>Feature sequence01 <1 609 gene locus_tag LOCUS_00010 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000681363.1:Na+/H+ antiporter NhaA 672 884 gene locus_tag LOCUS_00020 672 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1035 832 gene locus_tag LOCUS_00030 1035 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2360 1113 gene locus_tag LOCUS_00040 2360 1113 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032666220.1 protein_id gnl|my_center|LOCUS_00040 2756 3274 gene locus_tag LOCUS_00050 2756 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3274 4242 gene locus_tag LOCUS_00060 3274 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4644 5681 gene locus_tag LOCUS_00070 4644 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5681 7540 gene locus_tag LOCUS_00080 5681 7540 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966261.1 protein_id gnl|my_center|LOCUS_00080 7637 9430 gene locus_tag LOCUS_00090 7637 9430 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031064.1 protein_id gnl|my_center|LOCUS_00090 9645 10580 gene locus_tag LOCUS_00100 9645 10580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10727 11710 gene locus_tag LOCUS_00110 10727 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 16787 11901 gene locus_tag LOCUS_00120 16787 11901 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102960.1 protein_id gnl|my_center|LOCUS_00120 17288 17674 gene locus_tag LOCUS_00130 17288 17674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17683 18393 gene locus_tag LOCUS_00140 17683 18393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18483 18911 gene locus_tag LOCUS_00150 18483 18911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18908 20182 gene locus_tag LOCUS_00160 gene umuC 18908 20182 CDS product DNA polymerase V catalytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457628.1 protein_id gnl|my_center|LOCUS_00160 21240 20227 gene locus_tag LOCUS_00170 21240 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21560 21387 gene locus_tag LOCUS_00180 21560 21387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 22330 21692 gene locus_tag LOCUS_00190 22330 21692 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_00190 23719 22793 gene locus_tag LOCUS_00200 23719 22793 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205285.1 protein_id gnl|my_center|LOCUS_00200 23900 23712 gene locus_tag LOCUS_00210 23900 23712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24005 24379 gene locus_tag LOCUS_00220 24005 24379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25052 25372 gene locus_tag LOCUS_00230 25052 25372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25412 26164 gene locus_tag LOCUS_00240 25412 26164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26188 26802 gene locus_tag LOCUS_00250 26188 26802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 26792 27220 gene locus_tag LOCUS_00260 26792 27220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 27217 27957 gene locus_tag LOCUS_00270 27217 27957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27975 28280 gene locus_tag LOCUS_00280 27975 28280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28316 28684 gene locus_tag LOCUS_00290 28316 28684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 28692 29108 gene locus_tag LOCUS_00300 28692 29108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 29101 31425 gene locus_tag LOCUS_00310 29101 31425 CDS product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037611.1 protein_id gnl|my_center|LOCUS_00310 31465 32094 gene locus_tag LOCUS_00320 gene virB5 31465 32094 CDS product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042067.1 protein_id gnl|my_center|LOCUS_00320 32085 32459 gene locus_tag LOCUS_00330 32085 32459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 32462 33394 gene locus_tag LOCUS_00340 32462 33394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 33404 33796 gene locus_tag LOCUS_00350 33404 33796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 33995 34687 gene locus_tag LOCUS_00360 33995 34687 CDS product virB8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252745.1 protein_id gnl|my_center|LOCUS_00360 34697 35545 gene locus_tag LOCUS_00370 gene virB9 34697 35545 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597362.1 protein_id gnl|my_center|LOCUS_00370 35542 36729 gene locus_tag LOCUS_00380 gene virB10 35542 36729 CDS product type IV secretion system protein VirB10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264002.1 protein_id gnl|my_center|LOCUS_00380 36790 37869 gene locus_tag LOCUS_00390 gene virB11 36790 37869 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170068631.1 protein_id gnl|my_center|LOCUS_00390 37890 38318 gene locus_tag LOCUS_00400 37890 38318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 39052 40224 gene locus_tag LOCUS_00410 39052 40224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 40249 42792 gene locus_tag LOCUS_00420 40249 42792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 42789 42950 gene locus_tag LOCUS_00430 42789 42950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 43011 44003 gene locus_tag LOCUS_00440 43011 44003 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533282.1 protein_id gnl|my_center|LOCUS_00440 44005 44307 gene locus_tag LOCUS_00450 44005 44307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 44202 45230 gene locus_tag LOCUS_00460 44202 45230 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 protein_id gnl|my_center|LOCUS_00460 45427 45343 gene locus_tag LOCUS_t00010 45427 45343 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45640 46140 gene locus_tag LOCUS_00470 gene hutZ 45640 46140 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073462.1 protein_id gnl|my_center|LOCUS_00470 47425 46232 gene locus_tag LOCUS_00480 47425 46232 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184404.1 protein_id gnl|my_center|LOCUS_00480 47648 49564 gene locus_tag LOCUS_00490 gene htpG 47648 49564 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929604.1 protein_id gnl|my_center|LOCUS_00490 50199 49609 gene locus_tag LOCUS_00500 gene ampD 50199 49609 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807804.1 protein_id gnl|my_center|LOCUS_00500 51304 50453 gene locus_tag LOCUS_00510 gene ccsA 51304 50453 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929606.1 protein_id gnl|my_center|LOCUS_00510 51404 52825 gene locus_tag LOCUS_00520 gene ffh 51404 52825 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929607.1 protein_id gnl|my_center|LOCUS_00520 53315 52881 gene locus_tag LOCUS_00530 gene lysM 53315 52881 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853464.1 protein_id gnl|my_center|LOCUS_00530 54374 53427 gene locus_tag LOCUS_00540 gene pip 54374 53427 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925856.1 protein_id gnl|my_center|LOCUS_00540 55159 54380 gene locus_tag LOCUS_00550 gene trmB 55159 54380 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931594.1 protein_id gnl|my_center|LOCUS_00550 55775 55176 gene locus_tag LOCUS_00560 55775 55176 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577619.1 protein_id gnl|my_center|LOCUS_00560 57894 55819 gene locus_tag LOCUS_00570 gene metG 57894 55819 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064494.1 protein_id gnl|my_center|LOCUS_00570 58291 58004 gene locus_tag LOCUS_00580 58291 58004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808374.1 protein_id gnl|my_center|LOCUS_00580 58397 59482 gene locus_tag LOCUS_00590 gene apbC 58397 59482 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448044.1 protein_id gnl|my_center|LOCUS_00590 59526 61310 gene locus_tag LOCUS_00600 59526 61310 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039016.1 protein_id gnl|my_center|LOCUS_00600 61307 67342 gene locus_tag LOCUS_00610 61307 67342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 67457 68020 gene locus_tag LOCUS_00620 gene dcd 67457 68020 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808382.1 protein_id gnl|my_center|LOCUS_00620 68057 70321 gene locus_tag LOCUS_00630 68057 70321 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808393.1 protein_id gnl|my_center|LOCUS_00630 70314 71519 gene locus_tag LOCUS_00640 70314 71519 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929672.1 protein_id gnl|my_center|LOCUS_00640 71881 71552 gene locus_tag LOCUS_00650 71881 71552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 72108 73211 gene locus_tag LOCUS_00660 gene gcvT 72108 73211 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808404.1 protein_id gnl|my_center|LOCUS_00660 73335 73709 gene locus_tag LOCUS_00670 gene gcvH 73335 73709 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929676.1 protein_id gnl|my_center|LOCUS_00670 73735 76602 gene locus_tag LOCUS_00680 gene gcvP 73735 76602 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064491.1 protein_id gnl|my_center|LOCUS_00680 77270 76782 gene locus_tag LOCUS_00690 77270 76782 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064487.1 protein_id gnl|my_center|LOCUS_00690 78148 77354 gene locus_tag LOCUS_00700 gene thyA 78148 77354 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948554.1 protein_id gnl|my_center|LOCUS_00700 78574 78152 gene locus_tag LOCUS_00710 78574 78152 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 protein_id gnl|my_center|LOCUS_00710 78892 79575 gene locus_tag LOCUS_00720 gene coq7 78892 79575 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931327.1 protein_id gnl|my_center|LOCUS_00720 80030 81103 gene locus_tag LOCUS_00730 80030 81103 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808448.1 protein_id gnl|my_center|LOCUS_00730 81218 82492 gene locus_tag LOCUS_00740 gene tviB 81218 82492 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172607932.1 protein_id gnl|my_center|LOCUS_00740 82515 83540 gene locus_tag LOCUS_00750 82515 83540 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064483.1 protein_id gnl|my_center|LOCUS_00750 83613 84902 gene locus_tag LOCUS_00760 83613 84902 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064482.1 protein_id gnl|my_center|LOCUS_00760 84909 86063 gene locus_tag LOCUS_00770 84909 86063 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808452.1 protein_id gnl|my_center|LOCUS_00770 86066 87961 gene locus_tag LOCUS_00780 gene asnB 86066 87961 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039037.1 protein_id gnl|my_center|LOCUS_00780 88000 89130 gene locus_tag LOCUS_00790 88000 89130 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931322.1 protein_id gnl|my_center|LOCUS_00790 89127 90290 gene locus_tag LOCUS_00800 89127 90290 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931321.1 protein_id gnl|my_center|LOCUS_00800 90303 91421 gene locus_tag LOCUS_00810 90303 91421 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931320.1 protein_id gnl|my_center|LOCUS_00810 92840 91452 gene locus_tag LOCUS_00820 92840 91452 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808464.1 protein_id gnl|my_center|LOCUS_00820 93003 94424 gene locus_tag LOCUS_00830 93003 94424 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931317.1 protein_id gnl|my_center|LOCUS_00830 95232 94405 gene locus_tag LOCUS_00840 gene mutM 95232 94405 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925978.1 protein_id gnl|my_center|LOCUS_00840 95484 97196 gene locus_tag LOCUS_00850 95484 97196 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931312.1 protein_id gnl|my_center|LOCUS_00850 97193 97771 gene locus_tag LOCUS_00860 gene lolB 97193 97771 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818921.1 protein_id gnl|my_center|LOCUS_00860 97781 98710 gene locus_tag LOCUS_00870 gene ispE 97781 98710 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039050.1 protein_id gnl|my_center|LOCUS_00870 98946 100328 gene locus_tag LOCUS_00880 98946 100328 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535871.1 protein_id gnl|my_center|LOCUS_00880 100325 101572 gene locus_tag LOCUS_00890 100325 101572 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926512.1 protein_id gnl|my_center|LOCUS_00890 101771 103105 gene locus_tag LOCUS_00900 101771 103105 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527034.1 protein_id gnl|my_center|LOCUS_00900 103169 105004 gene locus_tag LOCUS_00910 103169 105004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 105196 105272 gene locus_tag LOCUS_t00020 105196 105272 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 105506 106330 gene locus_tag LOCUS_00920 105506 106330 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_00920 106438 107037 gene locus_tag LOCUS_00930 106438 107037 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808505.1 protein_id gnl|my_center|LOCUS_00930 107162 107761 gene locus_tag LOCUS_00940 gene pth 107162 107761 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931308.1 protein_id gnl|my_center|LOCUS_00940 107764 108522 gene locus_tag LOCUS_00950 107764 108522 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064479.1 protein_id gnl|my_center|LOCUS_00950 108531 108899 gene locus_tag LOCUS_00960 108531 108899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 108999 110090 gene locus_tag LOCUS_00970 gene ychF 108999 110090 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186874.1 protein_id gnl|my_center|LOCUS_00970 110205 112985 gene locus_tag LOCUS_00980 110205 112985 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808566.1 protein_id gnl|my_center|LOCUS_00980 113046 113420 gene locus_tag LOCUS_00990 113046 113420 CDS product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808567.1 protein_id gnl|my_center|LOCUS_00990 113707 113462 gene locus_tag LOCUS_01000 113707 113462 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808570.1 protein_id gnl|my_center|LOCUS_01000 114590 114081 gene locus_tag LOCUS_01010 gene coaD 114590 114081 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 protein_id gnl|my_center|LOCUS_01010 115358 114765 gene locus_tag LOCUS_01020 gene rsmD 115358 114765 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064460.1 protein_id gnl|my_center|LOCUS_01020 115483 116826 gene locus_tag LOCUS_01030 gene ftsY 115483 116826 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446951.1 protein_id gnl|my_center|LOCUS_01030 118662 116929 gene locus_tag LOCUS_01040 118662 116929 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925999.1 protein_id gnl|my_center|LOCUS_01040 120303 118765 gene locus_tag LOCUS_01050 120303 118765 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533070.1 protein_id gnl|my_center|LOCUS_01050 120833 120351 gene locus_tag LOCUS_01060 120833 120351 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815019.1 protein_id gnl|my_center|LOCUS_01060 121275 122426 gene locus_tag LOCUS_01070 gene ribBA 121275 122426 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808597.1 protein_id gnl|my_center|LOCUS_01070 122461 123006 gene locus_tag LOCUS_01080 gene ribH 122461 123006 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039074.1 protein_id gnl|my_center|LOCUS_01080 123015 123479 gene locus_tag LOCUS_01090 gene nusB 123015 123479 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808599.1 protein_id gnl|my_center|LOCUS_01090 123486 124460 gene locus_tag LOCUS_01100 gene thiL 123486 124460 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931503.1 protein_id gnl|my_center|LOCUS_01100 124506 125066 gene locus_tag LOCUS_01110 124506 125066 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247451.1 protein_id gnl|my_center|LOCUS_01110 125145 125657 gene locus_tag LOCUS_01120 125145 125657 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808604.1 protein_id gnl|my_center|LOCUS_01120 126500 125679 gene locus_tag LOCUS_01130 gene pyrF 126500 125679 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808606.1 protein_id gnl|my_center|LOCUS_01130 126896 126507 gene locus_tag LOCUS_01140 126896 126507 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808610.1 protein_id gnl|my_center|LOCUS_01140 128733 127087 gene locus_tag LOCUS_01150 gene groL 128733 127087 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808619.1 protein_id gnl|my_center|LOCUS_01150 129085 128798 gene locus_tag LOCUS_01160 gene groES 129085 128798 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808621.1 protein_id gnl|my_center|LOCUS_01160 130736 129267 gene locus_tag LOCUS_01170 130736 129267 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390069.1 protein_id gnl|my_center|LOCUS_01170 130916 132070 gene locus_tag LOCUS_01180 gene prpC 130916 132070 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065153.1 protein_id gnl|my_center|LOCUS_01180 132076 134679 gene locus_tag LOCUS_01190 gene acnD 132076 134679 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070708.1 protein_id gnl|my_center|LOCUS_01190 134676 135887 gene locus_tag LOCUS_01200 gene prpF 134676 135887 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 protein_id gnl|my_center|LOCUS_01200 135940 136800 gene locus_tag LOCUS_01210 135940 136800 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814441.1 protein_id gnl|my_center|LOCUS_01210 136958 137917 gene locus_tag LOCUS_01220 136958 137917 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 protein_id gnl|my_center|LOCUS_01220 138585 138079 gene locus_tag LOCUS_01230 138585 138079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 138916 139749 gene locus_tag LOCUS_01240 138916 139749 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927928.1 protein_id gnl|my_center|LOCUS_01240 139815 140195 gene locus_tag LOCUS_01250 139815 140195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812378.1 protein_id gnl|my_center|LOCUS_01250 140399 140602 gene locus_tag LOCUS_01260 140399 140602 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180943360.1 protein_id gnl|my_center|LOCUS_01260 141282 140932 gene locus_tag LOCUS_01270 141282 140932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064249.1 protein_id gnl|my_center|LOCUS_01270 141646 142764 gene locus_tag LOCUS_01280 141646 142764 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816851.1 protein_id gnl|my_center|LOCUS_01280 142818 143225 gene locus_tag LOCUS_01290 142818 143225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 143888 143346 gene locus_tag LOCUS_01300 143888 143346 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_01300 145052 143949 gene locus_tag LOCUS_01310 145052 143949 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 protein_id gnl|my_center|LOCUS_01310 >Feature sequence02 244 429 gene locus_tag LOCUS_01320 244 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 1504 569 gene locus_tag LOCUS_01330 1504 569 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727136.1 protein_id gnl|my_center|LOCUS_01330 1726 2724 gene locus_tag LOCUS_01340 1726 2724 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970169.1 protein_id gnl|my_center|LOCUS_01340 2796 3206 gene locus_tag LOCUS_01350 2796 3206 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810864.1 protein_id gnl|my_center|LOCUS_01350 3291 6608 gene locus_tag LOCUS_01360 3291 6608 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965449.1 protein_id gnl|my_center|LOCUS_01360 6714 9092 gene locus_tag LOCUS_01370 6714 9092 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_01370 9141 10148 gene locus_tag LOCUS_01380 9141 10148 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921424.1 protein_id gnl|my_center|LOCUS_01380 11218 10928 gene locus_tag LOCUS_01390 11218 10928 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_01390 11583 11215 gene locus_tag LOCUS_01400 11583 11215 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703181.1 protein_id gnl|my_center|LOCUS_01400 12327 11710 gene locus_tag LOCUS_01410 12327 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 12668 14287 gene locus_tag LOCUS_01420 12668 14287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 15012 15509 gene locus_tag LOCUS_01430 15012 15509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 15617 16090 gene locus_tag LOCUS_01440 15617 16090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 16780 16118 gene locus_tag LOCUS_01450 16780 16118 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533247.1 protein_id gnl|my_center|LOCUS_01450 17913 16777 gene locus_tag LOCUS_01460 17913 16777 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533246.1 protein_id gnl|my_center|LOCUS_01460 18546 17917 gene locus_tag LOCUS_01470 18546 17917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533245.1 protein_id gnl|my_center|LOCUS_01470 19007 18537 gene locus_tag LOCUS_01480 19007 18537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 19332 19090 gene locus_tag LOCUS_01490 19332 19090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 19443 19886 gene locus_tag LOCUS_01500 19443 19886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01500 20040 20585 gene locus_tag LOCUS_01510 20040 20585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01510 20996 22378 gene locus_tag LOCUS_01520 20996 22378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 23889 22615 gene locus_tag LOCUS_01530 gene tviB 23889 22615 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172607932.1 protein_id gnl|my_center|LOCUS_01530 24222 23929 gene locus_tag LOCUS_01540 24222 23929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 26067 24307 gene locus_tag LOCUS_01550 26067 24307 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_01550 27255 26071 gene locus_tag LOCUS_01560 27255 26071 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010356641.1 protein_id gnl|my_center|LOCUS_01560 28318 27314 gene locus_tag LOCUS_01570 28318 27314 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_01570 28903 28343 gene locus_tag LOCUS_01580 28903 28343 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469482.1 protein_id gnl|my_center|LOCUS_01580 29825 28914 gene locus_tag LOCUS_01590 29825 28914 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_01590 30252 29800 gene locus_tag LOCUS_01600 30252 29800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 32032 30905 gene locus_tag LOCUS_01610 32032 30905 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703236.1 protein_id gnl|my_center|LOCUS_01610 32326 32057 gene locus_tag LOCUS_01620 32326 32057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 32633 32295 gene locus_tag LOCUS_01630 32633 32295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 33533 32655 gene locus_tag LOCUS_01640 33533 32655 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765273.1 protein_id gnl|my_center|LOCUS_01640 34524 33637 gene locus_tag LOCUS_01650 34524 33637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 35519 34524 gene locus_tag LOCUS_01660 35519 34524 CDS product EpsG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203388.1 protein_id gnl|my_center|LOCUS_01660 36781 35732 gene locus_tag LOCUS_01670 36781 35732 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020707.1 protein_id gnl|my_center|LOCUS_01670 37920 36829 gene locus_tag LOCUS_01680 37920 36829 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_01680 38971 37922 gene locus_tag LOCUS_01690 38971 37922 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228262.1 protein_id gnl|my_center|LOCUS_01690 39971 38973 gene locus_tag LOCUS_01700 39971 38973 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922118.1 protein_id gnl|my_center|LOCUS_01700 41456 39975 gene locus_tag LOCUS_01710 41456 39975 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_01710 42550 41657 gene locus_tag LOCUS_01720 42550 41657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 44896 42668 gene locus_tag LOCUS_01730 44896 42668 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532211.1 protein_id gnl|my_center|LOCUS_01730 45398 44955 gene locus_tag LOCUS_01740 45398 44955 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527651.1 protein_id gnl|my_center|LOCUS_01740 46525 45410 gene locus_tag LOCUS_01750 46525 45410 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223870501.1 protein_id gnl|my_center|LOCUS_01750 47595 47008 gene locus_tag LOCUS_01760 gene rfaH 47595 47008 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957829.1 protein_id gnl|my_center|LOCUS_01760 47891 47965 gene locus_tag LOCUS_t00030 47891 47965 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 48940 48050 gene locus_tag LOCUS_01770 48940 48050 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 protein_id gnl|my_center|LOCUS_01770 50001 49018 gene locus_tag LOCUS_01780 50001 49018 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040004.1 protein_id gnl|my_center|LOCUS_01780 50000 51775 gene locus_tag LOCUS_01790 50000 51775 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135176397.1 protein_id gnl|my_center|LOCUS_01790 51799 52638 gene locus_tag LOCUS_01800 51799 52638 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_01800 52648 54018 gene locus_tag LOCUS_01810 52648 54018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 55011 54040 gene locus_tag LOCUS_01820 55011 54040 CDS product Bug family tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927499.1 protein_id gnl|my_center|LOCUS_01820 55823 55047 gene locus_tag LOCUS_01830 55823 55047 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090568.1 protein_id gnl|my_center|LOCUS_01830 57688 55847 gene locus_tag LOCUS_01840 57688 55847 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090526.1 protein_id gnl|my_center|LOCUS_01840 57850 59019 gene locus_tag LOCUS_01850 57850 59019 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967073.1 protein_id gnl|my_center|LOCUS_01850 59030 60661 gene locus_tag LOCUS_01860 59030 60661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 60677 62515 gene locus_tag LOCUS_01870 60677 62515 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968641.1 protein_id gnl|my_center|LOCUS_01870 62505 62918 gene locus_tag LOCUS_01880 62505 62918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 63219 62992 gene locus_tag LOCUS_01890 63219 62992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 63140 63775 gene locus_tag LOCUS_01900 63140 63775 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808119.1 protein_id gnl|my_center|LOCUS_01900 64058 64948 gene locus_tag LOCUS_01910 64058 64948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 64951 65895 gene locus_tag LOCUS_01920 64951 65895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 65916 66887 gene locus_tag LOCUS_01930 65916 66887 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818532.1 protein_id gnl|my_center|LOCUS_01930 66915 68114 gene locus_tag LOCUS_01940 66915 68114 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039906.1 protein_id gnl|my_center|LOCUS_01940 68145 69071 gene locus_tag LOCUS_01950 68145 69071 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206797.1 protein_id gnl|my_center|LOCUS_01950 69098 70291 gene locus_tag LOCUS_01960 69098 70291 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 protein_id gnl|my_center|LOCUS_01960 70426 70575 gene locus_tag LOCUS_01970 70426 70575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 70934 70692 gene locus_tag LOCUS_01980 70934 70692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 71508 71107 gene locus_tag LOCUS_01990 71508 71107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 71869 72447 gene locus_tag LOCUS_02000 71869 72447 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207538.1 protein_id gnl|my_center|LOCUS_02000 73850 72573 gene locus_tag LOCUS_02010 73850 72573 CDS product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 protein_id gnl|my_center|LOCUS_02010 74050 75075 gene locus_tag LOCUS_02020 74050 75075 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480142.1 protein_id gnl|my_center|LOCUS_02020 76103 75399 gene locus_tag LOCUS_02030 76103 75399 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929073.1 protein_id gnl|my_center|LOCUS_02030 77052 76090 gene locus_tag LOCUS_02040 gene trxB 77052 76090 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065064.1 protein_id gnl|my_center|LOCUS_02040 77097 79472 gene locus_tag LOCUS_02050 77097 79472 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814032.1 protein_id gnl|my_center|LOCUS_02050 79968 80687 gene locus_tag LOCUS_02060 gene lolA 79968 80687 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930946.1 protein_id gnl|my_center|LOCUS_02060 80924 82255 gene locus_tag LOCUS_02070 80924 82255 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930945.1 protein_id gnl|my_center|LOCUS_02070 83744 82377 gene locus_tag LOCUS_02080 83744 82377 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171375988.1 protein_id gnl|my_center|LOCUS_02080 84058 83741 gene locus_tag LOCUS_02090 84058 83741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 84576 85922 gene locus_tag LOCUS_02100 gene serS 84576 85922 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930944.1 protein_id gnl|my_center|LOCUS_02100 86191 86961 gene locus_tag LOCUS_02110 gene yaaA 86191 86961 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814010.1 protein_id gnl|my_center|LOCUS_02110 86958 88193 gene locus_tag LOCUS_02120 86958 88193 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814009.1 protein_id gnl|my_center|LOCUS_02120 89365 88241 gene locus_tag LOCUS_02130 89365 88241 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389543.1 protein_id gnl|my_center|LOCUS_02130 90507 89368 gene locus_tag LOCUS_02140 90507 89368 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389544.1 protein_id gnl|my_center|LOCUS_02140 92270 90504 gene locus_tag LOCUS_02150 92270 90504 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391778.1 protein_id gnl|my_center|LOCUS_02150 93318 92272 gene locus_tag LOCUS_02160 gene hlyD 93318 92272 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389546.1 protein_id gnl|my_center|LOCUS_02160 93932 93315 gene locus_tag LOCUS_02170 93932 93315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 96450 94171 gene locus_tag LOCUS_02180 96450 94171 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814008.1 protein_id gnl|my_center|LOCUS_02180 96997 98718 gene locus_tag LOCUS_02190 96997 98718 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814007.1 protein_id gnl|my_center|LOCUS_02190 98728 99219 gene locus_tag LOCUS_02200 gene ilvN 98728 99219 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_02200 99303 100319 gene locus_tag LOCUS_02210 gene ilvC 99303 100319 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185539.1 protein_id gnl|my_center|LOCUS_02210 101461 100472 gene locus_tag LOCUS_02220 101461 100472 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_02220 102897 101479 gene locus_tag LOCUS_02230 102897 101479 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039991.1 protein_id gnl|my_center|LOCUS_02230 103281 104039 gene locus_tag LOCUS_02240 103281 104039 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192955.1 protein_id gnl|my_center|LOCUS_02240 104069 105211 gene locus_tag LOCUS_02250 104069 105211 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705579.1 protein_id gnl|my_center|LOCUS_02250 106397 105438 gene locus_tag LOCUS_02260 106397 105438 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_02260 106631 107605 gene locus_tag LOCUS_02270 106631 107605 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064423.1 protein_id gnl|my_center|LOCUS_02270 107856 108824 gene locus_tag LOCUS_02280 107856 108824 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064423.1 protein_id gnl|my_center|LOCUS_02280 109592 108999 gene locus_tag LOCUS_02290 109592 108999 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732155.1 protein_id gnl|my_center|LOCUS_02290 110404 109700 gene locus_tag LOCUS_02300 110404 109700 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036904.1 protein_id gnl|my_center|LOCUS_02300 110807 111763 gene locus_tag LOCUS_02310 110807 111763 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036906.1 protein_id gnl|my_center|LOCUS_02310 112548 111751 gene locus_tag LOCUS_02320 112548 111751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 112755 112549 gene locus_tag LOCUS_02330 112755 112549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 113984 112836 gene locus_tag LOCUS_02340 113984 112836 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 protein_id gnl|my_center|LOCUS_02340 115978 114824 gene locus_tag LOCUS_02350 115978 114824 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069932.1 protein_id gnl|my_center|LOCUS_02350 116730 115975 gene locus_tag LOCUS_02360 116730 115975 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815313.1 protein_id gnl|my_center|LOCUS_02360 117751 116786 gene locus_tag LOCUS_02370 117751 116786 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040637.1 protein_id gnl|my_center|LOCUS_02370 118139 118966 gene locus_tag LOCUS_02380 118139 118966 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097851.1 protein_id gnl|my_center|LOCUS_02380 119428 119000 gene locus_tag LOCUS_02390 119428 119000 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811562.1 protein_id gnl|my_center|LOCUS_02390 120599 119451 gene locus_tag LOCUS_02400 gene pimD 120599 119451 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_02400 121857 120664 gene locus_tag LOCUS_02410 121857 120664 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_02410 122116 124206 gene locus_tag LOCUS_02420 122116 124206 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521274.1 protein_id gnl|my_center|LOCUS_02420 124376 125056 gene locus_tag LOCUS_02430 124376 125056 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552494.1 protein_id gnl|my_center|LOCUS_02430 125070 125705 gene locus_tag LOCUS_02440 125070 125705 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194517.1 protein_id gnl|my_center|LOCUS_02440 125736 126938 gene locus_tag LOCUS_02450 gene pcaF 125736 126938 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039581.1 protein_id gnl|my_center|LOCUS_02450 127111 127764 gene locus_tag LOCUS_02460 127111 127764 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196436.1 protein_id gnl|my_center|LOCUS_02460 127774 128538 gene locus_tag LOCUS_02470 gene pssA 127774 128538 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814004.1 protein_id gnl|my_center|LOCUS_02470 129163 128633 gene locus_tag LOCUS_02480 129163 128633 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814003.1 protein_id gnl|my_center|LOCUS_02480 129432 129701 gene locus_tag LOCUS_02490 gene rpsO 129432 129701 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_02490 129857 132010 gene locus_tag LOCUS_02500 gene pnp 129857 132010 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821234.1 protein_id gnl|my_center|LOCUS_02500 133574 132222 gene locus_tag LOCUS_02510 gene gdhA 133574 132222 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289187.1 protein_id gnl|my_center|LOCUS_02510 134185 133775 gene locus_tag LOCUS_02520 134185 133775 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821377.1 protein_id gnl|my_center|LOCUS_02520 137903 134346 gene locus_tag LOCUS_02530 137903 134346 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 protein_id gnl|my_center|LOCUS_02530 138164 138997 gene locus_tag LOCUS_02540 138164 138997 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267918.1 protein_id gnl|my_center|LOCUS_02540 138988 139251 gene locus_tag LOCUS_02550 138988 139251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 >Feature sequence03 <1 801 gene locus_tag LOCUS_02560 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931270.1:tripartite tricarboxylate transporter permease 971 1576 gene locus_tag LOCUS_02570 971 1576 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393403.1 protein_id gnl|my_center|LOCUS_02570 1579 2733 gene locus_tag LOCUS_02580 1579 2733 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071114.1 protein_id gnl|my_center|LOCUS_02580 2726 3931 gene locus_tag LOCUS_02590 2726 3931 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_02590 3931 4653 gene locus_tag LOCUS_02600 3931 4653 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_02600 5217 4666 gene locus_tag LOCUS_02610 5217 4666 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_02610 5750 5298 gene locus_tag LOCUS_02620 5750 5298 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808355.1 protein_id gnl|my_center|LOCUS_02620 5934 6224 gene locus_tag LOCUS_02630 5934 6224 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807161.1 protein_id gnl|my_center|LOCUS_02630 7647 6316 gene locus_tag LOCUS_02640 gene hslU 7647 6316 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064722.1 protein_id gnl|my_center|LOCUS_02640 8193 7660 gene locus_tag LOCUS_02650 gene hslV 8193 7660 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818422.1 protein_id gnl|my_center|LOCUS_02650 8715 8263 gene locus_tag LOCUS_02660 gene dksA 8715 8263 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807164.1 protein_id gnl|my_center|LOCUS_02660 9932 8841 gene locus_tag LOCUS_02670 9932 8841 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931290.1 protein_id gnl|my_center|LOCUS_02670 10684 10193 gene locus_tag LOCUS_02680 10684 10193 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807166.1 protein_id gnl|my_center|LOCUS_02680 11110 11766 gene locus_tag LOCUS_02690 gene aztA 11110 11766 CDS product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807167.1 protein_id gnl|my_center|LOCUS_02690 11766 12629 gene locus_tag LOCUS_02700 11766 12629 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376994.1 protein_id gnl|my_center|LOCUS_02700 12645 13628 gene locus_tag LOCUS_02710 12645 13628 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391451.1 protein_id gnl|my_center|LOCUS_02710 14582 13629 gene locus_tag LOCUS_02720 gene xerC 14582 13629 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038710.1 protein_id gnl|my_center|LOCUS_02720 15240 14584 gene locus_tag LOCUS_02730 15240 14584 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931281.1 protein_id gnl|my_center|LOCUS_02730 16144 15245 gene locus_tag LOCUS_02740 gene dapF 16144 15245 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807183.1 protein_id gnl|my_center|LOCUS_02740 17098 16208 gene locus_tag LOCUS_02750 17098 16208 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931280.1 protein_id gnl|my_center|LOCUS_02750 17511 18674 gene locus_tag LOCUS_02760 gene metK 17511 18674 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925730.1 protein_id gnl|my_center|LOCUS_02760 18936 20348 gene locus_tag LOCUS_02770 gene ahcY 18936 20348 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931278.1 protein_id gnl|my_center|LOCUS_02770 20470 20805 gene locus_tag LOCUS_02780 20470 20805 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_02780 20807 21649 gene locus_tag LOCUS_02790 gene metF 20807 21649 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807199.1 protein_id gnl|my_center|LOCUS_02790 22381 21767 gene locus_tag LOCUS_02800 22381 21767 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807206.1 protein_id gnl|my_center|LOCUS_02800 22483 24465 gene locus_tag LOCUS_02810 22483 24465 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038717.1 protein_id gnl|my_center|LOCUS_02810 24487 25665 gene locus_tag LOCUS_02820 24487 25665 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807209.1 protein_id gnl|my_center|LOCUS_02820 26972 25662 gene locus_tag LOCUS_02830 26972 25662 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038719.1 protein_id gnl|my_center|LOCUS_02830 27080 28459 gene locus_tag LOCUS_02840 27080 28459 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112765.1 protein_id gnl|my_center|LOCUS_02840 28487 29839 gene locus_tag LOCUS_02850 28487 29839 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268823.1 protein_id gnl|my_center|LOCUS_02850 29836 30837 gene locus_tag LOCUS_02860 29836 30837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 30840 31847 gene locus_tag LOCUS_02870 30840 31847 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265511.1 protein_id gnl|my_center|LOCUS_02870 31771 32931 gene locus_tag LOCUS_02880 31771 32931 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651618.1 protein_id gnl|my_center|LOCUS_02880 34236 33109 gene locus_tag LOCUS_02890 34236 33109 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_02890 35069 34275 gene locus_tag LOCUS_02900 35069 34275 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996082.1 protein_id gnl|my_center|LOCUS_02900 35190 36371 gene locus_tag LOCUS_02910 35190 36371 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226452.1 protein_id gnl|my_center|LOCUS_02910 36401 37165 gene locus_tag LOCUS_02920 36401 37165 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808206.1 protein_id gnl|my_center|LOCUS_02920 37279 38271 gene locus_tag LOCUS_02930 37279 38271 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931187.1 protein_id gnl|my_center|LOCUS_02930 38320 40005 gene locus_tag LOCUS_02940 38320 40005 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879007.1 protein_id gnl|my_center|LOCUS_02940 40002 41177 gene locus_tag LOCUS_02950 40002 41177 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_02950 41353 42510 gene locus_tag LOCUS_02960 41353 42510 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826425.1 protein_id gnl|my_center|LOCUS_02960 44394 42745 gene locus_tag LOCUS_02970 44394 42745 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807214.1 protein_id gnl|my_center|LOCUS_02970 45541 44780 gene locus_tag LOCUS_02980 45541 44780 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038721.1 protein_id gnl|my_center|LOCUS_02980 45988 45542 gene locus_tag LOCUS_02990 45988 45542 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925740.1 protein_id gnl|my_center|LOCUS_02990 46784 45993 gene locus_tag LOCUS_03000 gene trpC 46784 45993 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815394.1 protein_id gnl|my_center|LOCUS_03000 47812 46781 gene locus_tag LOCUS_03010 gene trpD 47812 46781 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817833.1 protein_id gnl|my_center|LOCUS_03010 48381 47809 gene locus_tag LOCUS_03020 48381 47809 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815390.1 protein_id gnl|my_center|LOCUS_03020 49932 48406 gene locus_tag LOCUS_03030 gene trpE 49932 48406 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064890.1 protein_id gnl|my_center|LOCUS_03030 50834 50163 gene locus_tag LOCUS_03040 50834 50163 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_03040 51554 50844 gene locus_tag LOCUS_03050 gene rpe 51554 50844 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815384.1 protein_id gnl|my_center|LOCUS_03050 51646 52020 gene locus_tag LOCUS_03060 gene apaG 51646 52020 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 protein_id gnl|my_center|LOCUS_03060 52043 53317 gene locus_tag LOCUS_03070 52043 53317 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_03070 53314 54489 gene locus_tag LOCUS_03080 53314 54489 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815378.1 protein_id gnl|my_center|LOCUS_03080 54543 55304 gene locus_tag LOCUS_03090 54543 55304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 56084 55359 gene locus_tag LOCUS_03100 56084 55359 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815194.1 protein_id gnl|my_center|LOCUS_03100 57004 56087 gene locus_tag LOCUS_03110 gene argB 57004 56087 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815193.1 protein_id gnl|my_center|LOCUS_03110 57519 57028 gene locus_tag LOCUS_03120 57519 57028 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815191.1 protein_id gnl|my_center|LOCUS_03120 58223 57519 gene locus_tag LOCUS_03130 58223 57519 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815190.1 protein_id gnl|my_center|LOCUS_03130 58813 58220 gene locus_tag LOCUS_03140 58813 58220 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446211.1 protein_id gnl|my_center|LOCUS_03140 59407 58934 gene locus_tag LOCUS_03150 59407 58934 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040603.1 protein_id gnl|my_center|LOCUS_03150 59506 60426 gene locus_tag LOCUS_03160 gene rsmI 59506 60426 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929780.1 protein_id gnl|my_center|LOCUS_03160 61148 60423 gene locus_tag LOCUS_03170 61148 60423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 62020 61145 gene locus_tag LOCUS_03180 gene rapZ 62020 61145 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815183.1 protein_id gnl|my_center|LOCUS_03180 63067 62132 gene locus_tag LOCUS_03190 gene hprK 63067 62132 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815180.1 protein_id gnl|my_center|LOCUS_03190 63522 63070 gene locus_tag LOCUS_03200 63522 63070 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929966.1 protein_id gnl|my_center|LOCUS_03200 63957 63637 gene locus_tag LOCUS_03210 gene raiA 63957 63637 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815178.1 protein_id gnl|my_center|LOCUS_03210 64909 64118 gene locus_tag LOCUS_03220 gene lptB 64909 64118 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040602.1 protein_id gnl|my_center|LOCUS_03220 65529 64924 gene locus_tag LOCUS_03230 gene lptA 65529 64924 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815175.1 protein_id gnl|my_center|LOCUS_03230 66155 65526 gene locus_tag LOCUS_03240 gene lptC 66155 65526 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815173.1 protein_id gnl|my_center|LOCUS_03240 66757 66158 gene locus_tag LOCUS_03250 66757 66158 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815172.1 protein_id gnl|my_center|LOCUS_03250 67753 66764 gene locus_tag LOCUS_03260 67753 66764 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815171.1 protein_id gnl|my_center|LOCUS_03260 67898 69121 gene locus_tag LOCUS_03270 gene purT 67898 69121 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064909.1 protein_id gnl|my_center|LOCUS_03270 69189 69722 gene locus_tag LOCUS_03280 69189 69722 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446416.1 protein_id gnl|my_center|LOCUS_03280 71311 69782 gene locus_tag LOCUS_03290 gene ilvA 71311 69782 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_03290 71404 71955 gene locus_tag LOCUS_03300 71404 71955 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815154.1 protein_id gnl|my_center|LOCUS_03300 72051 75989 gene locus_tag LOCUS_03310 72051 75989 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815152.1 protein_id gnl|my_center|LOCUS_03310 76824 76027 gene locus_tag LOCUS_03320 76824 76027 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815133.1 protein_id gnl|my_center|LOCUS_03320 77856 76852 gene locus_tag LOCUS_03330 77856 76852 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815130.1 protein_id gnl|my_center|LOCUS_03330 78577 77837 gene locus_tag LOCUS_03340 gene pxpB 78577 77837 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815128.1 protein_id gnl|my_center|LOCUS_03340 79826 78531 gene locus_tag LOCUS_03350 gene phoR 79826 78531 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815115.1 protein_id gnl|my_center|LOCUS_03350 80668 79973 gene locus_tag LOCUS_03360 gene phoB 80668 79973 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_03360 80787 81554 gene locus_tag LOCUS_03370 gene ubiE 80787 81554 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815111.1 protein_id gnl|my_center|LOCUS_03370 81726 82730 gene locus_tag LOCUS_03380 81726 82730 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929656.1 protein_id gnl|my_center|LOCUS_03380 82948 83577 gene locus_tag LOCUS_03390 82948 83577 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853232.1 protein_id gnl|my_center|LOCUS_03390 83574 85148 gene locus_tag LOCUS_03400 gene ubiB 83574 85148 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040584.1 