locus_tag LOCUS_t00310 1051 977 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1125 1054 gene locus_tag LOCUS_t00320 1125 1054 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1329 1254 gene locus_tag LOCUS_t00330 1329 1254 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1429 1337 gene locus_tag LOCUS_t00340 1429 1337 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1510 1436 gene locus_tag LOCUS_t00350 1510 1436 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1630 1521 gene locus_tag LOCUS_r00030 1630 1521 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence337 >Feature sequence338 5598 436 gene locus_tag LOCUS_08520 5598 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 6596 5595 gene locus_tag LOCUS_08530 6596 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 8581 6596 gene locus_tag LOCUS_08540 8581 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 10118 8586 gene locus_tag LOCUS_08550 10118 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 <11472 10631 gene locus_tag LOCUS_08560 <11472 10631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836414.1:AraC family transcriptional regulator >Feature sequence339 <1 1927 gene locus_tag LOCUS_08570 <1 1927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068390.1:glycosyl hydrolase 53 family protein >Feature sequence340 1374 34 gene locus_tag LOCUS_08580 gene brnQ 1374 34 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437758.1 protein_id gnl|my_center|LOCUS_08580 1485 1838 gene locus_tag LOCUS_08590 1485 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1851 2357 gene locus_tag LOCUS_08600 1851 2357 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262000.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence341 <1 1105 gene locus_tag LOCUS_08610 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254350.1:GH25 family lysozyme 1345 1187 gene locus_tag LOCUS_08620 1345 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1849 1502 gene locus_tag LOCUS_08630 1849 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence342 >Feature sequence343 <1 716 gene locus_tag LOCUS_08640 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546442.1:PTS transporter subunit EIIC 779 856 gene locus_tag LOCUS_t00360 779 856 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 891 1082 gene locus_tag LOCUS_08650 891 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1308 1156 gene locus_tag LOCUS_08660 1308 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1289 2215 gene locus_tag LOCUS_08670 1289 2215 CDS product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185920.1 protein_id gnl|my_center|LOCUS_08670 2453 3736 gene locus_tag LOCUS_08680 2453 3736 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700158.1 protein_id gnl|my_center|LOCUS_08680 3850 5100 gene locus_tag LOCUS_08690 3850 5100 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548246.1 protein_id gnl|my_center|LOCUS_08690 7269 5182 gene locus_tag LOCUS_08700 7269 5182 CDS product putative ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475545.1 protein_id gnl|my_center|LOCUS_08700 7551 7309 gene locus_tag LOCUS_08710 7551 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 8011 9465 gene locus_tag LOCUS_08720 8011 9465 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704100.1 protein_id gnl|my_center|LOCUS_08720 9714 9541 gene locus_tag LOCUS_08730 9714 9541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08730 10989 9796 gene locus_tag LOCUS_08740 10989 9796 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704100.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08740 11356 11159 gene locus_tag LOCUS_08750 11356 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 11458 12600 gene locus_tag LOCUS_08760 gene wecB 11458 12600 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254207.1 protein_id gnl|my_center|LOCUS_08760 13119 12640 gene locus_tag LOCUS_08770 13119 12640 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546446.1 protein_id gnl|my_center|LOCUS_08770 13558 13112 gene locus_tag LOCUS_08780 13558 13112 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546448.1 protein_id gnl|my_center|LOCUS_08780 13706 14533 gene locus_tag LOCUS_08790 gene map 13706 14533 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254208.1 protein_id gnl|my_center|LOCUS_08790 14536 15450 gene locus_tag LOCUS_08800 14536 15450 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546451.1 protein_id gnl|my_center|LOCUS_08800 15566 16477 gene locus_tag LOCUS_08810 gene galU 15566 16477 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254551.1 protein_id gnl|my_center|LOCUS_08810 16822 16541 gene locus_tag LOCUS_08820 16822 16541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 16901 17872 gene locus_tag LOCUS_08830 16901 17872 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254232.1 protein_id gnl|my_center|LOCUS_08830 <19033 18238 gene locus_tag LOCUS_08840 <19033 18238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546467.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD >Feature sequence344 <1 618 gene locus_tag LOCUS_08850 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263364.1:zinc-dependent alcohol dehydrogenase family protein 672 926 gene locus_tag LOCUS_08860 672 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 930 2192 gene locus_tag LOCUS_08870 930 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence345 72 1589 gene locus_tag LOCUS_08880 72 1589 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548835.1 protein_id gnl|my_center|LOCUS_08880 1960 1700 gene locus_tag LOCUS_08890 1960 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1917 3425 gene locus_tag LOCUS_08900 1917 3425 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548835.1 protein_id gnl|my_center|LOCUS_08900 3601 5238 gene locus_tag LOCUS_08910 3601 5238 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548835.1 protein_id gnl|my_center|LOCUS_08910 5446 7089 gene locus_tag LOCUS_08920 5446 7089 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154881464.1 protein_id gnl|my_center|LOCUS_08920 7517 8437 gene locus_tag LOCUS_08930 7517 8437 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254073.1 protein_id gnl|my_center|LOCUS_08930 8458 9489 gene locus_tag LOCUS_08940 8458 9489 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254074.1 protein_id gnl|my_center|LOCUS_08940 9503 10546 gene locus_tag LOCUS_08950 9503 10546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548860.1 protein_id gnl|my_center|LOCUS_08950 10561 11514 gene locus_tag LOCUS_08960 10561 11514 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548861.1 protein_id gnl|my_center|LOCUS_08960 12899 11586 gene locus_tag LOCUS_08970 12899 11586 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254075.1 protein_id gnl|my_center|LOCUS_08970 13087 13341 gene locus_tag LOCUS_08980 13087 13341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 14706 13393 gene locus_tag LOCUS_08990 14706 13393 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254075.1 protein_id gnl|my_center|LOCUS_08990 15227 14802 gene locus_tag LOCUS_09000 15227 14802 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254076.1 protein_id gnl|my_center|LOCUS_09000 15445 15906 gene locus_tag LOCUS_09010 gene greA 15445 15906 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548866.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence346 <1491 288 gene locus_tag LOCUS_09020 <1491 288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003601491.1:NAD-dependent malic enzyme >Feature sequence347 <1 1012 gene locus_tag LOCUS_09030 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003702957.1:Fe-S cluster assembly protein SufD >Feature sequence348 512 2137 gene locus_tag LOCUS_09040 512 2137 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254098.1 protein_id gnl|my_center|LOCUS_09040 2272 3231 gene locus_tag LOCUS_09050 2272 3231 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549622.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence349 >Feature sequence350 374 2077 gene locus_tag LOCUS_09060 374 2077 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549626.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence351 <1 1086 gene locus_tag LOCUS_09070 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584099.1:GGDEF domain-containing protein >Feature sequence352 >Feature sequence353 114 575 gene locus_tag LOCUS_09080 gene smpB 114 575 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550138.1 protein_id gnl|my_center|LOCUS_09080 1099 1269 gene locus_tag LOCUS_09090 1099 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1281 2516 gene locus_tag LOCUS_09100 1281 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2513 3058 gene locus_tag LOCUS_09110 2513 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09110 3004 3186 gene locus_tag LOCUS_09120 3004 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09120 3189 3356 gene locus_tag LOCUS_09130 3189 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 3622 4956 gene locus_tag LOCUS_09140 3622 4956 CDS product maltose-6'-phosphate glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549970.1 protein_id gnl|my_center|LOCUS_09140 5058 6941 gene locus_tag LOCUS_09150 5058 6941 CDS product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546418.1 protein_id gnl|my_center|LOCUS_09150 7026 7808 gene locus_tag LOCUS_09160 7026 7808 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254203.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence354 >Feature sequence355 455 171 gene locus_tag LOCUS_09170 455 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2040 538 gene locus_tag LOCUS_09180 2040 538 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254071.1 protein_id gnl|my_center|LOCUS_09180 2604 2518 gene locus_tag LOCUS_t00370 2604 2518 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence356 853 296 gene locus_tag LOCUS_09190 853 296 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547188.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence357 183 64 gene locus_tag LOCUS_09200 183 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence358 608 1774 gene locus_tag LOCUS_09210 608 1774 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644494.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence359 435 1139 gene locus_tag LOCUS_09220 435 1139 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547397.1 protein_id gnl|my_center|LOCUS_09220 1266 2177 gene locus_tag LOCUS_09230 gene fba 1266 2177 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254510.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence360 >Feature sequence361 >Feature sequence362 >Feature sequence363 >Feature sequence364 >Feature sequence365 >Feature sequence366 >Feature sequence367 >Feature sequence368 >Feature sequence369 >Feature sequence370 >Feature sequence371 1249 659 gene locus_tag LOCUS_09240 1249 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1913 1725 gene locus_tag LOCUS_09250 1913 1725 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547962.1 protein_id gnl|my_center|LOCUS_09250 2848 2003 gene locus_tag LOCUS_09260 2848 2003 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643460.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence372 821 33 gene locus_tag LOCUS_09270 821 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence373 >Feature sequence374 >Feature sequence375 2 334 gene locus_tag LOCUS_09280 2 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence376 >Feature sequence377 >Feature sequence378 >Feature sequence379 >Feature sequence380 >Feature sequence381 1201 971 gene locus_tag LOCUS_09290 1201 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1689 1249 gene locus_tag LOCUS_09300 1689 1249 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546746.1 protein_id gnl|my_center|LOCUS_09300 3140 1701 gene locus_tag LOCUS_09310 gene atpD 3140 1701 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254247.1 protein_id gnl|my_center|LOCUS_09310 4122 3160 gene locus_tag LOCUS_09320 4122 3160 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546744.1 protein_id gnl|my_center|LOCUS_09320 5686 4133 gene locus_tag LOCUS_09330 gene atpA 5686 4133 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254246.1 protein_id gnl|my_center|LOCUS_09330 4807 4864 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6251 5709 gene locus_tag LOCUS_09340 6251 5709 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546742.1 protein_id gnl|my_center|LOCUS_09340 6757 6251 gene locus_tag LOCUS_09350 gene atpF 6757 6251 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546741.1 protein_id gnl|my_center|LOCUS_09350 7037 6813 gene locus_tag LOCUS_09360 gene atpE 7037 6813 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029779745.1 protein_id gnl|my_center|LOCUS_09360 7775 7056 gene locus_tag LOCUS_09370 gene atpB 7775 7056 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546739.1 protein_id gnl|my_center|LOCUS_09370 8513 7884 gene locus_tag LOCUS_09380 gene upp 8513 7884 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546738.1 protein_id gnl|my_center|LOCUS_09380 9608 8613 gene locus_tag LOCUS_09390 9608 8613 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546737.1 protein_id gnl|my_center|LOCUS_09390 10450 9608 gene locus_tag LOCUS_09400 gene prmC 10450 9608 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546736.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence382 >Feature sequence383 >Feature sequence384 <1388 147 gene locus_tag LOCUS_09410 <1388 147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547162.1:dipeptidase PepV >Feature sequence385 >Feature sequence386 >Feature sequence387 >Feature sequence388 >Feature sequence389 >Feature sequence390 >Feature sequence391 <1 1125 gene locus_tag LOCUS_09420 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025079807.1:serine hydrolase domain-containing protein 1233 2348 gene locus_tag LOCUS_09430 1233 2348 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079807.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence392 >Feature sequence393 >Feature sequence394 <2099 743 gene locus_tag LOCUS_09440 <2099 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454973.1:EAL domain-containing protein >Feature sequence395 >Feature sequence396 >Feature sequence397 >Feature sequence398 72 233 gene locus_tag LOCUS_09450 72 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence399 <1 2902 gene locus_tag LOCUS_09460 <1 2902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002352268.1:glucosyltransferase GtfB 2953 6510 gene locus_tag LOCUS_09470 2953 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 6644 8833 gene locus_tag LOCUS_09480 6644 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 11309 8895 gene locus_tag LOCUS_09490 11309 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 12150 11458 gene locus_tag LOCUS_09500 12150 11458 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013854628.1 protein_id gnl|my_center|LOCUS_09500 12946 12293 gene locus_tag LOCUS_09510 12946 12293 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549989.1 protein_id gnl|my_center|LOCUS_09510 13611 12949 gene locus_tag LOCUS_09520 13611 12949 CDS product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549990.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence400 794 468 gene locus_tag LOCUS_09530 794 468 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 protein_id gnl|my_center|LOCUS_09530 1250 843 gene locus_tag LOCUS_09540 1250 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1405 2052 gene locus_tag LOCUS_09550 1405 2052 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100859.1 protein_id gnl|my_center|LOCUS_09550 2653 2432 gene locus_tag LOCUS_09560 2653 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 2851 2669 gene locus_tag LOCUS_09570 2851 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2967 3734 gene locus_tag LOCUS_09580 2967 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 4433 3783 gene locus_tag LOCUS_09590 4433 3783 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289290.1 protein_id gnl|my_center|LOCUS_09590 4583 4458 gene locus_tag LOCUS_09600 4583 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 5032 4601 gene locus_tag LOCUS_09610 5032 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09610 5719 5042 gene locus_tag LOCUS_09620 5719 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09620 6173 5850 gene locus_tag LOCUS_09630 6173 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 7404 6550 gene locus_tag LOCUS_09640 7404 6550 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906177.1 protein_id gnl|my_center|LOCUS_09640 8067 7528 gene locus_tag LOCUS_09650 8067 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 9002 8250 gene locus_tag LOCUS_09660 9002 8250 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_09660 9370 9023 gene locus_tag LOCUS_09670 9370 9023 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642289.1 protein_id gnl|my_center|LOCUS_09670 <10166 9454 gene locus_tag LOCUS_09680 <10166 9454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002287470.1:LysR family transcriptional regulator >Feature sequence401 509 33 gene locus_tag LOCUS_09690 509 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1653 934 gene locus_tag LOCUS_09700 1653 934 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357197.1 protein_id gnl|my_center|LOCUS_09700 2243 4135 gene locus_tag LOCUS_09710 2243 4135 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254405.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence402 >Feature sequence403 2102 915 gene locus_tag LOCUS_09720 2102 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 4679 2256 gene locus_tag LOCUS_09730 gene ppsA 4679 2256 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646028.1 protein_id gnl|my_center|LOCUS_09730 6634 5015 gene locus_tag LOCUS_09740 6634 5015 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548498.1 protein_id gnl|my_center|LOCUS_09740 9142 6728 gene locus_tag LOCUS_09750 gene leuS 9142 6728 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548508.1 protein_id gnl|my_center|LOCUS_09750 9440 10111 gene locus_tag LOCUS_09760 9440 10111 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254516.1 protein_id gnl|my_center|LOCUS_09760 11613 10162 gene locus_tag LOCUS_09770 11613 10162 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548513.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence404 <1 1802 gene locus_tag LOCUS_09780 <1 1802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549162.1:DNA mismatch repair endonuclease MutL >Feature sequence405 85 540 gene locus_tag LOCUS_09790 gene rplI 85 540 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549343.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence406 912 646 gene locus_tag LOCUS_09800 912 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1771 1001 gene locus_tag LOCUS_09810 1771 1001 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568116.1 protein_id gnl|my_center|LOCUS_09810 1947 2120 gene locus_tag LOCUS_09820 1947 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2107 3438 gene locus_tag LOCUS_09830 2107 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3440 4228 gene locus_tag LOCUS_09840 3440 4228 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721605.1 protein_id gnl|my_center|LOCUS_09840 4383 4670 gene locus_tag LOCUS_09850 4383 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4874 5608 gene locus_tag LOCUS_09860 4874 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 5629 5880 gene locus_tag LOCUS_09870 5629 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 6077 6745 gene locus_tag LOCUS_09880 6077 6745 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254077.1 protein_id gnl|my_center|LOCUS_09880 6881 6811 gene locus_tag LOCUS_t00380 6881 6811 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7062 8087 gene locus_tag LOCUS_09890 gene trpS 7062 8087 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548870.1 protein_id gnl|my_center|LOCUS_09890 8125 8571 gene locus_tag LOCUS_09900 8125 8571 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548871.1 protein_id gnl|my_center|LOCUS_09900 8636 9166 gene locus_tag LOCUS_09910 8636 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence407 <1 634 gene locus_tag LOCUS_09920 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021721377.1:flavodoxin 732 1196 gene locus_tag LOCUS_09930 732 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3147 1258 gene locus_tag LOCUS_09940 3147 1258 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549988.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence408 >Feature sequence409 1031 117 gene locus_tag LOCUS_09950 1031 117 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254356.1 protein_id gnl|my_center|LOCUS_09950 1485 1033 gene locus_tag LOCUS_09960 gene lspA 1485 1033 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613370.1 protein_id gnl|my_center|LOCUS_09960 3176 1497 gene locus_tag LOCUS_09970 3176 1497 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254358.1 protein_id gnl|my_center|LOCUS_09970 3525 3169 gene locus_tag LOCUS_09980 3525 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 4904 3678 gene locus_tag LOCUS_09990 4904 3678 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254359.1 protein_id gnl|my_center|LOCUS_09990 6060 4936 gene locus_tag LOCUS_10000 6060 4936 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547533.1 protein_id gnl|my_center|LOCUS_10000 7023 6565 gene locus_tag LOCUS_10010 7023 6565 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547534.1 protein_id gnl|my_center|LOCUS_10010 7659 7099 gene locus_tag LOCUS_10020 7659 7099 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547535.1 protein_id gnl|my_center|LOCUS_10020 7826 8458 gene locus_tag LOCUS_10030 gene recU 7826 8458 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254360.1 protein_id gnl|my_center|LOCUS_10030 8445 10745 gene locus_tag LOCUS_10040 8445 10745 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254361.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence410 731 135 gene locus_tag LOCUS_10050 731 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 852 718 gene locus_tag LOCUS_10060 852 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence411 >Feature sequence412 1598 717 gene locus_tag LOCUS_10070 1598 717 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642522.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence413 >Feature sequence414 1644 2618 gene locus_tag LOCUS_10080 gene bsh 1644 2618 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287105.1 protein_id gnl|my_center|LOCUS_10080 4343 2691 gene locus_tag LOCUS_10090 4343 2691 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_10090 5020 4343 gene locus_tag LOCUS_10100 5020 4343 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_10100 5747 5109 gene locus_tag LOCUS_10110 gene phoU 5747 5109 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_10110 6520 5765 gene locus_tag LOCUS_10120 gene pstB 6520 5765 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_10120 7398 6523 gene locus_tag LOCUS_10130 gene pstA 7398 6523 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994131.1 protein_id gnl|my_center|LOCUS_10130 8306 7398 gene locus_tag LOCUS_10140 gene pstC 8306 7398 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965013.1 protein_id gnl|my_center|LOCUS_10140 9200 8310 gene locus_tag LOCUS_10150 9200 8310 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722632.1 protein_id gnl|my_center|LOCUS_10150 9859 9575 gene locus_tag LOCUS_10160 9859 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 10040 9852 gene locus_tag LOCUS_10170 10040 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 10379 10041 gene locus_tag LOCUS_10180 10379 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 10669 10397 gene locus_tag LOCUS_10190 10669 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 10929 10747 gene locus_tag LOCUS_10200 10929 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 11207 10926 gene locus_tag LOCUS_10210 11207 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 11454 11260 gene locus_tag LOCUS_10220 11454 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence415 2 163 gene locus_tag LOCUS_10230 2 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 <1136 226 gene locus_tag LOCUS_10240 <1136 226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549861.1:GTPase HflX >Feature sequence416 >Feature sequence417 515 1462 gene locus_tag LOCUS_10250 gene fmt 515 1462 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547919.1 protein_id gnl|my_center|LOCUS_10250 1452 2768 gene locus_tag LOCUS_10260 gene rsmB 1452 2768 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254418.1 protein_id gnl|my_center|LOCUS_10260 2774 3529 gene locus_tag LOCUS_10270 2774 3529 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 protein_id gnl|my_center|LOCUS_10270 3519 5540 gene locus_tag LOCUS_10280 gene pknB 3519 5540 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254416.1 protein_id gnl|my_center|LOCUS_10280 5541 6434 gene locus_tag LOCUS_10290 gene rsgA 5541 6434 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547915.1 protein_id gnl|my_center|LOCUS_10290 6457 7140 gene locus_tag LOCUS_10300 6457 7140 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254415.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence418 2267 1008 gene locus_tag LOCUS_10310 2267 1008 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254461.1 protein_id gnl|my_center|LOCUS_10310 2935 2270 gene locus_tag LOCUS_10320 2935 2270 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548121.1 protein_id gnl|my_center|LOCUS_10320 3550 2942 gene locus_tag LOCUS_10330 3550 2942 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548123.1 protein_id gnl|my_center|LOCUS_10330 3629 5060 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aggatcacccccacttacgtggggaatac 5962 5090 gene locus_tag LOCUS_10340 gene cas2e 5962 5090 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 protein_id gnl|my_center|LOCUS_10340 6909 5959 gene locus_tag LOCUS_10350 gene cas1e 6909 5959 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 protein_id gnl|my_center|LOCUS_10350 7535 6912 gene locus_tag LOCUS_10360 gene cas6e 7535 6912 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_10360 8246 7548 gene locus_tag LOCUS_10370 gene cas5e 8246 7548 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 protein_id gnl|my_center|LOCUS_10370 9303 8227 gene locus_tag LOCUS_10380 gene cas7e 9303 8227 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 protein_id gnl|my_center|LOCUS_10380 9965 9315 gene locus_tag LOCUS_10390 gene casB 9965 9315 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586648.1 protein_id gnl|my_center|LOCUS_10390 11672 9975 gene locus_tag LOCUS_10400 11672 9975 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674071.1 protein_id gnl|my_center|LOCUS_10400 <14037 11675 gene locus_tag LOCUS_10410 <14037 11675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674070.1:CRISPR-associated helicase/endonuclease Cas3 >Feature sequence419 1419 202 gene locus_tag LOCUS_10420 1419 202 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930666.1 protein_id gnl|my_center|LOCUS_10420 1542 2411 gene locus_tag LOCUS_10430 1542 2411 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930045.1 protein_id gnl|my_center|LOCUS_10430 3053 2463 gene locus_tag LOCUS_10440 3053 2463 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261995.1 protein_id gnl|my_center|LOCUS_10440 3355 3164 gene locus_tag LOCUS_10450 3355 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence420 1657 1136 gene locus_tag LOCUS_10460 1657 1136 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643199.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence421 <796 50 gene locus_tag LOCUS_10470 <796 50 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254571.1:zinc ABC transporter substrate-binding protein >Feature sequence422 >Feature sequence423 811 506 gene locus_tag LOCUS_10480 gene gatC 811 506 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546283.1 protein_id gnl|my_center|LOCUS_10480 1968 823 gene locus_tag LOCUS_10490 1968 823 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546280.1 protein_id gnl|my_center|LOCUS_10490 <3260 1965 gene locus_tag LOCUS_10500 <3260 1965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546277.1:NAD-dependent DNA ligase LigA >Feature sequence424 <1 1073 gene locus_tag LOCUS_10510 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548730.1:YibE/F family protein >Feature sequence425 >Feature sequence426 949 626 gene locus_tag LOCUS_10520 949 626 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287484.1 protein_id gnl|my_center|LOCUS_10520 1658 933 gene locus_tag LOCUS_10530 1658 933 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356628.1 protein_id gnl|my_center|LOCUS_10530 2653 1742 gene locus_tag LOCUS_10540 2653 1742 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549598.1 protein_id gnl|my_center|LOCUS_10540 3546 2806 gene locus_tag LOCUS_10550 3546 2806 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254611.1 protein_id gnl|my_center|LOCUS_10550 4357 3548 gene locus_tag LOCUS_10560 4357 3548 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546636.1 protein_id gnl|my_center|LOCUS_10560 5294 4422 gene locus_tag LOCUS_10570 5294 4422 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549553.1 protein_id gnl|my_center|LOCUS_10570 6597 5287 gene locus_tag LOCUS_10580 6597 5287 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549552.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence427 1146 517 gene locus_tag LOCUS_10590 1146 517 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287269.1 protein_id gnl|my_center|LOCUS_10590 3150 1150 gene locus_tag LOCUS_10600 3150 1150 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475586.1 protein_id gnl|my_center|LOCUS_10600 3666 3277 gene locus_tag LOCUS_10610 3666 3277 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548621.1 protein_id gnl|my_center|LOCUS_10610 3829 4053 gene locus_tag LOCUS_10620 3829 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 <4932 4224 gene locus_tag LOCUS_10630 <4932 4224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549525.1:D-alanyl-lipoteichoic acid biosynthesis protein DltD >Feature sequence428 321 560 gene locus_tag LOCUS_10640 321 560 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547938.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence429 29 104 gene locus_tag LOCUS_t00390 29 104 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence430 >Feature sequence431 1911 775 gene locus_tag LOCUS_10650 1911 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence432 273 992 gene locus_tag LOCUS_10660 273 992 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_10660 994 1260 gene locus_tag LOCUS_10670 994 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 <2261 1353 gene locus_tag LOCUS_10680 <2261 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102053.1:FAD-dependent oxidoreductase >Feature sequence433 >Feature sequence434 2200 833 gene locus_tag LOCUS_10690 2200 833 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548990.1 protein_id gnl|my_center|LOCUS_10690 2566 2315 gene locus_tag LOCUS_10700 2566 2315 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548978.1 protein_id gnl|my_center|LOCUS_10700 >Feature sequence435 >Feature sequence436 <1 1005 gene locus_tag LOCUS_10710 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546285.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA 1011 2441 gene locus_tag LOCUS_10720 gene gatB 1011 2441 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254176.1 protein_id gnl|my_center|LOCUS_10720 2480 3406 gene locus_tag LOCUS_10730 2480 3406 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546288.1 protein_id gnl|my_center|LOCUS_10730 3466 4194 gene locus_tag LOCUS_10740 3466 4194 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721265.1 protein_id gnl|my_center|LOCUS_10740 4191 5537 gene locus_tag LOCUS_10750 gene rlmD 4191 5537 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546298.1 protein_id gnl|my_center|LOCUS_10750 5564 6511 gene locus_tag LOCUS_10760 5564 6511 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731552.1 protein_id gnl|my_center|LOCUS_10760 6508 7647 gene locus_tag LOCUS_10770 6508 7647 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836378.1 protein_id gnl|my_center|LOCUS_10770 7770 8327 gene locus_tag LOCUS_10780 7770 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence437 <1 558 gene locus_tag LOCUS_10790 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546733.1:Mur ligase family protein >Feature sequence438 404 1948 gene locus_tag LOCUS_10800 404 1948 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949006.1 protein_id gnl|my_center|LOCUS_10800 2297 2857 gene locus_tag LOCUS_10810 2297 2857 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_10810 3920 2889 gene locus_tag LOCUS_10820 3920 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4021 4677 gene locus_tag LOCUS_10830 4021 4677 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966864.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence439 457 32 gene locus_tag LOCUS_10840 gene msrB 457 32 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598806.1 protein_id gnl|my_center|LOCUS_10840 1538 546 gene locus_tag LOCUS_10850 1538 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2976 2098 gene locus_tag LOCUS_10860 2976 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3106 5076 gene locus_tag LOCUS_10870 3106 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 6251 5187 gene locus_tag LOCUS_10880 gene rfbB 6251 5187 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_10880 6857 6333 gene locus_tag LOCUS_10890 gene dhaS 6857 6333 CDS product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704309.1 protein_id gnl|my_center|LOCUS_10890 7602 6898 gene locus_tag LOCUS_10900 7602 6898 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548130.1 protein_id gnl|my_center|LOCUS_10900 7979 7605 gene locus_tag LOCUS_10910 gene dhaM 7979 7605 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548129.1 protein_id gnl|my_center|LOCUS_10910 8562 7981 gene locus_tag LOCUS_10920 gene dhaL 8562 7981 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704296.1 protein_id gnl|my_center|LOCUS_10920 9570 8575 gene locus_tag LOCUS_10930 gene dhaK 9570 8575 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701020.1 protein_id gnl|my_center|LOCUS_10930 10807 9908 gene locus_tag LOCUS_10940 10807 9908 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101137.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence440 278 2161 gene locus_tag LOCUS_10950 278 2161 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643065.1 protein_id gnl|my_center|LOCUS_10950 2166 5183 gene locus_tag LOCUS_10960 2166 5183 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_10960 5235 6233 gene locus_tag LOCUS_10970 5235 6233 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475724.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence441 <1 859 gene locus_tag LOCUS_10980 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003640478.1:MetQ/NlpA family ABC transporter substrate-binding protein 1328 903 gene locus_tag LOCUS_10990 1328 903 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254019.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence442 1192 29 gene locus_tag LOCUS_11000 1192 29 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546460.1 protein_id gnl|my_center|LOCUS_11000 <2209 1196 gene locus_tag LOCUS_11010 <2209 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546459.1:hydroxymethylglutaryl-CoA reductase >Feature sequence443 1778 267 gene locus_tag LOCUS_11020 1778 267 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641096.1 protein_id gnl|my_center|LOCUS_11020 2826 1975 gene locus_tag LOCUS_11030 2826 1975 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546367.1 protein_id gnl|my_center|LOCUS_11030 3540 2872 gene locus_tag LOCUS_11040 3540 2872 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546369.1 protein_id gnl|my_center|LOCUS_11040 4193 3552 gene locus_tag LOCUS_11050 4193 3552 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701287.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence444 >Feature sequence445 <1 802 gene locus_tag LOCUS_11060 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475674.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme 795 1850 gene locus_tag LOCUS_11070 795 1850 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475676.1 protein_id gnl|my_center|LOCUS_11070 1926 2007 gene locus_tag LOCUS_t00400 1926 2007 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2012 2085 gene locus_tag LOCUS_t00410 2012 2085 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2346 3956 gene locus_tag LOCUS_11080 2346 3956 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101336.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence446 >Feature sequence447 313 2040 gene locus_tag LOCUS_11090 313 2040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254586.