protein_id gnl|my_center|LOCUS_03400 85164 85661 gene locus_tag LOCUS_03410 gene rfaE2 85164 85661 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815102.1 protein_id gnl|my_center|LOCUS_03410 86348 85671 gene locus_tag LOCUS_03420 86348 85671 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815097.1 protein_id gnl|my_center|LOCUS_03420 87231 86422 gene locus_tag LOCUS_03430 gene thiD 87231 86422 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815096.1 protein_id gnl|my_center|LOCUS_03430 87754 87308 gene locus_tag LOCUS_03440 87754 87308 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085119.1 protein_id gnl|my_center|LOCUS_03440 87954 88490 gene locus_tag LOCUS_03450 87954 88490 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_03450 89025 88534 gene locus_tag LOCUS_03460 89025 88534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 89301 90656 gene locus_tag LOCUS_03470 gene gorA 89301 90656 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100366.1 protein_id gnl|my_center|LOCUS_03470 90956 91237 gene locus_tag LOCUS_03480 90956 91237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03480 91247 91804 gene locus_tag LOCUS_03490 91247 91804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03490 91825 92823 gene locus_tag LOCUS_03500 gene phnD 91825 92823 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113119.1 protein_id gnl|my_center|LOCUS_03500 92883 93878 gene locus_tag LOCUS_03510 gene phnD 92883 93878 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113119.1 protein_id gnl|my_center|LOCUS_03510 93919 94737 gene locus_tag LOCUS_03520 gene phnE 93919 94737 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 protein_id gnl|my_center|LOCUS_03520 94782 95519 gene locus_tag LOCUS_03530 gene phnF 94782 95519 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113121.1 protein_id gnl|my_center|LOCUS_03530 95500 95943 gene locus_tag LOCUS_03540 gene phnG 95500 95943 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267542.1 protein_id gnl|my_center|LOCUS_03540 95948 96541 gene locus_tag LOCUS_03550 gene phnH 95948 96541 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113122.1 protein_id gnl|my_center|LOCUS_03550 96544 97644 gene locus_tag LOCUS_03560 96544 97644 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091786.1 protein_id gnl|my_center|LOCUS_03560 97641 98519 gene locus_tag LOCUS_03570 97641 98519 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104084.1 protein_id gnl|my_center|LOCUS_03570 98519 99334 gene locus_tag LOCUS_03580 gene phnK 98519 99334 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104085.1 protein_id gnl|my_center|LOCUS_03580 99345 100049 gene locus_tag LOCUS_03590 gene phnL 99345 100049 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098702.1 protein_id gnl|my_center|LOCUS_03590 100039 101184 gene locus_tag LOCUS_03600 100039 101184 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113124.1 protein_id gnl|my_center|LOCUS_03600 101184 101789 gene locus_tag LOCUS_03610 gene phnN 101184 101789 CDS product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109293.1 protein_id gnl|my_center|LOCUS_03610 101851 102609 gene locus_tag LOCUS_03620 gene phnP 101851 102609 CDS product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113125.1 protein_id gnl|my_center|LOCUS_03620 102708 103982 gene locus_tag LOCUS_03630 102708 103982 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210192.1 protein_id gnl|my_center|LOCUS_03630 104179 105204 gene locus_tag LOCUS_03640 104179 105204 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809579.1 protein_id gnl|my_center|LOCUS_03640 105220 106029 gene locus_tag LOCUS_03650 105220 106029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568207.1 protein_id gnl|my_center|LOCUS_03650 106007 106825 gene locus_tag LOCUS_03660 106007 106825 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809582.1 protein_id gnl|my_center|LOCUS_03660 107052 108137 gene locus_tag LOCUS_03670 gene dmlA 107052 108137 CDS product multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978495.1 protein_id gnl|my_center|LOCUS_03670 108161 109156 gene locus_tag LOCUS_03680 108161 109156 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223629.1 protein_id gnl|my_center|LOCUS_03680 109131 109304 gene locus_tag LOCUS_03690 109131 109304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 109579 109358 gene locus_tag LOCUS_03700 109579 109358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 109705 110082 gene locus_tag LOCUS_03710 109705 110082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 111437 110190 gene locus_tag LOCUS_03720 111437 110190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 112177 111485 gene locus_tag LOCUS_03730 112177 111485 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173710.1 protein_id gnl|my_center|LOCUS_03730 112420 112226 gene locus_tag LOCUS_03740 112420 112226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 114061 112427 gene locus_tag LOCUS_03750 114061 112427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 114329 115477 gene locus_tag LOCUS_03760 114329 115477 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_03760 115984 115481 gene locus_tag LOCUS_03770 115984 115481 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815617.1 protein_id gnl|my_center|LOCUS_03770 116012 116779 gene locus_tag LOCUS_03780 116012 116779 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_03780 116833 117615 gene locus_tag LOCUS_03790 gene menB 116833 117615 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_03790 118038 117730 gene locus_tag LOCUS_03800 118038 117730 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088238.1 protein_id gnl|my_center|LOCUS_03800 118514 118035 gene locus_tag LOCUS_03810 118514 118035 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 protein_id gnl|my_center|LOCUS_03810 122539 118580 gene locus_tag LOCUS_03820 gene cobN 122539 118580 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114926.1 protein_id gnl|my_center|LOCUS_03820 124530 122539 gene locus_tag LOCUS_03830 124530 122539 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 protein_id gnl|my_center|LOCUS_03830 124785 125168 gene locus_tag LOCUS_03840 124785 125168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809253.1 protein_id gnl|my_center|LOCUS_03840 125290 126198 gene locus_tag LOCUS_03850 125290 126198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 127268 126312 gene locus_tag LOCUS_03860 127268 126312 CDS product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972348.1 protein_id gnl|my_center|LOCUS_03860 127732 128637 gene locus_tag LOCUS_03870 gene ppk2 127732 128637 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965809.1 protein_id gnl|my_center|LOCUS_03870 129082 128765 gene locus_tag LOCUS_03880 129082 128765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 129406 129331 gene locus_tag LOCUS_t00040 129406 129331 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 129727 131001 gene locus_tag LOCUS_03890 gene hemA 129727 131001 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064647.1 protein_id gnl|my_center|LOCUS_03890 131074 132153 gene locus_tag LOCUS_03900 gene prfA 131074 132153 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807618.1 protein_id gnl|my_center|LOCUS_03900 132173 132994 gene locus_tag LOCUS_03910 gene prmC 132173 132994 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927443.1 protein_id gnl|my_center|LOCUS_03910 133080 133409 gene locus_tag LOCUS_03920 gene grxD 133080 133409 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807622.1 protein_id gnl|my_center|LOCUS_03920 133402 133968 gene locus_tag LOCUS_03930 133402 133968 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807624.1 protein_id gnl|my_center|LOCUS_03930 134712 134167 gene locus_tag LOCUS_03940 134712 134167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 >Feature sequence04 755 477 gene locus_tag LOCUS_03950 755 477 CDS product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 protein_id gnl|my_center|LOCUS_03950 1060 2118 gene locus_tag LOCUS_03960 gene pyrC 1060 2118 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814588.1 protein_id gnl|my_center|LOCUS_03960 2267 2947 gene locus_tag LOCUS_03970 2267 2947 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096704.1 protein_id gnl|my_center|LOCUS_03970 4800 2971 gene locus_tag LOCUS_03980 4800 2971 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814586.1 protein_id gnl|my_center|LOCUS_03980 5576 6028 gene locus_tag LOCUS_03990 gene mraZ 5576 6028 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814584.1 protein_id gnl|my_center|LOCUS_03990 6028 7098 gene locus_tag LOCUS_04000 gene rsmH 6028 7098 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814582.1 protein_id gnl|my_center|LOCUS_04000 7086 7400 gene locus_tag LOCUS_04010 7086 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 7413 9218 gene locus_tag LOCUS_04020 7413 9218 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446492.1 protein_id gnl|my_center|LOCUS_04020 9215 12004 gene locus_tag LOCUS_04030 gene murF 9215 12004 CDS product bifunctional UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase MurE/UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase MurF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064959.1 protein_id gnl|my_center|LOCUS_04030 11994 13163 gene locus_tag LOCUS_04040 gene mraY 11994 13163 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247664.1 protein_id gnl|my_center|LOCUS_04040 13160 14689 gene locus_tag LOCUS_04050 gene murD 13160 14689 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039093.1 protein_id gnl|my_center|LOCUS_04050 14686 15906 gene locus_tag LOCUS_04060 gene ftsW 14686 15906 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814574.1 protein_id gnl|my_center|LOCUS_04060 15954 16976 gene locus_tag LOCUS_04070 gene murG 15954 16976 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039095.1 protein_id gnl|my_center|LOCUS_04070 16973 18382 gene locus_tag LOCUS_04080 gene murC 16973 18382 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814572.1 protein_id gnl|my_center|LOCUS_04080 18379 19332 gene locus_tag LOCUS_04090 18379 19332 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_04090 19452 20156 gene locus_tag LOCUS_04100 19452 20156 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814570.1 protein_id gnl|my_center|LOCUS_04100 20153 21382 gene locus_tag LOCUS_04110 gene ftsA 20153 21382 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039098.1 protein_id gnl|my_center|LOCUS_04110 21587 22780 gene locus_tag LOCUS_04120 gene ftsZ 21587 22780 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814568.1 protein_id gnl|my_center|LOCUS_04120 22979 23902 gene locus_tag LOCUS_04130 gene lpxC 22979 23902 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814567.1 protein_id gnl|my_center|LOCUS_04130 24402 23899 gene locus_tag LOCUS_04140 24402 23899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 24517 25512 gene locus_tag LOCUS_04150 24517 25512 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814565.1 protein_id gnl|my_center|LOCUS_04150 25607 28354 gene locus_tag LOCUS_04160 gene secA 25607 28354 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064961.1 protein_id gnl|my_center|LOCUS_04160 29972 28485 gene locus_tag LOCUS_04170 gene mgtE 29972 28485 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814555.1 protein_id gnl|my_center|LOCUS_04170 30844 29969 gene locus_tag LOCUS_04180 30844 29969 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814549.1 protein_id gnl|my_center|LOCUS_04180 31102 32841 gene locus_tag LOCUS_04190 gene mnmC 31102 32841 CDS product FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039107.1 protein_id gnl|my_center|LOCUS_04190 33018 35210 gene locus_tag LOCUS_04200 33018 35210 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814547.1 protein_id gnl|my_center|LOCUS_04200 35212 36087 gene locus_tag LOCUS_04210 35212 36087 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813227.1 protein_id gnl|my_center|LOCUS_04210 36215 37282 gene locus_tag LOCUS_04220 36215 37282 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814544.1 protein_id gnl|my_center|LOCUS_04220 37263 37916 gene locus_tag LOCUS_04230 37263 37916 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247918.1 protein_id gnl|my_center|LOCUS_04230 37934 38728 gene locus_tag LOCUS_04240 37934 38728 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814540.1 protein_id gnl|my_center|LOCUS_04240 38782 38857 gene locus_tag LOCUS_t00050 38782 38857 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 38933 39008 gene locus_tag LOCUS_t00060 38933 39008 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 39135 39210 gene locus_tag LOCUS_t00070 39135 39210 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 41037 39328 gene locus_tag LOCUS_04250 41037 39328 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_04250 41486 41067 gene locus_tag LOCUS_04260 41486 41067 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184408.1 protein_id gnl|my_center|LOCUS_04260 41955 41524 gene locus_tag LOCUS_04270 41955 41524 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_04270 42113 42595 gene locus_tag LOCUS_04280 gene rraA 42113 42595 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948542.1 protein_id gnl|my_center|LOCUS_04280 42692 43297 gene locus_tag LOCUS_04290 gene gstA 42692 43297 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210962.1 protein_id gnl|my_center|LOCUS_04290 44155 43397 gene locus_tag LOCUS_04300 44155 43397 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530255.1 protein_id gnl|my_center|LOCUS_04300 45939 44176 gene locus_tag LOCUS_04310 45939 44176 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009950383.1 protein_id gnl|my_center|LOCUS_04310 46197 48494 gene locus_tag LOCUS_04320 46197 48494 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929755.1 protein_id gnl|my_center|LOCUS_04320 47947 48032 gene locus_tag LOCUS_t00080 47947 48032 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 48533 49570 gene locus_tag LOCUS_04330 48533 49570 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040664.1 protein_id gnl|my_center|LOCUS_04330 49560 50408 gene locus_tag LOCUS_04340 49560 50408 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040665.1 protein_id gnl|my_center|LOCUS_04340 50395 51408 gene locus_tag LOCUS_04350 50395 51408 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815443.1 protein_id gnl|my_center|LOCUS_04350 51411 52223 gene locus_tag LOCUS_04360 51411 52223 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929751.1 protein_id gnl|my_center|LOCUS_04360 52306 53001 gene locus_tag LOCUS_04370 52306 53001 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064302.1 protein_id gnl|my_center|LOCUS_04370 52988 53317 gene locus_tag LOCUS_04380 52988 53317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 54206 53400 gene locus_tag LOCUS_04390 54206 53400 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957509.1 protein_id gnl|my_center|LOCUS_04390 54445 54218 gene locus_tag LOCUS_04400 54445 54218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 55512 54442 gene locus_tag LOCUS_04410 gene thiO 55512 54442 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957508.1 protein_id gnl|my_center|LOCUS_04410 56068 55631 gene locus_tag LOCUS_04420 56068 55631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 56195 57997 gene locus_tag LOCUS_04430 gene recQ 56195 57997 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927009.1 protein_id gnl|my_center|LOCUS_04430 59052 57994 gene locus_tag LOCUS_04440 gene ruvB 59052 57994 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931466.1 protein_id gnl|my_center|LOCUS_04440 60492 59182 gene locus_tag LOCUS_04450 60492 59182 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039498.1 protein_id gnl|my_center|LOCUS_04450 60996 60499 gene locus_tag LOCUS_04460 60996 60499 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813272.1 protein_id gnl|my_center|LOCUS_04460 62037 61054 gene locus_tag LOCUS_04470 62037 61054 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 protein_id gnl|my_center|LOCUS_04470 62648 62076 gene locus_tag LOCUS_04480 gene ruvA 62648 62076 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814226.1 protein_id gnl|my_center|LOCUS_04480 63214 62669 gene locus_tag LOCUS_04490 gene ruvC 63214 62669 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814225.1 protein_id gnl|my_center|LOCUS_04490 64810 63221 gene locus_tag LOCUS_04500 gene purH 64810 63221 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814223.1 protein_id gnl|my_center|LOCUS_04500 65052 64816 gene locus_tag LOCUS_04510 65052 64816 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814221.1 protein_id gnl|my_center|LOCUS_04510 66121 65108 gene locus_tag LOCUS_04520 gene dusB 66121 65108 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995141.1 protein_id gnl|my_center|LOCUS_04520 67336 66182 gene locus_tag LOCUS_04530 67336 66182 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039175.1 protein_id gnl|my_center|LOCUS_04530 67492 68433 gene locus_tag LOCUS_04540 67492 68433 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814205.1 protein_id gnl|my_center|LOCUS_04540 69526 68510 gene locus_tag LOCUS_04550 69526 68510 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931458.1 protein_id gnl|my_center|LOCUS_04550 70054 69593 gene locus_tag LOCUS_04560 70054 69593 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 protein_id gnl|my_center|LOCUS_04560 70241 70044 gene locus_tag LOCUS_04570 70241 70044 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814195.1 protein_id gnl|my_center|LOCUS_04570 70427 71197 gene locus_tag LOCUS_04580 70427 71197 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931455.1 protein_id gnl|my_center|LOCUS_04580 71194 71514 gene locus_tag LOCUS_04590 71194 71514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 71641 73095 gene locus_tag LOCUS_04600 71641 73095 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929121.1 protein_id gnl|my_center|LOCUS_04600 73453 73070 gene locus_tag LOCUS_04610 73453 73070 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039185.1 protein_id gnl|my_center|LOCUS_04610 73647 74447 gene locus_tag LOCUS_04620 73647 74447 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814179.1 protein_id gnl|my_center|LOCUS_04620 74626 74474 gene locus_tag LOCUS_04630 74626 74474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 74574 75386 gene locus_tag LOCUS_04640 74574 75386 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814178.1 protein_id gnl|my_center|LOCUS_04640 75666 76274 gene locus_tag LOCUS_04650 gene phaP 75666 76274 CDS product TIGR01841 family phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814172.1 protein_id gnl|my_center|LOCUS_04650 77443 76379 gene locus_tag LOCUS_04660 77443 76379 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814170.1 protein_id gnl|my_center|LOCUS_04660 78231 77497 gene locus_tag LOCUS_04670 78231 77497 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820991.1 protein_id gnl|my_center|LOCUS_04670 78998 78264 gene locus_tag LOCUS_04680 gene aat 78998 78264 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814164.1 protein_id gnl|my_center|LOCUS_04680 79574 79002 gene locus_tag LOCUS_04690 79574 79002 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814161.1 protein_id gnl|my_center|LOCUS_04690 80269 79649 gene locus_tag LOCUS_04700 80269 79649 CDS product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927005.1 protein_id gnl|my_center|LOCUS_04700 81755 80823 gene locus_tag LOCUS_04710 81755 80823 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705198.1 protein_id gnl|my_center|LOCUS_04710 81973 83208 gene locus_tag LOCUS_04720 81973 83208 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931022.1 protein_id gnl|my_center|LOCUS_04720 84622 83216 gene locus_tag LOCUS_04730 gene cls 84622 83216 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122347.1 protein_id gnl|my_center|LOCUS_04730 84824 84749 gene locus_tag LOCUS_t00090 84824 84749 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 84916 84843 gene locus_tag LOCUS_t00100 84916 84843 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 85342 85824 gene locus_tag LOCUS_04740 85342 85824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 86058 85983 gene locus_tag LOCUS_t00110 86058 85983 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 86244 87263 gene locus_tag LOCUS_04750 gene murB 86244 87263 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930965.1 protein_id gnl|my_center|LOCUS_04750 88173 87382 gene locus_tag LOCUS_04760 gene dapB 88173 87382 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065058.1 protein_id gnl|my_center|LOCUS_04760 88677 88222 gene locus_tag LOCUS_04770 88677 88222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 88841 89302 gene locus_tag LOCUS_04780 gene fur 88841 89302 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814098.1 protein_id gnl|my_center|LOCUS_04780 90978 89332 gene locus_tag LOCUS_04790 gene recN 90978 89332 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065059.1 protein_id gnl|my_center|LOCUS_04790 91835 90999 gene locus_tag LOCUS_04800 91835 90999 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039215.1 protein_id gnl|my_center|LOCUS_04800 92023 93036 gene locus_tag LOCUS_04810 gene hrcA 92023 93036 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814090.1 protein_id gnl|my_center|LOCUS_04810 93051 94121 gene locus_tag LOCUS_04820 gene hemH 93051 94121 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814087.1 protein_id gnl|my_center|LOCUS_04820 94310 94891 gene locus_tag LOCUS_04830 gene grpE 94310 94891 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814083.1 protein_id gnl|my_center|LOCUS_04830 95058 96971 gene locus_tag LOCUS_04840 gene dnaK 95058 96971 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814079.1 protein_id gnl|my_center|LOCUS_04840 97082 98203 gene locus_tag LOCUS_04850 gene dnaJ 97082 98203 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821186.1 protein_id gnl|my_center|LOCUS_04850 101024 98331 gene locus_tag LOCUS_04860 101024 98331 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814074.1 protein_id gnl|my_center|LOCUS_04860 102306 101134 gene locus_tag LOCUS_04870 102306 101134 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814068.1 protein_id gnl|my_center|LOCUS_04870 103194 102319 gene locus_tag LOCUS_04880 103194 102319 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814066.1 protein_id gnl|my_center|LOCUS_04880 103343 103693 gene locus_tag LOCUS_04890 103343 103693 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814065.1 protein_id gnl|my_center|LOCUS_04890 103708 104070 gene locus_tag LOCUS_04900 103708 104070 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129526501.1 protein_id gnl|my_center|LOCUS_04900 104516 104088 gene locus_tag LOCUS_04910 104516 104088 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814061.1 protein_id gnl|my_center|LOCUS_04910 104730 105986 gene locus_tag LOCUS_04920 gene icd 104730 105986 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814059.1 protein_id gnl|my_center|LOCUS_04920 106179 106640 gene locus_tag LOCUS_04930 106179 106640 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462646.1 protein_id gnl|my_center|LOCUS_04930 106766 107068 gene locus_tag LOCUS_04940 106766 107068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 107778 107972 gene locus_tag LOCUS_04950 107778 107972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 109049 107985 gene locus_tag LOCUS_04960 109049 107985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04960 109537 109046 gene locus_tag LOCUS_04970 109537 109046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04970 109630 110268 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgtatgcacggggataaaccg >Feature sequence05 655 807 gene locus_tag LOCUS_04980 655 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 873 1058 gene locus_tag LOCUS_04990 873 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1126 1545 gene locus_tag LOCUS_05000 1126 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211610.1 protein_id gnl|my_center|LOCUS_05000 2884 1964 gene locus_tag LOCUS_05010 2884 1964 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205285.1 protein_id gnl|my_center|LOCUS_05010 3071 2874 gene locus_tag LOCUS_05020 3071 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3238 3531 gene locus_tag LOCUS_05030 3238 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4121 4339 gene locus_tag LOCUS_05040 4121 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406454.1 protein_id gnl|my_center|LOCUS_05040 4404 5144 gene locus_tag LOCUS_05050 4404 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 5146 5793 gene locus_tag LOCUS_05060 5146 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 5780 6208 gene locus_tag LOCUS_05070 5780 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 6205 6951 gene locus_tag LOCUS_05080 6205 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 6969 7283 gene locus_tag LOCUS_05090 6969 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 7324 7674 gene locus_tag LOCUS_05100 7324 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 7912 7709 gene locus_tag LOCUS_05110 7912 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 8008 10422 gene locus_tag LOCUS_05120 8008 10422 CDS product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037611.1 protein_id gnl|my_center|LOCUS_05120 10471 11103 gene locus_tag LOCUS_05130 gene virB5 10471 11103 CDS product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042067.1 protein_id gnl|my_center|LOCUS_05130 11167 11451 gene locus_tag LOCUS_05140 11167 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 11463 12395 gene locus_tag LOCUS_05150 11463 12395 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042069.1 protein_id gnl|my_center|LOCUS_05150 12399 12809 gene locus_tag LOCUS_05160 12399 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 12879 13034 gene locus_tag LOCUS_05170 12879 13034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 13015 13713 gene locus_tag LOCUS_05180 13015 13713 CDS product virB8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974428.1 protein_id gnl|my_center|LOCUS_05180 13723 14568 gene locus_tag LOCUS_05190 gene virB9 13723 14568 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597362.1 protein_id gnl|my_center|LOCUS_05190 14565 15755 gene locus_tag LOCUS_05200 14565 15755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 15766 15999 gene locus_tag LOCUS_05210 15766 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 16044 17123 gene locus_tag LOCUS_05220 gene virB11 16044 17123 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170068631.1 protein_id gnl|my_center|LOCUS_05220 17126 17284 gene locus_tag LOCUS_05230 17126 17284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 17281 17709 gene locus_tag LOCUS_05240 gene ssb 17281 17709 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_05240 17742 19610 gene locus_tag LOCUS_05250 17742 19610 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037620.1 protein_id gnl|my_center|LOCUS_05250 19638 22313 gene locus_tag LOCUS_05260 19638 22313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 22310 22498 gene locus_tag LOCUS_05270 22310 22498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 22612 23730 gene locus_tag LOCUS_05280 22612 23730 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533282.1 protein_id gnl|my_center|LOCUS_05280 23944 24990 gene locus_tag LOCUS_05290 23944 24990 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350488.1 protein_id gnl|my_center|LOCUS_05290 25122 25046 gene locus_tag LOCUS_t00120 25122 25046 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 25295 26473 gene locus_tag LOCUS_05300 gene argE 25295 26473 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534727.1 protein_id gnl|my_center|LOCUS_05300 27868 26630 gene locus_tag LOCUS_05310 27868 26630 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207669.1 protein_id gnl|my_center|LOCUS_05310 28298 28080 gene locus_tag LOCUS_05320 28298 28080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 28261 30477 gene locus_tag LOCUS_05330 28261 30477 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 protein_id gnl|my_center|LOCUS_05330 30546 31457 gene locus_tag LOCUS_05340 gene rfbD 30546 31457 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771401.1 protein_id gnl|my_center|LOCUS_05340 32188 31454 gene locus_tag LOCUS_05350 32188 31454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 32340 32909 gene locus_tag LOCUS_05360 32340 32909 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926460.1 protein_id gnl|my_center|LOCUS_05360 33912 33322 gene locus_tag LOCUS_05370 33912 33322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 34588 33905 gene locus_tag LOCUS_05380 34588 33905 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039473.1 protein_id gnl|my_center|LOCUS_05380 35307 34576 gene locus_tag LOCUS_05390 gene ubiG 35307 34576 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 protein_id gnl|my_center|LOCUS_05390 36025 35459 gene locus_tag LOCUS_05400 36025 35459 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813377.1 protein_id gnl|my_center|LOCUS_05400 36577 39204 gene locus_tag LOCUS_05410 gene gyrA 36577 39204 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926826.1 protein_id gnl|my_center|LOCUS_05410 39217 40350 gene locus_tag LOCUS_05420 gene serC 39217 40350 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813372.1 protein_id gnl|my_center|LOCUS_05420 40343 41431 gene locus_tag LOCUS_05430 gene pheA 40343 41431 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813370.1 protein_id gnl|my_center|LOCUS_05430 41441 42343 gene locus_tag LOCUS_05440 41441 42343 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813366.1 protein_id gnl|my_center|LOCUS_05440 42343 43659 gene locus_tag LOCUS_05450 gene aroA 42343 43659 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930099.1 protein_id gnl|my_center|LOCUS_05450 43666 44337 gene locus_tag LOCUS_05460 gene cmk 43666 44337 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813361.1 protein_id gnl|my_center|LOCUS_05460 44520 46232 gene locus_tag LOCUS_05470 gene rpsA 44520 46232 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930101.1 protein_id gnl|my_center|LOCUS_05470 46236 46598 gene locus_tag LOCUS_05480 46236 46598 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928906.1 protein_id gnl|my_center|LOCUS_05480 46745 47086 gene locus_tag LOCUS_05490 46745 47086 CDS product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930103.1 protein_id gnl|my_center|LOCUS_05490 47099 48328 gene locus_tag LOCUS_05500 gene lapB 47099 48328 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930104.1 protein_id gnl|my_center|LOCUS_05500 48328 49257 gene locus_tag LOCUS_05510 gene rfaE1 48328 49257 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813350.1 protein_id gnl|my_center|LOCUS_05510 49254 50246 gene locus_tag LOCUS_05520 gene rfaD 49254 50246 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821513.1 protein_id gnl|my_center|LOCUS_05520 50846 51775 gene locus_tag LOCUS_05530 gene cysM 50846 51775 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813345.1 protein_id gnl|my_center|LOCUS_05530 51949 52941 gene locus_tag LOCUS_05540 51949 52941 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818557.1 protein_id gnl|my_center|LOCUS_05540 52947 53099 gene locus_tag LOCUS_05550 gene ccoS 52947 53099 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810379.1 protein_id gnl|my_center|LOCUS_05550 53310 54791 gene locus_tag LOCUS_05560 gene ccoN 53310 54791 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063997.1 protein_id gnl|my_center|LOCUS_05560 54806 55489 gene locus_tag LOCUS_05570 gene ccoO 54806 55489 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810383.1 protein_id gnl|my_center|LOCUS_05570 55668 56582 gene locus_tag LOCUS_05580 gene ccoP 55668 56582 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930775.1 protein_id gnl|my_center|LOCUS_05580 56609 58126 gene locus_tag LOCUS_05590 gene ccoG 56609 58126 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_05590 58147 58398 gene locus_tag LOCUS_05600 58147 58398 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810390.1 protein_id gnl|my_center|LOCUS_05600 58412 58660 gene locus_tag LOCUS_05610 58412 58660 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930778.1 protein_id gnl|my_center|LOCUS_05610 59455 58715 gene locus_tag LOCUS_05620 gene btr 59455 58715 CDS product oxygen-responsive transcriptional regulator Btr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930241.1 protein_id gnl|my_center|LOCUS_05620 60859 59651 gene locus_tag LOCUS_05630 60859 59651 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209743.1 protein_id gnl|my_center|LOCUS_05630 61901 60999 gene locus_tag LOCUS_05640 61901 60999 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 protein_id gnl|my_center|LOCUS_05640 62607 61987 gene locus_tag LOCUS_05650 62607 61987 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813998.1 protein_id gnl|my_center|LOCUS_05650 62788 65367 gene locus_tag LOCUS_05660 gene clpB 62788 65367 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040132.1 protein_id gnl|my_center|LOCUS_05660 65673 65882 gene locus_tag LOCUS_05670 65673 65882 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930551.1 protein_id gnl|my_center|LOCUS_05670 66694 67536 gene locus_tag LOCUS_05680 66694 67536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 67548 68534 gene locus_tag LOCUS_05690 67548 68534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 68551 69054 gene locus_tag LOCUS_05700 68551 69054 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812950.1 protein_id gnl|my_center|LOCUS_05700 69688 69122 gene locus_tag LOCUS_05710 69688 69122 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 protein_id gnl|my_center|LOCUS_05710 72693 69871 gene locus_tag LOCUS_05720 gene glnE 72693 69871 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810574.1 protein_id gnl|my_center|LOCUS_05720 72861 76493 gene locus_tag LOCUS_05730 72861 76493 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926768.1 protein_id gnl|my_center|LOCUS_05730 76517 76759 gene locus_tag LOCUS_05740 76517 76759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 77213 76782 gene locus_tag LOCUS_05750 77213 76782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 77549 78859 gene locus_tag LOCUS_05760 gene tig 77549 78859 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905723.1 protein_id gnl|my_center|LOCUS_05760 78859 79518 gene locus_tag LOCUS_05770 gene clpP 78859 79518 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 protein_id gnl|my_center|LOCUS_05770 79602 80918 gene locus_tag LOCUS_05780 gene clpX 79602 80918 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926436.1 protein_id gnl|my_center|LOCUS_05780 81023 83482 gene locus_tag LOCUS_05790 gene lon 81023 83482 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812504.1 protein_id gnl|my_center|LOCUS_05790 84346 83576 gene locus_tag LOCUS_05800 84346 83576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 84847 84401 gene locus_tag LOCUS_05810 84847 84401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 85382 87316 gene locus_tag LOCUS_05820 gene thrS 85382 87316 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812608.1 protein_id gnl|my_center|LOCUS_05820 87426 87893 gene locus_tag LOCUS_05830 gene infC 87426 87893 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446215.1 protein_id gnl|my_center|LOCUS_05830 87957 88919 gene locus_tag LOCUS_05840 gene gshB 87957 88919 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812603.1 protein_id gnl|my_center|LOCUS_05840 88929 89342 gene locus_tag LOCUS_05850 88929 89342 CDS product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812601.1 protein_id gnl|my_center|LOCUS_05850 89372 89641 gene locus_tag LOCUS_05860 89372 89641 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812598.1 protein_id gnl|my_center|LOCUS_05860 89651 91417 gene locus_tag LOCUS_05870 gene ptsP 89651 91417 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816751.1 protein_id gnl|my_center|LOCUS_05870 92671 91505 gene locus_tag LOCUS_05880 92671 91505 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230674.1 protein_id gnl|my_center|LOCUS_05880 94140 92914 gene locus_tag LOCUS_05890 gene amt 94140 92914 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812841.1 protein_id gnl|my_center|LOCUS_05890 94551 94213 gene locus_tag LOCUS_05900 gene glnK 94551 94213 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_05900 94823 95599 gene locus_tag LOCUS_05910 94823 95599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 95757 95996 gene locus_tag LOCUS_05920 95757 95996 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931105.1 protein_id gnl|my_center|LOCUS_05920 96087 97604 gene locus_tag LOCUS_05930 96087 97604 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926358.1 protein_id gnl|my_center|LOCUS_05930 97957 98166 gene locus_tag LOCUS_05940 gene rpmI 97957 98166 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812834.1 protein_id gnl|my_center|LOCUS_05940 98179 98538 gene locus_tag LOCUS_05950 gene rplT 98179 98538 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812832.1 protein_id gnl|my_center|LOCUS_05950 98626 99648 gene locus_tag LOCUS_05960 gene pheS 98626 99648 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926359.1 protein_id gnl|my_center|LOCUS_05960 99702 102107 gene locus_tag LOCUS_05970 gene pheT 99702 102107 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039594.1 protein_id gnl|my_center|LOCUS_05970 102120 102458 gene locus_tag LOCUS_05980 102120 102458 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931006.1 protein_id gnl|my_center|LOCUS_05980 102500 102895 gene locus_tag LOCUS_05990 102500 102895 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812822.1 protein_id gnl|my_center|LOCUS_05990 104178 103018 gene locus_tag LOCUS_06000 104178 103018 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040791.1 protein_id gnl|my_center|LOCUS_06000 104815 104366 gene locus_tag LOCUS_06010 104815 104366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 105189 105620 gene locus_tag LOCUS_06020 105189 105620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 105617 106138 gene locus_tag LOCUS_06030 105617 106138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 <106743 106226 gene locus_tag LOCUS_06040 <106743 106226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_204369239.1:RNA-guided endonuclease TnpB family protein >Feature sequence06 <1 518 gene locus_tag LOCUS_06050 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_204369239.1:RNA-guided endonuclease TnpB family protein 703 1335 gene locus_tag LOCUS_06060 703 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 1468 1313 gene locus_tag LOCUS_06070 1468 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2314 1532 gene locus_tag LOCUS_06080 2314 1532 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815979.1 protein_id gnl|my_center|LOCUS_06080 2486 3544 gene locus_tag LOCUS_06090 gene nmoA 2486 3544 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114723.1 protein_id gnl|my_center|LOCUS_06090 3815 6139 gene locus_tag LOCUS_06100 3815 6139 CDS product NosR/NirI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204371611.1 protein_id gnl|my_center|LOCUS_06100 6244 8160 gene locus_tag LOCUS_06110 gene nosZ 6244 8160 CDS product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083147.1 protein_id gnl|my_center|LOCUS_06110 8162 9457 gene locus_tag LOCUS_06120 8162 9457 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935040.1 protein_id gnl|my_center|LOCUS_06120 9454 10362 gene locus_tag LOCUS_06130 9454 10362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689241.1 protein_id gnl|my_center|LOCUS_06130 10359 11189 gene locus_tag LOCUS_06140 10359 11189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695633.1 protein_id gnl|my_center|LOCUS_06140 11186 11749 gene locus_tag LOCUS_06150 11186 11749 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221353.1 protein_id gnl|my_center|LOCUS_06150 11749 12762 gene locus_tag LOCUS_06160 11749 12762 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083152.1 protein_id gnl|my_center|LOCUS_06160 13134 12853 gene locus_tag LOCUS_06170 gene infA 13134 12853 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388420.1 protein_id gnl|my_center|LOCUS_06170 15423 13441 gene locus_tag LOCUS_06180 gene ftsH 15423 13441 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030322.1 protein_id gnl|my_center|LOCUS_06180 16536 15661 gene locus_tag LOCUS_06190 16536 15661 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 protein_id gnl|my_center|LOCUS_06190 18341 16776 gene locus_tag LOCUS_06200 18341 16776 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170491.1 protein_id gnl|my_center|LOCUS_06200 19404 21284 gene locus_tag LOCUS_06210 19404 21284 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 protein_id gnl|my_center|LOCUS_06210 21286 25176 gene locus_tag LOCUS_06220 gene cobN 21286 25176 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114926.1 protein_id gnl|my_center|LOCUS_06220 25194 25682 gene locus_tag LOCUS_06230 25194 25682 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 protein_id gnl|my_center|LOCUS_06230 25685 26005 gene locus_tag LOCUS_06240 25685 26005 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088238.1 protein_id gnl|my_center|LOCUS_06240 26828 26073 gene locus_tag LOCUS_06250 26828 26073 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 protein_id gnl|my_center|LOCUS_06250 27058 27876 gene locus_tag LOCUS_06260 27058 27876 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532447.1 protein_id gnl|my_center|LOCUS_06260 28263 27961 gene locus_tag LOCUS_06270 28263 27961 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210368.1 protein_id gnl|my_center|LOCUS_06270 28454 29896 gene locus_tag LOCUS_06280 28454 29896 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929684.1 protein_id gnl|my_center|LOCUS_06280 29936 30913 gene locus_tag LOCUS_06290 29936 30913 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_06290 30950 32626 gene locus_tag LOCUS_06300 30950 32626 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113513.1 protein_id gnl|my_center|LOCUS_06300 33597 32623 gene locus_tag LOCUS_06310 gene tcuR 33597 32623 CDS product tricarballylate utilization LysR family transcriptional regulator TcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704753.1 protein_id gnl|my_center|LOCUS_06310 34458 33607 gene locus_tag LOCUS_06320 34458 33607 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_06320 35960 34473 gene locus_tag LOCUS_06330 35960 34473 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206973.1 protein_id gnl|my_center|LOCUS_06330 36780 36043 gene locus_tag LOCUS_06340 36780 36043 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814743.1 protein_id gnl|my_center|LOCUS_06340 36963 37766 gene locus_tag LOCUS_06350 36963 37766 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073885237.1 protein_id gnl|my_center|LOCUS_06350 38010 38624 gene locus_tag LOCUS_06360 38010 38624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 39998 39033 gene locus_tag LOCUS_06370 39998 39033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 40080 40586 gene locus_tag LOCUS_06380 40080 40586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06380 40583 41638 gene locus_tag LOCUS_06390 40583 41638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06390 41846 42319 gene locus_tag LOCUS_06400 41846 42319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 44486 42654 gene locus_tag LOCUS_06410 gene glmS 44486 42654 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815700.1 protein_id gnl|my_center|LOCUS_06410 44655 45119 gene locus_tag LOCUS_06420 44655 45119 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064827.1 protein_id gnl|my_center|LOCUS_06420 46173 45106 gene locus_tag LOCUS_06430 46173 45106 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929453.1 protein_id gnl|my_center|LOCUS_06430 47080 46289 gene locus_tag LOCUS_06440 47080 46289 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042983.1 protein_id gnl|my_center|LOCUS_06440 48486 47089 gene locus_tag LOCUS_06450 48486 47089 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815720.1 protein_id gnl|my_center|LOCUS_06450 49961 48483 gene locus_tag LOCUS_06460 gene glmU 49961 48483 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040718.1 protein_id gnl|my_center|LOCUS_06460 50593 49958 gene locus_tag LOCUS_06470 50593 49958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064820.1 protein_id gnl|my_center|LOCUS_06470 51353 50613 gene locus_tag LOCUS_06480 51353 50613 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040726.1 protein_id gnl|my_center|LOCUS_06480 51725 52468 gene locus_tag LOCUS_06490 51725 52468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 52550 54145 gene locus_tag LOCUS_06500 gene ctaD 52550 54145 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064812.1 protein_id gnl|my_center|LOCUS_06500 54305 54529 gene locus_tag LOCUS_06510 54305 54529 CDS product DUF2970 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815740.1 protein_id gnl|my_center|LOCUS_06510 54566 55441 gene locus_tag LOCUS_06520 54566 55441 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815738.1 protein_id gnl|my_center|LOCUS_06520 55707 55504 gene locus_tag LOCUS_06530 55707 55504 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815736.1 protein_id gnl|my_center|LOCUS_06530 55793 56518 gene locus_tag LOCUS_06540 55793 56518 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995706.1 protein_id gnl|my_center|LOCUS_06540 56511 57146 gene locus_tag LOCUS_06550 56511 57146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815732.1 protein_id gnl|my_center|LOCUS_06550 57150 58166 gene locus_tag LOCUS_06560 57150 58166 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064815.1 protein_id gnl|my_center|LOCUS_06560 58163 59056 gene locus_tag LOCUS_06570 gene cyoE 58163 59056 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815729.1 protein_id gnl|my_center|LOCUS_06570 59070 59696 gene locus_tag LOCUS_06580 59070 59696 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815727.1 protein_id gnl|my_center|LOCUS_06580 60095 60919 gene locus_tag LOCUS_06590 gene bamE 60095 60919 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184872.1 protein_id gnl|my_center|LOCUS_06590 62078 61197 gene locus_tag LOCUS_06600 gene rpoH 62078 61197 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815756.1 protein_id gnl|my_center|LOCUS_06600 63061 62222 gene locus_tag LOCUS_06610 gene fghA 63061 62222 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064806.1 protein_id gnl|my_center|LOCUS_06610 63180 63881 gene locus_tag LOCUS_06620 63180 63881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040731.1 protein_id gnl|my_center|LOCUS_06620 63976 65469 gene locus_tag LOCUS_06630 gene glpK 63976 65469 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_06630 66883 65504 gene locus_tag LOCUS_06640 gene dbpA 66883 65504 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820592.1 protein_id gnl|my_center|LOCUS_06640 67173 71921 gene locus_tag LOCUS_06650 67173 71921 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040732.1 protein_id gnl|my_center|LOCUS_06650 71949 73415 gene locus_tag LOCUS_06660 71949 73415 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931634.1 protein_id gnl|my_center|LOCUS_06660 73524 74399 gene locus_tag LOCUS_06670 73524 74399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931636.1 protein_id gnl|my_center|LOCUS_06670 74396 75172 gene locus_tag LOCUS_06680 gene mlaE 74396 75172 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815775.1 protein_id gnl|my_center|LOCUS_06680 75241 75717 gene locus_tag LOCUS_06690 gene mlaD 75241 75717 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_06690 75794 76612 gene locus_tag LOCUS_06700 75794 76612 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931638.1 protein_id gnl|my_center|LOCUS_06700 76821 77435 gene locus_tag LOCUS_06710 76821 77435 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815780.1 protein_id gnl|my_center|LOCUS_06710 77499 78284 gene locus_tag LOCUS_06720 77499 78284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446832.1 protein_id gnl|my_center|LOCUS_06720 78284 79069 gene locus_tag LOCUS_06730 78284 79069 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815783.1 protein_id gnl|my_center|LOCUS_06730 79071 79313 gene locus_tag LOCUS_06740 79071 79313 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815785.1 protein_id gnl|my_center|LOCUS_06740 79306 80562 gene locus_tag LOCUS_06750 gene murA 79306 80562 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927222.1 protein_id gnl|my_center|LOCUS_06750 80543 81229 gene locus_tag LOCUS_06760 gene hisG 80543 81229 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815789.1 protein_id gnl|my_center|LOCUS_06760 81311 82609 gene locus_tag LOCUS_06770 gene hisD 81311 82609 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 protein_id gnl|my_center|LOCUS_06770 82622 83215 gene locus_tag LOCUS_06780 gene hisB 82622 83215 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815795.1 protein_id gnl|my_center|LOCUS_06780 83231 83911 gene locus_tag LOCUS_06790 gene hisH 83231 83911 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931644.1 protein_id gnl|my_center|LOCUS_06790 84074 84823 gene locus_tag LOCUS_06800 gene hisA 84074 84823 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_06800 84820 85623 gene locus_tag LOCUS_06810 gene hisF 84820 85623 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815802.1 protein_id gnl|my_center|LOCUS_06810 85620 86012 gene locus_tag LOCUS_06820 gene hisI 85620 86012 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815804.1 protein_id gnl|my_center|LOCUS_06820 86009 86362 gene locus_tag LOCUS_06830 86009 86362 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815805.1 protein_id gnl|my_center|LOCUS_06830 86459 86683 gene locus_tag LOCUS_06840 gene tatA 86459 86683 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_06840 86753 87163 gene locus_tag LOCUS_06850 gene tatB 86753 87163 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931646.1 protein_id gnl|my_center|LOCUS_06850 87163 87936 gene locus_tag LOCUS_06860 gene tatC 87163 87936 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_06860 89240 88014 gene locus_tag LOCUS_06870 89240 88014 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446841.1 protein_id gnl|my_center|LOCUS_06870 89254 90030 gene locus_tag LOCUS_06880 89254 90030 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927226.1 protein_id gnl|my_center|LOCUS_06880 90541 90080 gene locus_tag LOCUS_06890 gene mscL 90541 90080 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815814.1 protein_id gnl|my_center|LOCUS_06890 90663 91304 gene locus_tag LOCUS_06900 gene petA 90663 91304 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064798.1 protein_id gnl|my_center|LOCUS_06900 91358 92746 gene locus_tag LOCUS_06910 91358 92746 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815816.1 protein_id gnl|my_center|LOCUS_06910 92760 93611 gene locus_tag LOCUS_06920 92760 93611 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247426.1 protein_id gnl|my_center|LOCUS_06920 93750 94361 gene locus_tag LOCUS_06930 93750 94361 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815819.1 protein_id gnl|my_center|LOCUS_06930 94366 94785 gene locus_tag LOCUS_06940 94366 94785 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815821.1 protein_id gnl|my_center|LOCUS_06940 94875 94950 gene locus_tag LOCUS_t00130 94875 94950 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 96444 95056 gene locus_tag LOCUS_06950 96444 95056 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925787.1 protein_id gnl|my_center|LOCUS_06950 97157 96462 gene locus_tag LOCUS_06960 97157 96462 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038792.1 protein_id gnl|my_center|LOCUS_06960 97422 97970 gene locus_tag LOCUS_06970 97422 97970 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820744.