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence448 >Feature sequence449 <1 3235 gene locus_tag LOCUS_11100 <1 3235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243128.1:arabinogalactan endo-beta-1,4-galactanase 4300 3686 gene locus_tag LOCUS_11110 4300 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 4893 4600 gene locus_tag LOCUS_11120 4893 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 5107 5385 gene locus_tag LOCUS_11130 5107 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 5454 8306 gene locus_tag LOCUS_11140 5454 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence450 <1 585 gene locus_tag LOCUS_11150 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042680609.1:DUF438 domain-containing protein 684 1904 gene locus_tag LOCUS_11160 684 1904 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548780.1 protein_id gnl|my_center|LOCUS_11160 2034 2372 gene locus_tag LOCUS_11170 2034 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2396 4348 gene locus_tag LOCUS_11180 2396 4348 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548782.1 protein_id gnl|my_center|LOCUS_11180 6725 4659 gene locus_tag LOCUS_11190 6725 4659 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087236515.1 protein_id gnl|my_center|LOCUS_11190 7292 6879 gene locus_tag LOCUS_11200 7292 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548785.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence451 326 177 gene locus_tag LOCUS_11210 326 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1808 717 gene locus_tag LOCUS_11220 1808 717 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546967.1 protein_id gnl|my_center|LOCUS_11220 2447 1869 gene locus_tag LOCUS_11230 2447 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2895 2500 gene locus_tag LOCUS_11240 2895 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 3227 2901 gene locus_tag LOCUS_11250 3227 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 3398 3604 gene locus_tag LOCUS_11260 3398 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3636 4358 gene locus_tag LOCUS_11270 3636 4358 CDS product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922216.1 protein_id gnl|my_center|LOCUS_11270 4345 4671 gene locus_tag LOCUS_11280 4345 4671 CDS product DUF771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475911.1 protein_id gnl|my_center|LOCUS_11280 4933 5214 gene locus_tag LOCUS_11290 4933 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 5201 5479 gene locus_tag LOCUS_11300 5201 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 5472 6149 gene locus_tag LOCUS_11310 5472 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 6146 6457 gene locus_tag LOCUS_11320 6146 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 6454 7263 gene locus_tag LOCUS_11330 6454 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 7276 7533 gene locus_tag LOCUS_11340 7276 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 7530 8336 gene locus_tag LOCUS_11350 7530 8336 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057803058.1 protein_id gnl|my_center|LOCUS_11350 8542 9015 gene locus_tag LOCUS_11360 8542 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 9012 9182 gene locus_tag LOCUS_11370 9012 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 9184 9717 gene locus_tag LOCUS_11380 gene ssb 9184 9717 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288368.1 protein_id gnl|my_center|LOCUS_11380 9740 10069 gene locus_tag LOCUS_11390 9740 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 10105 10647 gene locus_tag LOCUS_11400 10105 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 10660 11163 gene locus_tag LOCUS_11410 10660 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 11175 11753 gene locus_tag LOCUS_11420 11175 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 11746 11871 gene locus_tag LOCUS_11430 11746 11871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 11861 12406 gene locus_tag LOCUS_11440 11861 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 12403 12621 gene locus_tag LOCUS_11450 12403 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 12671 12862 gene locus_tag LOCUS_11460 12671 12862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 12852 13268 gene locus_tag LOCUS_11470 12852 13268 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047623.1 protein_id gnl|my_center|LOCUS_11470 13265 13474 gene locus_tag LOCUS_11480 13265 13474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 13602 13847 gene locus_tag LOCUS_11490 13602 13847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 13844 14326 gene locus_tag LOCUS_11500 13844 14326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 14922 14788 gene locus_tag LOCUS_11510 14922 14788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 15416 16225 gene locus_tag LOCUS_11520 15416 16225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 16265 16543 gene locus_tag LOCUS_11530 16265 16543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 16594 17172 gene locus_tag LOCUS_11540 16594 17172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 17169 18203 gene locus_tag LOCUS_11550 17169 18203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 18206 18955 gene locus_tag LOCUS_11560 18206 18955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 19007 19819 gene locus_tag LOCUS_11570 19007 19819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 19722 20960 gene locus_tag LOCUS_11580 19722 20960 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_11580 20972 22468 gene locus_tag LOCUS_11590 20972 22468 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921892.1 protein_id gnl|my_center|LOCUS_11590 22416 22721 gene locus_tag LOCUS_11600 22416 22721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 22726 23766 gene locus_tag LOCUS_11610 22726 23766 CDS product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928179.1 protein_id gnl|my_center|LOCUS_11610 24059 24706 gene locus_tag LOCUS_11620 24059 24706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 24724 25110 gene locus_tag LOCUS_11630 24724 25110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076614581.1 protein_id gnl|my_center|LOCUS_11630 25126 26172 gene locus_tag LOCUS_11640 25126 26172 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674646.1 protein_id gnl|my_center|LOCUS_11640 26183 26488 gene locus_tag LOCUS_11650 26183 26488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 26488 26832 gene locus_tag LOCUS_11660 26488 26832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 26829 27374 gene locus_tag LOCUS_11670 26829 27374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 27371 27733 gene locus_tag LOCUS_11680 27371 27733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 27746 28183 gene locus_tag LOCUS_11690 27746 28183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 28318 28716 gene locus_tag LOCUS_11700 28318 28716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 28752 29066 gene locus_tag LOCUS_11710 28752 29066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 29089 34863 gene locus_tag LOCUS_11720 29089 34863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 34877 35242 gene locus_tag LOCUS_11730 34877 35242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 35253 40925 gene locus_tag LOCUS_11740 35253 40925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 41033 41296 gene locus_tag LOCUS_11750 41033 41296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 41309 41485 gene locus_tag LOCUS_11760 41309 41485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 41448 41897 gene locus_tag LOCUS_11770 41448 41897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 41903 42187 gene locus_tag LOCUS_11780 41903 42187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 42177 42611 gene locus_tag LOCUS_11790 42177 42611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 42604 43506 gene locus_tag LOCUS_11800 42604 43506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence452 <1 670 gene locus_tag LOCUS_11810 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548294.1:phenylalanine--tRNA ligase subunit beta 742 1230 gene locus_tag LOCUS_11820 gene greA 742 1230 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548292.1 protein_id gnl|my_center|LOCUS_11820 <3228 1283 gene locus_tag LOCUS_11830 <3228 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548276.1:YfhO family protein >Feature sequence453 >Feature sequence454 >Feature sequence455 260 369 gene locus_tag LOCUS_r00040 260 369 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 437 1024 gene locus_tag LOCUS_11840 437 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11840 1076 1297 gene locus_tag LOCUS_11850 1076 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11850 >Feature sequence456 1942 470 gene locus_tag LOCUS_11860 1942 470 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546652.1 protein_id gnl|my_center|LOCUS_11860 2097 2939 gene locus_tag LOCUS_11870 2097 2939 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641965.1 protein_id gnl|my_center|LOCUS_11870 3347 2976 gene locus_tag LOCUS_11880 3347 2976 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_11880 3585 3331 gene locus_tag LOCUS_11890 3585 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 5466 3913 gene locus_tag LOCUS_11900 gene guaA 5466 3913 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548925.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence457 >Feature sequence458 <1 775 gene locus_tag LOCUS_11910 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548604.1:proline iminopeptidase-family hydrolase 1290 772 gene locus_tag LOCUS_11920 1290 772 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550021.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence459 531 776 gene locus_tag LOCUS_11930 531 776 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699734.1 protein_id gnl|my_center|LOCUS_11930 780 1724 gene locus_tag LOCUS_11940 780 1724 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475764.1 protein_id gnl|my_center|LOCUS_11940 1708 2430 gene locus_tag LOCUS_11950 gene fabG 1708 2430 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699736.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence460 >Feature sequence461 >Feature sequence462 2827 1883 gene locus_tag LOCUS_11960 gene prmA 2827 1883 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547033.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence463 2635 2402 gene locus_tag LOCUS_11970 gene secG 2635 2402 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254157.1 protein_id gnl|my_center|LOCUS_11970 <3811 2690 gene locus_tag LOCUS_11980 <3811 2690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254156.1:LTA synthase family protein >Feature sequence464 >Feature sequence465 >Feature sequence466 378 785 gene locus_tag LOCUS_11990 378 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 880 1611 gene locus_tag LOCUS_12000 880 1611 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_12000 2449 2279 gene locus_tag LOCUS_12010 2449 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence467 1 324 gene locus_tag LOCUS_12020 1 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2443 1028 gene locus_tag LOCUS_12030 2443 1028 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641669.1 protein_id gnl|my_center|LOCUS_12030 4267 2456 gene locus_tag LOCUS_12040 4267 2456 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100862.1 protein_id gnl|my_center|LOCUS_12040 4503 5384 gene locus_tag LOCUS_12050 4503 5384 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641316.1 protein_id gnl|my_center|LOCUS_12050 6143 5439 gene locus_tag LOCUS_12060 gene nagB 6143 5439 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549469.1 protein_id gnl|my_center|LOCUS_12060 6342 7184 gene locus_tag LOCUS_12070 6342 7184 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549471.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence468 4327 4115 gene locus_tag LOCUS_12080 4327 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 7693 4373 gene locus_tag LOCUS_12090 7693 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 8694 7933 gene locus_tag LOCUS_12100 8694 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 9050 8691 gene locus_tag LOCUS_12110 gene crcB 9050 8691 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547161.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence469 >Feature sequence470 988 431 gene locus_tag LOCUS_12120 gene efp 988 431 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550017.1 protein_id gnl|my_center|LOCUS_12120 <1830 1038 gene locus_tag LOCUS_12130 <1830 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003550009.1:type I pantothenate kinase >Feature sequence471 1342 362 gene locus_tag LOCUS_12140 1342 362 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254080.1 protein_id gnl|my_center|LOCUS_12140 2320 1571 gene locus_tag LOCUS_12150 2320 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 3876 2491 gene locus_tag LOCUS_12160 gene glmU 3876 2491 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548882.1 protein_id gnl|my_center|LOCUS_12160 4766 3936 gene locus_tag LOCUS_12170 gene purR 4766 3936 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548880.1 protein_id gnl|my_center|LOCUS_12170 5124 4873 gene locus_tag LOCUS_12180 5124 4873 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548879.1 protein_id gnl|my_center|LOCUS_12180 6074 5184 gene locus_tag LOCUS_12190 gene rsmA 6074 5184 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548878.1 protein_id gnl|my_center|LOCUS_12190 6621 6049 gene locus_tag LOCUS_12200 gene rnmV 6621 6049 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548877.1 protein_id gnl|my_center|LOCUS_12200 7384 6605 gene locus_tag LOCUS_12210 7384 6605 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548876.1 protein_id gnl|my_center|LOCUS_12210 9366 7384 gene locus_tag LOCUS_12220 gene metG 9366 7384 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254078.1 protein_id gnl|my_center|LOCUS_12220 <10334 9503 gene locus_tag LOCUS_12230 <10334 9503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002379382.1:magnesium-translocating P-type ATPase >Feature sequence472 1417 1004 gene locus_tag LOCUS_12240 1417 1004 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130017.1 protein_id gnl|my_center|LOCUS_12240 3368 2166 gene locus_tag LOCUS_12250 3368 2166 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459310.1 protein_id gnl|my_center|LOCUS_12250 4870 3386 gene locus_tag LOCUS_12260 4870 3386 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352327.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence473 282 1199 gene locus_tag LOCUS_12270 282 1199 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721382.1 protein_id gnl|my_center|LOCUS_12270 1229 2140 gene locus_tag LOCUS_12280 1229 2140 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254527.1 protein_id gnl|my_center|LOCUS_12280 2412 2167 gene locus_tag LOCUS_12290 2412 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence474 960 481 gene locus_tag LOCUS_12300 960 481 CDS product YcxB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836328.1 protein_id gnl|my_center|LOCUS_12300 1754 1044 gene locus_tag LOCUS_12310 1754 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence475 >Feature sequence476 293 78 gene locus_tag LOCUS_12320 293 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549087.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence477 <1 775 gene locus_tag LOCUS_12330 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254051.1:CAP domain-containing protein 782 1438 gene locus_tag LOCUS_12340 782 1438 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549430.1 protein_id gnl|my_center|LOCUS_12340 2351 1518 gene locus_tag LOCUS_12350 2351 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548717.1 protein_id gnl|my_center|LOCUS_12350 3042 2362 gene locus_tag LOCUS_12360 3042 2362 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254049.1 protein_id gnl|my_center|LOCUS_12360 4202 3201 gene locus_tag LOCUS_12370 4202 3201 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548712.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence478 >Feature sequence479 1434 823 gene locus_tag LOCUS_12380 1434 823 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547441.1 protein_id gnl|my_center|LOCUS_12380 3012 1612 gene locus_tag LOCUS_12390 3012 1612 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101177.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence480 589 765 gene locus_tag LOCUS_12400 589 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 868 1461 gene locus_tag LOCUS_12410 868 1461 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131353.1 protein_id gnl|my_center|LOCUS_12410 2036 1506 gene locus_tag LOCUS_12420 2036 1506 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986394.1 protein_id gnl|my_center|LOCUS_12420 2255 2167 gene locus_tag LOCUS_t00420 2255 2167 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2405 2476 gene locus_tag LOCUS_t00430 2405 2476 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2479 2553 gene locus_tag LOCUS_t00440 2479 2553 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence481 >Feature sequence482 >Feature sequence483 1834 2973 gene locus_tag LOCUS_12430 1834 2973 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549814.1 protein_id gnl|my_center|LOCUS_12430 3103 3246 gene locus_tag LOCUS_12440 3103 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3250 5742 gene locus_tag LOCUS_12450 gene lanKC 3250 5742 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127742798.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence484 152 952 gene locus_tag LOCUS_12460 152 952 CDS product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548584.1 protein_id gnl|my_center|LOCUS_12460 970 1767 gene locus_tag LOCUS_12470 970 1767 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254029.1 protein_id gnl|my_center|LOCUS_12470 1858 3150 gene locus_tag LOCUS_12480 1858 3150 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 protein_id gnl|my_center|LOCUS_12480 3641 4120 gene locus_tag LOCUS_12490 gene rlmH 3641 4120 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548590.1 protein_id gnl|my_center|LOCUS_12490 4236 5051 gene locus_tag LOCUS_12500 4236 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 5166 5609 gene locus_tag LOCUS_12510 5166 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 5627 5935 gene locus_tag LOCUS_12520 5627 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 6180 6521 gene locus_tag LOCUS_12530 6180 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 7483 6557 gene locus_tag LOCUS_12540 7483 6557 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100868.1 protein_id gnl|my_center|LOCUS_12540 7575 7967 gene locus_tag LOCUS_12550 7575 7967 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102185.1 protein_id gnl|my_center|LOCUS_12550 8418 8050 gene locus_tag LOCUS_12560 8418 8050 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254569.1 protein_id gnl|my_center|LOCUS_12560 9219 8551 gene locus_tag LOCUS_12570 9219 8551 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548607.1 protein_id gnl|my_center|LOCUS_12570 10587 9232 gene locus_tag LOCUS_12580 10587 9232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548609.1 protein_id gnl|my_center|LOCUS_12580 10892 12367 gene locus_tag LOCUS_12590 10892 12367 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640572.