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence07 1356 877 gene locus_tag LOCUS_06980 1356 877 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039087.1 protein_id gnl|my_center|LOCUS_06980 1504 2619 gene locus_tag LOCUS_06990 gene hppD 1504 2619 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039086.1 protein_id gnl|my_center|LOCUS_06990 3437 2895 gene locus_tag LOCUS_07000 gene msrA 3437 2895 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931268.1 protein_id gnl|my_center|LOCUS_07000 3780 3451 gene locus_tag LOCUS_07010 3780 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 3946 4731 gene locus_tag LOCUS_07020 gene lgt 3946 4731 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 protein_id gnl|my_center|LOCUS_07020 5333 5022 gene locus_tag LOCUS_07030 5333 5022 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814611.1 protein_id gnl|my_center|LOCUS_07030 5746 5333 gene locus_tag LOCUS_07040 5746 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814613.1 protein_id gnl|my_center|LOCUS_07040 5917 6822 gene locus_tag LOCUS_07050 5917 6822 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814620.1 protein_id gnl|my_center|LOCUS_07050 7196 6936 gene locus_tag LOCUS_07060 7196 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 7433 8326 gene locus_tag LOCUS_07070 7433 8326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 8533 8447 gene locus_tag LOCUS_t00140 8533 8447 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9354 8749 gene locus_tag LOCUS_07080 9354 8749 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814635.1 protein_id gnl|my_center|LOCUS_07080 9417 11159 gene locus_tag LOCUS_07090 9417 11159 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814636.1 protein_id gnl|my_center|LOCUS_07090 11184 11609 gene locus_tag LOCUS_07100 gene ybgC 11184 11609 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814639.1 protein_id gnl|my_center|LOCUS_07100 11619 12299 gene locus_tag LOCUS_07110 gene tolQ 11619 12299 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814641.1 protein_id gnl|my_center|LOCUS_07110 12359 12742 gene locus_tag LOCUS_07120 gene tolR 12359 12742 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_07120 12772 13944 gene locus_tag LOCUS_07130 12772 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 13982 15265 gene locus_tag LOCUS_07140 gene tolB 13982 15265 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_07140 15292 15777 gene locus_tag LOCUS_07150 gene pal 15292 15777 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814650.1 protein_id gnl|my_center|LOCUS_07150 15855 16529 gene locus_tag LOCUS_07160 gene ybgF 15855 16529 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814652.1 protein_id gnl|my_center|LOCUS_07160 16627 17433 gene locus_tag LOCUS_07170 16627 17433 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040487.1 protein_id gnl|my_center|LOCUS_07170 17861 17418 gene locus_tag LOCUS_07180 17861 17418 CDS product CopD family copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225757.1 protein_id gnl|my_center|LOCUS_07180 18399 17890 gene locus_tag LOCUS_07190 18399 17890 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192175.1 protein_id gnl|my_center|LOCUS_07190 20109 18598 gene locus_tag LOCUS_07200 20109 18598 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188420.1 protein_id gnl|my_center|LOCUS_07200 20329 20802 gene locus_tag LOCUS_07210 20329 20802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 20879 21895 gene locus_tag LOCUS_07220 20879 21895 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807287.1 protein_id gnl|my_center|LOCUS_07220 21978 23966 gene locus_tag LOCUS_07230 21978 23966 CDS product bifunctional anthranilate synthase component I family protein/class IV aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225844.1 protein_id gnl|my_center|LOCUS_07230 23987 24319 gene locus_tag LOCUS_07240 23987 24319 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225768.1 protein_id gnl|my_center|LOCUS_07240 25670 24399 gene locus_tag LOCUS_07250 25670 24399 CDS product purine/pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847027.1 protein_id gnl|my_center|LOCUS_07250 27305 25683 gene locus_tag LOCUS_07260 27305 25683 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195844.1 protein_id gnl|my_center|LOCUS_07260 28251 27361 gene locus_tag LOCUS_07270 28251 27361 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089870.1 protein_id gnl|my_center|LOCUS_07270 28412 29407 gene locus_tag LOCUS_07280 28412 29407 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 protein_id gnl|my_center|LOCUS_07280 29451 29726 gene locus_tag LOCUS_07290 gene catC 29451 29726 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897236.1 protein_id gnl|my_center|LOCUS_07290 29807 30586 gene locus_tag LOCUS_07300 gene pcaD 29807 30586 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206900.1 protein_id gnl|my_center|LOCUS_07300 31168 30575 gene locus_tag LOCUS_07310 31168 30575 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978539.1 protein_id gnl|my_center|LOCUS_07310 32190 31183 gene locus_tag LOCUS_07320 32190 31183 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525879.1 protein_id gnl|my_center|LOCUS_07320 33383 32271 gene locus_tag LOCUS_07330 33383 32271 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204735.1 protein_id gnl|my_center|LOCUS_07330 33955 33530 gene locus_tag LOCUS_07340 33955 33530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 34730 33948 gene locus_tag LOCUS_07350 34730 33948 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083209.1 protein_id gnl|my_center|LOCUS_07350 35630 34770 gene locus_tag LOCUS_07360 35630 34770 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_07360 36496 35693 gene locus_tag LOCUS_07370 36496 35693 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970338.1 protein_id gnl|my_center|LOCUS_07370 36993 36499 gene locus_tag LOCUS_07380 36993 36499 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399852.1 protein_id gnl|my_center|LOCUS_07380 37702 37034 gene locus_tag LOCUS_07390 37702 37034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 38040 37723 gene locus_tag LOCUS_07400 38040 37723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 40465 38090 gene locus_tag LOCUS_07410 40465 38090 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_07410 41085 40510 gene locus_tag LOCUS_07420 41085 40510 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257236.1 protein_id gnl|my_center|LOCUS_07420 42069 41134 gene locus_tag LOCUS_07430 42069 41134 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227175.1 protein_id gnl|my_center|LOCUS_07430 43668 42103 gene locus_tag LOCUS_07440 43668 42103 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229060.1 protein_id gnl|my_center|LOCUS_07440 44613 43708 gene locus_tag LOCUS_07450 44613 43708 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612424.1 protein_id gnl|my_center|LOCUS_07450 46290 44737 gene locus_tag LOCUS_07460 46290 44737 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612422.1 protein_id gnl|my_center|LOCUS_07460 47371 46298 gene locus_tag LOCUS_07470 gene torT 47371 46298 CDS product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612420.1 protein_id gnl|my_center|LOCUS_07470 47556 48536 gene locus_tag LOCUS_07480 47556 48536 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024633.1 protein_id gnl|my_center|LOCUS_07480 49173 48511 gene locus_tag LOCUS_07490 49173 48511 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967872.1 protein_id gnl|my_center|LOCUS_07490 50300 49344 gene locus_tag LOCUS_07500 50300 49344 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064997.1 protein_id gnl|my_center|LOCUS_07500 50770 50366 gene locus_tag LOCUS_07510 50770 50366 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112911.1 protein_id gnl|my_center|LOCUS_07510 52155 51247 gene locus_tag LOCUS_07520 gene catA 52155 51247 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525033.1 protein_id gnl|my_center|LOCUS_07520 53337 52219 gene locus_tag LOCUS_07530 53337 52219 CDS product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540534.1 protein_id gnl|my_center|LOCUS_07530 <56139 53552 gene locus_tag LOCUS_07540 <56139 53552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001079584.1:trimeric autotransporter adhesin SadA >Feature sequence08 618 244 gene locus_tag LOCUS_07550 618 244 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687781.1 protein_id gnl|my_center|LOCUS_07550 2215 647 gene locus_tag LOCUS_07560 gene msrAB 2215 647 CDS product bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980745.1 protein_id gnl|my_center|LOCUS_07560 2753 2677 gene locus_tag LOCUS_t00150 2753 2677 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5009 2874 gene locus_tag LOCUS_07570 gene rpoD 5009 2874 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930783.1 protein_id gnl|my_center|LOCUS_07570 7272 5359 gene locus_tag LOCUS_07580 gene dnaG 7272 5359 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063924.1 protein_id gnl|my_center|LOCUS_07580 7481 7269 gene locus_tag LOCUS_07590 gene rpsU 7481 7269 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006218592.1 protein_id gnl|my_center|LOCUS_07590 8258 7713 gene locus_tag LOCUS_07600 8258 7713 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063925.1 protein_id gnl|my_center|LOCUS_07600 9573 8278 gene locus_tag LOCUS_07610 9573 8278 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852902.1 protein_id gnl|my_center|LOCUS_07610 10808 9642 gene locus_tag LOCUS_07620 10808 9642 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063927.1 protein_id gnl|my_center|LOCUS_07620 11829 10939 gene locus_tag LOCUS_07630 gene hflC 11829 10939 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063928.1 protein_id gnl|my_center|LOCUS_07630 13164 11842 gene locus_tag LOCUS_07640 gene hflK 13164 11842 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 protein_id gnl|my_center|LOCUS_07640 14236 13139 gene locus_tag LOCUS_07650 gene hflX 14236 13139 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447752.1 protein_id gnl|my_center|LOCUS_07650 14545 14309 gene locus_tag LOCUS_07660 gene hfq 14545 14309 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810707.1 protein_id gnl|my_center|LOCUS_07660 15757 14663 gene locus_tag LOCUS_07670 gene hisC 15757 14663 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268858.1 protein_id gnl|my_center|LOCUS_07670 17185 15770 gene locus_tag LOCUS_07680 gene der 17185 15770 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063931.1 protein_id gnl|my_center|LOCUS_07680 18279 17182 gene locus_tag LOCUS_07690 gene bamB 18279 17182 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810701.1 protein_id gnl|my_center|LOCUS_07690 18984 18343 gene locus_tag LOCUS_07700 18984 18343 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063932.1 protein_id gnl|my_center|LOCUS_07700 20294 18993 gene locus_tag LOCUS_07710 gene hisS 20294 18993 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926751.1 protein_id gnl|my_center|LOCUS_07710 21602 20340 gene locus_tag LOCUS_07720 gene ispG 21602 20340 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_07720 22099 21605 gene locus_tag LOCUS_07730 22099 21605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 23244 22099 gene locus_tag LOCUS_07740 gene rlmN 23244 22099 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568542.1 protein_id gnl|my_center|LOCUS_07740 23700 23293 gene locus_tag LOCUS_07750 gene ndk 23700 23293 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810689.1 protein_id gnl|my_center|LOCUS_07750 23846 26698 gene locus_tag LOCUS_07760 23846 26698 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063937.1 protein_id gnl|my_center|LOCUS_07760 27553 27017 gene locus_tag LOCUS_07770 gene ppa 27553 27017 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812734.1 protein_id gnl|my_center|LOCUS_07770 29035 27587 gene locus_tag LOCUS_07780 29035 27587 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064060.1 protein_id gnl|my_center|LOCUS_07780 30718 29039 gene locus_tag LOCUS_07790 30718 29039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 31626 30823 gene locus_tag LOCUS_07800 31626 30823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 32589 31654 gene locus_tag LOCUS_07810 gene hemC 32589 31654 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820470.1 protein_id gnl|my_center|LOCUS_07810 33451 32729 gene locus_tag LOCUS_07820 33451 32729 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930986.1 protein_id gnl|my_center|LOCUS_07820 34669 33788 gene locus_tag LOCUS_07830 gene sucD 34669 33788 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812748.1 protein_id gnl|my_center|LOCUS_07830 35845 34685 gene locus_tag LOCUS_07840 gene sucC 35845 34685 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 protein_id gnl|my_center|LOCUS_07840 36393 35905 gene locus_tag LOCUS_07850 36393 35905 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930988.1 protein_id gnl|my_center|LOCUS_07850 38899 36605 gene locus_tag LOCUS_07860 gene metE 38899 36605 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926372.1 protein_id gnl|my_center|LOCUS_07860 39080 39994 gene locus_tag LOCUS_07870 39080 39994 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812755.1 protein_id gnl|my_center|LOCUS_07870 40172 41332 gene locus_tag LOCUS_07880 gene cfa 40172 41332 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444610.1 protein_id gnl|my_center|LOCUS_07880 42682 41372 gene locus_tag LOCUS_07890 gene rlmD 42682 41372 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816525.1 protein_id gnl|my_center|LOCUS_07890 43508 42831 gene locus_tag LOCUS_07900 43508 42831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930528.1 protein_id gnl|my_center|LOCUS_07900 44441 43665 gene locus_tag LOCUS_07910 44441 43665 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926717.1 protein_id gnl|my_center|LOCUS_07910 45170 44451 gene locus_tag LOCUS_07920 45170 44451 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039995.1 protein_id gnl|my_center|LOCUS_07920 46088 45216 gene locus_tag LOCUS_07930 46088 45216 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928874.1 protein_id gnl|my_center|LOCUS_07930 46834 46073 gene locus_tag LOCUS_07940 gene surE 46834 46073 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930526.1 protein_id gnl|my_center|LOCUS_07940 47060 47701 gene locus_tag LOCUS_07950 gene plsY 47060 47701 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811015.1 protein_id gnl|my_center|LOCUS_07950 48726 47698 gene locus_tag LOCUS_07960 gene tsaD 48726 47698 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811013.1 protein_id gnl|my_center|LOCUS_07960 48947 50236 gene locus_tag LOCUS_07970 48947 50236 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061547.1 protein_id gnl|my_center|LOCUS_07970 50438 50824 gene locus_tag LOCUS_07980 50438 50824 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811007.1 protein_id gnl|my_center|LOCUS_07980 51543 50944 gene locus_tag LOCUS_07990 51543 50944 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811006.1 protein_id gnl|my_center|LOCUS_07990 53144 51543 gene locus_tag LOCUS_08000 53144 51543 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447525.1 protein_id gnl|my_center|LOCUS_08000 54482 53334 gene locus_tag LOCUS_08010 54482 53334 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930515.1 protein_id gnl|my_center|LOCUS_08010 54955 54479 gene locus_tag LOCUS_08020 gene tadA 54955 54479 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930514.1 protein_id gnl|my_center|LOCUS_08020 >Feature sequence09 445 110 gene locus_tag LOCUS_08030 445 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 1610 618 gene locus_tag LOCUS_08040 1610 618 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040490.1 protein_id gnl|my_center|LOCUS_08040 2608 1715 gene locus_tag LOCUS_08050 2608 1715 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811656.1 protein_id gnl|my_center|LOCUS_08050 2736 3629 gene locus_tag LOCUS_08060 2736 3629 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930228.1 protein_id gnl|my_center|LOCUS_08060 3671 4246 gene locus_tag LOCUS_08070 3671 4246 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811662.1 protein_id gnl|my_center|LOCUS_08070 5728 4325 gene locus_tag LOCUS_08080 5728 4325 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972875.1 protein_id gnl|my_center|LOCUS_08080 6500 5781 gene locus_tag LOCUS_08090 6500 5781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807934.1 protein_id gnl|my_center|LOCUS_08090 7216 6500 gene locus_tag LOCUS_08100 7216 6500 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_08100 8147 7200 gene locus_tag LOCUS_08110 8147 7200 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_08110 9028 8144 gene locus_tag LOCUS_08120 9028 8144 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_08120 10336 9155 gene locus_tag LOCUS_08130 10336 9155 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942648.1 protein_id gnl|my_center|LOCUS_08130 10775 11305 gene locus_tag LOCUS_08140 10775 11305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 12559 11768 gene locus_tag LOCUS_08150 gene lpxP 12559 11768 CDS product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174358.1 protein_id gnl|my_center|LOCUS_08150 13748 13122 gene locus_tag LOCUS_08160 gene paaY 13748 13122 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705605.1 protein_id gnl|my_center|LOCUS_08160 14563 13802 gene locus_tag LOCUS_08170 14563 13802 CDS product phenylacetate-CoA oxygenase subunit PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399747.1 protein_id gnl|my_center|LOCUS_08170 15651 14575 gene locus_tag LOCUS_08180 gene paaK 15651 14575 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329395.1 protein_id gnl|my_center|LOCUS_08180 16191 15670 gene locus_tag LOCUS_08190 gene paaJ 16191 15670 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153451216.1 protein_id gnl|my_center|LOCUS_08190 16964 16191 gene locus_tag LOCUS_08200 gene paaC 16964 16191 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969776.1 protein_id gnl|my_center|LOCUS_08200 17248 16964 gene locus_tag LOCUS_08210 gene paaB 17248 16964 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969775.1 protein_id gnl|my_center|LOCUS_08210 18321 17332 gene locus_tag LOCUS_08220 gene paaA 18321 17332 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976335.1 protein_id gnl|my_center|LOCUS_08220 19324 18464 gene locus_tag LOCUS_08230 gene paaX 19324 18464 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969773.1 protein_id gnl|my_center|LOCUS_08230 20041 19340 gene locus_tag LOCUS_08240 20041 19340 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810743.1 protein_id gnl|my_center|LOCUS_08240 20819 20028 gene locus_tag LOCUS_08250 20819 20028 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040055.1 protein_id gnl|my_center|LOCUS_08250 21775 20819 gene locus_tag LOCUS_08260 21775 20819 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810748.1 protein_id gnl|my_center|LOCUS_08260 22651 21779 gene locus_tag LOCUS_08270 22651 21779 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_08270 23876 22719 gene locus_tag LOCUS_08280 23876 22719 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040052.1 protein_id gnl|my_center|LOCUS_08280 25620 23962 gene locus_tag LOCUS_08290 gene paaN 25620 23962 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813288.1 protein_id gnl|my_center|LOCUS_08290 25763 26563 gene locus_tag LOCUS_08300 gene paaG 25763 26563 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117561.1 protein_id gnl|my_center|LOCUS_08300 26566 27012 gene locus_tag LOCUS_08310 gene paaI 26566 27012 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577719.1 protein_id gnl|my_center|LOCUS_08310 27066 28379 gene locus_tag LOCUS_08320 gene paaF 27066 28379 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329391.1 protein_id gnl|my_center|LOCUS_08320 28477 29079 gene locus_tag LOCUS_08330 28477 29079 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329392.1 protein_id gnl|my_center|LOCUS_08330 30330 29353 gene locus_tag LOCUS_08340 30330 29353 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930645.1 protein_id gnl|my_center|LOCUS_08340 31906 30392 gene locus_tag LOCUS_08350 31906 30392 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 protein_id gnl|my_center|LOCUS_08350 32796 31918 gene locus_tag LOCUS_08360 32796 31918 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085733.1 protein_id gnl|my_center|LOCUS_08360 32912 33835 gene locus_tag LOCUS_08370 32912 33835 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113474.1 protein_id gnl|my_center|LOCUS_08370 33950 34180 gene locus_tag LOCUS_08380 33950 34180 CDS product hexameric tyrosine-coordinated heme protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143643.1 protein_id gnl|my_center|LOCUS_08380 35413 34313 gene locus_tag LOCUS_08390 35413 34313 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085467.1 protein_id gnl|my_center|LOCUS_08390 36387 35413 gene locus_tag LOCUS_08400 36387 35413 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808748.1 protein_id gnl|my_center|LOCUS_08400 36999 36424 gene locus_tag LOCUS_08410 36999 36424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 37877 36996 gene locus_tag LOCUS_08420 37877 36996 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808075.1 protein_id gnl|my_center|LOCUS_08420 38027 38938 gene locus_tag LOCUS_08430 38027 38938 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532449.1 protein_id gnl|my_center|LOCUS_08430 40163 39138 gene locus_tag LOCUS_08440 40163 39138 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931134.1 protein_id gnl|my_center|LOCUS_08440 41004 40252 gene locus_tag LOCUS_08450 gene nagB 41004 40252 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118913.1 protein_id gnl|my_center|LOCUS_08450 41516 41959 gene locus_tag LOCUS_08460 41516 41959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 42184 42453 gene locus_tag LOCUS_08470 42184 42453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196059.1 protein_id gnl|my_center|LOCUS_08470 43591 42467 gene locus_tag LOCUS_08480 43591 42467 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065023.1 protein_id gnl|my_center|LOCUS_08480 45398 43725 gene locus_tag LOCUS_08490 45398 43725 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065025.1 protein_id gnl|my_center|LOCUS_08490 45513 46400 gene locus_tag LOCUS_08500 45513 46400 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039157.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence10 1183 155 gene locus_tag LOCUS_08510 1183 155 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400934.1 protein_id gnl|my_center|LOCUS_08510 2185 1208 gene locus_tag LOCUS_08520 2185 1208 CDS product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973350.1 protein_id gnl|my_center|LOCUS_08520 2288 3175 gene locus_tag LOCUS_08530 2288 3175 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_08530 3907 3236 gene locus_tag LOCUS_08540 3907 3236 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311533.1 protein_id gnl|my_center|LOCUS_08540 4939 4229 gene locus_tag LOCUS_08550 4939 4229 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808611.1 protein_id gnl|my_center|LOCUS_08550 6610 5018 gene locus_tag LOCUS_08560 gene guaA 6610 5018 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812366.1 protein_id gnl|my_center|LOCUS_08560 6786 7511 gene locus_tag LOCUS_08570 6786 7511 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966429.1 protein_id gnl|my_center|LOCUS_08570 9130 7670 gene locus_tag LOCUS_08580 gene guaB 9130 7670 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 protein_id gnl|my_center|LOCUS_08580 13349 9294 gene locus_tag LOCUS_08590 gene purL 13349 9294 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931067.1 protein_id gnl|my_center|LOCUS_08590 13734 14567 gene locus_tag LOCUS_08600 gene pbpG 13734 14567 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809563.1 protein_id gnl|my_center|LOCUS_08600 15399 14674 gene locus_tag LOCUS_08610 gene ypfH 15399 14674 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810880.1 protein_id gnl|my_center|LOCUS_08610 15463 15921 gene locus_tag LOCUS_08620 15463 15921 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810867.1 protein_id gnl|my_center|LOCUS_08620 17134 16070 gene locus_tag LOCUS_08630 gene dinB 17134 16070 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810865.1 protein_id gnl|my_center|LOCUS_08630 17376 17708 gene locus_tag LOCUS_08640 17376 17708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 19835 17682 gene locus_tag LOCUS_08650 19835 17682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 20401 20033 gene locus_tag LOCUS_08660 20401 20033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 20582 20331 gene locus_tag LOCUS_08670 20582 20331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 20705 20959 gene locus_tag LOCUS_08680 20705 20959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 22111 20975 gene locus_tag LOCUS_08690 22111 20975 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535007.1 protein_id gnl|my_center|LOCUS_08690 24974 22173 gene locus_tag LOCUS_08700 24974 22173 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054625.1 protein_id gnl|my_center|LOCUS_08700 25790 24996 gene locus_tag LOCUS_08710 gene fetB 25790 24996 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538235.1 protein_id gnl|my_center|LOCUS_08710 26476 25790 gene locus_tag LOCUS_08720 26476 25790 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535853.1 protein_id gnl|my_center|LOCUS_08720 26918 26466 gene locus_tag LOCUS_08730 gene dtd 26918 26466 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_08730 27526 26915 gene locus_tag LOCUS_08740 27526 26915 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109195.1 protein_id gnl|my_center|LOCUS_08740 28461 27523 gene locus_tag LOCUS_08750 28461 27523 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114822.1 protein_id gnl|my_center|LOCUS_08750 29270 28467 gene locus_tag LOCUS_08760 29270 28467 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114823.1 protein_id gnl|my_center|LOCUS_08760 30400 29264 gene locus_tag LOCUS_08770 30400 29264 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815885.1 protein_id gnl|my_center|LOCUS_08770 31095 30490 gene locus_tag LOCUS_08780 31095 30490 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947367.1 protein_id gnl|my_center|LOCUS_08780 32410 31427 gene locus_tag LOCUS_08790 gene cysK 32410 31427 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706833.1 protein_id gnl|my_center|LOCUS_08790 32596 33369 gene locus_tag LOCUS_08800 32596 33369 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064395.1 protein_id gnl|my_center|LOCUS_08800 34354 33740 gene locus_tag LOCUS_08810 gene wrbA 34354 33740 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970175.1 protein_id gnl|my_center|LOCUS_08810 34948 34448 gene locus_tag LOCUS_08820 gene sixA 34948 34448 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence11 208 612 gene locus_tag LOCUS_08830 208 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 609 953 gene locus_tag LOCUS_08840 gene tnpB 609 953 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529308.1 protein_id gnl|my_center|LOCUS_08840 1045 2595 gene locus_tag LOCUS_08850 1045 2595 CDS product IS66-like element ISEc8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998048.1 protein_id gnl|my_center|LOCUS_08850 3247 2726 gene locus_tag LOCUS_08860 3247 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 3503 5137 gene locus_tag LOCUS_08870 3503 5137 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543612.1 protein_id gnl|my_center|LOCUS_08870 5321 6571 gene locus_tag LOCUS_08880 5321 6571 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089388.1 protein_id gnl|my_center|LOCUS_08880 6587 7033 gene locus_tag LOCUS_08890 6587 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 7078 7461 gene locus_tag LOCUS_08900 7078 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 7667 10357 gene locus_tag LOCUS_08910 7667 10357 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040291.1 protein_id gnl|my_center|LOCUS_08910 10350 13868 gene locus_tag LOCUS_08920 10350 13868 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064283.1 protein_id gnl|my_center|LOCUS_08920 14010 14642 gene locus_tag LOCUS_08930 14010 14642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 14870 16927 gene locus_tag LOCUS_08940 14870 16927 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930422.1 protein_id gnl|my_center|LOCUS_08940 17005 17331 gene locus_tag LOCUS_08950 17005 17331 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 protein_id gnl|my_center|LOCUS_08950 17331 17939 gene locus_tag LOCUS_08960 gene recR 17331 17939 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809574.1 protein_id gnl|my_center|LOCUS_08960 18934 17978 gene locus_tag LOCUS_08970 gene tal 18934 17978 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926156.1 protein_id gnl|my_center|LOCUS_08970 19318 20118 gene locus_tag LOCUS_08980 19318 20118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 20233 21390 gene locus_tag LOCUS_08990 gene carA 20233 21390 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076879800.1 protein_id gnl|my_center|LOCUS_08990 21397 24636 gene locus_tag LOCUS_09000 gene carB 21397 24636 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 protein_id gnl|my_center|LOCUS_09000 24780 25244 gene locus_tag LOCUS_09010 gene bfr 24780 25244 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614296.1 protein_id gnl|my_center|LOCUS_09010 26022 25261 gene locus_tag LOCUS_09020 26022 25261 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809590.1 protein_id gnl|my_center|LOCUS_09020 26467 26051 gene locus_tag LOCUS_09030 26467 26051 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039223.1 protein_id gnl|my_center|LOCUS_09030 27166 26534 gene locus_tag LOCUS_09040 27166 26534 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809593.1 protein_id gnl|my_center|LOCUS_09040 28324 27221 gene locus_tag LOCUS_09050 28324 27221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809599.1 protein_id gnl|my_center|LOCUS_09050 30088 28349 gene locus_tag LOCUS_09060 30088 28349 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_09060 31465 30134 gene locus_tag LOCUS_09070 31465 30134 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809603.1 protein_id gnl|my_center|LOCUS_09070 31660 32979 gene locus_tag LOCUS_09080 31660 32979 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809610.1 protein_id gnl|my_center|LOCUS_09080 33255 33731 gene locus_tag LOCUS_09090 gene greA 33255 33731 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039234.1 protein_id gnl|my_center|LOCUS_09090 34501 33929 gene locus_tag LOCUS_09100 34501 33929 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809618.1 protein_id gnl|my_center|LOCUS_09100 34520 35170 gene locus_tag LOCUS_09110 34520 35170 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930175.1 protein_id gnl|my_center|LOCUS_09110 35377 37278 gene locus_tag LOCUS_09120 gene ftsH 35377 37278 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809623.1 protein_id gnl|my_center|LOCUS_09120 37295 38143 gene locus_tag LOCUS_09130 gene folP 37295 38143 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_09130 38140 39477 gene locus_tag LOCUS_09140 gene glmM 38140 39477 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819875.1 protein_id gnl|my_center|LOCUS_09140 39616 40380 gene locus_tag LOCUS_09150 39616 40380 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809629.1 protein_id gnl|my_center|LOCUS_09150 41946 40447 gene locus_tag LOCUS_09160 gene ppx 41946 40447 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930172.1 protein_id gnl|my_center|LOCUS_09160 42201 44285 gene locus_tag LOCUS_09170 gene ppk1 42201 44285 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809633.1 protein_id gnl|my_center|LOCUS_09170 44567 45613 gene locus_tag LOCUS_09180 gene pstS 44567 45613 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809635.1 protein_id gnl|my_center|LOCUS_09180 45885 45667 gene locus_tag LOCUS_09190 45885 45667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 45770 46729 gene locus_tag LOCUS_09200 gene pstC 45770 46729 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809636.1 protein_id gnl|my_center|LOCUS_09200 46748 47635 gene locus_tag LOCUS_09210 gene pstA 46748 47635 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_09210 47671 48447 gene locus_tag LOCUS_09220 gene pstB 47671 48447 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930167.1 protein_id gnl|my_center|LOCUS_09220 48881 48453 gene locus_tag LOCUS_09230 gene cadR 48881 48453 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195850.1 protein_id gnl|my_center|LOCUS_09230 48968 51235 gene locus_tag LOCUS_09240 48968 51235 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205309.1 protein_id gnl|my_center|LOCUS_09240 51249 52817 gene locus_tag LOCUS_09250 51249 52817 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_09250 53887 52904 gene locus_tag LOCUS_09260 53887 52904 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814174.1 protein_id gnl|my_center|LOCUS_09260 54337 54261 gene locus_tag LOCUS_t00160 54337 54261 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 54746 54447 gene locus_tag LOCUS_09270 54746 54447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 55289 54783 gene locus_tag LOCUS_09280 55289 54783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 55612 55699 gene locus_tag LOCUS_t00170 55612 55699 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 55710 55799 gene locus_tag LOCUS_t00180 55710 55799 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 56020 57444 gene locus_tag LOCUS_09290 gene aspA 56020 57444 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096822.1 protein_id gnl|my_center|LOCUS_09290 57639 58622 gene locus_tag LOCUS_09300 57639 58622 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813997.1 protein_id gnl|my_center|LOCUS_09300 58700 59458 gene locus_tag LOCUS_09310 gene tpiA 58700 59458 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813996.1 protein_id gnl|my_center|LOCUS_09310 59480 60037 gene locus_tag LOCUS_09320 59480 60037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 60090 60174 gene locus_tag LOCUS_t00190 60090 60174 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 61654 60359 gene locus_tag LOCUS_09330 gene bioA 61654 60359 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_09330 62273 61635 gene locus_tag LOCUS_09340 62273 61635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 63421 62282 gene locus_tag LOCUS_09350 gene bioF 63421 62282 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930772.1 protein_id gnl|my_center|LOCUS_09350 63911 64363 gene locus_tag LOCUS_09360 gene azu 63911 64363 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813974.1 protein_id gnl|my_center|LOCUS_09360 64752 67967 gene locus_tag LOCUS_09370 64752 67967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 69353 68151 gene locus_tag LOCUS_09380 69353 68151 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086066.1 protein_id gnl|my_center|LOCUS_09380 70833 69379 gene locus_tag LOCUS_09390 70833 69379 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447682.1 protein_id gnl|my_center|LOCUS_09390 70935 71010 gene locus_tag LOCUS_t00200 70935 71010 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 74048 71151 gene locus_tag LOCUS_09400 gene fdhF 74048 71151 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809310.1 protein_id gnl|my_center|LOCUS_09400 75634 74084 gene locus_tag LOCUS_09410 75634 74084 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 protein_id gnl|my_center|LOCUS_09410 76101 75622 gene locus_tag LOCUS_09420 76101 75622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 79011 76426 gene locus_tag LOCUS_09430 gene mutS 79011 76426 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446228.1 protein_id gnl|my_center|LOCUS_09430 80019 79084 gene locus_tag LOCUS_09440 80019 79084 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064119.1 protein_id gnl|my_center|LOCUS_09440 81532 80036 gene locus_tag LOCUS_09450 81532 80036 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811138.1 protein_id gnl|my_center|LOCUS_09450 82391 81627 gene locus_tag LOCUS_09460 82391 81627 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926281.1 protein_id gnl|my_center|LOCUS_09460 82505 83299 gene locus_tag LOCUS_09470 82505 83299 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809990.1 protein_id gnl|my_center|LOCUS_09470 83316 84170 gene locus_tag LOCUS_09480 83316 84170 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930627.1 protein_id gnl|my_center|LOCUS_09480 85445 84234 gene locus_tag LOCUS_09490 85445 84234 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040635.1 protein_id gnl|my_center|LOCUS_09490 86303 85446 gene locus_tag LOCUS_09500 86303 85446 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927194.1 protein_id gnl|my_center|LOCUS_09500 87245 86331 gene locus_tag LOCUS_09510 87245 86331 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086302.1 protein_id gnl|my_center|LOCUS_09510 87401 88309 gene locus_tag LOCUS_09520 87401 88309 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811152.1 protein_id gnl|my_center|LOCUS_09520 88530 89528 gene locus_tag LOCUS_09530 88530 89528 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064800.1 protein_id gnl|my_center|LOCUS_09530 90573 89602 gene locus_tag LOCUS_09540 90573 89602 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040043.1 protein_id gnl|my_center|LOCUS_09540 91636 90644 gene locus_tag LOCUS_09550 91636 90644 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_09550 92373 91672 gene locus_tag LOCUS_09560 92373 91672 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206933.1 protein_id gnl|my_center|LOCUS_09560 93040 92366 gene locus_tag LOCUS_09570 93040 92366 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552494.1 protein_id gnl|my_center|LOCUS_09570 94011 93049 gene locus_tag LOCUS_09580 94011 93049 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813620.1 protein_id gnl|my_center|LOCUS_09580 95248 94076 gene locus_tag LOCUS_09590 95248 94076 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 protein_id gnl|my_center|LOCUS_09590 95643 95251 gene locus_tag LOCUS_09600 95643 95251 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812491.1 protein_id gnl|my_center|LOCUS_09600 95892 97082 gene locus_tag LOCUS_09610 95892 97082 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927204.1 protein_id gnl|my_center|LOCUS_09610 97129 98241 gene locus_tag LOCUS_09620 97129 98241 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815676.1 protein_id gnl|my_center|LOCUS_09620 98238 99038 gene locus_tag LOCUS_09630 gene paaG 98238 99038 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039494.1 protein_id gnl|my_center|LOCUS_09630 99845 99060 gene locus_tag LOCUS_09640 99845 99060 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247344.1 protein_id gnl|my_center|LOCUS_09640 100461 99835 gene locus_tag LOCUS_09650 100461 99835 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_09650 101039 100464 gene locus_tag LOCUS_09660 101039 100464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 101262 102743 gene locus_tag LOCUS_09670 gene cysS 101262 102743 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810003.1 protein_id gnl|my_center|LOCUS_09670 102753 103394 gene locus_tag LOCUS_09680 102753 103394 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810006.1 protein_id gnl|my_center|LOCUS_09680 103433 104389 gene locus_tag LOCUS_09690 103433 104389 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810007.1 protein_id gnl|my_center|LOCUS_09690 104463 105431 gene locus_tag LOCUS_09700 gene tilS 104463 105431 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930632.1 protein_id gnl|my_center|LOCUS_09700 105478 106173 gene locus_tag LOCUS_09710 105478 106173 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810854.1 protein_id gnl|my_center|LOCUS_09710 106289 107083 gene locus_tag LOCUS_09720 106289 107083 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206049.1 protein_id gnl|my_center|LOCUS_09720 107129 107536 gene locus_tag LOCUS_09730 107129 107536 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072053.1 protein_id gnl|my_center|LOCUS_09730 107595 109559 gene locus_tag LOCUS_09740 107595 109559 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395834.1 protein_id gnl|my_center|LOCUS_09740 110505 109570 gene locus_tag LOCUS_09750 gene nac 110505 109570 CDS product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399193.1 protein_id gnl|my_center|LOCUS_09750 110681 110977 gene locus_tag LOCUS_09760 110681 110977 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721533.1 protein_id gnl|my_center|LOCUS_09760 111030 112007 gene locus_tag LOCUS_09770 111030 112007 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852766.1 protein_id gnl|my_center|LOCUS_09770 112444 112106 gene locus_tag LOCUS_09780 112444 112106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 112731 112654 gene locus_tag LOCUS_t00210 112731 112654 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 112823 112746 gene locus_tag LOCUS_t00220 112823 112746 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 113163 114344 gene locus_tag LOCUS_09790 113163 114344 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383282.1 protein_id gnl|my_center|LOCUS_09790 114385 115263 gene locus_tag LOCUS_09800 114385 115263 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303519.1 protein_id gnl|my_center|LOCUS_09800 115535 116758 gene locus_tag LOCUS_09810 115535 116758 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876827.1 protein_id gnl|my_center|LOCUS_09810 116773 117741 gene locus_tag LOCUS_09820 116773 117741 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225962.1 protein_id gnl|my_center|LOCUS_09820 117763 118635 gene locus_tag LOCUS_09830 117763 118635 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_09830 118681 119295 gene locus_tag LOCUS_09840 118681 119295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040508.1 protein_id gnl|my_center|LOCUS_09840 119306 120481 gene locus_tag LOCUS_09850 119306 120481 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927091.1 protein_id gnl|my_center|LOCUS_09850 120462 121769 gene locus_tag LOCUS_09860 120462 121769 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931611.1 protein_id gnl|my_center|LOCUS_09860 122889 123566 gene locus_tag LOCUS_09870 122889 123566 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003198.1 protein_id gnl|my_center|LOCUS_09870 123776 123609 gene locus_tag LOCUS_09880 123776 123609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 123789 124337 gene locus_tag LOCUS_09890 123789 124337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 124334 126541 gene locus_tag LOCUS_09900 gene yegI 124334 126541 CDS product protein kinase YegI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856071.1 protein_id gnl|my_center|LOCUS_09900 126830 127417 gene locus_tag LOCUS_09910 126830 127417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 128036 127731 gene locus_tag LOCUS_09920 128036 127731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 128170 128883 gene locus_tag LOCUS_09930 128170 128883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 129112 130212 gene locus_tag LOCUS_09940 129112 130212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 130784 130509 gene locus_tag LOCUS_09950 130784 130509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 131900 131466 gene locus_tag LOCUS_09960 131900 131466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 133585 132206 gene locus_tag LOCUS_09970 133585 132206 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267168.1 protein_id gnl|my_center|LOCUS_09970 133903 134823 gene locus_tag LOCUS_09980 133903 134823 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423235.1 protein_id gnl|my_center|LOCUS_09980 134929 135333 gene locus_tag LOCUS_09990 gene gloA 134929 135333 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143550.1 protein_id gnl|my_center|LOCUS_09990 136610 135303 gene locus_tag LOCUS_10000 gene fahA 136610 135303 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083174.1 protein_id gnl|my_center|LOCUS_10000 137688 136669 gene locus_tag LOCUS_10010 137688 136669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 138655 137681 gene locus_tag LOCUS_10020 138655 137681 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064423.1 protein_id gnl|my_center|LOCUS_10020 139423 138674 gene locus_tag LOCUS_10030 139423 138674 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020660801.1 protein_id gnl|my_center|LOCUS_10030 139792 139589 gene locus_tag LOCUS_10040 139792 139589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 140270 140073 gene locus_tag LOCUS_10050 140270 140073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 140517 142217 gene locus_tag LOCUS_10060 140517 142217 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531442.1 protein_id gnl|my_center|LOCUS_10060 143213 142176 gene locus_tag LOCUS_10070 143213 142176 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493669.1 protein_id gnl|my_center|LOCUS_10070 144096 143272 gene locus_tag LOCUS_10080 144096 143272 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_10080 145210 144197 gene locus_tag LOCUS_10090 145210 144197 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207597.1 protein_id gnl|my_center|LOCUS_10090 145512 146339 gene locus_tag LOCUS_10100 145512 146339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812446.1 protein_id gnl|my_center|LOCUS_10100 146348 147232 gene locus_tag LOCUS_10110 146348 147232 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812445.1 protein_id gnl|my_center|LOCUS_10110 147232 148272 gene locus_tag LOCUS_10120 147232 148272 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812443.1 protein_id gnl|my_center|LOCUS_10120 148296 149468 gene locus_tag LOCUS_10130 148296 149468 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926442.1 protein_id gnl|my_center|LOCUS_10130 149473 150285 gene locus_tag LOCUS_10140 149473 150285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063643.1 protein_id gnl|my_center|LOCUS_10140 150288 152105 gene locus_tag LOCUS_10150 150288 152105 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930188.1 protein_id gnl|my_center|LOCUS_10150 152221 153351 gene locus_tag LOCUS_10160 152221 153351 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173212.1 protein_id gnl|my_center|LOCUS_10160 153375 154568 gene locus_tag LOCUS_10170 153375 154568 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228126.1 protein_id gnl|my_center|LOCUS_10170 154747 154655 gene locus_tag LOCUS_t00230 154747 154655 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 156080 154842 gene locus_tag LOCUS_10180 156080 154842 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930633.1 protein_id gnl|my_center|LOCUS_10180 156215 157156 gene locus_tag LOCUS_10190 156215 157156 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064103.1 protein_id gnl|my_center|LOCUS_10190 157977 157252 gene locus_tag LOCUS_10200 gene perB 157977 157252 CDS product GDP-perosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055391.1 protein_id gnl|my_center|LOCUS_10200 158061 158405 gene locus_tag LOCUS_10210 158061 158405 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705012.1 protein_id gnl|my_center|LOCUS_10210 158452 158667 gene locus_tag LOCUS_10220 158452 158667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743213.1 protein_id gnl|my_center|LOCUS_10220 158712 160388 gene locus_tag LOCUS_10230 158712 160388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 160654 161541 gene locus_tag LOCUS_10240 gene mmsB 160654 161541 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523211.1 protein_id gnl|my_center|LOCUS_10240 161626 162777 gene locus_tag LOCUS_10250 161626 162777 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770780.1 protein_id gnl|my_center|LOCUS_10250 162826 163884 gene locus_tag LOCUS_10260 162826 163884 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810145.1 protein_id gnl|my_center|LOCUS_10260 163903 164382 gene locus_tag LOCUS_10270 163903 164382 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446597.1 protein_id gnl|my_center|LOCUS_10270 164483 165622 gene locus_tag LOCUS_10280 gene dauA 164483 165622 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113780.1 protein_id gnl|my_center|LOCUS_10280 166365 165676 gene locus_tag LOCUS_10290 166365 165676 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814743.1 protein_id gnl|my_center|LOCUS_10290 166671 167156 gene locus_tag LOCUS_10300 166671 167156 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_10300 167160 167570 gene locus_tag LOCUS_10310 167160 167570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 168213 167656 gene locus_tag LOCUS_10320 gene efp 168213 167656 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 protein_id gnl|my_center|LOCUS_10320 169450 168287 gene locus_tag LOCUS_10330 gene earP 169450 168287 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039402.1 protein_id gnl|my_center|LOCUS_10330 170645 169434 gene locus_tag LOCUS_10340 170645 169434 CDS product DUF2863 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039403.1 protein_id gnl|my_center|LOCUS_10340 173388 170695 gene locus_tag LOCUS_10350 gene acnA 173388 170695 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820240.1 protein_id gnl|my_center|LOCUS_10350 176226 173635 gene locus_tag LOCUS_10360 gene acnB 176226 173635 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064143.1 protein_id gnl|my_center|LOCUS_10360 176704 177672 gene locus_tag LOCUS_10370 176704 177672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 178060 177788 gene locus_tag LOCUS_10380 178060 177788 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810239.1 protein_id gnl|my_center|LOCUS_10380 178525 178148 gene locus_tag LOCUS_10390 178525 178148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039412.1 protein_id gnl|my_center|LOCUS_10390 178710 179909 gene locus_tag LOCUS_10400 178710 179909 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174520.1 protein_id gnl|my_center|LOCUS_10400 179950 180408 gene locus_tag LOCUS_10410 179950 180408 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064568.1 protein_id gnl|my_center|LOCUS_10410 180462 181613 gene locus_tag LOCUS_10420 180462 181613 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450234.1 protein_id gnl|my_center|LOCUS_10420 181626 182654 gene locus_tag LOCUS_10430 181626 182654 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665531.1 protein_id gnl|my_center|LOCUS_10430 182678 183661 gene locus_tag LOCUS_10440 182678 183661 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064567.1 protein_id gnl|my_center|LOCUS_10440 183681 184646 gene locus_tag LOCUS_10450 183681 184646 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811487.1 protein_id gnl|my_center|LOCUS_10450 184860 185750 gene locus_tag LOCUS_10460 184860 185750 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812502.1 protein_id gnl|my_center|LOCUS_10460 187325 185874 gene locus_tag LOCUS_10470 187325 185874 CDS product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065150.1 protein_id gnl|my_center|LOCUS_10470 188609 187620 gene locus_tag LOCUS_10480 188609 187620 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065155.1 protein_id gnl|my_center|LOCUS_10480 188853 189617 gene locus_tag LOCUS_10490 188853 189617 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813656.1 protein_id gnl|my_center|LOCUS_10490 189708 190124 gene locus_tag LOCUS_10500 gene sdhC 189708 190124 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813654.1 protein_id gnl|my_center|LOCUS_10500 190124 190504 gene locus_tag LOCUS_10510 gene sdhD 190124 190504 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813653.1 protein_id gnl|my_center|LOCUS_10510 190508 192286 gene locus_tag LOCUS_10520 gene sdhA 190508 192286 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065156.1 protein_id gnl|my_center|LOCUS_10520 192297 193013 gene locus_tag LOCUS_10530 192297 193013 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 protein_id gnl|my_center|LOCUS_10530 193024 193284 gene locus_tag LOCUS_10540 193024 193284 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813647.1 protein_id gnl|my_center|LOCUS_10540 193333 194643 gene locus_tag LOCUS_10550 193333 194643 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813645.1 protein_id gnl|my_center|LOCUS_10550 195138 194740 gene locus_tag LOCUS_10560 195138 194740 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 protein_id gnl|my_center|LOCUS_10560 197424 195142 gene locus_tag LOCUS_10570 197424 195142 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446507.1 protein_id gnl|my_center|LOCUS_10570 197713 200583 gene locus_tag LOCUS_10580 197713 200583 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813631.1 protein_id gnl|my_center|LOCUS_10580 200615 201817 gene locus_tag LOCUS_10590 gene odhB 200615 201817 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040184.1 protein_id gnl|my_center|LOCUS_10590 201909 203339 gene locus_tag LOCUS_10600 gene lpdA 201909 203339 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813626.1 protein_id gnl|my_center|LOCUS_10600 203469 204560 gene locus_tag LOCUS_10610 gene zapE 203469 204560 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447983.1 protein_id gnl|my_center|LOCUS_10610 204578 205942 gene locus_tag LOCUS_10620 204578 205942 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930211.1 protein_id gnl|my_center|LOCUS_10620 205953 206504 gene locus_tag LOCUS_10630 gene ddpX 205953 206504 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184811.1 protein_id gnl|my_center|LOCUS_10630 206633 208180 gene locus_tag LOCUS_10640 206633 208180 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370099.1 protein_id gnl|my_center|LOCUS_10640 208255 209271 gene locus_tag LOCUS_10650 208255 209271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145091.1 protein_id gnl|my_center|LOCUS_10650 209271 210137 gene locus_tag LOCUS_10660 209271 210137 CDS product D,D-dipeptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096542.1 protein_id gnl|my_center|LOCUS_10660 210137 211156 gene locus_tag LOCUS_10670 210137 211156 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703224.1 protein_id gnl|my_center|LOCUS_10670 211137 212150 gene locus_tag LOCUS_10680 211137 212150 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096540.1 protein_id gnl|my_center|LOCUS_10680 212107 213915 gene locus_tag LOCUS_10690 212107 213915 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_10690 216387 214027 gene locus_tag LOCUS_10700 gene tex 216387 214027 CDS product RNA-binding transcriptional accessory protein Tex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930212.1 protein_id gnl|my_center|LOCUS_10700 216587 218668 gene locus_tag LOCUS_10710 216587 218668 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930213.1 protein_id gnl|my_center|LOCUS_10710 219679 218852 gene locus_tag LOCUS_10720 219679 218852 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040179.1 protein_id gnl|my_center|LOCUS_10720 219764 220735 gene locus_tag LOCUS_10730 219764 220735 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930214.1 protein_id gnl|my_center|LOCUS_10730 220927 221517 gene locus_tag LOCUS_10740 gene pgeF 220927 221517 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247742.1 protein_id gnl|my_center|LOCUS_10740 221650 223284 gene locus_tag LOCUS_10750 gene phaC 221650 223284 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813588.1 protein_id gnl|my_center|LOCUS_10750 223338 224075 gene locus_tag LOCUS_10760 gene phbB 223338 224075 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813586.1 protein_id gnl|my_center|LOCUS_10760 224133 224693 gene locus_tag LOCUS_10770 gene phaR 224133 224693 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813585.1 protein_id gnl|my_center|LOCUS_10770 225862 224723 gene locus_tag LOCUS_10780 225862 224723 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813554.1 protein_id gnl|my_center|LOCUS_10780 225879 226874 gene locus_tag LOCUS_10790 225879 226874 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818883.1 protein_id gnl|my_center|LOCUS_10790 227446 227006 gene locus_tag LOCUS_10800 gene ssb 227446 227006 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_10800 227772 227696 gene locus_tag LOCUS_t00240 227772 227696 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 228220 228144 gene locus_tag LOCUS_t00250 228220 228144 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 228302 228958 gene locus_tag LOCUS_10810 228302 228958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 229104 230648 gene locus_tag LOCUS_10820 229104 230648 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041937173.1 protein_id gnl|my_center|LOCUS_10820 230985 231434 gene locus_tag LOCUS_10830 gene rimP 230985 231434 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810544.1 protein_id gnl|my_center|LOCUS_10830 231431 232915 gene locus_tag LOCUS_10840 gene nusA 231431 232915 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810546.1 protein_id gnl|my_center|LOCUS_10840 232991 236083 gene locus_tag LOCUS_10850 gene infB 232991 236083 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063979.1 protein_id gnl|my_center|LOCUS_10850 236092 236505 gene locus_tag LOCUS_10860 gene rbfA 236092 236505 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810550.1 protein_id gnl|my_center|LOCUS_10860 236529 237281 gene locus_tag LOCUS_10870 gene truB 236529 237281 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810552.1 protein_id gnl|my_center|LOCUS_10870 237278 239104 gene locus_tag LOCUS_10880 gene typA 237278 239104 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810554.1 protein_id gnl|my_center|LOCUS_10880 239528 239842 gene locus_tag LOCUS_10890 239528 239842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 240126 240671 gene locus_tag LOCUS_10900 240126 240671 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007249559.1 protein_id gnl|my_center|LOCUS_10900 240702 241250 gene locus_tag LOCUS_10910 240702 241250 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267564.1 protein_id gnl|my_center|LOCUS_10910 241389 242054 gene locus_tag LOCUS_10920 241389 242054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 243002 242796 gene locus_tag LOCUS_10930 243002 242796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 243172 244080 gene locus_tag LOCUS_10940 243172 244080 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089214.1 protein_id gnl|my_center|LOCUS_10940 244336 244411 gene locus_tag LOCUS_t00260 244336 244411 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 244544 244619 gene locus_tag LOCUS_t00270 244544 244619 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 244985 245524 gene locus_tag LOCUS_10950 244985 245524 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447334.1 protein_id gnl|my_center|LOCUS_10950 245692 246087 gene locus_tag LOCUS_10960 245692 246087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 246173 247480 gene locus_tag LOCUS_10970 gene ectB 246173 247480 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063970.1 protein_id gnl|my_center|LOCUS_10970 247477 247872 gene locus_tag LOCUS_10980 247477 247872 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063969.1 protein_id gnl|my_center|LOCUS_10980 247885 248817 gene locus_tag LOCUS_10990 gene thpD 247885 248817 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063968.1 protein_id gnl|my_center|LOCUS_10990 249094 251835 gene locus_tag LOCUS_11000 249094 251835 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_11000 252441 251878 gene locus_tag LOCUS_11010 252441 251878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 252820 254565 gene locus_tag LOCUS_11020 252820 254565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 254793 255275 gene locus_tag LOCUS_11030 254793 255275 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705960.1 protein_id gnl|my_center|LOCUS_11030 255288 256703 gene locus_tag LOCUS_11040 255288 256703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 256700 257773 gene locus_tag LOCUS_11050 256700 257773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 257888 258886 gene locus_tag LOCUS_11060 257888 258886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532795.1 protein_id gnl|my_center|LOCUS_11060 258883 259836 gene locus_tag LOCUS_11070 258883 259836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 260130 262430 gene locus_tag LOCUS_11080 260130 262430 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691589.1 protein_id gnl|my_center|LOCUS_11080 262860 262501 gene locus_tag LOCUS_11090 262860 262501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 263275 263766 gene locus_tag LOCUS_11100 263275 263766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 264446 264033 gene locus_tag LOCUS_11110 264446 264033 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529498.1 protein_id gnl|my_center|LOCUS_11110 264689 265078 gene locus_tag LOCUS_11120 264689 265078 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023551.1 protein_id gnl|my_center|LOCUS_11120 265638 267296 gene locus_tag LOCUS_11130 265638 267296 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_11130 267293 268144 gene locus_tag LOCUS_11140 gene kdsA 267293 268144 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065134.1 protein_id gnl|my_center|LOCUS_11140 268291 269901 gene locus_tag LOCUS_11150 268291 269901 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205169.1 protein_id gnl|my_center|LOCUS_11150 269902 270327 gene locus_tag LOCUS_11160 269902 270327 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189186.1 protein_id gnl|my_center|LOCUS_11160 270371 271663 gene locus_tag LOCUS_11170 gene eno 270371 271663 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813700.1 protein_id gnl|my_center|LOCUS_11170 271679 272038 gene locus_tag LOCUS_11180 gene ftsB 271679 272038 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065137.1 protein_id gnl|my_center|LOCUS_11180 272992 272060 gene locus_tag LOCUS_11190 272992 272060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 274092 273172 gene locus_tag LOCUS_11200 gene hslO 274092 273172 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930902.1 protein_id gnl|my_center|LOCUS_11200 274644 274123 gene locus_tag LOCUS_11210 274644 274123 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813683.1 protein_id gnl|my_center|LOCUS_11210 276071 274656 gene locus_tag LOCUS_11220 276071 274656 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065145.1 protein_id gnl|my_center|LOCUS_11220 277589 276147 gene locus_tag LOCUS_11230 277589 276147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 278590 277586 gene locus_tag LOCUS_11240 278590 277586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 279227 278736 gene locus_tag LOCUS_11250 279227 278736 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065147.1 protein_id gnl|my_center|LOCUS_11250 280774 279230 gene locus_tag LOCUS_11260 280774 279230 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065148.1 protein_id gnl|my_center|LOCUS_11260 281209 280787 gene locus_tag LOCUS_11270 281209 280787 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813670.1 protein_id gnl|my_center|LOCUS_11270 282482 281220 gene locus_tag LOCUS_11280 282482 281220 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810251.1 protein_id gnl|my_center|LOCUS_11280 283556 282504 gene locus_tag LOCUS_11290 gene holA 283556 282504 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810253.1 protein_id gnl|my_center|LOCUS_11290 284139 283558 gene locus_tag LOCUS_11300 284139 283558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 286804 284147 gene locus_tag LOCUS_11310 gene leuS 286804 284147 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810256.1 protein_id gnl|my_center|LOCUS_11310 287690 286965 gene locus_tag LOCUS_11320 287690 286965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 287878 288156 gene locus_tag LOCUS_11330 287878 288156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 288875 288207 gene locus_tag LOCUS_11340 288875 288207 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930272.1 protein_id gnl|my_center|LOCUS_11340 288934 291594 gene locus_tag LOCUS_11350 gene polA 288934 291594 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810562.1 protein_id gnl|my_center|LOCUS_11350 292605 291748 gene locus_tag LOCUS_11360 gene htpX 292605 291748 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 protein_id gnl|my_center|LOCUS_11360 292828 293703 gene locus_tag LOCUS_11370 292828 293703 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_11370 293749 294597 gene locus_tag LOCUS_11380 293749 294597 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820280.1 protein_id gnl|my_center|LOCUS_11380 294808 295056 gene locus_tag LOCUS_11390 294808 295056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 295060 295974 gene locus_tag LOCUS_11400 295060 295974 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820295.1 protein_id gnl|my_center|LOCUS_11400 295989 297857 gene locus_tag LOCUS_11410 gene dxs 295989 297857 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813105.1 protein_id gnl|my_center|LOCUS_11410 297869 298666 gene locus_tag LOCUS_11420 gene folE2 297869 298666 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813103.1 protein_id gnl|my_center|LOCUS_11420 298915 299295 gene locus_tag LOCUS_11430 gene rpsF 298915 299295 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926331.1 protein_id gnl|my_center|LOCUS_11430 299314 299637 gene locus_tag LOCUS_11440 gene priB 299314 299637 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813095.1 protein_id gnl|my_center|LOCUS_11440 299715 299990 gene locus_tag LOCUS_11450 gene rpsR 299715 299990 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813094.1 protein_id gnl|my_center|LOCUS_11450 300007 300462 gene locus_tag LOCUS_11460 gene rplI 300007 300462 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813092.1 protein_id gnl|my_center|LOCUS_11460 300633 302024 gene locus_tag LOCUS_11470 300633 302024 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813089.1 protein_id gnl|my_center|LOCUS_11470 303916 302192 gene locus_tag LOCUS_11480 303916 302192 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_11480 304452 303982 gene locus_tag LOCUS_11490 304452 303982 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813079.1 protein_id gnl|my_center|LOCUS_11490 304905 304453 gene locus_tag LOCUS_11500 304905 304453 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813077.1 protein_id gnl|my_center|LOCUS_11500 305218 306339 gene locus_tag LOCUS_11510 gene alaC 305218 306339 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 protein_id gnl|my_center|LOCUS_11510 306336 307646 gene locus_tag LOCUS_11520 306336 307646 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813074.1 protein_id gnl|my_center|LOCUS_11520 307643 309052 gene locus_tag LOCUS_11530 gene thrC 307643 309052 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813072.1 protein_id gnl|my_center|LOCUS_11530 309162 309545 gene locus_tag LOCUS_11540 gene crcB 309162 309545 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810483.1 protein_id gnl|my_center|LOCUS_11540 309648 310892 gene locus_tag LOCUS_11550 309648 310892 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039819.1 protein_id gnl|my_center|LOCUS_11550 310889 311338 gene locus_tag LOCUS_11560 gene nsrR 310889 311338 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_11560 312677 311328 gene locus_tag LOCUS_11570 gene hpnE 312677 311328 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_11570 313536 312664 gene locus_tag LOCUS_11580 gene hpnD 313536 312664 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_11580 314377 313541 gene locus_tag LOCUS_11590 gene hpnC 314377 313541 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 protein_id gnl|my_center|LOCUS_11590 314477 315625 gene locus_tag LOCUS_11600 gene alr 314477 315625 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810492.1 protein_id gnl|my_center|LOCUS_11600 315680 316387 gene locus_tag LOCUS_11610 315680 316387 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810494.1 protein_id gnl|my_center|LOCUS_11610 316455 317816 gene locus_tag LOCUS_11620 gene radA 316455 317816 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928233.1 protein_id gnl|my_center|LOCUS_11620 317838 318611 gene locus_tag LOCUS_11630 317838 318611 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818618.1 protein_id gnl|my_center|LOCUS_11630 318630 321128 gene locus_tag LOCUS_11640 318630 321128 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_11640 321129 321548 gene locus_tag LOCUS_11650 321129 321548 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813267.1 protein_id gnl|my_center|LOCUS_11650 321541 322266 gene locus_tag LOCUS_11660 321541 322266 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813264.1 protein_id gnl|my_center|LOCUS_11660 322335 323438 gene locus_tag LOCUS_11670 322335 323438 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813262.1 protein_id gnl|my_center|LOCUS_11670 323441 324565 gene locus_tag LOCUS_11680 gene potA 323441 324565 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813260.1 protein_id gnl|my_center|LOCUS_11680 324562 325467 gene locus_tag LOCUS_11690 324562 325467 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813258.1 protein_id gnl|my_center|LOCUS_11690 325475 326302 gene locus_tag LOCUS_11700 325475 326302 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813256.1 protein_id gnl|my_center|LOCUS_11700 326274 326630 gene locus_tag LOCUS_11710 326274 326630 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813253.1 protein_id gnl|my_center|LOCUS_11710 326642 327316 gene locus_tag LOCUS_11720 gene rpiA 326642 327316 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813244.1 protein_id gnl|my_center|LOCUS_11720 327382 328182 gene locus_tag LOCUS_11730 gene phoU 327382 328182 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813242.1 protein_id gnl|my_center|LOCUS_11730 328524 328252 gene locus_tag LOCUS_11740 328524 328252 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813239.1 protein_id gnl|my_center|LOCUS_11740 329892 328537 gene locus_tag LOCUS_11750 gene argA 329892 328537 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813237.1 protein_id gnl|my_center|LOCUS_11750 329972 333841 gene locus_tag LOCUS_11760 gene hrpA 329972 333841 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813236.1 protein_id gnl|my_center|LOCUS_11760 333855 337370 gene locus_tag LOCUS_11770 gene dnaE 333855 337370 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813231.1 protein_id gnl|my_center|LOCUS_11770 337367 338524 gene locus_tag LOCUS_11780 337367 338524 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925698.1 protein_id gnl|my_center|LOCUS_11780 339261 338500 gene locus_tag LOCUS_11790 339261 338500 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813215.1 protein_id gnl|my_center|LOCUS_11790 340174 339269 gene locus_tag LOCUS_11800 340174 339269 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926806.1 protein_id gnl|my_center|LOCUS_11800 340335 342110 gene locus_tag LOCUS_11810 gene msbA 340335 342110 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930870.1 protein_id gnl|my_center|LOCUS_11810 342180 342542 gene locus_tag LOCUS_11820 342180 342542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 344011 342548 gene locus_tag LOCUS_11830 gene rng 344011 342548 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813204.1 protein_id gnl|my_center|LOCUS_11830 344150 344851 gene locus_tag LOCUS_11840 344150 344851 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050480010.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence12 418 251 gene locus_tag LOCUS_11850 418 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1036 2373 gene locus_tag LOCUS_11860 1036 2373 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921638.1 protein_id gnl|my_center|LOCUS_11860 2381 3241 gene locus_tag LOCUS_11870 2381 3241 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_11870 3277 4473 gene locus_tag LOCUS_11880 3277 4473 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089103.1 protein_id gnl|my_center|LOCUS_11880 4502 5383 gene locus_tag LOCUS_11890 4502 5383 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 protein_id gnl|my_center|LOCUS_11890 5395 6285 gene locus_tag LOCUS_11900 5395 6285 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188783.1 protein_id gnl|my_center|LOCUS_11900 6326 7477 gene locus_tag LOCUS_11910 6326 7477 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921514.1 protein_id gnl|my_center|LOCUS_11910 7616 8485 gene locus_tag LOCUS_11920 7616 8485 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919678.1 protein_id gnl|my_center|LOCUS_11920 9273 8524 gene locus_tag LOCUS_11930 9273 8524 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807684.1 protein_id gnl|my_center|LOCUS_11930 10308 9343 gene locus_tag LOCUS_11940 10308 9343 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040464.1 protein_id gnl|my_center|LOCUS_11940 10795 10643 gene locus_tag LOCUS_11950 10795 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11950 11018 10767 gene locus_tag LOCUS_11960 11018 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 11309 12934 gene locus_tag LOCUS_11970 11309 12934 CDS product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085889.1 protein_id gnl|my_center|LOCUS_11970 14234 13044 gene locus_tag LOCUS_11980 14234 13044 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193455.1 protein_id gnl|my_center|LOCUS_11980 14465 15250 gene locus_tag LOCUS_11990 14465 15250 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816019.1 protein_id gnl|my_center|LOCUS_11990 16458 15277 gene locus_tag LOCUS_12000 16458 15277 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523585.1 protein_id gnl|my_center|LOCUS_12000 17495 16491 gene locus_tag LOCUS_12010 17495 16491 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815277.1 protein_id gnl|my_center|LOCUS_12010 19056 17782 gene locus_tag LOCUS_12020 19056 17782 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811299.1 protein_id gnl|my_center|LOCUS_12020 19165 20064 gene locus_tag LOCUS_12030 19165 20064 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813958.1 protein_id gnl|my_center|LOCUS_12030 20927 20136 gene locus_tag LOCUS_12040 20927 20136 CDS product DUF4394 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384314.1 protein_id gnl|my_center|LOCUS_12040 21803 21090 gene locus_tag LOCUS_12050 21803 21090 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765563.1 protein_id gnl|my_center|LOCUS_12050 22348 21800 gene locus_tag LOCUS_12060 22348 21800 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266351.1 protein_id gnl|my_center|LOCUS_12060 22814 22434 gene locus_tag LOCUS_12070 22814 22434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893665.1 protein_id gnl|my_center|LOCUS_12070 23019 23969 gene locus_tag LOCUS_12080 23019 23969 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397288.1 protein_id gnl|my_center|LOCUS_12080 24403 24038 gene locus_tag LOCUS_12090 24403 24038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 25734 24436 gene locus_tag LOCUS_12100 25734 24436 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040400.1 protein_id gnl|my_center|LOCUS_12100 26181 25849 gene locus_tag LOCUS_12110 26181 25849 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809062.1 protein_id gnl|my_center|LOCUS_12110 26396 26824 gene locus_tag LOCUS_12120 gene arsC 26396 26824 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969024.1 protein_id gnl|my_center|LOCUS_12120 26821 27546 gene locus_tag LOCUS_12130 gene arsH 26821 27546 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113752.1 protein_id gnl|my_center|LOCUS_12130 27565 28815 gene locus_tag LOCUS_12140 27565 28815 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337698.1 protein_id gnl|my_center|LOCUS_12140 30048 28834 gene locus_tag LOCUS_12150 gene gltS 30048 28834 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703819.1 protein_id gnl|my_center|LOCUS_12150 31598 30351 gene locus_tag LOCUS_12160 31598 30351 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207248.1 protein_id gnl|my_center|LOCUS_12160 31791 32666 gene locus_tag LOCUS_12170 31791 32666 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921014.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence13 270 581 gene locus_tag LOCUS_12180 gene rpsJ 270 581 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806903.1 protein_id gnl|my_center|LOCUS_12180 618 693 gene locus_tag LOCUS_t00280 618 693 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1012 2022 gene locus_tag LOCUS_12190 1012 2022 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266296.1 protein_id gnl|my_center|LOCUS_12190 2019 2678 gene locus_tag LOCUS_12200 2019 2678 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 protein_id gnl|my_center|LOCUS_12200 2692 3483 gene locus_tag LOCUS_12210 2692 3483 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040604.1 protein_id gnl|my_center|LOCUS_12210 3617 4012 gene locus_tag LOCUS_12220 3617 4012 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339147.1 protein_id gnl|my_center|LOCUS_12220 4136 4483 gene locus_tag LOCUS_12230 4136 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 4648 5229 gene locus_tag LOCUS_12240 4648 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531852.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence14 564 2078 gene locus_tag LOCUS_12250 564 2078 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649434.1 protein_id gnl|my_center|LOCUS_12250 3262 2072 gene locus_tag LOCUS_12260 3262 2072 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525371.1 protein_id gnl|my_center|LOCUS_12260 4831 3326 gene locus_tag LOCUS_12270 4831 3326 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926191.1 protein_id gnl|my_center|LOCUS_12270 5344 6522 gene locus_tag LOCUS_12280 5344 6522 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399310.1 protein_id gnl|my_center|LOCUS_12280 6624 7748 gene locus_tag LOCUS_12290 6624 7748 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266503.1 protein_id gnl|my_center|LOCUS_12290 7830 8747 gene locus_tag LOCUS_12300 7830 8747 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096033.1 protein_id gnl|my_center|LOCUS_12300 8747 10312 gene locus_tag LOCUS_12310 8747 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 10309 11127 gene locus_tag LOCUS_12320 10309 11127 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095566.1 protein_id gnl|my_center|LOCUS_12320 11124 11840 gene locus_tag LOCUS_12330 11124 11840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407872.1 protein_id gnl|my_center|LOCUS_12330 11840 12439 gene locus_tag LOCUS_12340 11840 12439 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478414.1 protein_id gnl|my_center|LOCUS_12340 12439 13380 gene locus_tag LOCUS_12350 12439 13380 CDS product delta(1)-pyrroline-2-carboxylate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551610.1 protein_id gnl|my_center|LOCUS_12350 13623 14312 gene locus_tag LOCUS_12360 gene rplC 13623 14312 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925687.1 protein_id gnl|my_center|LOCUS_12360 14312 14932 gene locus_tag LOCUS_12370 gene rplD 14312 14932 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806905.1 protein_id gnl|my_center|LOCUS_12370 14929 15231 gene locus_tag LOCUS_12380 gene rplW 14929 15231 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806906.1 protein_id gnl|my_center|LOCUS_12380 15233 16060 gene locus_tag LOCUS_12390 gene rplB 15233 16060 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806907.1 protein_id gnl|my_center|LOCUS_12390 16075 16350 gene locus_tag LOCUS_12400 gene rpsS 16075 16350 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806908.1 protein_id gnl|my_center|LOCUS_12400 16354 16683 gene locus_tag LOCUS_12410 gene rplV 16354 16683 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925688.1 protein_id gnl|my_center|LOCUS_12410 16693 17478 gene locus_tag LOCUS_12420 gene rpsC 16693 17478 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806910.1 protein_id gnl|my_center|LOCUS_12420 17481 17897 gene locus_tag LOCUS_12430 gene rplP 17481 17897 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806911.1 protein_id gnl|my_center|LOCUS_12430 17908 18099 gene locus_tag LOCUS_12440 gene rpmC 17908 18099 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806912.1 protein_id gnl|my_center|LOCUS_12440 18101 18379 gene locus_tag LOCUS_12450 gene rpsQ 18101 18379 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806913.1 protein_id gnl|my_center|LOCUS_12450 18587 19996 gene locus_tag LOCUS_12460 18587 19996 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244205.1 protein_id gnl|my_center|LOCUS_12460 20032 21444 gene locus_tag LOCUS_12470 20032 21444 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064125.1 protein_id gnl|my_center|LOCUS_12470 21476 22294 gene locus_tag LOCUS_12480 21476 22294 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113230.1 protein_id gnl|my_center|LOCUS_12480 22278 23186 gene locus_tag LOCUS_12490 22278 23186 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532966.1 protein_id gnl|my_center|LOCUS_12490 23190 23729 gene locus_tag LOCUS_12500 23190 23729 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 protein_id gnl|my_center|LOCUS_12500 24831 23851 gene locus_tag LOCUS_12510 24831 23851 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814174.1 protein_id gnl|my_center|LOCUS_12510 26266 25058 gene locus_tag LOCUS_12520 26266 25058 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820743.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence15 65 1024 gene locus_tag LOCUS_12530 65 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1102 1302 gene locus_tag LOCUS_12540 1102 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 2341 1328 gene locus_tag LOCUS_12550 2341 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 5820 2908 gene locus_tag LOCUS_12560 5820 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 6930 5893 gene locus_tag LOCUS_12570 6930 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12570 7429 6854 gene locus_tag LOCUS_12580 7429 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 7863 7441 gene locus_tag LOCUS_12590 7863 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 8605 7856 gene locus_tag LOCUS_12600 gene stbB 8605 7856 CDS product StbB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264012.1 protein_id gnl|my_center|LOCUS_12600 9125 8649 gene locus_tag LOCUS_12610 9125 8649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 10506 9139 gene locus_tag LOCUS_12620 10506 9139 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813089.1 protein_id gnl|my_center|LOCUS_12620 11399 10503 gene locus_tag LOCUS_12630 11399 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 11759 11478 gene locus_tag LOCUS_12640 11759 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 12772 11771 gene locus_tag LOCUS_12650 gene virB11 12772 11771 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034519683.1 protein_id gnl|my_center|LOCUS_12650 13862 12750 gene locus_tag LOCUS_12660 gene virB10 13862 12750 CDS product type IV secretion system protein VirB10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967687.1 protein_id gnl|my_center|LOCUS_12660 14983 13859 gene locus_tag LOCUS_12670 14983 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 15695 15006 gene locus_tag LOCUS_12680 15695 15006 CDS product virB8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252745.1 protein_id gnl|my_center|LOCUS_12680 16777 15848 gene locus_tag LOCUS_12690 16777 15848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 17460 16789 gene locus_tag LOCUS_12700 gene virB5 17460 16789 CDS product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042067.1 protein_id gnl|my_center|LOCUS_12700 17963 17589 gene locus_tag LOCUS_12710 17963 17589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 18426 18115 gene locus_tag LOCUS_12720 18426 18115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 18720 18430 gene locus_tag LOCUS_12730 18720 18430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 21331 18908 gene locus_tag LOCUS_12740 21331 18908 CDS product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263998.1 protein_id gnl|my_center|LOCUS_12740 21998 21675 gene locus_tag LOCUS_12750 21998 21675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 22643 22038 gene locus_tag LOCUS_12760 22643 22038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 23080 22646 gene locus_tag LOCUS_12770 23080 22646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 23845 23540 gene locus_tag LOCUS_12780 23845 23540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 26704 24020 gene locus_tag LOCUS_12790 26704 24020 CDS product autotransporter serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268617.1 protein_id gnl|my_center|LOCUS_12790 26759 28558 gene locus_tag LOCUS_12800 26759 28558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 29349 28714 gene locus_tag LOCUS_12810 29349 28714 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807659.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence16 253 843 gene locus_tag LOCUS_12820 253 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 998 1480 gene locus_tag LOCUS_12830 998 1480 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261948.1 protein_id gnl|my_center|LOCUS_12830 2212 1517 gene locus_tag LOCUS_12840 gene marC 2212 1517 CDS product NAAT family transporter MarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885033.1 protein_id gnl|my_center|LOCUS_12840 2451 3461 gene locus_tag LOCUS_12850 2451 3461 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365244.1 protein_id gnl|my_center|LOCUS_12850 4938 3493 gene locus_tag LOCUS_12860 gene cusS 4938 3493 CDS product Cu(+)/Ag(+) sensor histidine kinase CusS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253799.1 protein_id gnl|my_center|LOCUS_12860 5633 4935 gene locus_tag LOCUS_12870 5633 4935 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_12870 5992 6387 gene locus_tag LOCUS_12880 5992 6387 CDS product cupredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040632.1 protein_id gnl|my_center|LOCUS_12880 6400 6873 gene locus_tag LOCUS_12890 6400 6873 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039876.1 protein_id gnl|my_center|LOCUS_12890 7006 7596 gene locus_tag LOCUS_12900 7006 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 7944 7606 gene locus_tag LOCUS_12910 7944 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 8132 8365 gene locus_tag LOCUS_12920 8132 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 8861 8436 gene locus_tag LOCUS_12930 8861 8436 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346527.1 protein_id gnl|my_center|LOCUS_12930 9116 8865 gene locus_tag LOCUS_12940 9116 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 10327 9515 gene locus_tag LOCUS_12950 10327 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 10986 11573 gene locus_tag LOCUS_12960 10986 11573 CDS product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220727.1 protein_id gnl|my_center|LOCUS_12960 11674 11928 gene locus_tag LOCUS_12970 11674 11928 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211310.1 protein_id gnl|my_center|LOCUS_12970 13059 12166 gene locus_tag LOCUS_12980 13059 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042012908.1 protein_id gnl|my_center|LOCUS_12980 13639 13139 gene locus_tag LOCUS_12990 gene radC 13639 13139 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050665004.1 protein_id gnl|my_center|LOCUS_12990 14736 13735 gene locus_tag LOCUS_13000 14736 13735 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 protein_id gnl|my_center|LOCUS_13000 15778 14819 gene locus_tag LOCUS_13010 15778 14819 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_13010 16173 15802 gene locus_tag LOCUS_13020 16173 15802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 16613 21631 gene locus_tag LOCUS_13030 16613 21631 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102960.1 protein_id gnl|my_center|LOCUS_13030 21686 22186 gene locus_tag LOCUS_13040 21686 22186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence17 <1 615 gene locus_tag LOCUS_13050 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000998051.1:IS66-like element ISEc8 family transposase 1629 853 gene locus_tag LOCUS_13060 1629 853 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366809.1 protein_id gnl|my_center|LOCUS_13060 2855 1695 gene locus_tag LOCUS_13070 2855 1695 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099147.1 protein_id gnl|my_center|LOCUS_13070 4356 2902 gene locus_tag LOCUS_13080 4356 2902 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 protein_id gnl|my_center|LOCUS_13080 5691 4381 gene locus_tag LOCUS_13090 5691 4381 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338375.1 protein_id gnl|my_center|LOCUS_13090 6206 5688 gene locus_tag LOCUS_13100 6206 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 7361 6285 gene locus_tag LOCUS_13110 7361 6285 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_13110 8119 8394 gene locus_tag LOCUS_13120 8119 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 8381 8629 gene locus_tag LOCUS_13130 8381 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 8743 9360 gene locus_tag LOCUS_13140 8743 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 9344 9766 gene locus_tag LOCUS_13150 9344 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 10128 11549 gene locus_tag LOCUS_13160 10128 11549 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139860272.1 protein_id gnl|my_center|LOCUS_13160 11675 12226 gene locus_tag LOCUS_13170 11675 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 12219 12749 gene locus_tag LOCUS_13180 12219 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 13694 12909 gene locus_tag LOCUS_13190 13694 12909 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206211.1 protein_id gnl|my_center|LOCUS_13190 14722 13718 gene locus_tag LOCUS_13200 14722 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 16098 14845 gene locus_tag LOCUS_13210 16098 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 16598 16251 gene locus_tag LOCUS_13220 16598 16251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 18120 16696 gene locus_tag LOCUS_13230 18120 16696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 19138 20013 gene locus_tag LOCUS_13240 gene galU 19138 20013 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208056.