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence485 >Feature sequence486 2458 3033 gene locus_tag LOCUS_12600 2458 3033 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549286.1 protein_id gnl|my_center|LOCUS_12600 3040 3693 gene locus_tag LOCUS_12610 3040 3693 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549989.1 protein_id gnl|my_center|LOCUS_12610 3774 4595 gene locus_tag LOCUS_12620 3774 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence487 1701 1234 gene locus_tag LOCUS_12630 1701 1234 CDS product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254248.1 protein_id gnl|my_center|LOCUS_12630 2380 1823 gene locus_tag LOCUS_12640 gene rpsD 2380 1823 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254249.1 protein_id gnl|my_center|LOCUS_12640 2729 4447 gene locus_tag LOCUS_12650 gene ezrA 2729 4447 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546759.1 protein_id gnl|my_center|LOCUS_12650 4534 5691 gene locus_tag LOCUS_12660 4534 5691 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546760.1 protein_id gnl|my_center|LOCUS_12660 5694 6911 gene locus_tag LOCUS_12670 gene thiI 5694 6911 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546762.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence488 628 101 gene locus_tag LOCUS_12680 628 101 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547784.1 protein_id gnl|my_center|LOCUS_12680 2894 618 gene locus_tag LOCUS_12690 gene recJ 2894 618 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547786.1 protein_id gnl|my_center|LOCUS_12690 3595 2891 gene locus_tag LOCUS_12700 3595 2891 CDS product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547788.1 protein_id gnl|my_center|LOCUS_12700 5414 3576 gene locus_tag LOCUS_12710 gene lepA 5414 3576 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254395.1 protein_id gnl|my_center|LOCUS_12710 <6080 5538 gene locus_tag LOCUS_12720 <6080 5538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547790.1:molecular chaperone DnaJ >Feature sequence489 1304 747 gene locus_tag LOCUS_12730 1304 747 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254062.1 protein_id gnl|my_center|LOCUS_12730 2042 1323 gene locus_tag LOCUS_12740 gene nrdG 2042 1323 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548777.1 protein_id gnl|my_center|LOCUS_12740 4324 2114 gene locus_tag LOCUS_12750 gene nrdD 4324 2114 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254061.1 protein_id gnl|my_center|LOCUS_12750 5952 4690 gene locus_tag LOCUS_12760 5952 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548775.1 protein_id gnl|my_center|LOCUS_12760 7932 5983 gene locus_tag LOCUS_12770 gene asnB 7932 5983 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548773.1 protein_id gnl|my_center|LOCUS_12770 9429 8029 gene locus_tag LOCUS_12780 9429 8029 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254060.1 protein_id gnl|my_center|LOCUS_12780 9972 9487 gene locus_tag LOCUS_12790 9972 9487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548767.1 protein_id gnl|my_center|LOCUS_12790 10225 11850 gene locus_tag LOCUS_12800 10225 11850 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254071.1 protein_id gnl|my_center|LOCUS_12800 13080 11917 gene locus_tag LOCUS_12810 13080 11917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 13693 13061 gene locus_tag LOCUS_12820 13693 13061 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939892.1 protein_id gnl|my_center|LOCUS_12820 14021 13737 gene locus_tag LOCUS_12830 14021 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 15016 14204 gene locus_tag LOCUS_12840 gene phnE 15016 14204 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548762.1 protein_id gnl|my_center|LOCUS_12840 15816 15016 gene locus_tag LOCUS_12850 gene phnE 15816 15016 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254058.1 protein_id gnl|my_center|LOCUS_12850 16589 15819 gene locus_tag LOCUS_12860 gene phnC 16589 15819 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548759.1 protein_id gnl|my_center|LOCUS_12860 17643 16702 gene locus_tag LOCUS_12870 17643 16702 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254057.1 protein_id gnl|my_center|LOCUS_12870 18537 18064 gene locus_tag LOCUS_12880 18537 18064 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548753.1 protein_id gnl|my_center|LOCUS_12880 18734 19531 gene locus_tag LOCUS_12890 18734 19531 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 protein_id gnl|my_center|LOCUS_12890 20021 19542 gene locus_tag LOCUS_12900 20021 19542 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548750.1 protein_id gnl|my_center|LOCUS_12900 20195 20668 gene locus_tag LOCUS_12910 20195 20668 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence490 <1 504 gene locus_tag LOCUS_12920 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101592.1:DHA2 family efflux MFS transporter permease subunit 578 3241 gene locus_tag LOCUS_12930 gene polA 578 3241 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548351.1 protein_id gnl|my_center|LOCUS_12930 3253 4080 gene locus_tag LOCUS_12940 gene mutM 3253 4080 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548349.1 protein_id gnl|my_center|LOCUS_12940 4077 4661 gene locus_tag LOCUS_12950 gene coaE 4077 4661 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548347.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence491 3240 1195 gene locus_tag LOCUS_12960 gene uvrB 3240 1195 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546586.1 protein_id gnl|my_center|LOCUS_12960 4300 3368 gene locus_tag LOCUS_12970 gene trxB 4300 3368 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254223.1 protein_id gnl|my_center|LOCUS_12970 5389 4373 gene locus_tag LOCUS_12980 5389 4373 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546563.1 protein_id gnl|my_center|LOCUS_12980 6228 5395 gene locus_tag LOCUS_12990 gene lgt 6228 5395 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613330.1 protein_id gnl|my_center|LOCUS_12990 <6964 6228 gene locus_tag LOCUS_13000 <6964 6228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546560.1:HPr(Ser) kinase/phosphatase >Feature sequence492 308 775 gene locus_tag LOCUS_13010 gene mscL 308 775 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_13010 <1794 849 gene locus_tag LOCUS_13020 <1794 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011675014.1:nicotinate phosphoribosyltransferase >Feature sequence493 873 517 gene locus_tag LOCUS_13030 gene rnpA 873 517 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549413.1 protein_id gnl|my_center|LOCUS_13030 1536 2900 gene locus_tag LOCUS_13040 gene dnaA 1536 2900 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011253999.1 protein_id gnl|my_center|LOCUS_13040 3080 4207 gene locus_tag LOCUS_13050 gene dnaN 3080 4207 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549381.1 protein_id gnl|my_center|LOCUS_13050 4369 4656 gene locus_tag LOCUS_13060 gene yaaA 4369 4656 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254000.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence494 1055 381 gene locus_tag LOCUS_13070 gene purQ 1055 381 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475857.1 protein_id gnl|my_center|LOCUS_13070 1303 1055 gene locus_tag LOCUS_13080 gene purS 1303 1055 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700038.1 protein_id gnl|my_center|LOCUS_13080 2029 1307 gene locus_tag LOCUS_13090 2029 1307 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548371.1 protein_id gnl|my_center|LOCUS_13090 3632 2337 gene locus_tag LOCUS_13100 gene purB 3632 2337 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475797.1 protein_id gnl|my_center|LOCUS_13100 <4452 3676 gene locus_tag LOCUS_13110 <4452 3676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003697988.1:5-(carboxyamino)imidazole ribonucleotide synthase >Feature sequence495 1460 585 gene locus_tag LOCUS_13120 1460 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 2041 1478 gene locus_tag LOCUS_13130 2041 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 <3235 2201 gene locus_tag LOCUS_13140 <3235 2201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254519.1:serine--tRNA ligase >Feature sequence496 186 67 gene locus_tag LOCUS_13150 186 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence497 148 1542 gene locus_tag LOCUS_13160 gene hslU 148 1542 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254308.1 protein_id gnl|my_center|LOCUS_13160 1608 2504 gene locus_tag LOCUS_13170 1608 2504 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547149.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence498 <1 589 gene locus_tag LOCUS_13180 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546764.1:pseudouridine synthase 854 3493 gene locus_tag LOCUS_13190 854 3493 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254252.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence499 <2226 388 gene locus_tag LOCUS_13200 <2226 388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439757.1:EAL domain-containing protein >Feature sequence500 983 204 gene locus_tag LOCUS_13210 gene sufC 983 204 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702968.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence501 496 774 gene locus_tag LOCUS_13220 496 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13220 872 1348 gene locus_tag LOCUS_13230 872 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13230 2706 1417 gene locus_tag LOCUS_13240 2706 1417 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549585.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence502 <1 597 gene locus_tag LOCUS_13250 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254482.1:RNA-guided endonuclease TnpB family protein >Feature sequence503 2818 1130 gene locus_tag LOCUS_13260 2818 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence504 2604 2281 gene locus_tag LOCUS_13270 2604 2281 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549194.1 protein_id gnl|my_center|LOCUS_13270 3036 2608 gene locus_tag LOCUS_13280 gene ruvX 3036 2608 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549192.1 protein_id gnl|my_center|LOCUS_13280 3293 3036 gene locus_tag LOCUS_13290 3293 3036 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence505 >Feature sequence506 15 710 gene locus_tag LOCUS_13300 15 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence507 957 1877 gene locus_tag LOCUS_13310 957 1877 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549863.1 protein_id gnl|my_center|LOCUS_13310 1877 2764 gene locus_tag LOCUS_13320 1877 2764 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549864.1 protein_id gnl|my_center|LOCUS_13320 2774 3553 gene locus_tag LOCUS_13330 2774 3553 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549866.1 protein_id gnl|my_center|LOCUS_13330 3557 4333 gene locus_tag LOCUS_13340 3557 4333 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 protein_id gnl|my_center|LOCUS_13340 4362 5024 gene locus_tag LOCUS_13350 4362 5024 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721391.1 protein_id gnl|my_center|LOCUS_13350 5053 6729 gene locus_tag LOCUS_13360 5053 6729 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_13360 6741 8054 gene locus_tag LOCUS_13370 6741 8054 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288195.1 protein_id gnl|my_center|LOCUS_13370 8128 8874 gene locus_tag LOCUS_13380 8128 8874 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 protein_id gnl|my_center|LOCUS_13380 9502 9969 gene locus_tag LOCUS_13390 9502 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 10069 11148 gene locus_tag LOCUS_13400 10069 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 11509 12525 gene locus_tag LOCUS_13410 11509 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 12548 13087 gene locus_tag LOCUS_13420 12548 13087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 13349 14314 gene locus_tag LOCUS_13430 13349 14314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 14492 15547 gene locus_tag LOCUS_13440 14492 15547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 15564 16211 gene locus_tag LOCUS_13450 15564 16211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 16231 17229 gene locus_tag LOCUS_13460 16231 17229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 17491 17300 gene locus_tag LOCUS_13470 17491 17300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 18708 18541 gene locus_tag LOCUS_13480 18708 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 18815 19078 gene locus_tag LOCUS_13490 18815 19078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 19202 19876 gene locus_tag LOCUS_13500 19202 19876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 19881 20033 gene locus_tag LOCUS_13510 19881 20033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 20043 20417 gene locus_tag LOCUS_13520 20043 20417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 21347 20424 gene locus_tag LOCUS_13530 21347 20424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 21447 21836 gene locus_tag LOCUS_13540 21447 21836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 22307 23587 gene locus_tag LOCUS_13550 22307 23587 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102269.1 protein_id gnl|my_center|LOCUS_13550 23684 24142 gene locus_tag LOCUS_13560 23684 24142 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897772.1 protein_id gnl|my_center|LOCUS_13560 24139 24465 gene locus_tag LOCUS_13570 24139 24465 CDS product fructose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454881.1 protein_id gnl|my_center|LOCUS_13570 24468 25556 gene locus_tag LOCUS_13580 24468 25556 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008946817.1 protein_id gnl|my_center|LOCUS_13580 25634 28294 gene locus_tag LOCUS_13590 gene mngB 25634 28294 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861603.1 protein_id gnl|my_center|LOCUS_13590 28312 30933 gene locus_tag LOCUS_13600 28312 30933 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861780.1 protein_id gnl|my_center|LOCUS_13600 31014 32966 gene locus_tag LOCUS_13610 31014 32966 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861602.1 protein_id gnl|my_center|LOCUS_13610 32979 33941 gene locus_tag LOCUS_13620 gene manA 32979 33941 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101726.1 protein_id gnl|my_center|LOCUS_13620 35081 34620 gene locus_tag LOCUS_13630 35081 34620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 35575 36042 gene locus_tag LOCUS_13640 35575 36042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 36225 36614 gene locus_tag LOCUS_13650 36225 36614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 36624 37529 gene locus_tag LOCUS_13660 36624 37529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 37774 37995 gene locus_tag LOCUS_13670 37774 37995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 38188 38541 gene locus_tag LOCUS_13680 38188 38541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 38547 38846 gene locus_tag LOCUS_13690 38547 38846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 38801 38986 gene locus_tag LOCUS_13700 38801 38986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 40255 39368 gene locus_tag LOCUS_13710 40255 39368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 40375 42192 gene locus_tag LOCUS_13720 40375 42192 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459518.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence508 3555 1744 gene locus_tag LOCUS_13730 gene glmS 3555 1744 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546133.1 protein_id gnl|my_center|LOCUS_13730 4208 3768 gene locus_tag LOCUS_13740 4208 3768 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642743.1 protein_id gnl|my_center|LOCUS_13740 4742 4386 gene locus_tag LOCUS_13750 4742 4386 CDS product DUF1304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836732.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence509 >Feature sequence510 <1 605 gene locus_tag LOCUS_13760 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254220.1:ComF family protein 685 1242 gene locus_tag LOCUS_13770 gene raiA 685 1242 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 protein_id gnl|my_center|LOCUS_13770 1403 3805 gene locus_tag LOCUS_13780 gene secA 1403 3805 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254222.1 protein_id gnl|my_center|LOCUS_13780 4016 5014 gene locus_tag LOCUS_13790 gene prfB 4016 5014 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522727.1 protein_id gnl|my_center|LOCUS_13790 5025 5330 gene locus_tag LOCUS_13800 5025 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546557.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence511 491 300 gene locus_tag LOCUS_13810 gene rpmF 491 300 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547064.1 protein_id gnl|my_center|LOCUS_13810 <1322 605 gene locus_tag LOCUS_13820 <1322 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547056.1:SDR family oxidoreductase >Feature sequence512 >Feature sequence513 331 38 gene locus_tag LOCUS_13830 331 38 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022250.1 protein_id gnl|my_center|LOCUS_13830 484 1338 gene locus_tag LOCUS_13840 484 1338 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549073.1 protein_id gnl|my_center|LOCUS_13840 1542 2567 gene locus_tag LOCUS_13850 1542 2567 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_13850 2671 3798 gene locus_tag LOCUS_13860 2671 3798 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359094.1 protein_id gnl|my_center|LOCUS_13860 6119 3846 gene locus_tag LOCUS_13870 6119 3846 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254392.1 protein_id gnl|my_center|LOCUS_13870 6276 6112 gene locus_tag LOCUS_13880 6276 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 6266 7129 gene locus_tag LOCUS_13890 6266 7129 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254391.1 protein_id gnl|my_center|LOCUS_13890 7253 8434 gene locus_tag LOCUS_13900 7253 8434 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254401.1 protein_id gnl|my_center|LOCUS_13900 10007 8505 gene locus_tag LOCUS_13910 10007 8505 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548719.1 protein_id gnl|my_center|LOCUS_13910 10768 10028 gene locus_tag LOCUS_13920 10768 10028 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254050.