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence18 306 133 gene locus_tag LOCUS_13250 306 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 661 356 gene locus_tag LOCUS_13260 661 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13260 1384 755 gene locus_tag LOCUS_13270 1384 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1883 1674 gene locus_tag LOCUS_13280 1883 1674 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807785.1 protein_id gnl|my_center|LOCUS_13280 3035 1986 gene locus_tag LOCUS_13290 3035 1986 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705342.1 protein_id gnl|my_center|LOCUS_13290 3342 4070 gene locus_tag LOCUS_13300 3342 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13300 4080 4625 gene locus_tag LOCUS_13310 4080 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 4627 5046 gene locus_tag LOCUS_13320 4627 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 5641 5123 gene locus_tag LOCUS_13330 5641 5123 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071839.1 protein_id gnl|my_center|LOCUS_13330 6299 5703 gene locus_tag LOCUS_13340 6299 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528402.1 protein_id gnl|my_center|LOCUS_13340 7829 6387 gene locus_tag LOCUS_13350 gene gabD 7829 6387 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_13350 8038 8562 gene locus_tag LOCUS_13360 8038 8562 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706837.1 protein_id gnl|my_center|LOCUS_13360 10027 8750 gene locus_tag LOCUS_13370 gene dctM 10027 8750 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 protein_id gnl|my_center|LOCUS_13370 10575 10024 gene locus_tag LOCUS_13380 gene dctQ 10575 10024 CDS product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105527.1 protein_id gnl|my_center|LOCUS_13380 11712 10708 gene locus_tag LOCUS_13390 gene dctP 11712 10708 CDS product C4-dicarboxylate TRAP substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105525.1 protein_id gnl|my_center|LOCUS_13390 12234 11914 gene locus_tag LOCUS_13400 12234 11914 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261939.1 protein_id gnl|my_center|LOCUS_13400 12490 13290 gene locus_tag LOCUS_13410 12490 13290 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206444.1 protein_id gnl|my_center|LOCUS_13410 <13968 13355 gene locus_tag LOCUS_13420 <13968 13355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119453.1:Na+/H+ antiporter NhaA >Feature sequence19 488 135 gene locus_tag LOCUS_13430 488 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3979 1067 gene locus_tag LOCUS_13440 3979 1067 CDS product autotransporter serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268617.1 protein_id gnl|my_center|LOCUS_13440 5327 4347 gene locus_tag LOCUS_13450 5327 4347 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223743.1 protein_id gnl|my_center|LOCUS_13450 6204 5398 gene locus_tag LOCUS_13460 6204 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 7079 6201 gene locus_tag LOCUS_13470 7079 6201 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892069.1 protein_id gnl|my_center|LOCUS_13470 7912 7097 gene locus_tag LOCUS_13480 gene phnC 7912 7097 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258841.1 protein_id gnl|my_center|LOCUS_13480 8064 8984 gene locus_tag LOCUS_13490 8064 8984 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114270.1 protein_id gnl|my_center|LOCUS_13490 9119 12448 gene locus_tag LOCUS_13500 9119 12448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 12765 12604 gene locus_tag LOCUS_13510 12765 12604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13510 13378 12773 gene locus_tag LOCUS_13520 13378 12773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13520 >Feature sequence20 405 52 gene locus_tag LOCUS_13530 405 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 668 1558 gene locus_tag LOCUS_13540 668 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 2670 1888 gene locus_tag LOCUS_13550 2670 1888 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_13550 2861 3547 gene locus_tag LOCUS_13560 gene gph 2861 3547 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390779.1 protein_id gnl|my_center|LOCUS_13560 3549 4685 gene locus_tag LOCUS_13570 3549 4685 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992208.1 protein_id gnl|my_center|LOCUS_13570 4695 5567 gene locus_tag LOCUS_13580 4695 5567 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970865.1 protein_id gnl|my_center|LOCUS_13580 5564 6406 gene locus_tag LOCUS_13590 5564 6406 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310642.1 protein_id gnl|my_center|LOCUS_13590 6417 7679 gene locus_tag LOCUS_13600 6417 7679 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310644.1 protein_id gnl|my_center|LOCUS_13600 7691 8485 gene locus_tag LOCUS_13610 7691 8485 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086914.1 protein_id gnl|my_center|LOCUS_13610 9249 9001 gene locus_tag LOCUS_13620 9249 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13620 9631 9446 gene locus_tag LOCUS_13630 9631 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 9893 9645 gene locus_tag LOCUS_13640 9893 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13640 9957 10310 gene locus_tag LOCUS_13650 9957 10310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence21 391 1644 gene locus_tag LOCUS_13660 391 1644 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208057.1 protein_id gnl|my_center|LOCUS_13660 1644 3305 gene locus_tag LOCUS_13670 gene pgi 1644 3305 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208058.1 protein_id gnl|my_center|LOCUS_13670 4437 3454 gene locus_tag LOCUS_13680 4437 3454 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808634.1 protein_id gnl|my_center|LOCUS_13680 4931 4434 gene locus_tag LOCUS_13690 4931 4434 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808064.1 protein_id gnl|my_center|LOCUS_13690 6139 4991 gene locus_tag LOCUS_13700 6139 4991 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808865.1 protein_id gnl|my_center|LOCUS_13700 6244 7149 gene locus_tag LOCUS_13710 6244 7149 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929255.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence22 311 580 gene locus_tag LOCUS_13720 311 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 677 931 gene locus_tag LOCUS_13730 677 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1592 975 gene locus_tag LOCUS_13740 1592 975 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184853.1 protein_id gnl|my_center|LOCUS_13740 2638 1625 gene locus_tag LOCUS_13750 2638 1625 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_13750 3362 2730 gene locus_tag LOCUS_13760 3362 2730 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_13760 3807 4379 gene locus_tag LOCUS_13770 3807 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 4556 4480 gene locus_tag LOCUS_t00290 4556 4480 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5200 5439 gene locus_tag LOCUS_13780 5200 5439 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528365.1 protein_id gnl|my_center|LOCUS_13780 5454 6227 gene locus_tag LOCUS_13790 5454 6227 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 protein_id gnl|my_center|LOCUS_13790 6327 7013 gene locus_tag LOCUS_13800 6327 7013 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810191.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence23 2043 280 gene locus_tag LOCUS_13810 gene ggt 2043 280 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_13810 2673 2269 gene locus_tag LOCUS_13820 2673 2269 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811999.1 protein_id gnl|my_center|LOCUS_13820 2737 3228 gene locus_tag LOCUS_13830 2737 3228 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389836.1 protein_id gnl|my_center|LOCUS_13830 3306 4148 gene locus_tag LOCUS_13840 3306 4148 CDS product DUF3025 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527732.1 protein_id gnl|my_center|LOCUS_13840 5079 4252 gene locus_tag LOCUS_13850 5079 4252 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813022.1 protein_id gnl|my_center|LOCUS_13850 5243 5896 gene locus_tag LOCUS_13860 5243 5896 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225722.1 protein_id gnl|my_center|LOCUS_13860 5955 6881 gene locus_tag LOCUS_13870 5955 6881 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705573.1 protein_id gnl|my_center|LOCUS_13870 6899 7783 gene locus_tag LOCUS_13880 gene eamA 6899 7783 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087233.1 protein_id gnl|my_center|LOCUS_13880 8015 8263 gene locus_tag LOCUS_13890 8015 8263 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811953.1 protein_id gnl|my_center|LOCUS_13890 8318 8665 gene locus_tag LOCUS_13900 8318 8665 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815873.1 protein_id gnl|my_center|LOCUS_13900 8704 10080 gene locus_tag LOCUS_13910 8704 10080 CDS product DUF2868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064776.1 protein_id gnl|my_center|LOCUS_13910 10080 11471 gene locus_tag LOCUS_13920 10080 11471 CDS product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064775.1 protein_id gnl|my_center|LOCUS_13920 11853 11623 gene locus_tag LOCUS_13930 11853 11623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 12450 11953 gene locus_tag LOCUS_13940 12450 11953 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 protein_id gnl|my_center|LOCUS_13940 13345 12440 gene locus_tag LOCUS_13950 13345 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 13971 13345 gene locus_tag LOCUS_13960 13971 13345 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036019.1 protein_id gnl|my_center|LOCUS_13960 14347 14979 gene locus_tag LOCUS_13970 14347 14979 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815892.1 protein_id gnl|my_center|LOCUS_13970 15340 17049 gene locus_tag LOCUS_13980 15340 17049 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192163.1 protein_id gnl|my_center|LOCUS_13980 17101 17280 gene locus_tag LOCUS_13990 gene nrdD 17101 17280 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931260.1 protein_id gnl|my_center|LOCUS_13990 17322 17999 gene locus_tag LOCUS_14000 17322 17999 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196980.1 protein_id gnl|my_center|LOCUS_14000 18480 17977 gene locus_tag LOCUS_14010 18480 17977 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193409.1 protein_id gnl|my_center|LOCUS_14010 19406 18501 gene locus_tag LOCUS_14020 19406 18501 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 protein_id gnl|my_center|LOCUS_14020 20411 19425 gene locus_tag LOCUS_14030 20411 19425 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_14030 20689 20916 gene locus_tag LOCUS_14040 20689 20916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 20916 22220 gene locus_tag LOCUS_14050 20916 22220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536312.1 protein_id gnl|my_center|LOCUS_14050 22891 22217 gene locus_tag LOCUS_14060 22891 22217 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191689.1 protein_id gnl|my_center|LOCUS_14060 23061 24662 gene locus_tag LOCUS_14070 23061 24662 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815895.1 protein_id gnl|my_center|LOCUS_14070 24676 25263 gene locus_tag LOCUS_14080 24676 25263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815897.1 protein_id gnl|my_center|LOCUS_14080 25842 25369 gene locus_tag LOCUS_14090 gene bfr 25842 25369 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815898.1 protein_id gnl|my_center|LOCUS_14090 26273 26019 gene locus_tag LOCUS_14100 26273 26019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 27723 26332 gene locus_tag LOCUS_14110 gene rpoN 27723 26332 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853393.1 protein_id gnl|my_center|LOCUS_14110 27738 28301 gene locus_tag LOCUS_14120 27738 28301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064770.1 protein_id gnl|my_center|LOCUS_14120 28573 30285 gene locus_tag LOCUS_14130 gene leuA 28573 30285 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815908.1 protein_id gnl|my_center|LOCUS_14130 30887 30516 gene locus_tag LOCUS_14140 30887 30516 CDS product DUF1840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815933.1 protein_id gnl|my_center|LOCUS_14140 31038 34931 gene locus_tag LOCUS_14150 31038 34931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 35041 37275 gene locus_tag LOCUS_14160 35041 37275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 37627 37370 gene locus_tag LOCUS_14170 37627 37370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 37817 39499 gene locus_tag LOCUS_14180 gene argS 37817 39499 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815935.1 protein_id gnl|my_center|LOCUS_14180 39696 40298 gene locus_tag LOCUS_14190 39696 40298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 40481 41122 gene locus_tag LOCUS_14200 40481 41122 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 protein_id gnl|my_center|LOCUS_14200 42395 41160 gene locus_tag LOCUS_14210 gene metC 42395 41160 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815941.1 protein_id gnl|my_center|LOCUS_14210 42452 43090 gene locus_tag LOCUS_14220 42452 43090 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448965.1 protein_id gnl|my_center|LOCUS_14220 44144 43083 gene locus_tag LOCUS_14230 44144 43083 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815946.1 protein_id gnl|my_center|LOCUS_14230 44225 44611 gene locus_tag LOCUS_14240 44225 44611 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929528.1 protein_id gnl|my_center|LOCUS_14240 44700 45878 gene locus_tag LOCUS_14250 44700 45878 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 protein_id gnl|my_center|LOCUS_14250 45917 47764 gene locus_tag LOCUS_14260 gene aceK 45917 47764 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040776.1 protein_id gnl|my_center|LOCUS_14260 47764 48945 gene locus_tag LOCUS_14270 47764 48945 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818204.1 protein_id gnl|my_center|LOCUS_14270 49074 50681 gene locus_tag LOCUS_14280 49074 50681 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040777.1 protein_id gnl|my_center|LOCUS_14280 50696 52711 gene locus_tag LOCUS_14290 50696 52711 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815954.1 protein_id gnl|my_center|LOCUS_14290 54954 52810 gene locus_tag LOCUS_14300 54954 52810 CDS product TadG family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810187.1 protein_id gnl|my_center|LOCUS_14300 57448 55208 gene locus_tag LOCUS_14310 57448 55208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 57925 57545 gene locus_tag LOCUS_14320 57925 57545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 59998 57953 gene locus_tag LOCUS_14330 59998 57953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 61017 60004 gene locus_tag LOCUS_14340 61017 60004 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810184.1 protein_id gnl|my_center|LOCUS_14340 61962 61033 gene locus_tag LOCUS_14350 61962 61033 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810181.1 protein_id gnl|my_center|LOCUS_14350 63332 61962 gene locus_tag LOCUS_14360 63332 61962 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810179.1 protein_id gnl|my_center|LOCUS_14360 64649 63345 gene locus_tag LOCUS_14370 64649 63345 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930683.1 protein_id gnl|my_center|LOCUS_14370 66083 64686 gene locus_tag LOCUS_14380 66083 64686 CDS product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810175.1 protein_id gnl|my_center|LOCUS_14380 67055 66102 gene locus_tag LOCUS_14390 gene cpaB 67055 66102 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810173.1 protein_id gnl|my_center|LOCUS_14390 67564 67079 gene locus_tag LOCUS_14400 67564 67079 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930680.1 protein_id gnl|my_center|LOCUS_14400 68190 67576 gene locus_tag LOCUS_14410 68190 67576 CDS product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930679.1 protein_id gnl|my_center|LOCUS_14410 68692 68177 gene locus_tag LOCUS_14420 68692 68177 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820213.1 protein_id gnl|my_center|LOCUS_14420 68998 68780 gene locus_tag LOCUS_14430 68998 68780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 69394 70290 gene locus_tag LOCUS_14440 69394 70290 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_14440 70287 72080 gene locus_tag LOCUS_14450 70287 72080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 72479 73201 gene locus_tag LOCUS_14460 72479 73201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 74137 73163 gene locus_tag LOCUS_14470 74137 73163 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_14470 74316 74573 gene locus_tag LOCUS_14480 74316 74573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 74908 75087 gene locus_tag LOCUS_14490 74908 75087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 75327 75620 gene locus_tag LOCUS_14500 75327 75620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 76451 75717 gene locus_tag LOCUS_14510 76451 75717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 76596 77159 gene locus_tag LOCUS_14520 76596 77159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 77213 78064 gene locus_tag LOCUS_14530 77213 78064 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_14530 78095 79069 gene locus_tag LOCUS_14540 78095 79069 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_14540 79086 79865 gene locus_tag LOCUS_14550 79086 79865 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894390.1 protein_id gnl|my_center|LOCUS_14550 81601 80249 gene locus_tag LOCUS_14560 81601 80249 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 protein_id gnl|my_center|LOCUS_14560 83087 81801 gene locus_tag LOCUS_14570 83087 81801 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336769.1 protein_id gnl|my_center|LOCUS_14570 84220 83123 gene locus_tag LOCUS_14580 gene nspC 84220 83123 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973611.1 protein_id gnl|my_center|LOCUS_14580 84579 84241 gene locus_tag LOCUS_14590 84579 84241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 85583 84666 gene locus_tag LOCUS_14600 85583 84666 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036922.1 protein_id gnl|my_center|LOCUS_14600 85706 86692 gene locus_tag LOCUS_14610 85706 86692 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814324.1 protein_id gnl|my_center|LOCUS_14610 86707 88293 gene locus_tag LOCUS_14620 86707 88293 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_14620 88407 89396 gene locus_tag LOCUS_14630 88407 89396 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015041576.1 protein_id gnl|my_center|LOCUS_14630 90034 89456 gene locus_tag LOCUS_14640 90034 89456 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168228.1 protein_id gnl|my_center|LOCUS_14640 90319 90098 gene locus_tag LOCUS_14650 90319 90098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 90443 91123 gene locus_tag LOCUS_14660 90443 91123 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969543.1 protein_id gnl|my_center|LOCUS_14660 91276 91201 gene locus_tag LOCUS_t00300 91276 91201 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 91397 91639 gene locus_tag LOCUS_14670 91397 91639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 91912 91649 gene locus_tag LOCUS_14680 91912 91649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 93187 91997 gene locus_tag LOCUS_14690 93187 91997 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565905.1 protein_id gnl|my_center|LOCUS_14690 93423 93881 gene locus_tag LOCUS_14700 93423 93881 CDS product DUF494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815964.1 protein_id gnl|my_center|LOCUS_14700 93859 94791 gene locus_tag LOCUS_14710 gene gluQRS 93859 94791 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818220.1 protein_id gnl|my_center|LOCUS_14710 97336 94754 gene locus_tag LOCUS_14720 97336 94754 CDS product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815968.1 protein_id gnl|my_center|LOCUS_14720 97481 100183 gene locus_tag LOCUS_14730 97481 100183 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815970.1 protein_id gnl|my_center|LOCUS_14730 100235 101605 gene locus_tag LOCUS_14740 gene hemN 100235 101605 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963301.1 protein_id gnl|my_center|LOCUS_14740 101609 102430 gene locus_tag LOCUS_14750 101609 102430 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812386.1 protein_id gnl|my_center|LOCUS_14750 103071 102490 gene locus_tag LOCUS_14760 103071 102490 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267763.1 protein_id gnl|my_center|LOCUS_14760 103580 103068 gene locus_tag LOCUS_14770 103580 103068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762396.1 protein_id gnl|my_center|LOCUS_14770 104935 103592 gene locus_tag LOCUS_14780 104935 103592 CDS product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538269.1 protein_id gnl|my_center|LOCUS_14780 106507 104942 gene locus_tag LOCUS_14790 106507 104942 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267761.1 protein_id gnl|my_center|LOCUS_14790 107583 106576 gene locus_tag LOCUS_14800 107583 106576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267760.1 protein_id gnl|my_center|LOCUS_14800 108569 107580 gene locus_tag LOCUS_14810 108569 107580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267759.1 protein_id gnl|my_center|LOCUS_14810 109486 108566 gene locus_tag LOCUS_14820 109486 108566 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267758.1 protein_id gnl|my_center|LOCUS_14820 110457 109483 gene locus_tag LOCUS_14830 110457 109483 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267757.1 protein_id gnl|my_center|LOCUS_14830 111950 110454 gene locus_tag LOCUS_14840 111950 110454 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243944.1 protein_id gnl|my_center|LOCUS_14840 113853 112099 gene locus_tag LOCUS_14850 gene ilvB 113853 112099 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815985.1 protein_id gnl|my_center|LOCUS_14850 113986 114813 gene locus_tag LOCUS_14860 gene panB 113986 114813 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087450.1 protein_id gnl|my_center|LOCUS_14860 114806 115339 gene locus_tag LOCUS_14870 114806 115339 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818232.1 protein_id gnl|my_center|LOCUS_14870 115894 115400 gene locus_tag LOCUS_14880 115894 115400 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927248.1 protein_id gnl|my_center|LOCUS_14880 116064 116399 gene locus_tag LOCUS_14890 116064 116399 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301848.1 protein_id gnl|my_center|LOCUS_14890 117915 116461 gene locus_tag LOCUS_14900 117915 116461 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_14900 118880 117915 gene locus_tag LOCUS_14910 gene carH 118880 117915 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229194.1 protein_id gnl|my_center|LOCUS_14910 119177 120484 gene locus_tag LOCUS_14920 119177 120484 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163651105.1 protein_id gnl|my_center|LOCUS_14920 120486 121268 gene locus_tag LOCUS_14930 120486 121268 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 protein_id gnl|my_center|LOCUS_14930 121280 122518 gene locus_tag LOCUS_14940 121280 122518 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971979.1 protein_id gnl|my_center|LOCUS_14940 122522 123100 gene locus_tag LOCUS_14950 122522 123100 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263585.1 protein_id gnl|my_center|LOCUS_14950 123118 124395 gene locus_tag LOCUS_14960 123118 124395 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_14960 124398 124934 gene locus_tag LOCUS_14970 124398 124934 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407549.1 protein_id gnl|my_center|LOCUS_14970 124931 125707 gene locus_tag LOCUS_14980 124931 125707 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_14980 125736 126188 gene locus_tag LOCUS_14990 125736 126188 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383062.1 protein_id gnl|my_center|LOCUS_14990 126974 126207 gene locus_tag LOCUS_15000 126974 126207 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810083.1 protein_id gnl|my_center|LOCUS_15000 127746 126976 gene locus_tag LOCUS_15010 127746 126976 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810082.1 protein_id gnl|my_center|LOCUS_15010 129656 127743 gene locus_tag LOCUS_15020 129656 127743 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930654.1 protein_id gnl|my_center|LOCUS_15020 130880 129663 gene locus_tag LOCUS_15030 130880 129663 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930653.1 protein_id gnl|my_center|LOCUS_15030 131103 131879 gene locus_tag LOCUS_15040 131103 131879 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197182.1 protein_id gnl|my_center|LOCUS_15040 133836 132016 gene locus_tag LOCUS_15050 133836 132016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 133998 136169 gene locus_tag LOCUS_15060 133998 136169 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038670.1 protein_id gnl|my_center|LOCUS_15060 136421 136957 gene locus_tag LOCUS_15070 136421 136957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 136960 137742 gene locus_tag LOCUS_15080 136960 137742 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681823.1 protein_id gnl|my_center|LOCUS_15080 138673 137744 gene locus_tag LOCUS_15090 138673 137744 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225290.1 protein_id gnl|my_center|LOCUS_15090 140120 138735 gene locus_tag LOCUS_15100 gene pntB 140120 138735 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073523.1 protein_id gnl|my_center|LOCUS_15100 141660 140122 gene locus_tag LOCUS_15110 141660 140122 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073522.1 protein_id gnl|my_center|LOCUS_15110 141966 143189 gene locus_tag LOCUS_15120 141966 143189 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207797.1 protein_id gnl|my_center|LOCUS_15120 143272 144261 gene locus_tag LOCUS_15130 143272 144261 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967074.1 protein_id gnl|my_center|LOCUS_15130 144263 145198 gene locus_tag LOCUS_15140 gene dppB 144263 145198 CDS product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245446.1 protein_id gnl|my_center|LOCUS_15140 145195 146133 gene locus_tag LOCUS_15150 gene dppC 145195 146133 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245702.1 protein_id gnl|my_center|LOCUS_15150 146136 147140 gene locus_tag LOCUS_15160 gene dppD 146136 147140 CDS product dipeptide ABC transporter ATP-binding subunit DppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232615.1 protein_id gnl|my_center|LOCUS_15160 147186 148769 gene locus_tag LOCUS_15170 gene dppE 147186 148769 CDS product dipeptide ABC transporter substrate-binding protein DppE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886494.1 protein_id gnl|my_center|LOCUS_15170 148785 149273 gene locus_tag LOCUS_15180 148785 149273 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809464.1 protein_id gnl|my_center|LOCUS_15180 149436 149786 gene locus_tag LOCUS_15190 149436 149786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 150119 149913 gene locus_tag LOCUS_15200 gene copZ 150119 149913 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723406.1 protein_id gnl|my_center|LOCUS_15200 151032 150286 gene locus_tag LOCUS_15210 151032 150286 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693159.1 protein_id gnl|my_center|LOCUS_15210 151605 152612 gene locus_tag LOCUS_15220 151605 152612 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810304.1 protein_id gnl|my_center|LOCUS_15220 152715 153572 gene locus_tag LOCUS_15230 152715 153572 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810306.1 protein_id gnl|my_center|LOCUS_15230 153569 154960 gene locus_tag LOCUS_15240 153569 154960 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810308.1 protein_id gnl|my_center|LOCUS_15240 155862 155101 gene locus_tag LOCUS_15250 155862 155101 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038742.1 protein_id gnl|my_center|LOCUS_15250 156803 155859 gene locus_tag LOCUS_15260 156803 155859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038743.1 protein_id gnl|my_center|LOCUS_15260 156876 157511 gene locus_tag LOCUS_15270 156876 157511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 157528 158385 gene locus_tag LOCUS_15280 157528 158385 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815316.1 protein_id gnl|my_center|LOCUS_15280 159442 158456 gene locus_tag LOCUS_15290 159442 158456 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775988.1 protein_id gnl|my_center|LOCUS_15290 160800 159568 gene locus_tag LOCUS_15300 160800 159568 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814691.1 protein_id gnl|my_center|LOCUS_15300 162211 160829 gene locus_tag LOCUS_15310 162211 160829 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921638.1 protein_id gnl|my_center|LOCUS_15310 163041 162238 gene locus_tag LOCUS_15320 163041 162238 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921513.1 protein_id gnl|my_center|LOCUS_15320 163216 164004 gene locus_tag LOCUS_15330 163216 164004 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730668.1 protein_id gnl|my_center|LOCUS_15330 164074 165042 gene locus_tag LOCUS_15340 164074 165042 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065172.1 protein_id gnl|my_center|LOCUS_15340 165674 167014 gene locus_tag LOCUS_15350 165674 167014 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390060.1 protein_id gnl|my_center|LOCUS_15350 167029 167364 gene locus_tag LOCUS_15360 167029 167364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 167549 168346 gene locus_tag LOCUS_15370 167549 168346 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_15370 168680 168369 gene locus_tag LOCUS_15380 168680 168369 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390365.1 protein_id gnl|my_center|LOCUS_15380 168817 169716 gene locus_tag LOCUS_15390 168817 169716 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_15390 170774 169866 gene locus_tag LOCUS_15400 170774 169866 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929840.1 protein_id gnl|my_center|LOCUS_15400 170897 171439 gene locus_tag LOCUS_15410 170897 171439 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_15410 171462 172031 gene locus_tag LOCUS_15420 171462 172031 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202184.1 protein_id gnl|my_center|LOCUS_15420 172103 172675 gene locus_tag LOCUS_15430 172103 172675 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 protein_id gnl|my_center|LOCUS_15430 172810 173514 gene locus_tag LOCUS_15440 172810 173514 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967553.1 protein_id gnl|my_center|LOCUS_15440 174305 173637 gene locus_tag LOCUS_15450 174305 173637 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815769.1 protein_id gnl|my_center|LOCUS_15450 176316 174442 gene locus_tag LOCUS_15460 gene nadN 176316 174442 CDS product NAD nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868956.1 protein_id gnl|my_center|LOCUS_15460 176585 177382 gene locus_tag LOCUS_15470 gene map 176585 177382 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765650.1 protein_id gnl|my_center|LOCUS_15470 178124 177441 gene locus_tag LOCUS_15480 178124 177441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 178961 178215 gene locus_tag LOCUS_15490 178961 178215 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888988.1 protein_id gnl|my_center|LOCUS_15490 179057 179992 gene locus_tag LOCUS_15500 179057 179992 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944872.1 protein_id gnl|my_center|LOCUS_15500 179989 180771 gene locus_tag LOCUS_15510 179989 180771 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173656.1 protein_id gnl|my_center|LOCUS_15510 180764 181447 gene locus_tag LOCUS_15520 180764 181447 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973817.1 protein_id gnl|my_center|LOCUS_15520 181456 183558 gene locus_tag LOCUS_15530 181456 183558 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973814.1 protein_id gnl|my_center|LOCUS_15530 184504 183602 gene locus_tag LOCUS_15540 184504 183602 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130010930.1 protein_id gnl|my_center|LOCUS_15540 185497 184526 gene locus_tag LOCUS_15550 185497 184526 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 protein_id gnl|my_center|LOCUS_15550 185849 185529 gene locus_tag LOCUS_15560 185849 185529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247553.1 protein_id gnl|my_center|LOCUS_15560 187220 185850 gene locus_tag LOCUS_15570 187220 185850 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063958.1 protein_id gnl|my_center|LOCUS_15570 189029 187509 gene locus_tag LOCUS_15580 gene katA 189029 187509 CDS product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218620.1 protein_id gnl|my_center|LOCUS_15580 189627 190049 gene locus_tag LOCUS_15590 189627 190049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 190516 190097 gene locus_tag LOCUS_15600 190516 190097 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811562.1 protein_id gnl|my_center|LOCUS_15600 190708 191874 gene locus_tag LOCUS_15610 190708 191874 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809108.1 protein_id gnl|my_center|LOCUS_15610 191922 192905 gene locus_tag LOCUS_15620 191922 192905 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063889.1 protein_id gnl|my_center|LOCUS_15620 192920 193705 gene locus_tag LOCUS_15630 192920 193705 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809109.1 protein_id gnl|my_center|LOCUS_15630 193831 194760 gene locus_tag LOCUS_15640 193831 194760 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809112.1 protein_id gnl|my_center|LOCUS_15640 194879 195052 gene locus_tag LOCUS_15650 194879 195052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 195956 195351 gene locus_tag LOCUS_15660 195956 195351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 198555 196162 gene locus_tag LOCUS_15670 gene gyrB 198555 196162 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816022.1 protein_id gnl|my_center|LOCUS_15670 199813 198704 gene locus_tag LOCUS_15680 gene dnaN 199813 198704 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929839.1 protein_id gnl|my_center|LOCUS_15680 201282 199816 gene locus_tag LOCUS_15690 gene dnaA 201282 199816 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040794.1 protein_id gnl|my_center|LOCUS_15690 201810 202181 gene locus_tag LOCUS_15700 201810 202181 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816026.1 protein_id gnl|my_center|LOCUS_15700 202516 204183 gene locus_tag LOCUS_15710 gene yidC 202516 204183 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927254.1 protein_id gnl|my_center|LOCUS_15710 204391 205926 gene locus_tag LOCUS_15720 204391 205926 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265659.1 protein_id gnl|my_center|LOCUS_15720 206120 206338 gene locus_tag LOCUS_15730 206120 206338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 206335 206562 gene locus_tag LOCUS_15740 206335 206562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 207609 206629 gene locus_tag LOCUS_15750 207609 206629 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931174.1 protein_id gnl|my_center|LOCUS_15750 208781 207636 gene locus_tag LOCUS_15760 208781 207636 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225693.1 protein_id gnl|my_center|LOCUS_15760 210947 208818 gene locus_tag LOCUS_15770 210947 208818 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225692.1 protein_id gnl|my_center|LOCUS_15770 212308 210968 gene locus_tag LOCUS_15780 212308 210968 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525150.1 protein_id gnl|my_center|LOCUS_15780 212663 213151 gene locus_tag LOCUS_15790 212663 213151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 215652 213535 gene locus_tag LOCUS_15800 215652 213535 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112541.1 protein_id gnl|my_center|LOCUS_15800 216999 215818 gene locus_tag LOCUS_15810 216999 215818 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775996.1 protein_id gnl|my_center|LOCUS_15810 218010 217147 gene locus_tag LOCUS_15820 218010 217147 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815505.1 protein_id gnl|my_center|LOCUS_15820 218711 218022 gene locus_tag LOCUS_15830 218711 218022 CDS product fumarate hydratase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339079.1 protein_id gnl|my_center|LOCUS_15830 219640 218699 gene locus_tag LOCUS_15840 219640 218699 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339080.1 protein_id gnl|my_center|LOCUS_15840 221407 219671 gene locus_tag LOCUS_15850 221407 219671 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339081.1 protein_id gnl|my_center|LOCUS_15850 221766 221404 gene locus_tag LOCUS_15860 221766 221404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 222098 221766 gene locus_tag LOCUS_15870 222098 221766 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723680.1 protein_id gnl|my_center|LOCUS_15870 222814 222101 gene locus_tag LOCUS_15880 222814 222101 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723682.1 protein_id gnl|my_center|LOCUS_15880 223855 222857 gene locus_tag LOCUS_15890 223855 222857 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930318.1 protein_id gnl|my_center|LOCUS_15890 224037 224960 gene locus_tag LOCUS_15900 224037 224960 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811986.1 protein_id gnl|my_center|LOCUS_15900 227428 225053 gene locus_tag LOCUS_15910 227428 225053 CDS product cytochrome P450/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187052.1 protein_id gnl|my_center|LOCUS_15910 228471 227488 gene locus_tag LOCUS_15920 228471 227488 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807281.1 protein_id gnl|my_center|LOCUS_15920 228637 229452 gene locus_tag LOCUS_15930 228637 229452 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111362.1 protein_id gnl|my_center|LOCUS_15930 229831 229334 gene locus_tag LOCUS_15940 229831 229334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 231246 229837 gene locus_tag LOCUS_15950 gene mnmE 231246 229837 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816053.1 protein_id gnl|my_center|LOCUS_15950 231362 232051 gene locus_tag LOCUS_15960 231362 232051 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816057.1 protein_id gnl|my_center|LOCUS_15960 232104 233459 gene locus_tag LOCUS_15970 232104 233459 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929564.1 protein_id gnl|my_center|LOCUS_15970 233540 234535 gene locus_tag LOCUS_15980 233540 234535 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816062.1 protein_id gnl|my_center|LOCUS_15980 234604 235047 gene locus_tag LOCUS_15990 234604 235047 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816064.1 protein_id gnl|my_center|LOCUS_15990 235044 236570 gene locus_tag LOCUS_16000 235044 236570 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816065.1 protein_id gnl|my_center|LOCUS_16000 236577 237632 gene locus_tag LOCUS_16010 236577 237632 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208458.1 protein_id gnl|my_center|LOCUS_16010 238117 237689 gene locus_tag LOCUS_16020 238117 237689 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069390.1 protein_id gnl|my_center|LOCUS_16020 239853 238687 gene locus_tag LOCUS_16030 239853 238687 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906142.1 protein_id gnl|my_center|LOCUS_16030 240102 242087 gene locus_tag LOCUS_16040 gene mnmG 240102 242087 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818282.1 protein_id gnl|my_center|LOCUS_16040 242096 242749 gene locus_tag LOCUS_16050 gene rsmG 242096 242749 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818284.1 protein_id gnl|my_center|LOCUS_16050 242753 243571 gene locus_tag LOCUS_16060 242753 243571 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806879.1 protein_id gnl|my_center|LOCUS_16060 243561 244544 gene locus_tag LOCUS_16070 243561 244544 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806881.1 protein_id gnl|my_center|LOCUS_16070 244650 244735 gene locus_tag LOCUS_t00310 244650 244735 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 244823 244896 gene locus_tag LOCUS_t00320 244823 244896 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 244934 245008 gene locus_tag LOCUS_t00330 244934 245008 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 245054 246244 gene locus_tag LOCUS_16080 gene tuf 245054 246244 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806883.1 protein_id gnl|my_center|LOCUS_16080 246318 246393 gene locus_tag LOCUS_t00340 246318 246393 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 246434 246814 gene locus_tag LOCUS_16090 gene secE 246434 246814 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806884.1 protein_id gnl|my_center|LOCUS_16090 246825 247358 gene locus_tag LOCUS_16100 gene nusG 246825 247358 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806885.1 protein_id gnl|my_center|LOCUS_16100 247416 247850 gene locus_tag LOCUS_16110 gene rplK 247416 247850 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806886.1 protein_id gnl|my_center|LOCUS_16110 247850 248545 gene locus_tag LOCUS_16120 gene rplA 247850 248545 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806887.1 protein_id gnl|my_center|LOCUS_16120 248775 249299 gene locus_tag LOCUS_16130 gene rplJ 248775 249299 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_16130 249380 249760 gene locus_tag LOCUS_16140 gene rplL 249380 249760 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_16140 249943 254058 gene locus_tag LOCUS_16150 gene rpoB 249943 254058 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929573.1 protein_id gnl|my_center|LOCUS_16150 254055 258311 gene locus_tag LOCUS_16160 gene rpoC 254055 258311 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818292.1 protein_id gnl|my_center|LOCUS_16160 258445 259686 gene locus_tag LOCUS_16170 gene serA 258445 259686 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693698.1 protein_id gnl|my_center|LOCUS_16170 259756 260724 gene locus_tag LOCUS_16180 259756 260724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 261853 260726 gene locus_tag LOCUS_16190 261853 260726 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097429.1 protein_id gnl|my_center|LOCUS_16190 261964 262533 gene locus_tag LOCUS_16200 261964 262533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 262822 263778 gene locus_tag LOCUS_16210 262822 263778 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533410.1 protein_id gnl|my_center|LOCUS_16210 264689 263850 gene locus_tag LOCUS_16220 264689 263850 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206906.1 protein_id gnl|my_center|LOCUS_16220 265254 264862 gene locus_tag LOCUS_16230 265254 264862 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084059.1 protein_id gnl|my_center|LOCUS_16230 266131 265289 gene locus_tag LOCUS_16240 266131 265289 CDS product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_16240 266514 266119 gene locus_tag LOCUS_16250 266514 266119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 267276 266518 gene locus_tag LOCUS_16260 gene garL 267276 266518 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057715.1 protein_id gnl|my_center|LOCUS_16260 268172 267315 gene locus_tag LOCUS_16270 268172 267315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338976.1 protein_id gnl|my_center|LOCUS_16270 269184 268210 gene locus_tag LOCUS_16280 269184 268210 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930207.1 protein_id gnl|my_center|LOCUS_16280 270453 269227 gene locus_tag LOCUS_16290 270453 269227 CDS product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 protein_id gnl|my_center|LOCUS_16290 271507 270722 gene locus_tag LOCUS_16300 271507 270722 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551489.1 protein_id gnl|my_center|LOCUS_16300 271585 271749 gene locus_tag LOCUS_16310 271585 271749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 271685 273139 gene locus_tag LOCUS_16320 gene gabD 271685 273139 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971372.1 protein_id gnl|my_center|LOCUS_16320 273350 274516 gene locus_tag LOCUS_16330 gene kch 273350 274516 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931563.1 protein_id gnl|my_center|LOCUS_16330 274965 274543 gene locus_tag LOCUS_16340 274965 274543 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001056.1 protein_id gnl|my_center|LOCUS_16340 275106 276200 gene locus_tag LOCUS_16350 275106 276200 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680822.1 protein_id gnl|my_center|LOCUS_16350 277449 276223 gene locus_tag LOCUS_16360 277449 276223 CDS product phenylpropionate dioxygenase ferredoxin reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660778.1 protein_id gnl|my_center|LOCUS_16360 278408 277470 gene locus_tag LOCUS_16370 gene mhpB 278408 277470 CDS product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543457.1 protein_id gnl|my_center|LOCUS_16370 279288 278476 gene locus_tag LOCUS_16380 gene hcaB 279288 278476 CDS product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281389.1 protein_id gnl|my_center|LOCUS_16380 279608 279285 gene locus_tag LOCUS_16390 279608 279285 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080101.1 protein_id gnl|my_center|LOCUS_16390 280144 279611 gene locus_tag LOCUS_16400 280144 279611 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276072.1 protein_id gnl|my_center|LOCUS_16400 281517 280144 gene locus_tag LOCUS_16410 281517 280144 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211170.1 protein_id gnl|my_center|LOCUS_16410 281655 282554 gene locus_tag LOCUS_16420 gene hcaR 281655 282554 CDS product DNA-binding transcriptional regulator HcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423252.1 protein_id gnl|my_center|LOCUS_16420 282676 283593 gene locus_tag LOCUS_16430 282676 283593 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730147.1 protein_id gnl|my_center|LOCUS_16430 283609 284397 gene locus_tag LOCUS_16440 gene mhpD 283609 284397 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160723.1 protein_id gnl|my_center|LOCUS_16440 284423 285322 gene locus_tag LOCUS_16450 284423 285322 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878495.1 protein_id gnl|my_center|LOCUS_16450 285340 286362 gene locus_tag LOCUS_16460 gene dmpG 285340 286362 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013510.1 protein_id gnl|my_center|LOCUS_16460 287454 286702 gene locus_tag LOCUS_16470 287454 286702 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969871.1 protein_id gnl|my_center|LOCUS_16470 288393 287467 gene locus_tag LOCUS_16480 288393 287467 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195013.1 protein_id gnl|my_center|LOCUS_16480 289350 288421 gene locus_tag LOCUS_16490 289350 288421 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533048.1 protein_id gnl|my_center|LOCUS_16490 290570 289362 gene locus_tag LOCUS_16500 290570 289362 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040237.1 protein_id gnl|my_center|LOCUS_16500 290749 291390 gene locus_tag LOCUS_16510 290749 291390 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114140.1 protein_id gnl|my_center|LOCUS_16510 292157 291387 gene locus_tag LOCUS_16520 292157 291387 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533049.1 protein_id gnl|my_center|LOCUS_16520 292301 293236 gene locus_tag LOCUS_16530 gene rocF 292301 293236 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808362.1 protein_id gnl|my_center|LOCUS_16530 293249 293689 gene locus_tag LOCUS_16540 293249 293689 CDS product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929783.1 protein_id gnl|my_center|LOCUS_16540 293692 294312 gene locus_tag LOCUS_16550 293692 294312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 294930 294361 gene locus_tag LOCUS_16560 294930 294361 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220466.1 protein_id gnl|my_center|LOCUS_16560 295111 296007 gene locus_tag LOCUS_16570 295111 296007 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097200.1 protein_id gnl|my_center|LOCUS_16570 296741 296091 gene locus_tag LOCUS_16580 gene dsbM 296741 296091 CDS product disulfide reductase DsbM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114663.1 protein_id gnl|my_center|LOCUS_16580 296942 297535 gene locus_tag LOCUS_16590 296942 297535 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840622.1 protein_id gnl|my_center|LOCUS_16590 297582 298958 gene locus_tag LOCUS_16600 297582 298958 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105011.1 protein_id gnl|my_center|LOCUS_16600 298964 299194 gene locus_tag LOCUS_16610 298964 299194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 299260 299925 gene locus_tag LOCUS_16620 299260 299925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 300169 300459 gene locus_tag LOCUS_16630 300169 300459 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391284.1 protein_id gnl|my_center|LOCUS_16630 300471 300797 gene locus_tag LOCUS_16640 300471 300797 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312649.1 protein_id gnl|my_center|LOCUS_16640 301810 301154 gene locus_tag LOCUS_16650 301810 301154 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385122.1 protein_id gnl|my_center|LOCUS_16650 303629 302280 gene locus_tag LOCUS_16660 303629 302280 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811151.1 protein_id gnl|my_center|LOCUS_16660 304908 303748 gene locus_tag LOCUS_16670 304908 303748 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807998.1 protein_id gnl|my_center|LOCUS_16670 305043 305987 gene locus_tag LOCUS_16680 305043 305987 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811152.1 protein_id gnl|my_center|LOCUS_16680 306106 306945 gene locus_tag LOCUS_16690 306106 306945 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064993.1 protein_id gnl|my_center|LOCUS_16690 306972 308156 gene locus_tag LOCUS_16700 306972 308156 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083368598.1 protein_id gnl|my_center|LOCUS_16700 308156 308977 gene locus_tag LOCUS_16710 308156 308977 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064995.1 protein_id gnl|my_center|LOCUS_16710 311267 308940 gene locus_tag LOCUS_16720 311267 308940 CDS product CHASE2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925685.1 protein_id gnl|my_center|LOCUS_16720 312385 311285 gene locus_tag LOCUS_16730 312385 311285 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806895.1 protein_id gnl|my_center|LOCUS_16730 313127 312402 gene locus_tag LOCUS_16740 313127 312402 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806896.1 protein_id gnl|my_center|LOCUS_16740 313728 314105 gene locus_tag LOCUS_16750 gene rpsL 313728 314105 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005017264.1 protein_id gnl|my_center|LOCUS_16750 314260 314730 gene locus_tag LOCUS_16760 gene rpsG 314260 314730 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806901.1 protein_id gnl|my_center|LOCUS_16760 314746 316851 gene locus_tag LOCUS_16770 gene fusA 314746 316851 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806902.