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence514 <1 661 gene locus_tag LOCUS_13930 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546670.1:competence type IV pilus ATPase ComGA >Feature sequence515 >Feature sequence516 >Feature sequence517 774 136 gene locus_tag LOCUS_13940 774 136 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700625.1 protein_id gnl|my_center|LOCUS_13940 1769 855 gene locus_tag LOCUS_13950 1769 855 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_13950 1888 2115 gene locus_tag LOCUS_13960 1888 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 2134 3129 gene locus_tag LOCUS_13970 2134 3129 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_13970 3302 3631 gene locus_tag LOCUS_13980 3302 3631 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679440.1 protein_id gnl|my_center|LOCUS_13980 3661 4215 gene locus_tag LOCUS_13990 3661 4215 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence518 503 1432 gene locus_tag LOCUS_14000 gene rnz 503 1432 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547055.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence519 >Feature sequence520 653 1846 gene locus_tag LOCUS_14010 653 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102087.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence521 <1 1374 gene locus_tag LOCUS_14020 <1 1374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546854.1:DNA internalization-related competence protein ComEC/Rec2 1406 2395 gene locus_tag LOCUS_14030 gene holA 1406 2395 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546856.1 protein_id gnl|my_center|LOCUS_14030 2713 2462 gene locus_tag LOCUS_14040 gene rpsT 2713 2462 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546858.1 protein_id gnl|my_center|LOCUS_14040 2917 3186 gene locus_tag LOCUS_14050 gene rpsO 2917 3186 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546859.1 protein_id gnl|my_center|LOCUS_14050 3382 5268 gene locus_tag LOCUS_14060 3382 5268 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546860.1 protein_id gnl|my_center|LOCUS_14060 5255 6088 gene locus_tag LOCUS_14070 5255 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254267.1 protein_id gnl|my_center|LOCUS_14070 6269 7459 gene locus_tag LOCUS_14080 gene tuf 6269 7459 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546862.1 protein_id gnl|my_center|LOCUS_14080 7641 8972 gene locus_tag LOCUS_14090 gene tig 7641 8972 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546863.1 protein_id gnl|my_center|LOCUS_14090 9118 10371 gene locus_tag LOCUS_14100 gene clpX 9118 10371 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546864.1 protein_id gnl|my_center|LOCUS_14100 10361 10954 gene locus_tag LOCUS_14110 gene yihA 10361 10954 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 protein_id gnl|my_center|LOCUS_14110 12625 11015 gene locus_tag LOCUS_14120 12625 11015 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546894.1 protein_id gnl|my_center|LOCUS_14120 12905 12759 gene locus_tag LOCUS_14130 12905 12759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 13034 13696 gene locus_tag LOCUS_14140 13034 13696 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100859.1 protein_id gnl|my_center|LOCUS_14140 13977 15620 gene locus_tag LOCUS_14150 13977 15620 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550020.1 protein_id gnl|my_center|LOCUS_14150 16035 15664 gene locus_tag LOCUS_14160 16035 15664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643535.1 protein_id gnl|my_center|LOCUS_14160 16276 17268 gene locus_tag LOCUS_14170 16276 17268 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640741.1 protein_id gnl|my_center|LOCUS_14170 17442 18404 gene locus_tag LOCUS_14180 17442 18404 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546979.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence522 262 371 gene locus_tag LOCUS_r00050 262 371 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence523 >Feature sequence524 1575 1111 gene locus_tag LOCUS_14190 gene ribE 1575 1111 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152414.1 protein_id gnl|my_center|LOCUS_14190 2769 1591 gene locus_tag LOCUS_14200 2769 1591 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101406.1 protein_id gnl|my_center|LOCUS_14200 <3329 2789 gene locus_tag LOCUS_14210 <3329 2789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014470.1:riboflavin synthase >Feature sequence525 729 1430 gene locus_tag LOCUS_14220 729 1430 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546250.1 protein_id gnl|my_center|LOCUS_14220 1581 2720 gene locus_tag LOCUS_14230 1581 2720 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546266.1 protein_id gnl|my_center|LOCUS_14230 2725 4152 gene locus_tag LOCUS_14240 2725 4152 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254175.1 protein_id gnl|my_center|LOCUS_14240 4202 4939 gene locus_tag LOCUS_14250 4202 4939 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546254.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence526 1445 603 gene locus_tag LOCUS_14260 1445 603 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101955.1 protein_id gnl|my_center|LOCUS_14260 1736 2281 gene locus_tag LOCUS_14270 1736 2281 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242788.1 protein_id gnl|my_center|LOCUS_14270 2290 3450 gene locus_tag LOCUS_14280 2290 3450 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201247498.1 protein_id gnl|my_center|LOCUS_14280 3548 4465 gene locus_tag LOCUS_14290 3548 4465 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037249854.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence527 >Feature sequence528 440 658 gene locus_tag LOCUS_14300 440 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 677 1375 gene locus_tag LOCUS_14310 677 1375 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254262.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence529 >Feature sequence530 >Feature sequence531 1816 272 gene locus_tag LOCUS_14320 1816 272 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549479.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence532 >Feature sequence533 1110 253 gene locus_tag LOCUS_14330 1110 253 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549634.1 protein_id gnl|my_center|LOCUS_14330 2471 1113 gene locus_tag LOCUS_14340 2471 1113 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549632.1 protein_id gnl|my_center|LOCUS_14340 3719 2505 gene locus_tag LOCUS_14350 3719 2505 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549630.1 protein_id gnl|my_center|LOCUS_14350 4933 3827 gene locus_tag LOCUS_14360 gene ugpC 4933 3827 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546234.1 protein_id gnl|my_center|LOCUS_14360 5609 4944 gene locus_tag LOCUS_14370 gene pgmB 5609 4944 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549628.1 protein_id gnl|my_center|LOCUS_14370 7399 5594 gene locus_tag LOCUS_14380 7399 5594 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549627.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence534 478 1164 gene locus_tag LOCUS_14390 478 1164 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549720.1 protein_id gnl|my_center|LOCUS_14390 1154 2356 gene locus_tag LOCUS_14400 1154 2356 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549721.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence535 667 921 gene locus_tag LOCUS_14410 667 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 921 1097 gene locus_tag LOCUS_14420 921 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1107 1922 gene locus_tag LOCUS_14430 1107 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1922 2452 gene locus_tag LOCUS_14440 1922 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2487 3092 gene locus_tag LOCUS_14450 2487 3092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359491.1 protein_id gnl|my_center|LOCUS_14450 3082 3570 gene locus_tag LOCUS_14460 3082 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3598 4095 gene locus_tag LOCUS_14470 3598 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178084644.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence536 >Feature sequence537 >Feature sequence538 859 332 gene locus_tag LOCUS_14480 gene msrA 859 332 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547717.1 protein_id gnl|my_center|LOCUS_14480 1123 2754 gene locus_tag LOCUS_14490 1123 2754 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546656.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence539 <1 1149 gene locus_tag LOCUS_14500 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546145.1:TerB N-terminal domain-containing protein 1152 2471 gene locus_tag LOCUS_14510 1152 2471 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence540 163 318 gene locus_tag LOCUS_14520 163 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence541 >Feature sequence542 >Feature sequence543 55 921 gene locus_tag LOCUS_14530 55 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1527 1015 gene locus_tag LOCUS_14540 1527 1015 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476576.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence544 1634 234 gene locus_tag LOCUS_14550 1634 234 CDS product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254371.1 protein_id gnl|my_center|LOCUS_14550 2610 1627 gene locus_tag LOCUS_14560 2610 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547594.1 protein_id gnl|my_center|LOCUS_14560 3358 2612 gene locus_tag LOCUS_14570 3358 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254372.1 protein_id gnl|my_center|LOCUS_14570 3706 3509 gene locus_tag LOCUS_14580 3706 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence545 1736 1023 gene locus_tag LOCUS_14590 gene dapD 1736 1023 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641534.1 protein_id gnl|my_center|LOCUS_14590 2249 3613 gene locus_tag LOCUS_14600 2249 3613 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546873.1 protein_id gnl|my_center|LOCUS_14600 3615 4601 gene locus_tag LOCUS_14610 gene dapF 3615 4601 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546870.1 protein_id gnl|my_center|LOCUS_14610 5943 4669 gene locus_tag LOCUS_14620 5943 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 7541 6210 gene locus_tag LOCUS_14630 7541 6210 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547445.1 protein_id gnl|my_center|LOCUS_14630 8637 7852 gene locus_tag LOCUS_14640 8637 7852 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361478.1 protein_id gnl|my_center|LOCUS_14640 9489 8716 gene locus_tag LOCUS_14650 9489 8716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 10075 9482 gene locus_tag LOCUS_14660 10075 9482 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence546 >Feature sequence547 >Feature sequence548 >Feature sequence549 1 477 gene locus_tag LOCUS_14670 1 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence550 427 14 gene locus_tag LOCUS_14680 427 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence551 >Feature sequence552 1436 513 gene locus_tag LOCUS_14690 1436 513 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_14690 1712 1639 gene locus_tag LOCUS_t00450 1712 1639 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1822 1748 gene locus_tag LOCUS_t00460 1822 1748 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1931 1857 gene locus_tag LOCUS_t00470 1931 1857 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2040 1966 gene locus_tag LOCUS_t00480 2040 1966 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence553 >Feature sequence554 >Feature sequence555 >Feature sequence556 >Feature sequence557 749 96 gene locus_tag LOCUS_14700 749 96 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674825.1 protein_id gnl|my_center|LOCUS_14700 1304 846 gene locus_tag LOCUS_14710 1304 846 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence558 <1 551 gene locus_tag LOCUS_14720 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546257.1:glycosyltransferase family 4 protein 548 1249 gene locus_tag LOCUS_14730 548 1249 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546270.1 protein_id gnl|my_center|LOCUS_14730 1354 2184 gene locus_tag LOCUS_14740 gene nadE 1354 2184 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546262.1 protein_id gnl|my_center|LOCUS_14740 2390 5056 gene locus_tag LOCUS_14750 2390 5056 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence559 >Feature sequence560 >Feature sequence561 200 45 gene locus_tag LOCUS_14760 200 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence562 413 45 gene locus_tag LOCUS_14770 413 45 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546115.1 protein_id gnl|my_center|LOCUS_14770 1337 423 gene locus_tag LOCUS_14780 1337 423 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254159.1 protein_id gnl|my_center|LOCUS_14780 2178 1366 gene locus_tag LOCUS_14790 2178 1366 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254158.1 protein_id gnl|my_center|LOCUS_14790 3198 2197 gene locus_tag LOCUS_14800 3198 2197 CDS product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546107.1 protein_id gnl|my_center|LOCUS_14800 3556 3467 gene locus_tag LOCUS_t00490 3556 3467 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence563 >Feature sequence564 >Feature sequence565 1174 812 gene locus_tag LOCUS_14810 1174 812 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547807.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence566 >Feature sequence567 >Feature sequence568 >Feature sequence569 >Feature sequence570 >Feature sequence571 >Feature sequence572 >Feature sequence573 >Feature sequence574 >Feature sequence575 >Feature sequence576 183 64 gene locus_tag LOCUS_14820 183 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence577 >Feature sequence578 >Feature sequence579 >Feature sequence580 <1 1722 gene locus_tag LOCUS_14830 <1 1722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549091.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence581 >Feature sequence582 >Feature sequence583 758 1399 gene locus_tag LOCUS_14840 758 1399 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549992.1 protein_id gnl|my_center|LOCUS_14840 1413 2045 gene locus_tag LOCUS_14850 1413 2045 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254538.1 protein_id gnl|my_center|LOCUS_14850 2047 2877 gene locus_tag LOCUS_14860 2047 2877 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550005.1 protein_id gnl|my_center|LOCUS_14860 3508 2939 gene locus_tag LOCUS_14870 3508 2939 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550008.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence584 >Feature sequence585 >Feature sequence586 143 54 gene locus_tag LOCUS_t00500 143 54 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 220 145 gene locus_tag LOCUS_t00510 220 145 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 292 222 gene locus_tag LOCUS_t00520 292 222 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 383 309 gene locus_tag LOCUS_t00530 383 309 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 475 399 gene locus_tag LOCUS_t00540 475 399 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 561 486 gene locus_tag LOCUS_t00550 561 486 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 647 572 gene locus_tag LOCUS_t00560 647 572 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 756 683 gene locus_tag LOCUS_t00570 756 683 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 837 762 gene locus_tag LOCUS_t00580 837 762 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 931 844 gene locus_tag LOCUS_t00590 931 844 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1015 944 gene locus_tag LOCUS_t00600 1015 944 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1093 1018 gene locus_tag LOCUS_t00610 1093 1018 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1187 1104 gene locus_tag LOCUS_t00620 1187 1104 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1271 1199 gene locus_tag LOCUS_t00630 1271 1199 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1347 1272 gene locus_tag LOCUS_t00640 1347 1272 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2932 1505 gene locus_tag LOCUS_14880 gene arcD 2932 1505 CDS product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286721.1 protein_id gnl|my_center|LOCUS_14880 <4045 3033 gene locus_tag LOCUS_14890 <4045 3033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004254504.1:arginine deiminase >Feature sequence587 <1 934 gene locus_tag LOCUS_14900 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003643525.1:DUF1002 domain-containing protein >Feature sequence588 >Feature sequence589 1709 990 gene locus_tag LOCUS_14910 1709 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence590 >Feature sequence591 784 443 gene locus_tag LOCUS_14920 784 443 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546844.1 protein_id gnl|my_center|LOCUS_14920 1979 774 gene locus_tag LOCUS_14930 1979 774 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254265.1 protein_id gnl|my_center|LOCUS_14930 <3000 2079 gene locus_tag LOCUS_14940 <3000 2079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254264.1:translational GTPase TypA >Feature sequence592 <1 1784 gene locus_tag LOCUS_14950 <1 1784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254507.1:AAA family ATPase 1786 2736 gene locus_tag LOCUS_14960 1786 2736 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254506.1 protein_id gnl|my_center|LOCUS_14960 3079 3618 gene locus_tag LOCUS_14970 3079 3618 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640717.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence593 >Feature sequence594 <3006 1014 gene locus_tag LOCUS_14980 <3006 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003641095.1:RNA degradosome polyphosphate kinase >Feature sequence595 <1 513 gene locus_tag LOCUS_14990 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549117.1:DNA polymerase III subunit delta 529 861 gene locus_tag LOCUS_15000 gene yabA 529 861 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254135.1 protein_id gnl|my_center|LOCUS_15000 861 1721 gene locus_tag LOCUS_15010 gene rsmI 861 1721 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549119.1 protein_id gnl|my_center|LOCUS_15010 1721 2470 gene locus_tag LOCUS_15020 1721 2470 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254136.1 protein_id gnl|my_center|LOCUS_15020 2512 3042 gene locus_tag LOCUS_15030 2512 3042 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613301.1 protein_id gnl|my_center|LOCUS_15030 3060 3782 gene locus_tag LOCUS_15040 gene tsaB 3060 3782 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549123.1 protein_id gnl|my_center|LOCUS_15040 3790 4320 gene locus_tag LOCUS_15050 gene rimI 3790 4320 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549125.1 protein_id gnl|my_center|LOCUS_15050 4323 5363 gene locus_tag LOCUS_15060 gene tsaD 4323 5363 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549127.1 protein_id gnl|my_center|LOCUS_15060 7332 5416 gene locus_tag LOCUS_15070 7332 5416 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549141.1 protein_id gnl|my_center|LOCUS_15070 7585 8247 gene locus_tag LOCUS_15080 7585 8247 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 protein_id gnl|my_center|LOCUS_15080 8418 8702 gene locus_tag LOCUS_15090 gene groES 8418 8702 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549156.1 protein_id gnl|my_center|LOCUS_15090 8725 10338 gene locus_tag LOCUS_15100 gene groL 8725 10338 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549158.