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence24 373 1914 gene locus_tag LOCUS_r00010 373 1914 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2035 2111 gene locus_tag LOCUS_t00350 2035 2111 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2124 2199 gene locus_tag LOCUS_t00360 2124 2199 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2645 5515 gene locus_tag LOCUS_r00020 2645 5515 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5711 5818 gene locus_tag LOCUS_r00030 5711 5818 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence25 686 1003 gene locus_tag LOCUS_16780 686 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1039 1224 gene locus_tag LOCUS_16790 1039 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16790 1199 1369 gene locus_tag LOCUS_16800 1199 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1366 1560 gene locus_tag LOCUS_16810 1366 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1658 1942 gene locus_tag LOCUS_16820 1658 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 3165 2098 gene locus_tag LOCUS_16830 3165 2098 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400551.1 protein_id gnl|my_center|LOCUS_16830 3371 3162 gene locus_tag LOCUS_16840 3371 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 3413 3733 gene locus_tag LOCUS_16850 3413 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 4272 3970 gene locus_tag LOCUS_16860 4272 3970 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057517.1 protein_id gnl|my_center|LOCUS_16860 4581 4276 gene locus_tag LOCUS_16870 4581 4276 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_16870 4675 4818 gene locus_tag LOCUS_16880 4675 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence26 216 524 gene locus_tag LOCUS_16890 216 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 859 1137 gene locus_tag LOCUS_16900 859 1137 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_16900 1150 1482 gene locus_tag LOCUS_16910 1150 1482 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence27 <1 575 gene locus_tag LOCUS_16920 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024698054.1:IS66 family transposase >Feature sequence28 >Feature sequence29 501 130 gene locus_tag LOCUS_16930 501 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 822 550 gene locus_tag LOCUS_16940 822 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence30 >Feature sequence31 793 110 gene locus_tag LOCUS_16950 793 110 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694191.1 protein_id gnl|my_center|LOCUS_16950 1380 910 gene locus_tag LOCUS_16960 1380 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1724 2758 gene locus_tag LOCUS_16970 gene galE 1724 2758 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261055.1 protein_id gnl|my_center|LOCUS_16970 2993 2823 gene locus_tag LOCUS_16980 2993 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 2940 3659 gene locus_tag LOCUS_16990 2940 3659 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931406.1 protein_id gnl|my_center|LOCUS_16990 4636 3737 gene locus_tag LOCUS_17000 4636 3737 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815680.1 protein_id gnl|my_center|LOCUS_17000 5483 4746 gene locus_tag LOCUS_17010 5483 4746 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807859.1 protein_id gnl|my_center|LOCUS_17010 7609 5504 gene locus_tag LOCUS_17020 7609 5504 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665581.1 protein_id gnl|my_center|LOCUS_17020 8354 7632 gene locus_tag LOCUS_17030 8354 7632 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249391.1 protein_id gnl|my_center|LOCUS_17030 8947 8369 gene locus_tag LOCUS_17040 8947 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040628.1 protein_id gnl|my_center|LOCUS_17040 10109 8949 gene locus_tag LOCUS_17050 10109 8949 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815298.1 protein_id gnl|my_center|LOCUS_17050 10217 10999 gene locus_tag LOCUS_17060 10217 10999 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931406.1 protein_id gnl|my_center|LOCUS_17060 11206 12588 gene locus_tag LOCUS_17070 11206 12588 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_17070 12687 14288 gene locus_tag LOCUS_17080 12687 14288 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388557.1 protein_id gnl|my_center|LOCUS_17080 14320 15369 gene locus_tag LOCUS_17090 14320 15369 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973844.1 protein_id gnl|my_center|LOCUS_17090 15366 16253 gene locus_tag LOCUS_17100 15366 16253 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389672.1 protein_id gnl|my_center|LOCUS_17100 16257 17096 gene locus_tag LOCUS_17110 16257 17096 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008282.1 protein_id gnl|my_center|LOCUS_17110 17093 17854 gene locus_tag LOCUS_17120 17093 17854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338502.1 protein_id gnl|my_center|LOCUS_17120 18055 19038 gene locus_tag LOCUS_17130 18055 19038 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 protein_id gnl|my_center|LOCUS_17130 19117 19893 gene locus_tag LOCUS_17140 19117 19893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17140 19821 20102 gene locus_tag LOCUS_17150 19821 20102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17150 20103 20918 gene locus_tag LOCUS_17160 20103 20918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 21981 21016 gene locus_tag LOCUS_17170 21981 21016 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927543.1 protein_id gnl|my_center|LOCUS_17170 23189 22035 gene locus_tag LOCUS_17180 23189 22035 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_17180 23500 23213 gene locus_tag LOCUS_17190 23500 23213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 24337 23534 gene locus_tag LOCUS_17200 24337 23534 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977985.1 protein_id gnl|my_center|LOCUS_17200 25098 24352 gene locus_tag LOCUS_17210 gene fabG 25098 24352 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546317.1 protein_id gnl|my_center|LOCUS_17210 26327 25122 gene locus_tag LOCUS_17220 26327 25122 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038912.1 protein_id gnl|my_center|LOCUS_17220 27532 26363 gene locus_tag LOCUS_17230 27532 26363 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061151682.1 protein_id gnl|my_center|LOCUS_17230 28657 27797 gene locus_tag LOCUS_17240 28657 27797 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064596.1 protein_id gnl|my_center|LOCUS_17240 29418 28666 gene locus_tag LOCUS_17250 29418 28666 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227935.1 protein_id gnl|my_center|LOCUS_17250 30163 29408 gene locus_tag LOCUS_17260 30163 29408 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_17260 31041 30166 gene locus_tag LOCUS_17270 31041 30166 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674209.1 protein_id gnl|my_center|LOCUS_17270 31907 31038 gene locus_tag LOCUS_17280 31907 31038 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728922.1 protein_id gnl|my_center|LOCUS_17280 33165 32041 gene locus_tag LOCUS_17290 33165 32041 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_17290 33880 33209 gene locus_tag LOCUS_17300 33880 33209 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705262.1 protein_id gnl|my_center|LOCUS_17300 34571 33891 gene locus_tag LOCUS_17310 34571 33891 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 protein_id gnl|my_center|LOCUS_17310 35185 34721 gene locus_tag LOCUS_17320 35185 34721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 36324 35200 gene locus_tag LOCUS_17330 36324 35200 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523159.1 protein_id gnl|my_center|LOCUS_17330 37268 36384 gene locus_tag LOCUS_17340 37268 36384 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727064.1 protein_id gnl|my_center|LOCUS_17340 37581 37303 gene locus_tag LOCUS_17350 gene catC 37581 37303 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807674.1 protein_id gnl|my_center|LOCUS_17350 37765 38811 gene locus_tag LOCUS_17360 37765 38811 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853200.1 protein_id gnl|my_center|LOCUS_17360 39620 38850 gene locus_tag LOCUS_17370 39620 38850 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_17370 40313 39768 gene locus_tag LOCUS_17380 40313 39768 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930988.1 protein_id gnl|my_center|LOCUS_17380 41058 40555 gene locus_tag LOCUS_17390 41058 40555 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087757.1 protein_id gnl|my_center|LOCUS_17390 41279 41494 gene locus_tag LOCUS_17400 41279 41494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 41775 41548 gene locus_tag LOCUS_17410 41775 41548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 42509 42021 gene locus_tag LOCUS_17420 gene ybaK 42509 42021 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189587.1 protein_id gnl|my_center|LOCUS_17420 43407 42514 gene locus_tag LOCUS_17430 gene xerD 43407 42514 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809554.1 protein_id gnl|my_center|LOCUS_17430 43546 44451 gene locus_tag LOCUS_17440 43546 44451 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814325.1 protein_id gnl|my_center|LOCUS_17440 44854 45228 gene locus_tag LOCUS_17450 44854 45228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 45195 46529 gene locus_tag LOCUS_17460 45195 46529 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_17460 46659 48578 gene locus_tag LOCUS_17470 gene mutL 46659 48578 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039151.1 protein_id gnl|my_center|LOCUS_17470 48718 49692 gene locus_tag LOCUS_17480 gene miaA 48718 49692 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065014.1 protein_id gnl|my_center|LOCUS_17480 50780 49731 gene locus_tag LOCUS_17490 gene purM 50780 49731 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065013.1 protein_id gnl|my_center|LOCUS_17490 50842 51909 gene locus_tag LOCUS_17500 50842 51909 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_17500 51902 52579 gene locus_tag LOCUS_17510 gene hda 51902 52579 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065012.1 protein_id gnl|my_center|LOCUS_17510 52576 53259 gene locus_tag LOCUS_17520 52576 53259 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820913.1 protein_id gnl|my_center|LOCUS_17520 53285 54673 gene locus_tag LOCUS_17530 gene pcnB 53285 54673 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929702.1 protein_id gnl|my_center|LOCUS_17530 54670 55140 gene locus_tag LOCUS_17540 54670 55140 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814348.1 protein_id gnl|my_center|LOCUS_17540 56808 55279 gene locus_tag LOCUS_17550 56808 55279 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064992.1 protein_id gnl|my_center|LOCUS_17550 57624 56857 gene locus_tag LOCUS_17560 57624 56857 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064991.1 protein_id gnl|my_center|LOCUS_17560 57754 58653 gene locus_tag LOCUS_17570 gene glyQ 57754 58653 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929585.1 protein_id gnl|my_center|LOCUS_17570 58654 60780 gene locus_tag LOCUS_17580 gene glyS 58654 60780 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064983.1 protein_id gnl|my_center|LOCUS_17580 60777 61316 gene locus_tag LOCUS_17590 gene gmhB 60777 61316 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814404.1 protein_id gnl|my_center|LOCUS_17590 61319 62050 gene locus_tag LOCUS_17600 61319 62050 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064981.1 protein_id gnl|my_center|LOCUS_17600 62066 62767 gene locus_tag LOCUS_17610 62066 62767 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064980.1 protein_id gnl|my_center|LOCUS_17610 62928 63347 gene locus_tag LOCUS_17620 gene gloA 62928 63347 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705221.1 protein_id gnl|my_center|LOCUS_17620 63385 64905 gene locus_tag LOCUS_17630 63385 64905 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705246.1 protein_id gnl|my_center|LOCUS_17630 65800 65135 gene locus_tag LOCUS_17640 65800 65135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 66284 65877 gene locus_tag LOCUS_17650 66284 65877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 66779 68218 gene locus_tag LOCUS_17660 gene pyk 66779 68218 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814419.1 protein_id gnl|my_center|LOCUS_17660 68231 69394 gene locus_tag LOCUS_17670 68231 69394 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931414.1 protein_id gnl|my_center|LOCUS_17670 70277 69492 gene locus_tag LOCUS_17680 gene rsmA 70277 69492 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814423.1 protein_id gnl|my_center|LOCUS_17680 71768 70281 gene locus_tag LOCUS_17690 71768 70281 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039136.1 protein_id gnl|my_center|LOCUS_17690 74158 71768 gene locus_tag LOCUS_17700 74158 71768 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814429.1 protein_id gnl|my_center|LOCUS_17700 74457 75509 gene locus_tag LOCUS_17710 74457 75509 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064974.1 protein_id gnl|my_center|LOCUS_17710 75506 76234 gene locus_tag LOCUS_17720 75506 76234 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931409.1 protein_id gnl|my_center|LOCUS_17720 76274 76978 gene locus_tag LOCUS_17730 76274 76978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064973.1 protein_id gnl|my_center|LOCUS_17730 77147 77854 gene locus_tag LOCUS_17740 77147 77854 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814239.1 protein_id gnl|my_center|LOCUS_17740 77851 79254 gene locus_tag LOCUS_17750 77851 79254 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039169.1 protein_id gnl|my_center|LOCUS_17750 80273 79251 gene locus_tag LOCUS_17760 80273 79251 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931360.1 protein_id gnl|my_center|LOCUS_17760 81421 80270 gene locus_tag LOCUS_17770 81421 80270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 81531 83282 gene locus_tag LOCUS_17780 81531 83282 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820957.1 protein_id gnl|my_center|LOCUS_17780 83273 84079 gene locus_tag LOCUS_17790 gene minC 83273 84079 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814248.1 protein_id gnl|my_center|LOCUS_17790 84168 84983 gene locus_tag LOCUS_17800 gene minD 84168 84983 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814250.1 protein_id gnl|my_center|LOCUS_17800 84985 85260 gene locus_tag LOCUS_17810 gene minE 84985 85260 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814252.1 protein_id gnl|my_center|LOCUS_17810 86210 85425 gene locus_tag LOCUS_17820 gene bamE 86210 85425 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184872.1 protein_id gnl|my_center|LOCUS_17820 95745 86299 gene locus_tag LOCUS_17830 95745 86299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 96519 96307 gene locus_tag LOCUS_17840 gene osmB 96519 96307 CDS product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100683974.1 protein_id gnl|my_center|LOCUS_17840 98346 96673 gene locus_tag LOCUS_17850 gene ettA 98346 96673 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814257.1 protein_id gnl|my_center|LOCUS_17850 98497 98973 gene locus_tag LOCUS_17860 98497 98973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039167.1 protein_id gnl|my_center|LOCUS_17860 99899 98970 gene locus_tag LOCUS_17870 99899 98970 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814275.1 protein_id gnl|my_center|LOCUS_17870 100245 100117 gene locus_tag LOCUS_17880 100245 100117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018026767.1 protein_id gnl|my_center|LOCUS_17880 101564 100473 gene locus_tag LOCUS_17890 gene pdxA 101564 100473 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813085.1 protein_id gnl|my_center|LOCUS_17890 101811 107489 gene locus_tag LOCUS_17900 gene uvrA 101811 107489 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814283.1 protein_id gnl|my_center|LOCUS_17900 108678 107794 gene locus_tag LOCUS_17910 108678 107794 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929152.1 protein_id gnl|my_center|LOCUS_17910 108769 109395 gene locus_tag LOCUS_17920 108769 109395 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814300.1 protein_id gnl|my_center|LOCUS_17920 109451 110083 gene locus_tag LOCUS_17930 gene pdxH 109451 110083 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814302.1 protein_id gnl|my_center|LOCUS_17930 110119 110640 gene locus_tag LOCUS_17940 110119 110640 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814305.1 protein_id gnl|my_center|LOCUS_17940 110637 111761 gene locus_tag LOCUS_17950 110637 111761 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 protein_id gnl|my_center|LOCUS_17950 111763 112614 gene locus_tag LOCUS_17960 gene purU 111763 112614 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814312.1 protein_id gnl|my_center|LOCUS_17960 113520 112621 gene locus_tag LOCUS_17970 113520 112621 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809552.1 protein_id gnl|my_center|LOCUS_17970 113664 114857 gene locus_tag LOCUS_17980 113664 114857 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930413.1 protein_id gnl|my_center|LOCUS_17980 115508 115053 gene locus_tag LOCUS_17990 115508 115053 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930412.1 protein_id gnl|my_center|LOCUS_17990 116456 115890 gene locus_tag LOCUS_18000 116456 115890 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418984.1 protein_id gnl|my_center|LOCUS_18000 118134 116479 gene locus_tag LOCUS_18010 118134 116479 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_18010 118816 118157 gene locus_tag LOCUS_18020 118816 118157 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_18020 119758 118835 gene locus_tag LOCUS_18030 119758 118835 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821371.1 protein_id gnl|my_center|LOCUS_18030 119878 121086 gene locus_tag LOCUS_18040 119878 121086 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821372.1 protein_id gnl|my_center|LOCUS_18040 121103 122596 gene locus_tag LOCUS_18050 121103 122596 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065110.1 protein_id gnl|my_center|LOCUS_18050 123666 122683 gene locus_tag LOCUS_18060 123666 122683 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807825.1 protein_id gnl|my_center|LOCUS_18060 124644 123694 gene locus_tag LOCUS_18070 124644 123694 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807822.1 protein_id gnl|my_center|LOCUS_18070 125835 124645 gene locus_tag LOCUS_18080 125835 124645 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267114.1 protein_id gnl|my_center|LOCUS_18080 126862 125930 gene locus_tag LOCUS_18090 126862 125930 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064606.1 protein_id gnl|my_center|LOCUS_18090 127467 126865 gene locus_tag LOCUS_18100 127467 126865 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090616.1 protein_id gnl|my_center|LOCUS_18100 128799 127747 gene locus_tag LOCUS_18110 128799 127747 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 protein_id gnl|my_center|LOCUS_18110 129946 129146 gene locus_tag LOCUS_18120 gene bamE 129946 129146 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184872.1 protein_id gnl|my_center|LOCUS_18120 130630 130214 gene locus_tag LOCUS_18130 130630 130214 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172297.1 protein_id gnl|my_center|LOCUS_18130 131091 130627 gene locus_tag LOCUS_18140 gene queD 131091 130627 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040017.1 protein_id gnl|my_center|LOCUS_18140 131804 131091 gene locus_tag LOCUS_18150 gene queC 131804 131091 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190026.1 protein_id gnl|my_center|LOCUS_18150 132436 131804 gene locus_tag LOCUS_18160 gene queE 132436 131804 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810901.1 protein_id gnl|my_center|LOCUS_18160 132638 133732 gene locus_tag LOCUS_18170 132638 133732 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113628.1 protein_id gnl|my_center|LOCUS_18170 133822 134172 gene locus_tag LOCUS_18180 133822 134172 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_18180 134192 135040 gene locus_tag LOCUS_18190 134192 135040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 136005 135067 gene locus_tag LOCUS_18200 136005 135067 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813179.1 protein_id gnl|my_center|LOCUS_18200 137218 136031 gene locus_tag LOCUS_18210 137218 136031 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816039.1 protein_id gnl|my_center|LOCUS_18210 138295 137273 gene locus_tag LOCUS_18220 138295 137273 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853543.1 protein_id gnl|my_center|LOCUS_18220 139480 138296 gene locus_tag LOCUS_18230 139480 138296 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809527.1 protein_id gnl|my_center|LOCUS_18230 140014 139511 gene locus_tag LOCUS_18240 gene purE 140014 139511 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247930.1 protein_id gnl|my_center|LOCUS_18240 140909 140028 gene locus_tag LOCUS_18250 140909 140028 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 protein_id gnl|my_center|LOCUS_18250 142137 141073 gene locus_tag LOCUS_18260 gene fba 142137 141073 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064288.1 protein_id gnl|my_center|LOCUS_18260 142448 142798 gene locus_tag LOCUS_18270 142448 142798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 142897 144444 gene locus_tag LOCUS_18280 142897 144444 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073167.1 protein_id gnl|my_center|LOCUS_18280 144456 145604 gene locus_tag LOCUS_18290 gene cydB 144456 145604 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 protein_id gnl|my_center|LOCUS_18290 146728 145910 gene locus_tag LOCUS_18300 146728 145910 CDS product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704731.1 protein_id gnl|my_center|LOCUS_18300 147012 147893 gene locus_tag LOCUS_18310 147012 147893 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065121.1 protein_id gnl|my_center|LOCUS_18310 150187 147959 gene locus_tag LOCUS_18320 150187 147959 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038744040.1 protein_id gnl|my_center|LOCUS_18320 156052 150191 gene locus_tag LOCUS_18330 156052 150191 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266335.1 protein_id gnl|my_center|LOCUS_18330 157369 156170 gene locus_tag LOCUS_18340 157369 156170 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930133.1 protein_id gnl|my_center|LOCUS_18340 158467 157457 gene locus_tag LOCUS_18350 gene gap 158467 157457 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809444.1 protein_id gnl|my_center|LOCUS_18350 160538 158484 gene locus_tag LOCUS_18360 gene tkt 160538 158484 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809443.1 protein_id gnl|my_center|LOCUS_18360 160736 161473 gene locus_tag LOCUS_18370 160736 161473 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930130.1 protein_id gnl|my_center|LOCUS_18370 162002 161529 gene locus_tag LOCUS_18380 162002 161529 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809441.1 protein_id gnl|my_center|LOCUS_18380 163243 161999 gene locus_tag LOCUS_18390 163243 161999 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809440.1 protein_id gnl|my_center|LOCUS_18390 165512 163206 gene locus_tag LOCUS_18400 165512 163206 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126621993.1 protein_id gnl|my_center|LOCUS_18400 166595 165684 gene locus_tag LOCUS_18410 166595 165684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 166766 167968 gene locus_tag LOCUS_18420 166766 167968 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809437.1 protein_id gnl|my_center|LOCUS_18420 168793 167939 gene locus_tag LOCUS_18430 168793 167939 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809436.1 protein_id gnl|my_center|LOCUS_18430 168884 170503 gene locus_tag LOCUS_18440 168884 170503 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809435.1 protein_id gnl|my_center|LOCUS_18440 170864 170460 gene locus_tag LOCUS_18450 170864 170460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 171253 170861 gene locus_tag LOCUS_18460 171253 170861 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185460.1 protein_id gnl|my_center|LOCUS_18460 171592 171275 gene locus_tag LOCUS_18470 171592 171275 CDS product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809432.1 protein_id gnl|my_center|LOCUS_18470 172453 171758 gene locus_tag LOCUS_18480 gene upp 172453 171758 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809425.1 protein_id gnl|my_center|LOCUS_18480 172584 173642 gene locus_tag LOCUS_18490 gene queA 172584 173642 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064321.1 protein_id gnl|my_center|LOCUS_18490 173692 174831 gene locus_tag LOCUS_18500 gene tgt 173692 174831 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809419.1 protein_id gnl|my_center|LOCUS_18500 174884 175231 gene locus_tag LOCUS_18510 gene yajC 174884 175231 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064323.1 protein_id gnl|my_center|LOCUS_18510 175297 177171 gene locus_tag LOCUS_18520 gene secD 175297 177171 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064324.1 protein_id gnl|my_center|LOCUS_18520 177250 178191 gene locus_tag LOCUS_18530 gene secF 177250 178191 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809411.1 protein_id gnl|my_center|LOCUS_18530 178397 179833 gene locus_tag LOCUS_18540 gene miaB 178397 179833 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809403.1 protein_id gnl|my_center|LOCUS_18540 179833 180858 gene locus_tag LOCUS_18550 179833 180858 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064328.1 protein_id gnl|my_center|LOCUS_18550 180879 181355 gene locus_tag LOCUS_18560 gene ybeY 180879 181355 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809396.1 protein_id gnl|my_center|LOCUS_18560 181447 182376 gene locus_tag LOCUS_18570 181447 182376 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446766.1 protein_id gnl|my_center|LOCUS_18570 182380 183948 gene locus_tag LOCUS_18580 gene lnt 182380 183948 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064331.1 protein_id gnl|my_center|LOCUS_18580 184124 184199 gene locus_tag LOCUS_t00370 184124 184199 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 184288 184363 gene locus_tag LOCUS_t00380 184288 184363 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 184402 184478 gene locus_tag LOCUS_t00390 184402 184478 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 184563 184638 gene locus_tag LOCUS_t00400 184563 184638 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 184677 184753 gene locus_tag LOCUS_t00410 184677 184753 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 184964 185506 gene locus_tag LOCUS_18590 184964 185506 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659051.1 protein_id gnl|my_center|LOCUS_18590 185542 186669 gene locus_tag LOCUS_18600 185542 186669 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222585.1 protein_id gnl|my_center|LOCUS_18600 186669 186833 gene locus_tag LOCUS_18610 186669 186833 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688501.1 protein_id gnl|my_center|LOCUS_18610 186847 187671 gene locus_tag LOCUS_18620 186847 187671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115101.1 protein_id gnl|my_center|LOCUS_18620 187723 188916 gene locus_tag LOCUS_18630 187723 188916 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107732.1 protein_id gnl|my_center|LOCUS_18630 188980 189765 gene locus_tag LOCUS_18640 188980 189765 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107734.1 protein_id gnl|my_center|LOCUS_18640 190844 189873 gene locus_tag LOCUS_18650 190844 189873 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112641.1 protein_id gnl|my_center|LOCUS_18650 191020 190841 gene locus_tag LOCUS_18660 191020 190841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 191146 191310 gene locus_tag LOCUS_18670 191146 191310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 191910 191368 gene locus_tag LOCUS_18680 191910 191368 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225264.1 protein_id gnl|my_center|LOCUS_18680 193387 191933 gene locus_tag LOCUS_18690 gene cls 193387 191933 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035272.1 protein_id gnl|my_center|LOCUS_18690 194340 193528 gene locus_tag LOCUS_18700 194340 193528 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 protein_id gnl|my_center|LOCUS_18700 194519 195541 gene locus_tag LOCUS_18710 gene bioB 194519 195541 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926132.1 protein_id gnl|my_center|LOCUS_18710 195566 196423 gene locus_tag LOCUS_18720 195566 196423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693980.1 protein_id gnl|my_center|LOCUS_18720 197965 196442 gene locus_tag LOCUS_18730 197965 196442 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931094.1 protein_id gnl|my_center|LOCUS_18730 198550 198044 gene locus_tag LOCUS_18740 198550 198044 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064337.1 protein_id gnl|my_center|LOCUS_18740 199170 198709 gene locus_tag LOCUS_18750 199170 198709 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814701.1 protein_id gnl|my_center|LOCUS_18750 199533 199189 gene locus_tag LOCUS_18760 199533 199189 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820700.1 protein_id gnl|my_center|LOCUS_18760 200381 199677 gene locus_tag LOCUS_18770 gene dnaQ 200381 199677 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064948.1 protein_id gnl|my_center|LOCUS_18770 201186 200404 gene locus_tag LOCUS_18780 gene fabI 201186 200404 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814739.1 protein_id gnl|my_center|LOCUS_18780 202807 201290 gene locus_tag LOCUS_18790 202807 201290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 203742 202960 gene locus_tag LOCUS_18800 gene gloB 203742 202960 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814736.1 protein_id gnl|my_center|LOCUS_18800 203794 204585 gene locus_tag LOCUS_18810 203794 204585 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931355.1 protein_id gnl|my_center|LOCUS_18810 204578 205030 gene locus_tag LOCUS_18820 gene rnhA 204578 205030 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814734.1 protein_id gnl|my_center|LOCUS_18820 205269 205054 gene locus_tag LOCUS_18830 205269 205054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 205610 205320 gene locus_tag LOCUS_18840 205610 205320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 205860 207917 gene locus_tag LOCUS_18850 gene cirA 205860 207917 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420204.1 protein_id gnl|my_center|LOCUS_18850 208023 209309 gene locus_tag LOCUS_18860 208023 209309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 209462 210223 gene locus_tag LOCUS_18870 209462 210223 CDS product maleate cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064689.1 protein_id gnl|my_center|LOCUS_18870 210234 211142 gene locus_tag LOCUS_18880 210234 211142 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083249.1 protein_id gnl|my_center|LOCUS_18880 211977 211150 gene locus_tag LOCUS_18890 211977 211150 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618822.1 protein_id gnl|my_center|LOCUS_18890 212924 212055 gene locus_tag LOCUS_18900 212924 212055 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189984.1 protein_id gnl|my_center|LOCUS_18900 213939 212917 gene locus_tag LOCUS_18910 213939 212917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929892.1 protein_id gnl|my_center|LOCUS_18910 214605 213973 gene locus_tag LOCUS_18920 214605 213973 CDS product N-carbamoylsarcosine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 protein_id gnl|my_center|LOCUS_18920 214987 215979 gene locus_tag LOCUS_18930 214987 215979 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905641.1 protein_id gnl|my_center|LOCUS_18930 215979 216464 gene locus_tag LOCUS_18940 215979 216464 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811705.1 protein_id gnl|my_center|LOCUS_18940 216471 217754 gene locus_tag LOCUS_18950 216471 217754 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811706.1 protein_id gnl|my_center|LOCUS_18950 217883 217698 gene locus_tag LOCUS_18960 217883 217698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 219373 217931 gene locus_tag LOCUS_18970 gene adeC 219373 217931 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153304094.1 protein_id gnl|my_center|LOCUS_18970 222533 219375 gene locus_tag LOCUS_18980 gene acrB 222533 219375 CDS product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132507.1 protein_id gnl|my_center|LOCUS_18980 223743 222565 gene locus_tag LOCUS_18990 223743 222565 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_18990 223921 224529 gene locus_tag LOCUS_19000 223921 224529 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037814.1 protein_id gnl|my_center|LOCUS_19000 224587 225168 gene locus_tag LOCUS_19010 224587 225168 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191695.1 protein_id gnl|my_center|LOCUS_19010 225175 226089 gene locus_tag LOCUS_19020 225175 226089 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084684.1 protein_id gnl|my_center|LOCUS_19020 227502 226117 gene locus_tag LOCUS_19030 227502 226117 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038874.1 protein_id gnl|my_center|LOCUS_19030 228063 227851 gene locus_tag LOCUS_19040 228063 227851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 227953 228339 gene locus_tag LOCUS_19050 227953 228339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 228446 229375 gene locus_tag LOCUS_19060 228446 229375 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965948.1 protein_id gnl|my_center|LOCUS_19060 229552 230529 gene locus_tag LOCUS_19070 229552 230529 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039342.1 protein_id gnl|my_center|LOCUS_19070 230526 231269 gene locus_tag LOCUS_19080 230526 231269 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921438.1 protein_id gnl|my_center|LOCUS_19080 231303 232076 gene locus_tag LOCUS_19090 231303 232076 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040786.1 protein_id gnl|my_center|LOCUS_19090 232937 232107 gene locus_tag LOCUS_19100 gene thiM 232937 232107 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_19100 233631 233032 gene locus_tag LOCUS_19110 233631 233032 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_19110 234063 234776 gene locus_tag LOCUS_19120 234063 234776 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811686.1 protein_id gnl|my_center|LOCUS_19120 235096 235479 gene locus_tag LOCUS_19130 gene panD 235096 235479 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225586.1 protein_id gnl|my_center|LOCUS_19130 235606 236994 gene locus_tag LOCUS_19140 235606 236994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 237095 237517 gene locus_tag LOCUS_19150 237095 237517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 237660 239693 gene locus_tag LOCUS_19160 237660 239693 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 protein_id gnl|my_center|LOCUS_19160 240343 239738 gene locus_tag LOCUS_19170 gene ttrR 240343 239738 CDS product tetrathionate respiration response regulator TtrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019083413.1 protein_id gnl|my_center|LOCUS_19170 242079 240340 gene locus_tag LOCUS_19180 gene ttrS 242079 240340 CDS product tetrathionate respiration histidine kinase TtrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816070.1 protein_id gnl|my_center|LOCUS_19180 242281 241961 gene locus_tag LOCUS_19190 242281 241961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 242280 243629 gene locus_tag LOCUS_19200 242280 243629 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277854.1 protein_id gnl|my_center|LOCUS_19200 243622 244527 gene locus_tag LOCUS_19210 243622 244527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 245618 244659 gene locus_tag LOCUS_19220 245618 244659 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968613.1 protein_id gnl|my_center|LOCUS_19220 246253 245642 gene locus_tag LOCUS_19230 246253 245642 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327147.1 protein_id gnl|my_center|LOCUS_19230 246933 246250 gene locus_tag LOCUS_19240 246933 246250 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974325.1 protein_id gnl|my_center|LOCUS_19240 247382 247636 gene locus_tag LOCUS_19250 247382 247636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 248451 247789 gene locus_tag LOCUS_19260 gene tenA 248451 247789 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263205.1 protein_id gnl|my_center|LOCUS_19260 249441 248485 gene locus_tag LOCUS_19270 249441 248485 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389332.1 protein_id gnl|my_center|LOCUS_19270 250260 249508 gene locus_tag LOCUS_19280 250260 249508 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693804.1 protein_id gnl|my_center|LOCUS_19280 251006 250257 gene locus_tag LOCUS_19290 251006 250257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705473.1 protein_id gnl|my_center|LOCUS_19290 252438 251221 gene locus_tag LOCUS_19300 252438 251221 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809449.1 protein_id gnl|my_center|LOCUS_19300 253394 252456 gene locus_tag LOCUS_19310 253394 252456 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064309.1 protein_id gnl|my_center|LOCUS_19310 253632 255323 gene locus_tag LOCUS_19320 gene sulP 253632 255323 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085632.1 protein_id gnl|my_center|LOCUS_19320 255343 256119 gene locus_tag LOCUS_19330 255343 256119 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931055.1 protein_id gnl|my_center|LOCUS_19330 257482 256145 gene locus_tag LOCUS_19340 gene clcA 257482 256145 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107451.1 protein_id gnl|my_center|LOCUS_19340 258505 257573 gene locus_tag LOCUS_19350 258505 257573 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930460.1 protein_id gnl|my_center|LOCUS_19350 258618 260138 gene locus_tag LOCUS_19360 258618 260138 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808433.1 protein_id gnl|my_center|LOCUS_19360 260867 260229 gene locus_tag LOCUS_19370 260867 260229 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927036.1 protein_id gnl|my_center|LOCUS_19370 261950 261153 gene locus_tag LOCUS_19380 261950 261153 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815084.1 protein_id gnl|my_center|LOCUS_19380 265738 261959 gene locus_tag LOCUS_19390 gene metH 265738 261959 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064919.1 protein_id gnl|my_center|LOCUS_19390 266039 267913 gene locus_tag LOCUS_19400 266039 267913 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040580.1 protein_id gnl|my_center|LOCUS_19400 268019 268897 gene locus_tag LOCUS_19410 268019 268897 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_19410 269856 268894 gene locus_tag LOCUS_19420 269856 268894 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064893.1 protein_id gnl|my_center|LOCUS_19420 270015 270374 gene locus_tag LOCUS_19430 gene folB 270015 270374 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817821.1 protein_id gnl|my_center|LOCUS_19430 270377 271324 gene locus_tag LOCUS_19440 gene ttcA 270377 271324 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815371.1 protein_id gnl|my_center|LOCUS_19440 271338 272168 gene locus_tag LOCUS_19450 gene queF 271338 272168 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930727.1 protein_id gnl|my_center|LOCUS_19450 272642 272433 gene locus_tag LOCUS_19460 272642 272433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 272605 273678 gene locus_tag LOCUS_19470 272605 273678 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524995.1 protein_id gnl|my_center|LOCUS_19470 273686 276448 gene locus_tag LOCUS_19480 gene rbbA 273686 276448 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149085.1 protein_id gnl|my_center|LOCUS_19480 276451 277575 gene locus_tag LOCUS_19490 276451 277575 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188525.1 protein_id gnl|my_center|LOCUS_19490 278558 277710 gene locus_tag LOCUS_19500 278558 277710 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762770.1 protein_id gnl|my_center|LOCUS_19500 278702 279280 gene locus_tag LOCUS_19510 278702 279280 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928388.1 protein_id gnl|my_center|LOCUS_19510 279334 280929 gene locus_tag LOCUS_19520 279334 280929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 282225 281107 gene locus_tag LOCUS_19530 282225 281107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 282391 282191 gene locus_tag LOCUS_19540 282391 282191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 282788 282456 gene locus_tag LOCUS_19550 gene tnpB 282788 282456 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 protein_id gnl|my_center|LOCUS_19550 283186 282785 gene locus_tag LOCUS_19560 283186 282785 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105580.