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence596 1149 28 gene locus_tag LOCUS_15110 1149 28 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549213.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence597 >Feature sequence598 <1 824 gene locus_tag LOCUS_15120 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548366.1:phosphoribosylformylglycinamidine synthase subunit PurL 800 2278 gene locus_tag LOCUS_15130 gene purF 800 2278 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475859.1 protein_id gnl|my_center|LOCUS_15130 2275 3315 gene locus_tag LOCUS_15140 gene purM 2275 3315 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254495.1 protein_id gnl|my_center|LOCUS_15140 3324 3905 gene locus_tag LOCUS_15150 gene purN 3324 3905 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700046.1 protein_id gnl|my_center|LOCUS_15150 3906 5447 gene locus_tag LOCUS_15160 gene purH 3906 5447 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548356.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence599 <1 516 gene locus_tag LOCUS_15170 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003565195.1:cysteine desulfurase family protein 571 912 gene locus_tag LOCUS_15180 571 912 CDS product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546822.1 protein_id gnl|my_center|LOCUS_15180 917 2044 gene locus_tag LOCUS_15190 gene mnmA 917 2044 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546824.1 protein_id gnl|my_center|LOCUS_15190 2141 2800 gene locus_tag LOCUS_15200 2141 2800 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546826.1 protein_id gnl|my_center|LOCUS_15200 2800 3462 gene locus_tag LOCUS_15210 2800 3462 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546828.1 protein_id gnl|my_center|LOCUS_15210 3459 5852 gene locus_tag LOCUS_15220 3459 5852 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546830.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence600 1256 36 gene locus_tag LOCUS_15230 1256 36 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546535.1 protein_id gnl|my_center|LOCUS_15230 2939 1359 gene locus_tag LOCUS_15240 gene rny 2939 1359 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254219.1 protein_id gnl|my_center|LOCUS_15240 4262 3150 gene locus_tag LOCUS_15250 gene recA 4262 3150 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546531.1 protein_id gnl|my_center|LOCUS_15250 4654 4472 gene locus_tag LOCUS_15260 4654 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence601 >Feature sequence602 <1 724 gene locus_tag LOCUS_15270 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254512.1:serine hydrolase >Feature sequence603 >Feature sequence604 >Feature sequence605 2047 410 gene locus_tag LOCUS_15280 2047 410 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548835.1 protein_id gnl|my_center|LOCUS_15280 2897 2247 gene locus_tag LOCUS_15290 2897 2247 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254070.1 protein_id gnl|my_center|LOCUS_15290 4131 2983 gene locus_tag LOCUS_15300 4131 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4313 4241 gene locus_tag LOCUS_t00650 4313 4241 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence606 1823 816 gene locus_tag LOCUS_15310 1823 816 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_15310 2265 1813 gene locus_tag LOCUS_15320 2265 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 2613 2344 gene locus_tag LOCUS_15330 2613 2344 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933877.1 protein_id gnl|my_center|LOCUS_15330 3322 2861 gene locus_tag LOCUS_15340 3322 2861 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence607 3412 476 gene locus_tag LOCUS_15350 3412 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence608 >Feature sequence609 778 20 gene locus_tag LOCUS_15360 778 20 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548691.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence610 951 715 gene locus_tag LOCUS_15370 gene dltC 951 715 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549523.1 protein_id gnl|my_center|LOCUS_15370 2237 1005 gene locus_tag LOCUS_15380 gene dltB 2237 1005 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254621.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence611 3446 1380 gene locus_tag LOCUS_15390 gene glyS 3446 1380 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547620.1 protein_id gnl|my_center|LOCUS_15390 4350 3439 gene locus_tag LOCUS_15400 gene glyQ 4350 3439 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547621.1 protein_id gnl|my_center|LOCUS_15400 5364 4615 gene locus_tag LOCUS_15410 gene recO 5364 4615 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547622.1 protein_id gnl|my_center|LOCUS_15410 6269 5364 gene locus_tag LOCUS_15420 gene era 6269 5364 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254378.1 protein_id gnl|my_center|LOCUS_15420 6672 6253 gene locus_tag LOCUS_15430 6672 6253 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289205.1 protein_id gnl|my_center|LOCUS_15430 7199 6675 gene locus_tag LOCUS_15440 gene ybeY 7199 6675 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547628.1 protein_id gnl|my_center|LOCUS_15440 8147 7200 gene locus_tag LOCUS_15450 8147 7200 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254379.1 protein_id gnl|my_center|LOCUS_15450 8496 8320 gene locus_tag LOCUS_15460 gene rpsU 8496 8320 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002880182.1 protein_id gnl|my_center|LOCUS_15460 8665 9507 gene locus_tag LOCUS_15470 8665 9507 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547712.1 protein_id gnl|my_center|LOCUS_15470 9833 9564 gene locus_tag LOCUS_15480 9833 9564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 10782 9898 gene locus_tag LOCUS_15490 10782 9898 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547719.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence612 >Feature sequence613 816 340 gene locus_tag LOCUS_15500 816 340 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254605.1 protein_id gnl|my_center|LOCUS_15500 2040 994 gene locus_tag LOCUS_15510 2040 994 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321171.1 protein_id gnl|my_center|LOCUS_15510 2822 2337 gene locus_tag LOCUS_15520 2822 2337 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254605.1 protein_id gnl|my_center|LOCUS_15520 3470 2931 gene locus_tag LOCUS_15530 3470 2931 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041814911.1 protein_id gnl|my_center|LOCUS_15530 3560 3880 gene locus_tag LOCUS_15540 3560 3880 CDS product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549842.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence614 210 49 gene locus_tag LOCUS_15550 210 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1473 427 gene locus_tag LOCUS_15560 1473 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2398 1478 gene locus_tag LOCUS_15570 2398 1478 CDS product abortive infection system antitoxin AbiGi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090290936.1 protein_id gnl|my_center|LOCUS_15570 3337 2573 gene locus_tag LOCUS_15580 3337 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence615 >Feature sequence616 1216 740 gene locus_tag LOCUS_15590 1216 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 2548 1967 gene locus_tag LOCUS_15600 2548 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 8539 3038 gene locus_tag LOCUS_15610 8539 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence617 >Feature sequence618 2065 296 gene locus_tag LOCUS_15620 gene recQ 2065 296 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547178.1 protein_id gnl|my_center|LOCUS_15620 3082 2132 gene locus_tag LOCUS_15630 3082 2132 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254294.1 protein_id gnl|my_center|LOCUS_15630 4059 3085 gene locus_tag LOCUS_15640 4059 3085 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209628184.1 protein_id gnl|my_center|LOCUS_15640 <5322 4182 gene locus_tag LOCUS_15650 <5322 4182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254293.1:bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC >Feature sequence619 203 418 gene locus_tag LOCUS_15660 203 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence620 1587 1429 gene locus_tag LOCUS_15670 1587 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2054 1752 gene locus_tag LOCUS_15680 2054 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence621 4182 2815 gene locus_tag LOCUS_15690 4182 2815 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549176.1 protein_id gnl|my_center|LOCUS_15690 5134 4175 gene locus_tag LOCUS_15700 5134 4175 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254146.1 protein_id gnl|my_center|LOCUS_15700 6312 5197 gene locus_tag LOCUS_15710 gene dinB 6312 5197 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549172.1 protein_id gnl|my_center|LOCUS_15710 7760 6312 gene locus_tag LOCUS_15720 gene zwf 7760 6312 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549170.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence622 >Feature sequence623 >Feature sequence624 >Feature sequence625 <1 537 gene locus_tag LOCUS_15730 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254200.1:LytTR family DNA-binding domain-containing protein 616 2154 gene locus_tag LOCUS_15740 616 2154 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549425.1 protein_id gnl|my_center|LOCUS_15740 <2793 2233 gene locus_tag LOCUS_15750 <2793 2233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025014283.1:NCS2 family permease >Feature sequence626 >Feature sequence627 715 1221 gene locus_tag LOCUS_15760 715 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1307 1810 gene locus_tag LOCUS_15770 1307 1810 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100964.1 protein_id gnl|my_center|LOCUS_15770 1914 2825 gene locus_tag LOCUS_15780 gene htpX 1914 2825 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254032.1 protein_id gnl|my_center|LOCUS_15780 3745 2885 gene locus_tag LOCUS_15790 3745 2885 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102090.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence628 >Feature sequence629 771 1568 gene locus_tag LOCUS_15800 771 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 2177 1623 gene locus_tag LOCUS_15810 2177 1623 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004134.1 protein_id gnl|my_center|LOCUS_15810 2779 2201 gene locus_tag LOCUS_15820 2779 2201 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963525.1 protein_id gnl|my_center|LOCUS_15820 2901 4046 gene locus_tag LOCUS_15830 2901 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 5019 4123 gene locus_tag LOCUS_15840 5019 4123 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464393.1 protein_id gnl|my_center|LOCUS_15840 5878 5039 gene locus_tag LOCUS_15850 5878 5039 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906177.1 protein_id gnl|my_center|LOCUS_15850 7114 6041 gene locus_tag LOCUS_15860 7114 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 7551 7144 gene locus_tag LOCUS_15870 7551 7144 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462027.1 protein_id gnl|my_center|LOCUS_15870 7992 7564 gene locus_tag LOCUS_15880 7992 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 8650 8207 gene locus_tag LOCUS_15890 8650 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 8895 8701 gene locus_tag LOCUS_15900 8895 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 9447 8929 gene locus_tag LOCUS_15910 9447 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 10413 9553 gene locus_tag LOCUS_15920 10413 9553 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812722.1 protein_id gnl|my_center|LOCUS_15920 10595 10410 gene locus_tag LOCUS_15930 10595 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15930 11059 10535 gene locus_tag LOCUS_15940 11059 10535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15940 11243 11545 gene locus_tag LOCUS_15950 11243 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 11730 12242 gene locus_tag LOCUS_15960 11730 12242 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644685.1 protein_id gnl|my_center|LOCUS_15960 12271 13098 gene locus_tag LOCUS_15970 12271 13098 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101829.1 protein_id gnl|my_center|LOCUS_15970 13133 13642 gene locus_tag LOCUS_15980 13133 13642 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101828.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence630 13 88 gene locus_tag LOCUS_t00660 13 88 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 93 167 gene locus_tag LOCUS_t00670 93 167 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 174 257 gene locus_tag LOCUS_t00680 174 257 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 260 332 gene locus_tag LOCUS_t00690 260 332 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 344 417 gene locus_tag LOCUS_t00700 344 417 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 447 517 gene locus_tag LOCUS_t00710 447 517 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 547 633 gene locus_tag LOCUS_t00720 547 633 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence631 >Feature sequence632 481 828 gene locus_tag LOCUS_15990 gene rplS 481 828 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003629071.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence633 245 320 gene locus_tag LOCUS_t00730 245 320 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence634 <1 1666 gene locus_tag LOCUS_16000 <1 1666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254101.1:transcription-repair coupling factor 1697 1939 gene locus_tag LOCUS_16010 1697 1939 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_16010 2004 2387 gene locus_tag LOCUS_16020 2004 2387 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254103.1 protein_id gnl|my_center|LOCUS_16020 2387 2740 gene locus_tag LOCUS_16030 2387 2740 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549009.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence635 228 428 gene locus_tag LOCUS_16040 228 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 2414 519 gene locus_tag LOCUS_16050 gene mnmG 2414 519 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549419.1 protein_id gnl|my_center|LOCUS_16050 3826 2441 gene locus_tag LOCUS_16060 gene mnmE 3826 2441 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549418.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence636 1173 85 gene locus_tag LOCUS_16070 1173 85 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550081.1 protein_id gnl|my_center|LOCUS_16070 <2298 1291 gene locus_tag LOCUS_16080 <2298 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254525.1:MMPL family transporter >Feature sequence637 >Feature sequence638 1063 1761 gene locus_tag LOCUS_16090 1063 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1754 2398 gene locus_tag LOCUS_16100 1754 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2402 3064 gene locus_tag LOCUS_16110 2402 3064 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_16110 3048 3509 gene locus_tag LOCUS_16120 3048 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 4986 3586 gene locus_tag LOCUS_16130 4986 3586 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549685.1 protein_id gnl|my_center|LOCUS_16130 5262 5813 gene locus_tag LOCUS_16140 5262 5813 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549687.1 protein_id gnl|my_center|LOCUS_16140 5942 6481 gene locus_tag LOCUS_16150 5942 6481 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549688.1 protein_id gnl|my_center|LOCUS_16150 6496 7044 gene locus_tag LOCUS_16160 6496 7044 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549689.1 protein_id gnl|my_center|LOCUS_16160 7140 7922 gene locus_tag LOCUS_16170 7140 7922 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 protein_id gnl|my_center|LOCUS_16170 7933 8892 gene locus_tag LOCUS_16180 7933 8892 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549691.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence639 >Feature sequence640 186 115 gene locus_tag LOCUS_t00740 186 115 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 223 447 gene locus_tag LOCUS_16190 223 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 483 1526 gene locus_tag LOCUS_16200 483 1526 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546600.1 protein_id gnl|my_center|LOCUS_16200 1564 2580 gene locus_tag LOCUS_16210 gene gap 1564 2580 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546601.1 protein_id gnl|my_center|LOCUS_16210 2676 3887 gene locus_tag LOCUS_16220 2676 3887 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546602.1 protein_id gnl|my_center|LOCUS_16220 3906 4664 gene locus_tag LOCUS_16230 gene tpiA 3906 4664 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 protein_id gnl|my_center|LOCUS_16230 5093 5659 gene locus_tag LOCUS_16240 5093 5659 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254542.1 protein_id gnl|my_center|LOCUS_16240 6185 5616 gene locus_tag LOCUS_16250 6185 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254226.1 protein_id gnl|my_center|LOCUS_16250 7066 6182 gene locus_tag LOCUS_16260 7066 6182 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546611.1 protein_id gnl|my_center|LOCUS_16260 7228 7911 gene locus_tag LOCUS_16270 7228 7911 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546612.1 protein_id gnl|my_center|LOCUS_16270 7929 8918 gene locus_tag LOCUS_16280 gene pta 7929 8918 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254227.1 protein_id gnl|my_center|LOCUS_16280 8928 9413 gene locus_tag LOCUS_16290 gene tsaE 8928 9413 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546616.1 protein_id gnl|my_center|LOCUS_16290 9994 9458 gene locus_tag LOCUS_16300 9994 9458 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546623.1 protein_id gnl|my_center|LOCUS_16300 10115 11008 gene locus_tag LOCUS_16310 gene murB 10115 11008 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546624.1 protein_id gnl|my_center|LOCUS_16310 11043 12131 gene locus_tag LOCUS_16320 11043 12131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546625.1 protein_id gnl|my_center|LOCUS_16320 12135 12947 gene locus_tag LOCUS_16330 12135 12947 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546626.1 protein_id gnl|my_center|LOCUS_16330 12944 13747 gene locus_tag LOCUS_16340 12944 13747 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254228.1 protein_id gnl|my_center|LOCUS_16340 13744 14826 gene locus_tag LOCUS_16350 13744 14826 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546630.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence641 >Feature sequence642 432 223 gene locus_tag LOCUS_16360 432 223 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546816.1 protein_id gnl|my_center|LOCUS_16360 3227 432 gene locus_tag LOCUS_16370 gene ileS 3227 432 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254260.1 protein_id gnl|my_center|LOCUS_16370 4346 3546 gene locus_tag LOCUS_16380 4346 3546 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546811.1 protein_id gnl|my_center|LOCUS_16380 4645 4343 gene locus_tag LOCUS_16390 4645 4343 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221463.1 protein_id gnl|my_center|LOCUS_16390 5091 4645 gene locus_tag LOCUS_16400 gene sepF 5091 4645 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254258.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence643 954 85 gene locus_tag LOCUS_16410 954 85 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_16410 1072 2097 gene locus_tag LOCUS_16420 1072 2097 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922256.1 protein_id gnl|my_center|LOCUS_16420 3676 2174 gene locus_tag LOCUS_16430 gene gltX 3676 2174 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 protein_id gnl|my_center|LOCUS_16430 4648 3812 gene locus_tag LOCUS_16440 4648 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 5346 4648 gene locus_tag LOCUS_16450 5346 4648 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547603.1 protein_id gnl|my_center|LOCUS_16450 5716 5348 gene locus_tag LOCUS_16460 5716 5348 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547604.1 protein_id gnl|my_center|LOCUS_16460 6070 7686 gene locus_tag LOCUS_16470 6070 7686 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548835.1 protein_id gnl|my_center|LOCUS_16470 7816 8340 gene locus_tag LOCUS_16480 7816 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence644 62 1066 gene locus_tag LOCUS_16490 62 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1096 1992 gene locus_tag LOCUS_16500 gene srtC4 1096 1992 CDS product PI-2a pilus assembly sortase SrtC4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508996.1 protein_id gnl|my_center|LOCUS_16500 2139 3485 gene locus_tag LOCUS_16510 2139 3485 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546431.1 protein_id gnl|my_center|LOCUS_16510 3593 4165 gene locus_tag LOCUS_16520 gene hpt 3593 4165 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254205.1 protein_id gnl|my_center|LOCUS_16520 <4748 4218 gene locus_tag LOCUS_16530 <4748 4218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254206.1:amino acid permease >Feature sequence645 >Feature sequence646 >Feature sequence647 <1 587 gene locus_tag LOCUS_16540 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254533.1:PAS domain-containing protein 701 1606 gene locus_tag LOCUS_16550 701 1606 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254084.1 protein_id gnl|my_center|LOCUS_16550 2147 1692 gene locus_tag LOCUS_16560 2147 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 2681 2280 gene locus_tag LOCUS_16570 2681 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 3209 2808 gene locus_tag LOCUS_16580 3209 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 4428 3598 gene locus_tag LOCUS_16590 4428 3598 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 protein_id gnl|my_center|LOCUS_16590 4547 5386 gene locus_tag LOCUS_16600 4547 5386 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550055.1 protein_id gnl|my_center|LOCUS_16600 5402 6805 gene locus_tag LOCUS_16610 5402 6805 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550057.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence648 1201 461 gene locus_tag LOCUS_16620 1201 461 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549071.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence649 <1 1705 gene locus_tag LOCUS_16630 <1 1705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254216.1:oleate hydratase 2159 1899 gene locus_tag LOCUS_16640 2159 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 2345 2202 gene locus_tag LOCUS_16650 2345 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 3109 2738 gene locus_tag LOCUS_16660 3109 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 4385 3210 gene locus_tag LOCUS_16670 4385 3210 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548117.1 protein_id gnl|my_center|LOCUS_16670 6012 4675 gene locus_tag LOCUS_16680 gene glnA 6012 4675 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548245.1 protein_id gnl|my_center|LOCUS_16680 7405 6149 gene locus_tag LOCUS_16690 7405 6149 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548246.1 protein_id gnl|my_center|LOCUS_16690 8327 7398 gene locus_tag LOCUS_16700 gene miaA 8327 7398 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548247.1 protein_id gnl|my_center|LOCUS_16700 8809 8408 gene locus_tag LOCUS_16710 8809 8408 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548248.1 protein_id gnl|my_center|LOCUS_16710 9097 8870 gene locus_tag LOCUS_16720 9097 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 9765 9094 gene locus_tag LOCUS_16730 9765 9094 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 protein_id gnl|my_center|LOCUS_16730 10318 9758 gene locus_tag LOCUS_16740 10318 9758 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548253.1 protein_id gnl|my_center|LOCUS_16740 10522 10373 gene locus_tag LOCUS_16750 gene rpmG 10522 10373 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548272.1 protein_id gnl|my_center|LOCUS_16750 <11145 10609 gene locus_tag LOCUS_16760 <11145 10609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254485.1:penicillin-binding protein 2 >Feature sequence650 <1 1001 gene locus_tag LOCUS_16770 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436710.1:EAL domain-containing protein 2130 1255 gene locus_tag LOCUS_16780 2130 1255 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254003.1 protein_id gnl|my_center|LOCUS_16780 3134 2172 gene locus_tag LOCUS_16790 gene manA 3134 2172 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101726.1 protein_id gnl|my_center|LOCUS_16790 4611 3217 gene locus_tag LOCUS_16800 4611 3217 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102266.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence651 227 2407 gene locus_tag LOCUS_16810 gene ftsH 227 2407 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254105.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence652 186 1022 gene locus_tag LOCUS_16820 186 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1187 2161 gene locus_tag LOCUS_16830 1187 2161 CDS product class III bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548389.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence653 1705 1472 gene locus_tag LOCUS_16840 1705 1472 CDS product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546835.1 protein_id gnl|my_center|LOCUS_16840 2441 1887 gene locus_tag LOCUS_16850 gene def 2441 1887 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546838.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence654 2503 587 gene locus_tag LOCUS_16860 gene walK 2503 587 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254027.1 protein_id gnl|my_center|LOCUS_16860 3253 2525 gene locus_tag LOCUS_16870 gene yycF 3253 2525 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548578.1 protein_id gnl|my_center|LOCUS_16870 3380 3452 gene locus_tag LOCUS_t00750 3380 3452 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3510 4286 gene locus_tag LOCUS_16880 3510 4286 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254023.1 protein_id gnl|my_center|LOCUS_16880 4316 5140 gene locus_tag LOCUS_16890 4316 5140 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254021.1 protein_id gnl|my_center|LOCUS_16890 5174 6121 gene locus_tag LOCUS_16900 5174 6121 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254020.1 protein_id gnl|my_center|LOCUS_16900 6139 7002 gene locus_tag LOCUS_16910 6139 7002 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548564.1 protein_id gnl|my_center|LOCUS_16910 8539 7061 gene locus_tag LOCUS_16920 8539 7061 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546652.1 protein_id gnl|my_center|LOCUS_16920 9166 8699 gene locus_tag LOCUS_16930 9166 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 10097 9189 gene locus_tag LOCUS_16940 10097 9189 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548210.1 protein_id gnl|my_center|LOCUS_16940 10910 10161 gene locus_tag LOCUS_16950 10910 10161 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 protein_id gnl|my_center|LOCUS_16950 11542 11075 gene locus_tag LOCUS_16960 11542 11075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 13518 11632 gene locus_tag LOCUS_16970 13518 11632 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187364788.1 protein_id gnl|my_center|LOCUS_16970 13686 14612 gene locus_tag LOCUS_16980 13686 14612 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643099.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence655 413 1111 gene locus_tag LOCUS_16990 gene cbpA 413 1111 CDS product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254100.1 protein_id gnl|my_center|LOCUS_16990 2295 1165 gene locus_tag LOCUS_17000 gene alr 2295 1165 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548996.1 protein_id gnl|my_center|LOCUS_17000 2704 2279 gene locus_tag LOCUS_17010 gene acpS 2704 2279 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254099.1 protein_id gnl|my_center|LOCUS_17010 <3452 2791 gene locus_tag LOCUS_17020 <3452 2791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548992.1:DEAD/DEAH box helicase >Feature sequence656 >Feature sequence657 >Feature sequence658 >Feature sequence659 >Feature sequence660 >Feature sequence661 >Feature sequence662 >Feature sequence663 380 2203 gene locus_tag LOCUS_17030 380 2203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564926.1 protein_id gnl|my_center|LOCUS_17030 2941 2297 gene locus_tag LOCUS_17040 gene plsY 2941 2297 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547474.1 protein_id gnl|my_center|LOCUS_17040 3037 4968 gene locus_tag LOCUS_17050 gene parE 3037 4968 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547476.1 protein_id gnl|my_center|LOCUS_17050 4983 7466 gene locus_tag LOCUS_17060 gene parC 4983 7466 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547478.1 protein_id gnl|my_center|LOCUS_17060 7583 8518 gene locus_tag LOCUS_17070 7583 8518 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547481.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence664 1703 348 gene locus_tag LOCUS_17080 1703 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 1924 1775 gene locus_tag LOCUS_17090 1924 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2144 1989 gene locus_tag LOCUS_17100 2144 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 2287 2141 gene locus_tag LOCUS_17110 2287 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 4781 2298 gene locus_tag LOCUS_17120 gene lanKC 4781 2298 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127742798.1 protein_id gnl|my_center|LOCUS_17120 6487 4790 gene locus_tag LOCUS_17130 6487 4790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642231.1 protein_id gnl|my_center|LOCUS_17130 7400 6765 gene locus_tag LOCUS_17140 7400 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 7642 9324 gene locus_tag LOCUS_17150 7642 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 10158 9376 gene locus_tag LOCUS_17160 10158 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 10679 10170 gene locus_tag LOCUS_17170 10679 10170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 11298 10669 gene locus_tag LOCUS_17180 11298 10669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 12931 12392 gene locus_tag LOCUS_17190 12931 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 14471 13086 gene locus_tag LOCUS_17200 gene gndA 14471 13086 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254636.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence665 >Feature sequence666 2237 2016 gene locus_tag LOCUS_17210 gene rpoZ 2237 2016 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547927.1 protein_id gnl|my_center|LOCUS_17210 2853 2239 gene locus_tag LOCUS_17220 gene gmk 2853 2239 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 protein_id gnl|my_center|LOCUS_17220 3026 3331 gene locus_tag LOCUS_17230 3026 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 4984 3368 gene locus_tag LOCUS_17240 4984 3368 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548835.1 protein_id gnl|my_center|LOCUS_17240 6883 5201 gene locus_tag LOCUS_17250 gene recN 6883 5201 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547931.1 protein_id gnl|my_center|LOCUS_17250 7719 6904 gene locus_tag LOCUS_17260 7719 6904 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547933.1 protein_id gnl|my_center|LOCUS_17260 8582 7719 gene locus_tag LOCUS_17270 8582 7719 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547935.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence667 >Feature sequence668 881 2464 gene locus_tag LOCUS_17280 881 2464 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254042.1 protein_id gnl|my_center|LOCUS_17280 2468 3229 gene locus_tag LOCUS_17290 2468 3229 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548674.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence669 446 1087 gene locus_tag LOCUS_17300 446 1087 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065989431.1 protein_id gnl|my_center|LOCUS_17300 1090 1752 gene locus_tag LOCUS_17310 1090 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17310 1762 2076 gene locus_tag LOCUS_17320 1762 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17320 2733 2164 gene locus_tag LOCUS_17330 2733 2164 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644741.1 protein_id gnl|my_center|LOCUS_17330 4636 2867 gene locus_tag LOCUS_17340 4636 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 5988 4765 gene locus_tag LOCUS_17350 5988 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 6195 6371 gene locus_tag LOCUS_17360 6195 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 7390 6488 gene locus_tag LOCUS_17370 7390 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 7365 7688 gene locus_tag LOCUS_17380 7365 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 7896 11912 gene locus_tag LOCUS_17390 7896 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 12954 12031 gene locus_tag LOCUS_17400 12954 12031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence670 359 2113 gene locus_tag LOCUS_17410 359 2113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814583.1 protein_id gnl|my_center|LOCUS_17410 2106 3872 gene locus_tag LOCUS_17420 2106 3872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428271.1 protein_id gnl|my_center|LOCUS_17420 4000 5925 gene locus_tag LOCUS_17430 4000 5925 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016921.1 protein_id gnl|my_center|LOCUS_17430 6010 7011 gene locus_tag LOCUS_17440 6010 7011 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674791.1 protein_id gnl|my_center|LOCUS_17440 7700 7071 gene locus_tag LOCUS_17450 gene nth 7700 7071 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254362.1 protein_id gnl|my_center|LOCUS_17450 8364 7717 gene locus_tag LOCUS_17460 8364 7717 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547543.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence671 111 1622 gene locus_tag LOCUS_17470 111 1622 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549839.1 protein_id gnl|my_center|LOCUS_17470 2193 1666 gene locus_tag LOCUS_17480 2193 1666 CDS product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549837.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence672 1066 458 gene locus_tag LOCUS_17490 1066 458 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546493.1 protein_id gnl|my_center|LOCUS_17490 1169 1801 gene locus_tag LOCUS_17500 1169 1801 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546495.1 protein_id gnl|my_center|LOCUS_17500 1798 2595 gene locus_tag LOCUS_17510 1798 2595 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254215.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence673 >Feature sequence674 >Feature sequence675 456 1652 gene locus_tag LOCUS_17520 gene acmB 456 1652 CDS product beta-N-acetylglucosaminidase AcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548795.1 protein_id gnl|my_center|LOCUS_17520 1674 3299 gene locus_tag LOCUS_17530 1674 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence676 4408 2447 gene locus_tag LOCUS_17540 gene gyrB 4408 2447 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549374.1 protein_id gnl|my_center|LOCUS_17540 <4964 4392 gene locus_tag LOCUS_17550 <4964 4392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549377.1:DNA replication/repair protein RecF >Feature sequence677 >Feature sequence678 847 257 gene locus_tag LOCUS_17560 847 257 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549069.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence679 >Feature sequence680 585 1463 gene locus_tag LOCUS_17570 gene rapZ 585 1463 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546593.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence681 223 459 gene locus_tag LOCUS_17580 gene rpsR 223 459 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549366.1 protein_id gnl|my_center|LOCUS_17580 598 2619 gene locus_tag LOCUS_17590 598 2619 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549345.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence682 <1 1197 gene locus_tag LOCUS_17600 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254297.1:GTPase ObgE >Feature sequence683 525 1424 gene locus_tag LOCUS_17610 525 1424 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence684 908 504 gene locus_tag LOCUS_17620 908 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence685 2030 228 gene locus_tag LOCUS_17630 gene uvrC 2030 228 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547051.1 protein_id gnl|my_center|LOCUS_17630 2287 3225 gene locus_tag LOCUS_17640 2287 3225 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254272.1 protein_id gnl|my_center|LOCUS_17640 <4313 3283 gene locus_tag LOCUS_17650 <4313 3283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389901.1:excinuclease ABC subunit A >Feature sequence686 <1 936 gene locus_tag LOCUS_17660 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548798.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence687 >Feature sequence688 10 84 gene locus_tag LOCUS_t00760 10 84 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 87 160 gene locus_tag LOCUS_t00770 87 160 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 180 251 gene locus_tag LOCUS_t00780 180 251 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 286 359 gene locus_tag LOCUS_t00790 286 359 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 362 434 gene locus_tag LOCUS_t00800 362 434 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 437 512 gene locus_tag LOCUS_t00810 437 512 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 858 1913 gene locus_tag LOCUS_17670 gene ribD 858 1913 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398763.