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence32 152 451 gene locus_tag LOCUS_19570 152 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 1329 481 gene locus_tag LOCUS_19580 1329 481 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256676.1 protein_id gnl|my_center|LOCUS_19580 2854 1418 gene locus_tag LOCUS_19590 2854 1418 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_19590 3932 2871 gene locus_tag LOCUS_19600 3932 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 4074 5168 gene locus_tag LOCUS_19610 4074 5168 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992495.1 protein_id gnl|my_center|LOCUS_19610 5321 5614 gene locus_tag LOCUS_19620 5321 5614 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298602.1 protein_id gnl|my_center|LOCUS_19620 5697 5891 gene locus_tag LOCUS_19630 5697 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 6495 5905 gene locus_tag LOCUS_19640 6495 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 6673 7086 gene locus_tag LOCUS_19650 6673 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 7083 7415 gene locus_tag LOCUS_19660 7083 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 7450 8454 gene locus_tag LOCUS_19670 7450 8454 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807415.1 protein_id gnl|my_center|LOCUS_19670 9231 8440 gene locus_tag LOCUS_19680 9231 8440 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815979.1 protein_id gnl|my_center|LOCUS_19680 9305 10621 gene locus_tag LOCUS_19690 9305 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 11022 13754 gene locus_tag LOCUS_19700 11022 13754 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810967.1 protein_id gnl|my_center|LOCUS_19700 13755 14099 gene locus_tag LOCUS_19710 13755 14099 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810969.1 protein_id gnl|my_center|LOCUS_19710 14096 15733 gene locus_tag LOCUS_19720 14096 15733 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568496.1 protein_id gnl|my_center|LOCUS_19720 15733 16221 gene locus_tag LOCUS_19730 15733 16221 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810973.1 protein_id gnl|my_center|LOCUS_19730 16218 16499 gene locus_tag LOCUS_19740 16218 16499 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810975.1 protein_id gnl|my_center|LOCUS_19740 16496 16810 gene locus_tag LOCUS_19750 gene mnhG 16496 16810 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930511.1 protein_id gnl|my_center|LOCUS_19750 16829 19210 gene locus_tag LOCUS_19760 16829 19210 CDS product DUF3772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039409.1 protein_id gnl|my_center|LOCUS_19760 19950 19372 gene locus_tag LOCUS_19770 19950 19372 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812011.1 protein_id gnl|my_center|LOCUS_19770 20698 19988 gene locus_tag LOCUS_19780 gene pdxJ 20698 19988 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810344.1 protein_id gnl|my_center|LOCUS_19780 22057 20717 gene locus_tag LOCUS_19790 22057 20717 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810342.1 protein_id gnl|my_center|LOCUS_19790 25416 22159 gene locus_tag LOCUS_19800 25416 22159 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040154.1 protein_id gnl|my_center|LOCUS_19800 26627 25425 gene locus_tag LOCUS_19810 26627 25425 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810338.1 protein_id gnl|my_center|LOCUS_19810 27719 26925 gene locus_tag LOCUS_19820 27719 26925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039425.1 protein_id gnl|my_center|LOCUS_19820 28611 27724 gene locus_tag LOCUS_19830 28611 27724 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092881.1 protein_id gnl|my_center|LOCUS_19830 29692 28721 gene locus_tag LOCUS_19840 29692 28721 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064003.1 protein_id gnl|my_center|LOCUS_19840 30564 29785 gene locus_tag LOCUS_19850 30564 29785 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930714.1 protein_id gnl|my_center|LOCUS_19850 31745 30564 gene locus_tag LOCUS_19860 31745 30564 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905810.1 protein_id gnl|my_center|LOCUS_19860 31848 32621 gene locus_tag LOCUS_19870 gene xth 31848 32621 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812032.1 protein_id gnl|my_center|LOCUS_19870 33290 32730 gene locus_tag LOCUS_19880 33290 32730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 34033 33308 gene locus_tag LOCUS_19890 34033 33308 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811964.1 protein_id gnl|my_center|LOCUS_19890 34349 34705 gene locus_tag LOCUS_19900 34349 34705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 35080 34742 gene locus_tag LOCUS_19910 35080 34742 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_19910 36824 35148 gene locus_tag LOCUS_19920 36824 35148 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931082.1 protein_id gnl|my_center|LOCUS_19920 36954 38369 gene locus_tag LOCUS_19930 gene argH 36954 38369 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812010.1 protein_id gnl|my_center|LOCUS_19930 39290 38595 gene locus_tag LOCUS_19940 39290 38595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 40472 39411 gene locus_tag LOCUS_19950 gene recA 40472 39411 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812760.1 protein_id gnl|my_center|LOCUS_19950 40826 41734 gene locus_tag LOCUS_19960 40826 41734 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_19960 42236 41739 gene locus_tag LOCUS_19970 42236 41739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 44894 42621 gene locus_tag LOCUS_19980 44894 42621 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980966.1 protein_id gnl|my_center|LOCUS_19980 45477 44965 gene locus_tag LOCUS_19990 45477 44965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 45630 47171 gene locus_tag LOCUS_20000 gene norR 45630 47171 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 protein_id gnl|my_center|LOCUS_20000 49288 47267 gene locus_tag LOCUS_20010 gene uvrB 49288 47267 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812466.1 protein_id gnl|my_center|LOCUS_20010 49388 50587 gene locus_tag LOCUS_20020 49388 50587 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930567.1 protein_id gnl|my_center|LOCUS_20020 50668 51321 gene locus_tag LOCUS_20030 gene lexA 50668 51321 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930566.1 protein_id gnl|my_center|LOCUS_20030 52452 51421 gene locus_tag LOCUS_20040 52452 51421 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531405.1 protein_id gnl|my_center|LOCUS_20040 53306 52617 gene locus_tag LOCUS_20050 gene aqpZ 53306 52617 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262065.1 protein_id gnl|my_center|LOCUS_20050 56166 53533 gene locus_tag LOCUS_20060 56166 53533 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063974.1 protein_id gnl|my_center|LOCUS_20060 57260 56265 gene locus_tag LOCUS_20070 57260 56265 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063973.1 protein_id gnl|my_center|LOCUS_20070 58055 57459 gene locus_tag LOCUS_20080 58055 57459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122761.1 protein_id gnl|my_center|LOCUS_20080 58239 59357 gene locus_tag LOCUS_20090 58239 59357 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_20090 60037 59558 gene locus_tag LOCUS_20100 gene eco 60037 59558 CDS product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114416.1 protein_id gnl|my_center|LOCUS_20100 60203 61156 gene locus_tag LOCUS_20110 60203 61156 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384590.1 protein_id gnl|my_center|LOCUS_20110 61146 61661 gene locus_tag LOCUS_20120 61146 61661 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537806.1 protein_id gnl|my_center|LOCUS_20120 61694 63181 gene locus_tag LOCUS_20130 61694 63181 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384588.1 protein_id gnl|my_center|LOCUS_20130 63684 63202 gene locus_tag LOCUS_20140 63684 63202 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930202.1 protein_id gnl|my_center|LOCUS_20140 63833 66499 gene locus_tag LOCUS_20150 gene mdeB 63833 66499 CDS product alpha-ketoglutarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065164.1 protein_id gnl|my_center|LOCUS_20150 68153 66567 gene locus_tag LOCUS_20160 gene ahpF 68153 66567 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111221.1 protein_id gnl|my_center|LOCUS_20160 68842 68279 gene locus_tag LOCUS_20170 gene ahpC 68842 68279 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525522.1 protein_id gnl|my_center|LOCUS_20170 70410 69004 gene locus_tag LOCUS_20180 70410 69004 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_20180 71069 70416 gene locus_tag LOCUS_20190 71069 70416 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 protein_id gnl|my_center|LOCUS_20190 71428 71069 gene locus_tag LOCUS_20200 71428 71069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 71586 71894 gene locus_tag LOCUS_20210 71586 71894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 71949 73271 gene locus_tag LOCUS_20220 71949 73271 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 protein_id gnl|my_center|LOCUS_20220 74067 73345 gene locus_tag LOCUS_20230 74067 73345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 74994 74095 gene locus_tag LOCUS_20240 gene nadC 74994 74095 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814746.1 protein_id gnl|my_center|LOCUS_20240 75253 77196 gene locus_tag LOCUS_20250 75253 77196 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931315.1 protein_id gnl|my_center|LOCUS_20250 78111 77182 gene locus_tag LOCUS_20260 78111 77182 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113533.1 protein_id gnl|my_center|LOCUS_20260 78310 79356 gene locus_tag LOCUS_20270 gene gtdA 78310 79356 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289858.1 protein_id gnl|my_center|LOCUS_20270 79396 80607 gene locus_tag LOCUS_20280 79396 80607 CDS product 3-hydroxybenzoate 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150113.1 protein_id gnl|my_center|LOCUS_20280 80732 81436 gene locus_tag LOCUS_20290 80732 81436 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365722.1 protein_id gnl|my_center|LOCUS_20290 81800 83152 gene locus_tag LOCUS_20300 81800 83152 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194222.1 protein_id gnl|my_center|LOCUS_20300 84676 83264 gene locus_tag LOCUS_20310 gene yegQ 84676 83264 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_20310 85162 86022 gene locus_tag LOCUS_20320 gene ehuB 85162 86022 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220332954.1 protein_id gnl|my_center|LOCUS_20320 86080 86754 gene locus_tag LOCUS_20330 gene ehuC 86080 86754 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220332953.1 protein_id gnl|my_center|LOCUS_20330 86756 87448 gene locus_tag LOCUS_20340 gene ehuD 86756 87448 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209942630.1 protein_id gnl|my_center|LOCUS_20340 87445 88218 gene locus_tag LOCUS_20350 gene ehuA 87445 88218 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209942632.1 protein_id gnl|my_center|LOCUS_20350 89215 88304 gene locus_tag LOCUS_20360 89215 88304 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552076.1 protein_id gnl|my_center|LOCUS_20360 89371 90291 gene locus_tag LOCUS_20370 gene catA 89371 90291 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113693.1 protein_id gnl|my_center|LOCUS_20370 90377 91732 gene locus_tag LOCUS_20380 gene benA 90377 91732 CDS product benzoate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529144.1 protein_id gnl|my_center|LOCUS_20380 91732 92223 gene locus_tag LOCUS_20390 gene benB 91732 92223 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206213.1 protein_id gnl|my_center|LOCUS_20390 92306 93322 gene locus_tag LOCUS_20400 gene benC 92306 93322 CDS product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206212.1 protein_id gnl|my_center|LOCUS_20400 93326 94117 gene locus_tag LOCUS_20410 93326 94117 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206211.1 protein_id gnl|my_center|LOCUS_20410 94124 95359 gene locus_tag LOCUS_20420 gene benE 94124 95359 CDS product benzoate/H(+) symporter BenE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 protein_id gnl|my_center|LOCUS_20420 95484 96809 gene locus_tag LOCUS_20430 95484 96809 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 protein_id gnl|my_center|LOCUS_20430 96885 97127 gene locus_tag LOCUS_20440 96885 97127 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036496.1 protein_id gnl|my_center|LOCUS_20440 97491 97285 gene locus_tag LOCUS_20450 97491 97285 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933882.1 protein_id gnl|my_center|LOCUS_20450 97727 97811 gene locus_tag LOCUS_t00420 97727 97811 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 97950 98936 gene locus_tag LOCUS_20460 97950 98936 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926402.1 protein_id gnl|my_center|LOCUS_20460 99455 98985 gene locus_tag LOCUS_20470 99455 98985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 100059 99445 gene locus_tag LOCUS_20480 100059 99445 CDS product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113192.1 protein_id gnl|my_center|LOCUS_20480 100306 100046 gene locus_tag LOCUS_20490 100306 100046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 100619 100299 gene locus_tag LOCUS_20500 100619 100299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 100916 100686 gene locus_tag LOCUS_20510 100916 100686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 102992 100926 gene locus_tag LOCUS_20520 102992 100926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 103624 103070 gene locus_tag LOCUS_20530 103624 103070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 104197 103631 gene locus_tag LOCUS_20540 104197 103631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 105940 104201 gene locus_tag LOCUS_20550 105940 104201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 106551 105937 gene locus_tag LOCUS_20560 106551 105937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 109037 106689 gene locus_tag LOCUS_20570 109037 106689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 109605 109246 gene locus_tag LOCUS_20580 109605 109246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 110009 109605 gene locus_tag LOCUS_20590 110009 109605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 110417 110046 gene locus_tag LOCUS_20600 110417 110046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 110842 110414 gene locus_tag LOCUS_20610 110842 110414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 111162 110839 gene locus_tag LOCUS_20620 111162 110839 CDS product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938789.1 protein_id gnl|my_center|LOCUS_20620 111638 111159 gene locus_tag LOCUS_20630 111638 111159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 111795 111619 gene locus_tag LOCUS_20640 111795 111619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 112133 111798 gene locus_tag LOCUS_20650 112133 111798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 113401 112184 gene locus_tag LOCUS_20660 113401 112184 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257523.1 protein_id gnl|my_center|LOCUS_20660 114246 113401 gene locus_tag LOCUS_20670 114246 113401 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337208.1 protein_id gnl|my_center|LOCUS_20670 115462 114224 gene locus_tag LOCUS_20680 115462 114224 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466243.1 protein_id gnl|my_center|LOCUS_20680 117146 115470 gene locus_tag LOCUS_20690 117146 115470 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301491.1 protein_id gnl|my_center|LOCUS_20690 117584 117147 gene locus_tag LOCUS_20700 117584 117147 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958416.1 protein_id gnl|my_center|LOCUS_20700 118150 118010 gene locus_tag LOCUS_20710 118150 118010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 118657 118253 gene locus_tag LOCUS_20720 118657 118253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 118911 118657 gene locus_tag LOCUS_20730 118911 118657 CDS product DUF3310 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111491.1 protein_id gnl|my_center|LOCUS_20730 119373 118993 gene locus_tag LOCUS_20740 119373 118993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 120121 119606 gene locus_tag LOCUS_20750 120121 119606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 120791 120102 gene locus_tag LOCUS_20760 120791 120102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 121107 120898 gene locus_tag LOCUS_20770 121107 120898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 121259 121741 gene locus_tag LOCUS_20780 121259 121741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 122502 121771 gene locus_tag LOCUS_20790 122502 121771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 122741 122532 gene locus_tag LOCUS_20800 122741 122532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 123232 122852 gene locus_tag LOCUS_20810 123232 122852 CDS product recombination protein NinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098063.1 protein_id gnl|my_center|LOCUS_20810 123603 123229 gene locus_tag LOCUS_20820 123603 123229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 123678 123806 gene locus_tag LOCUS_20830 123678 123806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 124038 123796 gene locus_tag LOCUS_20840 124038 123796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 124170 124775 gene locus_tag LOCUS_20850 124170 124775 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225569.1 protein_id gnl|my_center|LOCUS_20850 124802 125398 gene locus_tag LOCUS_20860 124802 125398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 125449 125862 gene locus_tag LOCUS_20870 125449 125862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 125882 126211 gene locus_tag LOCUS_20880 125882 126211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 126236 127111 gene locus_tag LOCUS_20890 126236 127111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 127655 127146 gene locus_tag LOCUS_20900 127655 127146 CDS product DUF4760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002241413.1 protein_id gnl|my_center|LOCUS_20900 128095 127889 gene locus_tag LOCUS_20910 128095 127889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 129213 129407 gene locus_tag LOCUS_20920 129213 129407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 130264 130476 gene locus_tag LOCUS_20930 130264 130476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 130469 130621 gene locus_tag LOCUS_20940 130469 130621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 130608 130772 gene locus_tag LOCUS_20950 130608 130772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 130769 131857 gene locus_tag LOCUS_20960 130769 131857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 131838 132155 gene locus_tag LOCUS_20970 131838 132155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 132152 132904 gene locus_tag LOCUS_20980 132152 132904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 132908 133543 gene locus_tag LOCUS_20990 132908 133543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 133562 133984 gene locus_tag LOCUS_21000 133562 133984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 133998 134921 gene locus_tag LOCUS_21010 133998 134921 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_21010 134902 135468 gene locus_tag LOCUS_21020 134902 135468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 135413 135631 gene locus_tag LOCUS_21030 135413 135631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 135631 136284 gene locus_tag LOCUS_21040 135631 136284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 136256 136537 gene locus_tag LOCUS_21050 136256 136537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 136602 137003 gene locus_tag LOCUS_21060 136602 137003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 137000 137227 gene locus_tag LOCUS_21070 137000 137227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 137224 137391 gene locus_tag LOCUS_21080 137224 137391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 137388 137864 gene locus_tag LOCUS_21090 137388 137864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 137861 138118 gene locus_tag LOCUS_21100 137861 138118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 138115 138318 gene locus_tag LOCUS_21110 138115 138318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 138315 138545 gene locus_tag LOCUS_21120 138315 138545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 138832 140025 gene locus_tag LOCUS_21130 gene dapC 138832 140025 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448163.1 protein_id gnl|my_center|LOCUS_21130 140102 140923 gene locus_tag LOCUS_21140 gene dapD 140102 140923 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812536.1 protein_id gnl|my_center|LOCUS_21140 140929 142059 gene locus_tag LOCUS_21150 gene dapE 140929 142059 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812538.1 protein_id gnl|my_center|LOCUS_21150 142088 142987 gene locus_tag LOCUS_21160 gene prmB 142088 142987 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926401.1 protein_id gnl|my_center|LOCUS_21160 143014 144942 gene locus_tag LOCUS_21170 143014 144942 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812542.1 protein_id gnl|my_center|LOCUS_21170 145813 145172 gene locus_tag LOCUS_21180 145813 145172 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064048.1 protein_id gnl|my_center|LOCUS_21180 147517 145826 gene locus_tag LOCUS_21190 147517 145826 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930387.1 protein_id gnl|my_center|LOCUS_21190 148128 147520 gene locus_tag LOCUS_21200 148128 147520 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930386.1 protein_id gnl|my_center|LOCUS_21200 149209 148373 gene locus_tag LOCUS_21210 gene truA 149209 148373 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930384.1 protein_id gnl|my_center|LOCUS_21210 149412 149212 gene locus_tag LOCUS_21220 149412 149212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 150545 149415 gene locus_tag LOCUS_21230 gene asd 150545 149415 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812646.1 protein_id gnl|my_center|LOCUS_21230 151749 150673 gene locus_tag LOCUS_21240 gene leuB 151749 150673 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812648.1 protein_id gnl|my_center|LOCUS_21240 152418 151765 gene locus_tag LOCUS_21250 gene leuD 152418 151765 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926388.1 protein_id gnl|my_center|LOCUS_21250 153827 152424 gene locus_tag LOCUS_21260 gene leuC 153827 152424 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_21260 154200 155516 gene locus_tag LOCUS_21270 154200 155516 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446730.1 protein_id gnl|my_center|LOCUS_21270 155777 157096 gene locus_tag LOCUS_21280 gene fahA 155777 157096 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818932.1 protein_id gnl|my_center|LOCUS_21280 158234 157176 gene locus_tag LOCUS_21290 gene aroC 158234 157176 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820487.1 protein_id gnl|my_center|LOCUS_21290 159774 158290 gene locus_tag LOCUS_21300 159774 158290 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812698.1 protein_id gnl|my_center|LOCUS_21300 160219 159776 gene locus_tag LOCUS_21310 160219 159776 CDS product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930180.1 protein_id gnl|my_center|LOCUS_21310 160336 161649 gene locus_tag LOCUS_21320 160336 161649 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812701.1 protein_id gnl|my_center|LOCUS_21320 161883 162338 gene locus_tag LOCUS_21330 161883 162338 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812703.1 protein_id gnl|my_center|LOCUS_21330 163620 162550 gene locus_tag LOCUS_21340 163620 162550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064646.1 protein_id gnl|my_center|LOCUS_21340 163857 164675 gene locus_tag LOCUS_21350 163857 164675 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064645.1 protein_id gnl|my_center|LOCUS_21350 164922 165158 gene locus_tag LOCUS_21360 164922 165158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 166730 165207 gene locus_tag LOCUS_21370 166730 165207 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926498.1 protein_id gnl|my_center|LOCUS_21370 167774 166923 gene locus_tag LOCUS_21380 167774 166923 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_21380 168572 167814 gene locus_tag LOCUS_21390 168572 167814 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114686.1 protein_id gnl|my_center|LOCUS_21390 170076 168595 gene locus_tag LOCUS_21400 170076 168595 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088040.1 protein_id gnl|my_center|LOCUS_21400 170629 170078 gene locus_tag LOCUS_21410 170629 170078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 170780 171760 gene locus_tag LOCUS_21420 170780 171760 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818532.1 protein_id gnl|my_center|LOCUS_21420 171945 172484 gene locus_tag LOCUS_21430 171945 172484 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208113920.1 protein_id gnl|my_center|LOCUS_21430 172679 173311 gene locus_tag LOCUS_21440 172679 173311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21440 173702 173379 gene locus_tag LOCUS_21450 gene yfaE 173702 173379 CDS product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688918.1 protein_id gnl|my_center|LOCUS_21450 174832 173699 gene locus_tag LOCUS_21460 gene nrdB 174832 173699 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357909.1 protein_id gnl|my_center|LOCUS_21460 177137 174861 gene locus_tag LOCUS_21470 gene nrdA 177137 174861 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819935.1 protein_id gnl|my_center|LOCUS_21470 178509 177469 gene locus_tag LOCUS_21480 gene dusA 178509 177469 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930178.1 protein_id gnl|my_center|LOCUS_21480 180196 178490 gene locus_tag LOCUS_21490 180196 178490 CDS product ClcB-like voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192418.1 protein_id gnl|my_center|LOCUS_21490 180469 181437 gene locus_tag LOCUS_21500 180469 181437 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812707.1 protein_id gnl|my_center|LOCUS_21500 181522 182259 gene locus_tag LOCUS_21510 181522 182259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 182293 183015 gene locus_tag LOCUS_21520 182293 183015 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099722191.1 protein_id gnl|my_center|LOCUS_21520 184049 183120 gene locus_tag LOCUS_21530 184049 183120 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813337.1 protein_id gnl|my_center|LOCUS_21530 184800 184051 gene locus_tag LOCUS_21540 184800 184051 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 protein_id gnl|my_center|LOCUS_21540 185815 184934 gene locus_tag LOCUS_21550 185815 184934 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039480.1 protein_id gnl|my_center|LOCUS_21550 186044 187177 gene locus_tag LOCUS_21560 gene mltB 186044 187177 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926823.1 protein_id gnl|my_center|LOCUS_21560 188647 187349 gene locus_tag LOCUS_21570 gene aceA 188647 187349 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810362.1 protein_id gnl|my_center|LOCUS_21570 189121 188993 gene locus_tag LOCUS_21580 189121 188993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 190366 189140 gene locus_tag LOCUS_21590 190366 189140 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_21590 191637 190378 gene locus_tag LOCUS_21600 191637 190378 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 protein_id gnl|my_center|LOCUS_21600 192288 191716 gene locus_tag LOCUS_21610 gene pgsA 192288 191716 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 protein_id gnl|my_center|LOCUS_21610 194135 192306 gene locus_tag LOCUS_21620 gene uvrC 194135 192306 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930726.1 protein_id gnl|my_center|LOCUS_21620 195144 194098 gene locus_tag LOCUS_21630 gene nagZ 195144 194098 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_21630 195581 195147 gene locus_tag LOCUS_21640 gene acpS 195581 195147 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810346.1 protein_id gnl|my_center|LOCUS_21640 196151 195606 gene locus_tag LOCUS_21650 gene orn 196151 195606 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_21650 196209 197474 gene locus_tag LOCUS_21660 196209 197474 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813306.1 protein_id gnl|my_center|LOCUS_21660 197479 198366 gene locus_tag LOCUS_21670 gene rsgA 197479 198366 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039490.1 protein_id gnl|my_center|LOCUS_21670 199160 198441 gene locus_tag LOCUS_21680 199160 198441 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813314.1 protein_id gnl|my_center|LOCUS_21680 199627 199250 gene locus_tag LOCUS_21690 gene rplS 199627 199250 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813315.1 protein_id gnl|my_center|LOCUS_21690 200097 199864 gene locus_tag LOCUS_21700 200097 199864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 202173 200374 gene locus_tag LOCUS_21710 202173 200374 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821527.1 protein_id gnl|my_center|LOCUS_21710 203670 202792 gene locus_tag LOCUS_21720 203670 202792 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928273.1 protein_id gnl|my_center|LOCUS_21720 204537 203680 gene locus_tag LOCUS_21730 204537 203680 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136348290.1 protein_id gnl|my_center|LOCUS_21730 206310 204553 gene locus_tag LOCUS_21740 206310 204553 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064053.1 protein_id gnl|my_center|LOCUS_21740 207799 206339 gene locus_tag LOCUS_21750 207799 206339 CDS product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064054.1 protein_id gnl|my_center|LOCUS_21750 208805 207825 gene locus_tag LOCUS_21760 gene cpaB 208805 207825 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128354298.1 protein_id gnl|my_center|LOCUS_21760 209509 208802 gene locus_tag LOCUS_21770 209509 208802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 210244 209513 gene locus_tag LOCUS_21780 210244 209513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 211506 210241 gene locus_tag LOCUS_21790 211506 210241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930980.1 protein_id gnl|my_center|LOCUS_21790 211835 211566 gene locus_tag LOCUS_21800 211835 211566 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812728.1 protein_id gnl|my_center|LOCUS_21800 212009 212785 gene locus_tag LOCUS_21810 212009 212785 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808642.1 protein_id gnl|my_center|LOCUS_21810 214044 212878 gene locus_tag LOCUS_21820 214044 212878 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040039.1 protein_id gnl|my_center|LOCUS_21820 215258 214041 gene locus_tag LOCUS_21830 215258 214041 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814691.1 protein_id gnl|my_center|LOCUS_21830 216225 215260 gene locus_tag LOCUS_21840 216225 215260 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 protein_id gnl|my_center|LOCUS_21840 216643 216269 gene locus_tag LOCUS_21850 216643 216269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 216956 218200 gene locus_tag LOCUS_21860 216956 218200 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532265.1 protein_id gnl|my_center|LOCUS_21860 219527 218202 gene locus_tag LOCUS_21870 219527 218202 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368593.1 protein_id gnl|my_center|LOCUS_21870 220337 219720 gene locus_tag LOCUS_21880 220337 219720 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121256.1 protein_id gnl|my_center|LOCUS_21880 222184 220790 gene locus_tag LOCUS_21890 222184 220790 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038930.1 protein_id gnl|my_center|LOCUS_21890 222545 222174 gene locus_tag LOCUS_21900 222545 222174 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376486.1 protein_id gnl|my_center|LOCUS_21900 223994 222975 gene locus_tag LOCUS_21910 gene dmpG 223994 222975 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998299.1 protein_id gnl|my_center|LOCUS_21910 224977 224024 gene locus_tag LOCUS_21920 gene mhpF 224977 224024 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044314.1 protein_id gnl|my_center|LOCUS_21920 225991 225014 gene locus_tag LOCUS_21930 225991 225014 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_21930 226824 226033 gene locus_tag LOCUS_21940 gene mhpD 226824 226033 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160712.1 protein_id gnl|my_center|LOCUS_21940 227808 226846 gene locus_tag LOCUS_21950 gene mhpB 227808 226846 CDS product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543457.1 protein_id gnl|my_center|LOCUS_21950 229641 227827 gene locus_tag LOCUS_21960 229641 227827 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007421.1 protein_id gnl|my_center|LOCUS_21960 230594 229683 gene locus_tag LOCUS_21970 230594 229683 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730147.1 protein_id gnl|my_center|LOCUS_21970 230718 231545 gene locus_tag LOCUS_21980 230718 231545 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303819.1 protein_id gnl|my_center|LOCUS_21980 232195 231653 gene locus_tag LOCUS_21990 232195 231653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 232458 233351 gene locus_tag LOCUS_22000 232458 233351 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 protein_id gnl|my_center|LOCUS_22000 233365 234300 gene locus_tag LOCUS_22010 233365 234300 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968134.1 protein_id gnl|my_center|LOCUS_22010 234314 235102 gene locus_tag LOCUS_22020 234314 235102 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061894.1 protein_id gnl|my_center|LOCUS_22020 235156 236526 gene locus_tag LOCUS_22030 235156 236526 CDS product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227202.1 protein_id gnl|my_center|LOCUS_22030 236529 237917 gene locus_tag LOCUS_22040 236529 237917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 237914 239323 gene locus_tag LOCUS_22050 237914 239323 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_22050 239346 240092 gene locus_tag LOCUS_22060 239346 240092 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229007.1 protein_id gnl|my_center|LOCUS_22060 240101 241105 gene locus_tag LOCUS_22070 240101 241105 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535938.1 protein_id gnl|my_center|LOCUS_22070 241186 242427 gene locus_tag LOCUS_22080 241186 242427 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040259.1 protein_id gnl|my_center|LOCUS_22080 242623 244512 gene locus_tag LOCUS_22090 gene betT 242623 244512 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040260.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence33 1003 374 gene locus_tag LOCUS_22100 1003 374 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818481.1 protein_id gnl|my_center|LOCUS_22100 2322 1003 gene locus_tag LOCUS_22110 gene rimO 2322 1003 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064698.1 protein_id gnl|my_center|LOCUS_22110 2477 3367 gene locus_tag LOCUS_22120 gene yghX 2477 3367 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 protein_id gnl|my_center|LOCUS_22120 3484 4833 gene locus_tag LOCUS_22130 gene rsmB 3484 4833 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038748.1 protein_id gnl|my_center|LOCUS_22130 4839 5471 gene locus_tag LOCUS_22140 4839 5471 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807331.1 protein_id gnl|my_center|LOCUS_22140 5423 7786 gene locus_tag LOCUS_22150 5423 7786 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807333.1 protein_id gnl|my_center|LOCUS_22150 7826 8551 gene locus_tag LOCUS_22160 7826 8551 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807335.1 protein_id gnl|my_center|LOCUS_22160 8567 9943 gene locus_tag LOCUS_22170 gene trkA 8567 9943 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818498.1 protein_id gnl|my_center|LOCUS_22170 9952 11421 gene locus_tag LOCUS_22180 9952 11421 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 protein_id gnl|my_center|LOCUS_22180 11894 11424 gene locus_tag LOCUS_22190 11894 11424 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929906.1 protein_id gnl|my_center|LOCUS_22190 12667 11903 gene locus_tag LOCUS_22200 12667 11903 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807412.1 protein_id gnl|my_center|LOCUS_22200 12747 13670 gene locus_tag LOCUS_22210 12747 13670 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788683.1 protein_id gnl|my_center|LOCUS_22210 13845 14930 gene locus_tag LOCUS_22220 13845 14930 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057335.1 protein_id gnl|my_center|LOCUS_22220 14932 16407 gene locus_tag LOCUS_22230 14932 16407 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095324.1 protein_id gnl|my_center|LOCUS_22230 16431 17144 gene locus_tag LOCUS_22240 16431 17144 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_22240 17141 18412 gene locus_tag LOCUS_22250 17141 18412 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267632.1 protein_id gnl|my_center|LOCUS_22250 19492 18440 gene locus_tag LOCUS_22260 19492 18440 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929907.1 protein_id gnl|my_center|LOCUS_22260 20021 19503 gene locus_tag LOCUS_22270 gene secB 20021 19503 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807422.1 protein_id gnl|my_center|LOCUS_22270 20311 20069 gene locus_tag LOCUS_22280 gene grxC 20311 20069 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929908.1 protein_id gnl|my_center|LOCUS_22280 20801 20349 gene locus_tag LOCUS_22290 20801 20349 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_22290 20951 21703 gene locus_tag LOCUS_22300 gene gpmA 20951 21703 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807430.1 protein_id gnl|my_center|LOCUS_22300 21720 23312 gene locus_tag LOCUS_22310 21720 23312 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929910.1 protein_id gnl|my_center|LOCUS_22310 23378 24844 gene locus_tag LOCUS_22320 gene cptA 23378 24844 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446625.1 protein_id gnl|my_center|LOCUS_22320 24844 25599 gene locus_tag LOCUS_22330 gene moeB 24844 25599 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807436.1 protein_id gnl|my_center|LOCUS_22330 27363 25600 gene locus_tag LOCUS_22340 27363 25600 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815368.1 protein_id gnl|my_center|LOCUS_22340 27467 28246 gene locus_tag LOCUS_22350 27467 28246 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815367.1 protein_id gnl|my_center|LOCUS_22350 28311 28781 gene locus_tag LOCUS_22360 28311 28781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 28848 29735 gene locus_tag LOCUS_22370 gene atpB 28848 29735 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815364.1 protein_id gnl|my_center|LOCUS_22370 29885 30127 gene locus_tag LOCUS_22380 gene atpE 29885 30127 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815363.1 protein_id gnl|my_center|LOCUS_22380 30345 30752 gene locus_tag LOCUS_22390 30345 30752 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815350.1 protein_id gnl|my_center|LOCUS_22390 30765 31307 gene locus_tag LOCUS_22400 30765 31307 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815348.1 protein_id gnl|my_center|LOCUS_22400 31341 32882 gene locus_tag LOCUS_22410 gene atpA 31341 32882 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815346.1 protein_id gnl|my_center|LOCUS_22410 32950 33852 gene locus_tag LOCUS_22420 gene atpG 32950 33852 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817813.1 protein_id gnl|my_center|LOCUS_22420 33910 35307 gene locus_tag LOCUS_22430 gene atpD 33910 35307 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064897.1 protein_id gnl|my_center|LOCUS_22430 35321 35746 gene locus_tag LOCUS_22440 35321 35746 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815341.1 protein_id gnl|my_center|LOCUS_22440 37566 35890 gene locus_tag LOCUS_22450 37566 35890 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819848.1 protein_id gnl|my_center|LOCUS_22450 37678 38667 gene locus_tag LOCUS_22460 37678 38667 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 protein_id gnl|my_center|LOCUS_22460 39117 38887 gene locus_tag LOCUS_22470 39117 38887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 39352 40149 gene locus_tag LOCUS_22480 39352 40149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931388.1 protein_id gnl|my_center|LOCUS_22480 40219 41292 gene locus_tag LOCUS_22490 gene hemE 40219 41292 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815337.1 protein_id gnl|my_center|LOCUS_22490 41578 43644 gene locus_tag LOCUS_22500 41578 43644 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815335.1 protein_id gnl|my_center|LOCUS_22500 43641 45722 gene locus_tag LOCUS_22510 43641 45722 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931391.1 protein_id gnl|my_center|LOCUS_22510 46323 45787 gene locus_tag LOCUS_22520 46323 45787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 46632 46706 gene locus_tag LOCUS_t00430 46632 46706 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 47177 48244 gene locus_tag LOCUS_22530 47177 48244 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929006.1 protein_id gnl|my_center|LOCUS_22530 48280 49041 gene locus_tag LOCUS_22540 48280 49041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973986.1 protein_id gnl|my_center|LOCUS_22540 49109 50104 gene locus_tag LOCUS_22550 49109 50104 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207030.1 protein_id gnl|my_center|LOCUS_22550 50467 51495 gene locus_tag LOCUS_22560 50467 51495 CDS product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040097.1 protein_id gnl|my_center|LOCUS_22560 51492 52709 gene locus_tag LOCUS_22570 51492 52709 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063966.1 protein_id gnl|my_center|LOCUS_22570 52706 53746 gene locus_tag LOCUS_22580 gene pdxA 52706 53746 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063965.1 protein_id gnl|my_center|LOCUS_22580 53766 54551 gene locus_tag LOCUS_22590 53766 54551 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063964.1 protein_id gnl|my_center|LOCUS_22590 54586 55158 gene locus_tag LOCUS_22600 54586 55158 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225444.1 protein_id gnl|my_center|LOCUS_22600 55535 55161 gene locus_tag LOCUS_22610 55535 55161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 56055 55618 gene locus_tag LOCUS_22620 56055 55618 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616222.1 protein_id gnl|my_center|LOCUS_22620 57713 56160 gene locus_tag LOCUS_22630 gene gshA 57713 56160 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815271.1 protein_id gnl|my_center|LOCUS_22630 57809 58318 gene locus_tag LOCUS_22640 57809 58318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 58426 59610 gene locus_tag LOCUS_22650 58426 59610 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815253.1 protein_id gnl|my_center|LOCUS_22650 59607 60239 gene locus_tag LOCUS_22660 gene metW 59607 60239 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815252.1 protein_id gnl|my_center|LOCUS_22660 60336 61589 gene locus_tag LOCUS_22670 60336 61589 CDS product muropeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815250.1 protein_id gnl|my_center|LOCUS_22670 62461 61664 gene locus_tag LOCUS_22680 62461 61664 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815212.1 protein_id gnl|my_center|LOCUS_22680 63330 62482 gene locus_tag LOCUS_22690 63330 62482 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064131.1 protein_id gnl|my_center|LOCUS_22690 64203 63409 gene locus_tag LOCUS_22700 64203 63409 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125007115.1 protein_id gnl|my_center|LOCUS_22700 64587 65255 gene locus_tag LOCUS_22710 gene pyrE 64587 65255 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459018.1 protein_id gnl|my_center|LOCUS_22710 65565 66812 gene locus_tag LOCUS_22720 65565 66812 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524302.1 protein_id gnl|my_center|LOCUS_22720 66835 67110 gene locus_tag LOCUS_22730 66835 67110 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536552.1 protein_id gnl|my_center|LOCUS_22730 67107 70115 gene locus_tag LOCUS_22740 67107 70115 CDS product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202495.1 protein_id gnl|my_center|LOCUS_22740 70105 70719 gene locus_tag LOCUS_22750 70105 70719 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205601.1 protein_id gnl|my_center|LOCUS_22750 70937 70761 gene locus_tag LOCUS_22760 70937 70761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 72622 71168 gene locus_tag LOCUS_22770 gene gatB 72622 71168 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929770.1 protein_id gnl|my_center|LOCUS_22770 74154 72622 gene locus_tag LOCUS_22780 gene gatA 74154 72622 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040608.1 protein_id gnl|my_center|LOCUS_22780 74465 74157 gene locus_tag LOCUS_22790 gene gatC 74465 74157 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929772.1 protein_id gnl|my_center|LOCUS_22790 74705 75748 gene locus_tag LOCUS_22800 74705 75748 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815204.1 protein_id gnl|my_center|LOCUS_22800 75926 76744 gene locus_tag LOCUS_22810 gene mreC 75926 76744 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815203.1 protein_id gnl|my_center|LOCUS_22810 76748 77284 gene locus_tag LOCUS_22820 gene mreD 76748 77284 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815202.1 protein_id gnl|my_center|LOCUS_22820 77305 79362 gene locus_tag LOCUS_22830 gene mrdA 77305 79362 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815201.1 protein_id gnl|my_center|LOCUS_22830 79359 80510 gene locus_tag LOCUS_22840 gene rodA 79359 80510 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815198.1 protein_id gnl|my_center|LOCUS_22840 81556 80474 gene locus_tag LOCUS_22850 gene mutY 81556 80474 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927127.1 protein_id gnl|my_center|LOCUS_22850 82469 81561 gene locus_tag LOCUS_22860 82469 81561 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040576.1 protein_id gnl|my_center|LOCUS_22860 83135 82470 gene locus_tag LOCUS_22870 83135 82470 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815073.1 protein_id gnl|my_center|LOCUS_22870 83249 84427 gene locus_tag LOCUS_22880 83249 84427 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 protein_id gnl|my_center|LOCUS_22880 84429 85541 gene locus_tag LOCUS_22890 84429 85541 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815066.1 protein_id gnl|my_center|LOCUS_22890 85554 86294 gene locus_tag LOCUS_22900 85554 86294 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815064.1 protein_id gnl|my_center|LOCUS_22900 86341 86529 gene locus_tag LOCUS_22910 86341 86529 CDS product DUF3460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815055.1 protein_id gnl|my_center|LOCUS_22910 86539 87408 gene locus_tag LOCUS_22920 86539 87408 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040572.1 protein_id gnl|my_center|LOCUS_22920 87441 88289 gene locus_tag LOCUS_22930 gene panC 87441 88289 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815051.1 protein_id gnl|my_center|LOCUS_22930 88382 88612 gene locus_tag LOCUS_22940 88382 88612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 88827 89456 gene locus_tag LOCUS_22950 gene coaE 88827 89456 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927124.1 protein_id gnl|my_center|LOCUS_22950 89475 90230 gene locus_tag LOCUS_22960 gene zapD 89475 90230 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815038.1 protein_id gnl|my_center|LOCUS_22960 90555 91562 gene locus_tag LOCUS_22970 90555 91562 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 protein_id gnl|my_center|LOCUS_22970 91559 94657 gene locus_tag LOCUS_22980 91559 94657 CDS product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815034.1 protein_id gnl|my_center|LOCUS_22980 94644 97757 gene locus_tag LOCUS_22990 94644 97757 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064923.1 protein_id gnl|my_center|LOCUS_22990 97768 99201 gene locus_tag LOCUS_23000 97768 99201 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927123.1 protein_id gnl|my_center|LOCUS_23000 99284 100240 gene locus_tag LOCUS_23010 99284 100240 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528649.1 protein_id gnl|my_center|LOCUS_23010 101293 100337 gene locus_tag LOCUS_23020 101293 100337 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815027.1 protein_id gnl|my_center|LOCUS_23020 102191 101319 gene locus_tag LOCUS_23030 102191 101319 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815026.1 protein_id gnl|my_center|LOCUS_23030 102341 103306 gene locus_tag LOCUS_23040 gene ispB 102341 103306 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807467.1 protein_id gnl|my_center|LOCUS_23040 104448 103408 gene locus_tag LOCUS_23050 104448 103408 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930622.1 protein_id gnl|my_center|LOCUS_23050 104724 105482 gene locus_tag LOCUS_23060 gene glnH 104724 105482 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811110.1 protein_id gnl|my_center|LOCUS_23060 105603 106313 gene locus_tag LOCUS_23070 gene glnP 105603 106313 CDS product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811112.1 protein_id gnl|my_center|LOCUS_23070 106310 107038 gene locus_tag LOCUS_23080 gene glnQ 106310 107038 CDS product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811113.1 protein_id gnl|my_center|LOCUS_23080 107065 108930 gene locus_tag LOCUS_23090 gene ilvD 107065 108930 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819105.1 protein_id gnl|my_center|LOCUS_23090 111972 109165 gene locus_tag LOCUS_23100 gene ppc 111972 109165 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064641.1 protein_id gnl|my_center|LOCUS_23100 113000 112221 gene locus_tag LOCUS_23110 113000 112221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970689.1 protein_id gnl|my_center|LOCUS_23110 113803 113000 gene locus_tag LOCUS_23120 113803 113000 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309981.1 protein_id gnl|my_center|LOCUS_23120 114792 113830 gene locus_tag LOCUS_23130 114792 113830 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256048.1 protein_id gnl|my_center|LOCUS_23130 115134 117047 gene locus_tag LOCUS_23140 gene thiC 115134 117047 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929683.1 protein_id gnl|my_center|LOCUS_23140 118433 117060 gene locus_tag LOCUS_23150 gene cysG 118433 117060 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815607.1 protein_id gnl|my_center|LOCUS_23150 119799 118651 gene locus_tag LOCUS_23160 gene proB 119799 118651 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807457.1 