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence689 1832 240 gene locus_tag LOCUS_17680 gene asnB 1832 240 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_17680 2364 2438 gene locus_tag LOCUS_t00820 2364 2438 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2441 2514 gene locus_tag LOCUS_t00830 2441 2514 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2534 2605 gene locus_tag LOCUS_t00840 2534 2605 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2634 2709 gene locus_tag LOCUS_t00850 2634 2709 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2710 2784 gene locus_tag LOCUS_t00860 2710 2784 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2787 2860 gene locus_tag LOCUS_t00870 2787 2860 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2902 2989 gene locus_tag LOCUS_t00880 2902 2989 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2997 3072 gene locus_tag LOCUS_t00890 2997 3072 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3074 3149 gene locus_tag LOCUS_t00900 3074 3149 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3154 3228 gene locus_tag LOCUS_t00910 3154 3228 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence690 >Feature sequence691 >Feature sequence692 <1 947 gene locus_tag LOCUS_17690 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005667625.1:thiol reductant ABC exporter subunit CydC 2423 996 gene locus_tag LOCUS_17700 gene sufB 2423 996 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702990.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence693 <563 34 gene locus_tag LOCUS_17710 <563 34 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_154549573.1:IS3 family transposase >Feature sequence694 >Feature sequence695 1330 326 gene locus_tag LOCUS_17720 1330 326 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546776.1 protein_id gnl|my_center|LOCUS_17720 2035 1421 gene locus_tag LOCUS_17730 gene radC 2035 1421 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546774.1 protein_id gnl|my_center|LOCUS_17730 2765 2085 gene locus_tag LOCUS_17740 2765 2085 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546772.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence696 2439 2155 gene locus_tag LOCUS_17750 2439 2155 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547810.1 protein_id gnl|my_center|LOCUS_17750 2744 2466 gene locus_tag LOCUS_17760 2744 2466 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547812.1 protein_id gnl|my_center|LOCUS_17760 3971 2775 gene locus_tag LOCUS_17770 gene nusA 3971 2775 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254397.1 protein_id gnl|my_center|LOCUS_17770 4467 3991 gene locus_tag LOCUS_17780 gene rimP 4467 3991 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254398.1 protein_id gnl|my_center|LOCUS_17780 8914 4577 gene locus_tag LOCUS_17790 8914 4577 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547817.1 protein_id gnl|my_center|LOCUS_17790 10624 8927 gene locus_tag LOCUS_17800 10624 8927 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547819.1 protein_id gnl|my_center|LOCUS_17800 11919 10672 gene locus_tag LOCUS_17810 gene rseP 11919 10672 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547820.1 protein_id gnl|my_center|LOCUS_17810 12726 11929 gene locus_tag LOCUS_17820 12726 11929 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547823.1 protein_id gnl|my_center|LOCUS_17820 13463 12732 gene locus_tag LOCUS_17830 13463 12732 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547825.1 protein_id gnl|my_center|LOCUS_17830 14023 13466 gene locus_tag LOCUS_17840 gene frr 14023 13466 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095341972.1 protein_id gnl|my_center|LOCUS_17840 14748 14023 gene locus_tag LOCUS_17850 gene pyrH 14748 14023 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254400.1 protein_id gnl|my_center|LOCUS_17850 15912 14884 gene locus_tag LOCUS_17860 gene tsf 15912 14884 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808080.1 protein_id gnl|my_center|LOCUS_17860 16740 15976 gene locus_tag LOCUS_17870 gene rpsB 16740 15976 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547837.1 protein_id gnl|my_center|LOCUS_17870 17914 16904 gene locus_tag LOCUS_17880 17914 16904 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547839.1 protein_id gnl|my_center|LOCUS_17880 17997 18611 gene locus_tag LOCUS_17890 17997 18611 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547840.1 protein_id gnl|my_center|LOCUS_17890 19662 18673 gene locus_tag LOCUS_17900 19662 18673 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524132.1 protein_id gnl|my_center|LOCUS_17900 21003 19663 gene locus_tag LOCUS_17910 21003 19663 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence697 >Feature sequence698 1225 638 gene locus_tag LOCUS_17920 1225 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence699 >Feature sequence700 1036 233 gene locus_tag LOCUS_17930 1036 233 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549854.1 protein_id gnl|my_center|LOCUS_17930 1840 1082 gene locus_tag LOCUS_17940 1840 1082 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549854.1 protein_id gnl|my_center|LOCUS_17940 2268 2447 gene locus_tag LOCUS_17950 2268 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3296 2583 gene locus_tag LOCUS_17960 3296 2583 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549854.1 protein_id gnl|my_center|LOCUS_17960 <4183 3453 gene locus_tag LOCUS_17970 <4183 3453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549854.1:C40 family peptidase >Feature sequence701 >Feature sequence702 1198 149 gene locus_tag LOCUS_17980 1198 149 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 protein_id gnl|my_center|LOCUS_17980 2616 1240 gene locus_tag LOCUS_17990 2616 1240 CDS product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254557.1 protein_id gnl|my_center|LOCUS_17990 3103 2648 gene locus_tag LOCUS_18000 gene tagD 3103 2648 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646390.1 protein_id gnl|my_center|LOCUS_18000 4023 3103 gene locus_tag LOCUS_18010 4023 3103 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062005.1 protein_id gnl|my_center|LOCUS_18010 5466 4033 gene locus_tag LOCUS_18020 5466 4033 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101282.1 protein_id gnl|my_center|LOCUS_18020 6623 5571 gene locus_tag LOCUS_18030 6623 5571 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383751.1 protein_id gnl|my_center|LOCUS_18030 7343 6627 gene locus_tag LOCUS_18040 7343 6627 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380521.1 protein_id gnl|my_center|LOCUS_18040 8360 7356 gene locus_tag LOCUS_18050 8360 7356 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549884.1 protein_id gnl|my_center|LOCUS_18050 9493 8363 gene locus_tag LOCUS_18060 9493 8363 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434606.1 protein_id gnl|my_center|LOCUS_18060 10419 9490 gene locus_tag LOCUS_18070 10419 9490 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902065.1 protein_id gnl|my_center|LOCUS_18070 11531 10422 gene locus_tag LOCUS_18080 gene glf 11531 10422 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057797519.1 protein_id gnl|my_center|LOCUS_18080 12296 11562 gene locus_tag LOCUS_18090 12296 11562 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549870.1 protein_id gnl|my_center|LOCUS_18090 13013 12360 gene locus_tag LOCUS_18100 13013 12360 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986980.1 protein_id gnl|my_center|LOCUS_18100 14199 13219 gene locus_tag LOCUS_18110 14199 13219 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641230.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence703 >Feature sequence704 >Feature sequence705 123 1346 gene locus_tag LOCUS_18120 123 1346 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_18120 1376 2758 gene locus_tag LOCUS_18130 gene argH 1376 2758 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence706 >Feature sequence707 701 213 gene locus_tag LOCUS_18140 701 213 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546424.1 protein_id gnl|my_center|LOCUS_18140 1003 707 gene locus_tag LOCUS_18150 1003 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence708 >Feature sequence709 788 1603 gene locus_tag LOCUS_18160 gene recX 788 1603 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546469.1 protein_id gnl|my_center|LOCUS_18160 1646 2122 gene locus_tag LOCUS_18170 1646 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254210.1 protein_id gnl|my_center|LOCUS_18170 2583 2119 gene locus_tag LOCUS_18180 2583 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 2684 3547 gene locus_tag LOCUS_18190 2684 3547 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546472.1 protein_id gnl|my_center|LOCUS_18190 3547 5118 gene locus_tag LOCUS_18200 3547 5118 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546473.1 protein_id gnl|my_center|LOCUS_18200 5370 5182 gene locus_tag LOCUS_18210 5370 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 7055 5394 gene locus_tag LOCUS_18220 7055 5394 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585581.1 protein_id gnl|my_center|LOCUS_18220 7614 7336 gene locus_tag LOCUS_18230 7614 7336 CDS product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546474.1 protein_id gnl|my_center|LOCUS_18230 <8577 7731 gene locus_tag LOCUS_18240 <8577 7731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254211.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence710 <1 538 gene locus_tag LOCUS_18250 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546793.1:penicillin-binding protein 546 1505 gene locus_tag LOCUS_18260 gene mraY 546 1505 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546795.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence711 >Feature sequence712 318 1943 gene locus_tag LOCUS_18270 318 1943 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548835.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence713 1165 305 gene locus_tag LOCUS_18280 1165 305 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254214.1 protein_id gnl|my_center|LOCUS_18280 <1821 1277 gene locus_tag LOCUS_18290 <1821 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546487.1:adaptor protein MecA >Feature sequence714 398 1741 gene locus_tag LOCUS_18300 398 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 >Feature sequence715 4822 5016 gene locus_tag LOCUS_18310 4822 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 5071 5940 gene locus_tag LOCUS_18320 5071 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 7428 6226 gene locus_tag LOCUS_18330 gene trpB 7428 6226 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016308.1 protein_id gnl|my_center|LOCUS_18330 7638 7474 gene locus_tag LOCUS_18340 7638 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 8038 8781 gene locus_tag LOCUS_18350 8038 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 9026 10447 gene locus_tag LOCUS_18360 9026 10447 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_18360 10579 10917 gene locus_tag LOCUS_18370 10579 10917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 11059 11235 gene locus_tag LOCUS_18380 11059 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 11256 11918 gene locus_tag LOCUS_18390 11256 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 12062 12721 gene locus_tag LOCUS_18400 12062 12721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 12875 13627 gene locus_tag LOCUS_18410 12875 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 14738 13704 gene locus_tag LOCUS_18420 14738 13704 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004046647.1 protein_id gnl|my_center|LOCUS_18420 15311 14991 gene locus_tag LOCUS_18430 15311 14991 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644759.1 protein_id gnl|my_center|LOCUS_18430 16376 15342 gene locus_tag LOCUS_18440 16376 15342 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004046647.1 protein_id gnl|my_center|LOCUS_18440 17414 16500 gene locus_tag LOCUS_18450 17414 16500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 17928 17476 gene locus_tag LOCUS_18460 17928 17476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 19212 18130 gene locus_tag LOCUS_18470 19212 18130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 19709 19443 gene locus_tag LOCUS_18480 19709 19443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 20059 19907 gene locus_tag LOCUS_18490 20059 19907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 20709 20059 gene locus_tag LOCUS_18500 20709 20059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 21034 20849 gene locus_tag LOCUS_18510 21034 20849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 21192 21055 gene locus_tag LOCUS_18520 21192 21055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 22009 21404 gene locus_tag LOCUS_18530 22009 21404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 22420 22250 gene locus_tag LOCUS_18540 22420 22250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 23723 22509 gene locus_tag LOCUS_18550 23723 22509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 24449 23871 gene locus_tag LOCUS_18560 24449 23871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 25665 24475 gene locus_tag LOCUS_18570 25665 24475 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102112.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence716 >Feature sequence717 190 312 gene locus_tag LOCUS_18580 190 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1383 298 gene locus_tag LOCUS_18590 1383 298 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546967.1 protein_id gnl|my_center|LOCUS_18590 1604 1386 gene locus_tag LOCUS_18600 1604 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1907 1743 gene locus_tag LOCUS_18610 1907 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2812 2027 gene locus_tag LOCUS_18620 2812 2027 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206343.1 protein_id gnl|my_center|LOCUS_18620 3288 2815 gene locus_tag LOCUS_18630 3288 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 3422 4078 gene locus_tag LOCUS_18640 3422 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 4374 4213 gene locus_tag LOCUS_18650 4374 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 4795 4412 gene locus_tag LOCUS_18660 4795 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 5150 4779 gene locus_tag LOCUS_18670 5150 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 5298 5492 gene locus_tag LOCUS_18680 5298 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 5518 6291 gene locus_tag LOCUS_18690 5518 6291 CDS product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148557.1 protein_id gnl|my_center|LOCUS_18690 6300 6689 gene locus_tag LOCUS_18700 6300 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 6704 6937 gene locus_tag LOCUS_18710 6704 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 7189 6941 gene locus_tag LOCUS_18720 7189 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 7273 7479 gene locus_tag LOCUS_18730 7273 7479 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475619.1 protein_id gnl|my_center|LOCUS_18730 7463 7789 gene locus_tag LOCUS_18740 7463 7789 CDS product DUF771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475911.1 protein_id gnl|my_center|LOCUS_18740 8398 8559 gene locus_tag LOCUS_18750 8398 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence718 351 872 gene locus_tag LOCUS_18760 351 872 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254234.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence719 >Feature sequence720 833 30 gene locus_tag LOCUS_18770 833 30 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence721 341 925 gene locus_tag LOCUS_18780 gene clpP 341 925 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564255.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence722 1054 278 gene locus_tag LOCUS_18790 1054 278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642244.1 protein_id gnl|my_center|LOCUS_18790 2044 1070 gene locus_tag LOCUS_18800 2044 1070 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101995.1 protein_id gnl|my_center|LOCUS_18800 2937 2059 gene locus_tag LOCUS_18810 2937 2059 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563083.1 protein_id gnl|my_center|LOCUS_18810 4180 2987 gene locus_tag LOCUS_18820 4180 2987 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101996.1 protein_id gnl|my_center|LOCUS_18820 >Feature sequence723 2081 1587 gene locus_tag LOCUS_18830 2081 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 2518 2165 gene locus_tag LOCUS_18840 2518 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 3670 2657 gene locus_tag LOCUS_18850 3670 2657 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence724 <1 804 gene locus_tag LOCUS_18860 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101262.1:AEC family transporter 1538 1059 gene locus_tag LOCUS_18870 1538 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1809 1660 gene locus_tag LOCUS_18880 1809 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2623 2514 gene locus_tag LOCUS_r00060 2623 2514 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence725 960 121 gene locus_tag LOCUS_18890 960 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2882 1260 gene locus_tag LOCUS_18900 2882 1260 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546358.1 protein_id gnl|my_center|LOCUS_18900 3061 4005 gene locus_tag LOCUS_18910 3061 4005 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_18910 4175 6904 gene locus_tag LOCUS_18920 gene ppc 4175 6904 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254335.1 protein_id gnl|my_center|LOCUS_18920 8141 6996 gene locus_tag LOCUS_18930 8141 6996 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476472.1 protein_id gnl|my_center|LOCUS_18930 8593 8144 gene locus_tag LOCUS_18940 8593 8144 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701041.1 protein_id gnl|my_center|LOCUS_18940 10478 8607 gene locus_tag LOCUS_18950 10478 8607 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476473.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence726 >Feature sequence727 >Feature sequence728 418 1038 gene locus_tag LOCUS_18960 418 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 1215 1132 gene locus_tag LOCUS_t00920 1215 1132 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1941 1270 gene locus_tag LOCUS_18970 1941 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2715 1951 gene locus_tag LOCUS_18980 gene fabI 2715 1951 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475769.1 protein_id gnl|my_center|LOCUS_18980