protein_id gnl|my_center|LOCUS_23160 120943 119840 gene locus_tag LOCUS_23170 gene obgE 120943 119840 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807459.1 protein_id gnl|my_center|LOCUS_23170 121333 121073 gene locus_tag LOCUS_23180 gene rpmA 121333 121073 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807460.1 protein_id gnl|my_center|LOCUS_23180 121678 121367 gene locus_tag LOCUS_23190 gene rplU 121678 121367 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_23190 122901 121822 gene locus_tag LOCUS_23200 122901 121822 CDS product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547886.1 protein_id gnl|my_center|LOCUS_23200 124134 122908 gene locus_tag LOCUS_23210 gene argJ 124134 122908 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931662.1 protein_id gnl|my_center|LOCUS_23210 125658 124381 gene locus_tag LOCUS_23220 gene hemL 125658 124381 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 protein_id gnl|my_center|LOCUS_23220 126326 125664 gene locus_tag LOCUS_23230 gene thiE 126326 125664 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814984.1 protein_id gnl|my_center|LOCUS_23230 127113 126319 gene locus_tag LOCUS_23240 127113 126319 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814982.1 protein_id gnl|my_center|LOCUS_23240 127252 127404 gene locus_tag LOCUS_23250 127252 127404 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814980.1 protein_id gnl|my_center|LOCUS_23250 127441 128022 gene locus_tag LOCUS_23260 127441 128022 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927118.1 protein_id gnl|my_center|LOCUS_23260 128015 128410 gene locus_tag LOCUS_23270 gene ruvX 128015 128410 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064931.1 protein_id gnl|my_center|LOCUS_23270 128451 128975 gene locus_tag LOCUS_23280 gene pyrR 128451 128975 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 protein_id gnl|my_center|LOCUS_23280 128968 129921 gene locus_tag LOCUS_23290 128968 129921 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_23290 129918 131213 gene locus_tag LOCUS_23300 129918 131213 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 protein_id gnl|my_center|LOCUS_23300 131210 131968 gene locus_tag LOCUS_23310 131210 131968 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929737.1 protein_id gnl|my_center|LOCUS_23310 132870 132061 gene locus_tag LOCUS_23320 132870 132061 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929738.1 protein_id gnl|my_center|LOCUS_23320 134058 132883 gene locus_tag LOCUS_23330 gene lptG 134058 132883 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929739.1 protein_id gnl|my_center|LOCUS_23330 134997 134215 gene locus_tag LOCUS_23340 gene mtgA 134997 134215 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040553.1 protein_id gnl|my_center|LOCUS_23340 135845 134997 gene locus_tag LOCUS_23350 gene aroE 135845 134997 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040552.1 protein_id gnl|my_center|LOCUS_23350 137764 135842 gene locus_tag LOCUS_23360 137764 135842 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931245.1 protein_id gnl|my_center|LOCUS_23360 138300 137776 gene locus_tag LOCUS_23370 138300 137776 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814956.1 protein_id gnl|my_center|LOCUS_23370 139763 138387 gene locus_tag LOCUS_23380 gene mpl 139763 138387 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814955.1 protein_id gnl|my_center|LOCUS_23380 139906 140433 gene locus_tag LOCUS_23390 139906 140433 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040551.1 protein_id gnl|my_center|LOCUS_23390 140529 140969 gene locus_tag LOCUS_23400 gene aroQ 140529 140969 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707111.1 protein_id gnl|my_center|LOCUS_23400 141027 141470 gene locus_tag LOCUS_23410 gene accB 141027 141470 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_23410 141472 142824 gene locus_tag LOCUS_23420 gene accC 141472 142824 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 protein_id gnl|my_center|LOCUS_23420 142890 143807 gene locus_tag LOCUS_23430 gene prmA 142890 143807 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814950.1 protein_id gnl|my_center|LOCUS_23430 143826 144803 gene locus_tag LOCUS_23440 143826 144803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 144816 145760 gene locus_tag LOCUS_23450 144816 145760 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814947.1 protein_id gnl|my_center|LOCUS_23450 146314 145763 gene locus_tag LOCUS_23460 146314 145763 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814933.1 protein_id gnl|my_center|LOCUS_23460 147113 146388 gene locus_tag LOCUS_23470 147113 146388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 149322 147919 gene locus_tag LOCUS_23480 gene gltX 149322 147919 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814917.1 protein_id gnl|my_center|LOCUS_23480 149432 151894 gene locus_tag LOCUS_23490 149432 151894 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064936.1 protein_id gnl|my_center|LOCUS_23490 152575 151895 gene locus_tag LOCUS_23500 152575 151895 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_23500 153127 152582 gene locus_tag LOCUS_23510 gene yjgA 153127 152582 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814897.1 protein_id gnl|my_center|LOCUS_23510 153221 154561 gene locus_tag LOCUS_23520 gene pmbA 153221 154561 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567741.1 protein_id gnl|my_center|LOCUS_23520 154693 155796 gene locus_tag LOCUS_23530 154693 155796 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814893.1 protein_id gnl|my_center|LOCUS_23530 156104 156532 gene locus_tag LOCUS_23540 gene rplM 156104 156532 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927106.1 protein_id gnl|my_center|LOCUS_23540 156542 156934 gene locus_tag LOCUS_23550 gene rpsI 156542 156934 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_23550 157140 158198 gene locus_tag LOCUS_23560 gene argC 157140 158198 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820599.1 protein_id gnl|my_center|LOCUS_23560 158213 158905 gene locus_tag LOCUS_23570 158213 158905 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814436.1 protein_id gnl|my_center|LOCUS_23570 158989 159357 gene locus_tag LOCUS_23580 gene erpA 158989 159357 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_23580 161059 159476 gene locus_tag LOCUS_23590 gene nadB 161059 159476 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_23590 162255 161065 gene locus_tag LOCUS_23600 gene nadA 162255 161065 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185886.1 protein_id gnl|my_center|LOCUS_23600 162433 163377 gene locus_tag LOCUS_23610 162433 163377 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931618.1 protein_id gnl|my_center|LOCUS_23610 164687 163446 gene locus_tag LOCUS_23620 164687 163446 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931222.1 protein_id gnl|my_center|LOCUS_23620 164702 165928 gene locus_tag LOCUS_23630 gene tyrS 164702 165928 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814877.1 protein_id gnl|my_center|LOCUS_23630 165152 165056 gene locus_tag LOCUS_t00440 165152 165056 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 165970 166599 gene locus_tag LOCUS_23640 165970 166599 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814875.1 protein_id gnl|my_center|LOCUS_23640 166632 167876 gene locus_tag LOCUS_23650 166632 167876 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814873.1 protein_id gnl|my_center|LOCUS_23650 167935 168414 gene locus_tag LOCUS_23660 gene nrdR 167935 168414 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 protein_id gnl|my_center|LOCUS_23660 168428 169558 gene locus_tag LOCUS_23670 gene ribD 168428 169558 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931219.1 protein_id gnl|my_center|LOCUS_23670 169578 170183 gene locus_tag LOCUS_23680 169578 170183 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_23680 170259 170346 gene locus_tag LOCUS_t00450 170259 170346 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 171361 170444 gene locus_tag LOCUS_23690 171361 170444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 171857 172132 gene locus_tag LOCUS_23700 171857 172132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 173073 172360 gene locus_tag LOCUS_23710 173073 172360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23710 173513 173235 gene locus_tag LOCUS_23720 173513 173235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23720 173625 174674 gene locus_tag LOCUS_23730 173625 174674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 175171 176136 gene locus_tag LOCUS_23740 175171 176136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 176133 180809 gene locus_tag LOCUS_23750 176133 180809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 180806 181294 gene locus_tag LOCUS_23760 180806 181294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 181616 181765 gene locus_tag LOCUS_23770 181616 181765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 182257 181784 gene locus_tag LOCUS_23780 182257 181784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 182905 183288 gene locus_tag LOCUS_23790 182905 183288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 183293 185128 gene locus_tag LOCUS_23800 183293 185128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 185151 186116 gene locus_tag LOCUS_23810 185151 186116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 186561 186740 gene locus_tag LOCUS_23820 186561 186740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 186896 187537 gene locus_tag LOCUS_23830 186896 187537 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690625.1 protein_id gnl|my_center|LOCUS_23830 187521 187787 gene locus_tag LOCUS_23840 187521 187787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 188045 188563 gene locus_tag LOCUS_23850 gene radC 188045 188563 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148675.1 protein_id gnl|my_center|LOCUS_23850 190832 188742 gene locus_tag LOCUS_23860 gene brxL 190832 188742 CDS product BREX system Lon protease-like protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939301.1 protein_id gnl|my_center|LOCUS_23860 193354 190847 gene locus_tag LOCUS_23870 gene pglZ 193354 190847 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038873.1 protein_id gnl|my_center|LOCUS_23870 194877 193357 gene locus_tag LOCUS_23880 194877 193357 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022342.1 protein_id gnl|my_center|LOCUS_23880 195796 194879 gene locus_tag LOCUS_23890 195796 194879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 199716 196663 gene locus_tag LOCUS_23900 199716 196663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 201518 199713 gene locus_tag LOCUS_23910 201518 199713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 205121 201531 gene locus_tag LOCUS_23920 gene brxC 205121 201531 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228200.1 protein_id gnl|my_center|LOCUS_23920 205729 205118 gene locus_tag LOCUS_23930 205729 205118 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038867.1 protein_id gnl|my_center|LOCUS_23930 206353 205733 gene locus_tag LOCUS_23940 206353 205733 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228220.1 protein_id gnl|my_center|LOCUS_23940 206544 206350 gene locus_tag LOCUS_23950 206544 206350 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_23950 206895 206680 gene locus_tag LOCUS_23960 206895 206680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 207370 208185 gene locus_tag LOCUS_23970 207370 208185 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095238.1 protein_id gnl|my_center|LOCUS_23970 208636 209259 gene locus_tag LOCUS_23980 208636 209259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 209165 209359 gene locus_tag LOCUS_23990 209165 209359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 209449 209877 gene locus_tag LOCUS_24000 209449 209877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 209874 211148 gene locus_tag LOCUS_24010 gene umuC 209874 211148 CDS product DNA polymerase V catalytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457597.1 protein_id gnl|my_center|LOCUS_24010 211283 211546 gene locus_tag LOCUS_24020 211283 211546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24020 211930 212211 gene locus_tag LOCUS_24030 211930 212211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24030 212622 213872 gene locus_tag LOCUS_24040 212622 213872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 213956 214327 gene locus_tag LOCUS_24050 213956 214327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence34 949 425 gene locus_tag LOCUS_24060 949 425 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208113920.1 protein_id gnl|my_center|LOCUS_24060 1429 1055 gene locus_tag LOCUS_24070 1429 1055 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818524.1 protein_id gnl|my_center|LOCUS_24070 2642 1506 gene locus_tag LOCUS_24080 gene bamC 2642 1506 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809956.1 protein_id gnl|my_center|LOCUS_24080 3563 2661 gene locus_tag LOCUS_24090 gene dapA 3563 2661 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809954.1 protein_id gnl|my_center|LOCUS_24090 4341 3718 gene locus_tag LOCUS_24100 4341 3718 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809950.1 protein_id gnl|my_center|LOCUS_24100 4504 4580 gene locus_tag LOCUS_t00460 4504 4580 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4884 6239 gene locus_tag LOCUS_24110 4884 6239 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089807.1 protein_id gnl|my_center|LOCUS_24110 6829 8322 gene locus_tag LOCUS_24120 gene nirK 6829 8322 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200986.1 protein_id gnl|my_center|LOCUS_24120 8495 9379 gene locus_tag LOCUS_24130 8495 9379 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220499.1 protein_id gnl|my_center|LOCUS_24130 9859 11226 gene locus_tag LOCUS_24140 9859 11226 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813945.1 protein_id gnl|my_center|LOCUS_24140 11430 11227 gene locus_tag LOCUS_24150 11430 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 11779 12159 gene locus_tag LOCUS_24160 11779 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 12349 12708 gene locus_tag LOCUS_24170 12349 12708 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813943.1 protein_id gnl|my_center|LOCUS_24170 12730 13215 gene locus_tag LOCUS_24180 12730 13215 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813941.1 protein_id gnl|my_center|LOCUS_24180 13248 13856 gene locus_tag LOCUS_24190 13248 13856 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926963.1 protein_id gnl|my_center|LOCUS_24190 13859 15115 gene locus_tag LOCUS_24200 13859 15115 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813935.1 protein_id gnl|my_center|LOCUS_24200 15142 15633 gene locus_tag LOCUS_24210 gene nuoE 15142 15633 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813932.1 protein_id gnl|my_center|LOCUS_24210 15630 16988 gene locus_tag LOCUS_24220 gene nuoF 15630 16988 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_24220 16998 19307 gene locus_tag LOCUS_24230 gene nuoG 16998 19307 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813928.1 protein_id gnl|my_center|LOCUS_24230 19307 20401 gene locus_tag LOCUS_24240 gene nuoH 19307 20401 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813926.1 protein_id gnl|my_center|LOCUS_24240 20416 20904 gene locus_tag LOCUS_24250 gene nuoI 20416 20904 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_24250 20923 21549 gene locus_tag LOCUS_24260 20923 21549 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 protein_id gnl|my_center|LOCUS_24260 21546 21872 gene locus_tag LOCUS_24270 gene nuoK 21546 21872 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813920.1 protein_id gnl|my_center|LOCUS_24270 21886 23895 gene locus_tag LOCUS_24280 gene nuoL 21886 23895 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813919.1 protein_id gnl|my_center|LOCUS_24280 23897 25387 gene locus_tag LOCUS_24290 23897 25387 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813918.1 protein_id gnl|my_center|LOCUS_24290 25397 26881 gene locus_tag LOCUS_24300 gene nuoN 25397 26881 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_24300 26894 27397 gene locus_tag LOCUS_24310 26894 27397 CDS product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813915.1 protein_id gnl|my_center|LOCUS_24310 28042 29277 gene locus_tag LOCUS_24320 gene torC 28042 29277 CDS product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422246.1 protein_id gnl|my_center|LOCUS_24320 29293 31818 gene locus_tag LOCUS_24330 gene torA 29293 31818 CDS product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462326.1 protein_id gnl|my_center|LOCUS_24330 31896 32582 gene locus_tag LOCUS_24340 gene torD 31896 32582 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983166.1 protein_id gnl|my_center|LOCUS_24340 32626 33270 gene locus_tag LOCUS_24350 gene ccmA 32626 33270 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370110.1 protein_id gnl|my_center|LOCUS_24350 33267 33932 gene locus_tag LOCUS_24360 gene ccmB 33267 33932 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005637214.1 protein_id gnl|my_center|LOCUS_24360 34038 34757 gene locus_tag LOCUS_24370 gene ccmC 34038 34757 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_24370 34770 34991 gene locus_tag LOCUS_24380 34770 34991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 34978 35427 gene locus_tag LOCUS_24390 gene ccmE 34978 35427 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_24390 35432 37450 gene locus_tag LOCUS_24400 35432 37450 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_24400 37447 37977 gene locus_tag LOCUS_24410 37447 37977 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946598.1 protein_id gnl|my_center|LOCUS_24410 37974 38498 gene locus_tag LOCUS_24420 37974 38498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 38495 39436 gene locus_tag LOCUS_24430 38495 39436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 40496 39651 gene locus_tag LOCUS_24440 gene serB 40496 39651 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813898.1 protein_id gnl|my_center|LOCUS_24440 43892 40554 gene locus_tag LOCUS_24450 gene mfd 43892 40554 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065075.1 protein_id gnl|my_center|LOCUS_24450 44296 44994 gene locus_tag LOCUS_24460 gene ispD 44296 44994 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040254.1 protein_id gnl|my_center|LOCUS_24460 45189 45674 gene locus_tag LOCUS_24470 gene ispF 45189 45674 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813893.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence35 674 126 gene locus_tag LOCUS_24480 674 126 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813886.1 protein_id gnl|my_center|LOCUS_24480 2139 736 gene locus_tag LOCUS_24490 2139 736 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813884.1 protein_id gnl|my_center|LOCUS_24490 2889 2155 gene locus_tag LOCUS_24500 gene ompR 2889 2155 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813882.1 protein_id gnl|my_center|LOCUS_24500 3254 4528 gene locus_tag LOCUS_24510 3254 4528 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB/ribosomal protein alanine acetyltransferase RimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926956.1 protein_id gnl|my_center|LOCUS_24510 4536 5447 gene locus_tag LOCUS_24520 4536 5447 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033452148.1 protein_id gnl|my_center|LOCUS_24520 6742 5453 gene locus_tag LOCUS_24530 gene lplT 6742 5453 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813878.1 protein_id gnl|my_center|LOCUS_24530 6962 10546 gene locus_tag LOCUS_24540 gene smc 6962 10546 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813877.1 protein_id gnl|my_center|LOCUS_24540 10568 11647 gene locus_tag LOCUS_24550 10568 11647 CDS product cell division protein ZipA C-terminal FtsZ-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821312.1 protein_id gnl|my_center|LOCUS_24550 11665 13707 gene locus_tag LOCUS_24560 gene ligA 11665 13707 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040247.1 protein_id gnl|my_center|LOCUS_24560 14689 13898 gene locus_tag LOCUS_24570 14689 13898 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813874.1 protein_id gnl|my_center|LOCUS_24570 14967 14707 gene locus_tag LOCUS_24580 14967 14707 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813873.1 protein_id gnl|my_center|LOCUS_24580 15521 14976 gene locus_tag LOCUS_24590 15521 14976 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813872.1 protein_id gnl|my_center|LOCUS_24590 15910 15518 gene locus_tag LOCUS_24600 gene msrB 15910 15518 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813871.1 protein_id gnl|my_center|LOCUS_24600 16175 17350 gene locus_tag LOCUS_24610 16175 17350 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813867.1 protein_id gnl|my_center|LOCUS_24610 17469 18509 gene locus_tag LOCUS_24620 17469 18509 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813866.1 protein_id gnl|my_center|LOCUS_24620 18514 20337 gene locus_tag LOCUS_24630 18514 20337 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813865.1 protein_id gnl|my_center|LOCUS_24630 20334 21077 gene locus_tag LOCUS_24640 20334 21077 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813864.1 protein_id gnl|my_center|LOCUS_24640 21820 21182 gene locus_tag LOCUS_24650 gene nth 21820 21182 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813856.1 protein_id gnl|my_center|LOCUS_24650 22515 21817 gene locus_tag LOCUS_24660 gene rsxB 22515 21817 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813855.1 protein_id gnl|my_center|LOCUS_24660 23803 22571 gene locus_tag LOCUS_24670 gene phaZ 23803 22571 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813854.1 protein_id gnl|my_center|LOCUS_24670 24774 24004 gene locus_tag LOCUS_24680 24774 24004 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813853.1 protein_id gnl|my_center|LOCUS_24680 25120 24797 gene locus_tag LOCUS_24690 25120 24797 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931551.1 protein_id gnl|my_center|LOCUS_24690 25224 26408 gene locus_tag LOCUS_24700 gene pncB 25224 26408 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995174.1 protein_id gnl|my_center|LOCUS_24700 26442 26792 gene locus_tag LOCUS_24710 26442 26792 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813850.1 protein_id gnl|my_center|LOCUS_24710 27352 26849 gene locus_tag LOCUS_24720 27352 26849 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821327.1 protein_id gnl|my_center|LOCUS_24720 27410 29731 gene locus_tag LOCUS_24730 27410 29731 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065079.1 protein_id gnl|my_center|LOCUS_24730 29785 30984 gene locus_tag LOCUS_24740 gene trpB 29785 30984 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813845.1 protein_id gnl|my_center|LOCUS_24740 30997 31836 gene locus_tag LOCUS_24750 gene trpA 30997 31836 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813844.1 protein_id gnl|my_center|LOCUS_24750 31836 32711 gene locus_tag LOCUS_24760 gene accD 31836 32711 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813843.1 protein_id gnl|my_center|LOCUS_24760 32876 33319 gene locus_tag LOCUS_24770 32876 33319 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192378.1 protein_id gnl|my_center|LOCUS_24770 33446 35140 gene locus_tag LOCUS_24780 33446 35140 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039047.1 protein_id gnl|my_center|LOCUS_24780 35154 35336 gene locus_tag LOCUS_24790 35154 35336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 35867 36832 gene locus_tag LOCUS_24800 35867 36832 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929877.1 protein_id gnl|my_center|LOCUS_24800 37059 37697 gene locus_tag LOCUS_24810 37059 37697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 40911 37813 gene locus_tag LOCUS_24820 40911 37813 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459643.1 protein_id gnl|my_center|LOCUS_24820 41454 42407 gene locus_tag LOCUS_24830 41454 42407 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813839.1 protein_id gnl|my_center|LOCUS_24830 42431 43108 gene locus_tag LOCUS_24840 42431 43108 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065082.1 protein_id gnl|my_center|LOCUS_24840 43127 43789 gene locus_tag LOCUS_24850 gene msrQ 43127 43789 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065084.1 protein_id gnl|my_center|LOCUS_24850 43824 44651 gene locus_tag LOCUS_24860 43824 44651 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040228.1 protein_id gnl|my_center|LOCUS_24860 45375 44665 gene locus_tag LOCUS_24870 45375 44665 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821344.1 protein_id gnl|my_center|LOCUS_24870 45982 45368 gene locus_tag LOCUS_24880 45982 45368 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065087.1 protein_id gnl|my_center|LOCUS_24880 46089 46706 gene locus_tag LOCUS_24890 46089 46706 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065088.1 protein_id gnl|my_center|LOCUS_24890 46772 46954 gene locus_tag LOCUS_24900 gene rpmF 46772 46954 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813827.1 protein_id gnl|my_center|LOCUS_24900 47037 48062 gene locus_tag LOCUS_24910 gene plsX 47037 48062 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065089.1 protein_id gnl|my_center|LOCUS_24910 48120 49094 gene locus_tag LOCUS_24920 48120 49094 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447294.1 protein_id gnl|my_center|LOCUS_24920 49119 50051 gene locus_tag LOCUS_24930 gene fabD 49119 50051 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065091.1 protein_id gnl|my_center|LOCUS_24930 50063 50809 gene locus_tag LOCUS_24940 gene fabG 50063 50809 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065092.1 protein_id gnl|my_center|LOCUS_24940 51067 51303 gene locus_tag LOCUS_24950 gene acpP 51067 51303 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 protein_id gnl|my_center|LOCUS_24950 51503 52732 gene locus_tag LOCUS_24960 gene fabF 51503 52732 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040224.1 protein_id gnl|my_center|LOCUS_24960 52821 53171 gene locus_tag LOCUS_24970 52821 53171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 53168 53767 gene locus_tag LOCUS_24980 gene rpoE 53168 53767 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_24980 53779 54288 gene locus_tag LOCUS_24990 53779 54288 CDS product sigma-E factor negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813794.1 protein_id gnl|my_center|LOCUS_24990 54288 55322 gene locus_tag LOCUS_25000 54288 55322 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144922.1 protein_id gnl|my_center|LOCUS_25000 55336 56847 gene locus_tag LOCUS_25010 55336 56847 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813791.1 protein_id gnl|my_center|LOCUS_25010 56930 58723 gene locus_tag LOCUS_25020 gene lepA 56930 58723 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065097.1 protein_id gnl|my_center|LOCUS_25020 58751 59557 gene locus_tag LOCUS_25030 gene lepB 58751 59557 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065098.1 protein_id gnl|my_center|LOCUS_25030 59557 60312 gene locus_tag LOCUS_25040 gene rnc 59557 60312 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853248.1 protein_id gnl|my_center|LOCUS_25040 60309 61202 gene locus_tag LOCUS_25050 gene era 60309 61202 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813784.1 protein_id gnl|my_center|LOCUS_25050 61240 61785 gene locus_tag LOCUS_25060 gene recO 61240 61785 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065100.1 protein_id gnl|my_center|LOCUS_25060 61857 63560 gene locus_tag LOCUS_25070 gene muiA 61857 63560 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_25070 64427 63735 gene locus_tag LOCUS_25080 64427 63735 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040216.1 protein_id gnl|my_center|LOCUS_25080 65084 64647 gene locus_tag LOCUS_25090 65084 64647 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065106.1 protein_id gnl|my_center|LOCUS_25090 66589 65090 gene locus_tag LOCUS_25100 66589 65090 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821370.1 protein_id gnl|my_center|LOCUS_25100 66644 67750 gene locus_tag LOCUS_25110 gene lptF 66644 67750 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065108.1 protein_id gnl|my_center|LOCUS_25110 67823 68770 gene locus_tag LOCUS_25120 67823 68770 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813758.1 protein_id gnl|my_center|LOCUS_25120 70464 68803 gene locus_tag LOCUS_25130 70464 68803 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039376.1 protein_id gnl|my_center|LOCUS_25130 72469 70538 gene locus_tag LOCUS_25140 72469 70538 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064156.1 protein_id gnl|my_center|LOCUS_25140 73758 72466 gene locus_tag LOCUS_25150 73758 72466 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810114.1 protein_id gnl|my_center|LOCUS_25150 76070 73755 gene locus_tag LOCUS_25160 76070 73755 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039380.1 protein_id gnl|my_center|LOCUS_25160 76293 76637 gene locus_tag LOCUS_25170 76293 76637 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930920.1 protein_id gnl|my_center|LOCUS_25170 77385 76717 gene locus_tag LOCUS_25180 77385 76717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 79491 77845 gene locus_tag LOCUS_25190 79491 77845 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449775.1 protein_id gnl|my_center|LOCUS_25190 79661 80113 gene locus_tag LOCUS_25200 79661 80113 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813730.1 protein_id gnl|my_center|LOCUS_25200 80206 80904 gene locus_tag LOCUS_25210 80206 80904 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065123.1 protein_id gnl|my_center|LOCUS_25210 80916 81569 gene locus_tag LOCUS_25220 80916 81569 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813726.1 protein_id gnl|my_center|LOCUS_25220 82064 81687 gene locus_tag LOCUS_25230 82064 81687 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811293.1 protein_id gnl|my_center|LOCUS_25230 82337 83503 gene locus_tag LOCUS_25240 82337 83503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 83519 83881 gene locus_tag LOCUS_25250 83519 83881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 83924 84544 gene locus_tag LOCUS_25260 83924 84544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 84590 85081 gene locus_tag LOCUS_25270 84590 85081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 85078 88572 gene locus_tag LOCUS_25280 85078 88572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 88757 90547 gene locus_tag LOCUS_25290 88757 90547 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031274664.1 protein_id gnl|my_center|LOCUS_25290 91599 90544 gene locus_tag LOCUS_25300 91599 90544 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_25300 91698 92579 gene locus_tag LOCUS_25310 gene gigC 91698 92579 CDS product LysR family transcriptional regulator GigC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120024.1 protein_id gnl|my_center|LOCUS_25310 92791 92576 gene locus_tag LOCUS_25320 92791 92576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 93208 93041 gene locus_tag LOCUS_25330 gene rpmG 93208 93041 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810296.1 protein_id gnl|my_center|LOCUS_25330 93492 93256 gene locus_tag LOCUS_25340 gene rpmB 93492 93256 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216391.1 protein_id gnl|my_center|LOCUS_25340 95014 93824 gene locus_tag LOCUS_25350 95014 93824 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080561929.1 protein_id gnl|my_center|LOCUS_25350 96401 94992 gene locus_tag LOCUS_25360 96401 94992 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930260.1 protein_id gnl|my_center|LOCUS_25360 98149 96407 gene locus_tag LOCUS_25370 98149 96407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040117.1 protein_id gnl|my_center|LOCUS_25370 98547 98281 gene locus_tag LOCUS_25380 98547 98281 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810513.1 protein_id gnl|my_center|LOCUS_25380 99048 98728 gene locus_tag LOCUS_25390 99048 98728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815930.1 protein_id gnl|my_center|LOCUS_25390 99888 99211 gene locus_tag LOCUS_25400 gene radC 99888 99211 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810520.1 protein_id gnl|my_center|LOCUS_25400 99934 100410 gene locus_tag LOCUS_25410 99934 100410 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818626.1 protein_id gnl|my_center|LOCUS_25410 100410 101351 gene locus_tag LOCUS_25420 gene ispH 100410 101351 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446429.1 protein_id gnl|my_center|LOCUS_25420 101368 102015 gene locus_tag LOCUS_25430 gene maiA 101368 102015 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_25430 102608 101997 gene locus_tag LOCUS_25440 102608 101997 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930865.1 protein_id gnl|my_center|LOCUS_25440 103093 102623 gene locus_tag LOCUS_25450 gene rlmH 103093 102623 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813199.1 protein_id gnl|my_center|LOCUS_25450 103508 103104 gene locus_tag LOCUS_25460 gene rsfS 103508 103104 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813196.1 protein_id gnl|my_center|LOCUS_25460 104125 103538 gene locus_tag LOCUS_25470 gene nadD 104125 103538 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930864.1 protein_id gnl|my_center|LOCUS_25470 105033 104125 gene locus_tag LOCUS_25480 gene hemF 105033 104125 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930863.1 protein_id gnl|my_center|LOCUS_25480 106312 105035 gene locus_tag LOCUS_25490 gene purD 106312 105035 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930862.1 protein_id gnl|my_center|LOCUS_25490 107062 106328 gene locus_tag LOCUS_25500 107062 106328 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813187.1 protein_id gnl|my_center|LOCUS_25500 107177 108667 gene locus_tag LOCUS_25510 107177 108667 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 protein_id gnl|my_center|LOCUS_25510 109277 108747 gene locus_tag LOCUS_25520 109277 108747 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813149.1 protein_id gnl|my_center|LOCUS_25520 109412 110398 gene locus_tag LOCUS_25530 109412 110398 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813144.1 protein_id gnl|my_center|LOCUS_25530 110454 111518 gene locus_tag LOCUS_25540 110454 111518 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_25540 112510 111500 gene locus_tag LOCUS_25550 112510 111500 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_25550 115245 112531 gene locus_tag LOCUS_25560 gene pepN 115245 112531 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039536.1 protein_id gnl|my_center|LOCUS_25560 115405 116019 gene locus_tag LOCUS_25570 115405 116019 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039537.1 protein_id gnl|my_center|LOCUS_25570 116006 117460 gene locus_tag LOCUS_25580 gene tldD 116006 117460 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931196.1 protein_id gnl|my_center|LOCUS_25580 117747 118820 gene locus_tag LOCUS_25590 gene aroG 117747 118820 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813056.1 protein_id gnl|my_center|LOCUS_25590 118999 120486 gene locus_tag LOCUS_25600 118999 120486 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813050.1 protein_id gnl|my_center|LOCUS_25600 120491 121591 gene locus_tag LOCUS_25610 gene glcE 120491 121591 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813049.1 protein_id gnl|my_center|LOCUS_25610 121601 122830 gene locus_tag LOCUS_25620 gene glcF 121601 122830 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813047.1 protein_id gnl|my_center|LOCUS_25620 122866 123978 gene locus_tag LOCUS_25630 gene mnmA 122866 123978 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039549.1 protein_id gnl|my_center|LOCUS_25630 124006 125385 gene locus_tag LOCUS_25640 gene purB 124006 125385 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446450.1 protein_id gnl|my_center|LOCUS_25640 125563 126009 gene locus_tag LOCUS_25650 125563 126009 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813017.1 protein_id gnl|my_center|LOCUS_25650 126909 126181 gene locus_tag LOCUS_25660 126909 126181 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_25660 127057 127641 gene locus_tag LOCUS_25670 127057 127641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 127723 128322 gene locus_tag LOCUS_25680 127723 128322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 128446 128922 gene locus_tag LOCUS_25690 128446 128922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 129065 130711 gene locus_tag LOCUS_25700 129065 130711 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064121.1 protein_id gnl|my_center|LOCUS_25700 131285 130779 gene locus_tag LOCUS_25710 131285 130779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 132736 131414 gene locus_tag LOCUS_25720 132736 131414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 132897 133391 gene locus_tag LOCUS_25730 132897 133391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 133382 133708 gene locus_tag LOCUS_25740 133382 133708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 134159 134677 gene locus_tag LOCUS_25750 134159 134677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 134677 135654 gene locus_tag LOCUS_25760 134677 135654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 135877 136044 gene locus_tag LOCUS_25770 135877 136044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 136421 138424 gene locus_tag LOCUS_25780 136421 138424 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385729.1 protein_id gnl|my_center|LOCUS_25780 138427 139755 gene locus_tag LOCUS_25790 138427 139755 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167385843.1 protein_id gnl|my_center|LOCUS_25790 139865 140929 gene locus_tag LOCUS_25800 139865 140929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25800 140857 143148 gene locus_tag LOCUS_25810 140857 143148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25810 143161 144510 gene locus_tag LOCUS_25820 143161 144510 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281642.1 protein_id gnl|my_center|LOCUS_25820 144962 145393 gene locus_tag LOCUS_25830 144962 145393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence36 320 1951 gene locus_tag LOCUS_25840 320 1951 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038744.1 protein_id gnl|my_center|LOCUS_25840 2377 2180 gene locus_tag LOCUS_25850 2377 2180 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523495.1 protein_id gnl|my_center|LOCUS_25850 2647 3666 gene locus_tag LOCUS_25860 2647 3666 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973040.1 protein_id gnl|my_center|LOCUS_25860 3682 4746 gene locus_tag LOCUS_25870 3682 4746 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205191.1 protein_id gnl|my_center|LOCUS_25870 5847 4861 gene locus_tag LOCUS_25880 5847 4861 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535938.1 protein_id gnl|my_center|LOCUS_25880 6639 5869 gene locus_tag LOCUS_25890 6639 5869 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229007.1 protein_id gnl|my_center|LOCUS_25890 8026 6692 gene locus_tag LOCUS_25900 8026 6692 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921638.1 protein_id gnl|my_center|LOCUS_25900 9228 8035 gene locus_tag LOCUS_25910 9228 8035 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089103.1 protein_id gnl|my_center|LOCUS_25910 10169 9252 gene locus_tag LOCUS_25920 10169 9252 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083524.1 protein_id gnl|my_center|LOCUS_25920 11317 10166 gene locus_tag LOCUS_25930 11317 10166 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931674.1 protein_id gnl|my_center|LOCUS_25930 12114 11320 gene locus_tag LOCUS_25940 12114 11320 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921513.1 protein_id gnl|my_center|LOCUS_25940 13110 12124 gene locus_tag LOCUS_25950 13110 12124 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 protein_id gnl|my_center|LOCUS_25950 13216 14013 gene locus_tag LOCUS_25960 13216 14013 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267602.1 protein_id gnl|my_center|LOCUS_25960 14463 14050 gene locus_tag LOCUS_25970 14463 14050 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929743.1 protein_id gnl|my_center|LOCUS_25970 15635 14466 gene locus_tag LOCUS_25980 15635 14466 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929744.1 protein_id gnl|my_center|LOCUS_25980 16640 15660 gene locus_tag LOCUS_25990 16640 15660 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 protein_id gnl|my_center|LOCUS_25990 18272 16701 gene locus_tag LOCUS_26000 18272 16701 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084147.1 protein_id gnl|my_center|LOCUS_26000 18417 18983 gene locus_tag LOCUS_26010 18417 18983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 19132 20121 gene locus_tag LOCUS_26020 19132 20121 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811475.1 protein_id gnl|my_center|LOCUS_26020 21294 20326 gene locus_tag LOCUS_26030 21294 20326 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065172.1 protein_id gnl|my_center|LOCUS_26030 21998 21315 gene locus_tag LOCUS_26040 21998 21315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807136.1 protein_id gnl|my_center|LOCUS_26040 22283 23251 gene locus_tag LOCUS_26050 22283 23251 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974584.1 protein_id gnl|my_center|LOCUS_26050 23253 24308 gene locus_tag LOCUS_26060 23253 24308 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966058.1 protein_id gnl|my_center|LOCUS_26060 25255 24323 gene locus_tag LOCUS_26070 25255 24323 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807997.1 protein_id gnl|my_center|LOCUS_26070 25365 25904 gene locus_tag LOCUS_26080 25365 25904 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965676.1 protein_id gnl|my_center|LOCUS_26080 25904 26503 gene locus_tag LOCUS_26090 25904 26503 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267478.1 protein_id gnl|my_center|LOCUS_26090 26525 28003 gene locus_tag LOCUS_26100 26525 28003 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243012.1 protein_id gnl|my_center|LOCUS_26100 28110 29318 gene locus_tag LOCUS_26110 gene chrA 28110 29318 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_26110 30342 29404 gene locus_tag LOCUS_26120 30342 29404 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124047.1 protein_id gnl|my_center|LOCUS_26120 31266 30640 gene locus_tag LOCUS_26130 31266 30640 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454888.1 protein_id gnl|my_center|LOCUS_26130 31554 31979 gene locus_tag LOCUS_26140 31554 31979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 32797 32033 gene locus_tag LOCUS_26150 32797 32033 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038723.1 protein_id gnl|my_center|LOCUS_26150 33077 32886 gene locus_tag LOCUS_26160 33077 32886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 34545 33289 gene locus_tag LOCUS_26170 gene rho 34545 33289 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810577.1 protein_id gnl|my_center|LOCUS_26170 34958 34632 gene locus_tag LOCUS_26180 gene trxA 34958 34632 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852918.1 protein_id gnl|my_center|LOCUS_26180 35136 37142 gene locus_tag LOCUS_26190 35136 37142 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033451799.1 protein_id gnl|my_center|LOCUS_26190 37142 39448 gene locus_tag LOCUS_26200 gene parC 37142 39448 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063976.1 protein_id gnl|my_center|LOCUS_26200 39548 40603 gene locus_tag LOCUS_26210 39548 40603 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930577.1 protein_id gnl|my_center|LOCUS_26210 40730 41128 gene locus_tag LOCUS_26220 40730 41128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 41272 43887 gene locus_tag LOCUS_26230 gene alaS 41272 43887 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810664.1 protein_id gnl|my_center|LOCUS_26230 43890 44129 gene locus_tag LOCUS_26240 43890 44129 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063946.1 protein_id gnl|my_center|LOCUS_26240 44275 44529 gene locus_tag LOCUS_26250 gene rpsP 44275 44529 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926757.1 protein_id gnl|my_center|LOCUS_26250 44636 45229 gene locus_tag LOCUS_26260 gene rimM 44636 45229 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930592.1 protein_id gnl|my_center|LOCUS_26260 45229 45993 gene locus_tag LOCUS_26270 gene trmD 45229 45993 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063943.1 protein_id gnl|my_center|LOCUS_26270 46036 47016 gene locus_tag LOCUS_26280 46036 47016 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528459.1 protein_id gnl|my_center|LOCUS_26280 47265 47729 gene locus_tag LOCUS_26290 47265 47729 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_26290 47869 48372 gene locus_tag LOCUS_26300 gene iscR 47869 48372 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039699.1 protein_id gnl|my_center|LOCUS_26300 48391 49602 gene locus_tag LOCUS_26310 48391 49602 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930570.1 protein_id gnl|my_center|LOCUS_26310 49623 50006 gene locus_tag LOCUS_26320 gene iscU 49623 50006 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 protein_id gnl|my_center|LOCUS_26320 50009 50332 gene locus_tag LOCUS_26330 gene iscA 50009 50332 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039700.1 protein_id gnl|my_center|LOCUS_26330 50344 50844 gene locus_tag LOCUS_26340 gene hscB 50344 50844 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812456.1 protein_id gnl|my_center|LOCUS_26340 50874 52736 gene locus_tag LOCUS_26350 gene hscA 50874 52736 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930571.1 protein_id gnl|my_center|LOCUS_26350 52748 53089 gene locus_tag LOCUS_26360 gene fdx 52748 53089 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812453.1 protein_id gnl|my_center|LOCUS_26360 53109 53969 gene locus_tag LOCUS_26370 53109 53969 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092745.1 protein_id gnl|my_center|LOCUS_26370 54354 55199 gene locus_tag LOCUS_26380 54354 55199 CDS product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339025.1 protein_id gnl|my_center|LOCUS_26380 55309 56172 gene locus_tag LOCUS_26390 55309 56172 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981018.1 protein_id gnl|my_center|LOCUS_26390 56186 57106 gene locus_tag LOCUS_26400 56186 57106 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972350.1 protein_id gnl|my_center|LOCUS_26400 57103 57861 gene locus_tag LOCUS_26410 57103 57861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226767.1 protein_id gnl|my_center|LOCUS_26410 57897 58355 gene locus_tag LOCUS_26420 57897 58355 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927831.1 protein_id gnl|my_center|LOCUS_26420 59575 58544 gene locus_tag LOCUS_26430 59575 58544 CDS product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704233.1 protein_id gnl|my_center|LOCUS_26430 64036 59600 gene locus_tag LOCUS_26440 64036 59600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704232.1 protein_id gnl|my_center|LOCUS_26440 64911 64039 gene locus_tag LOCUS_26450 64911 64039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704231.1 protein_id gnl|my_center|LOCUS_26450 66380 64914 gene locus_tag LOCUS_26460 66380 64914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704230.1 protein_id gnl|my_center|LOCUS_26460 67987 66464 gene locus_tag LOCUS_26470 gene lysS 67987 66464 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816835.1 protein_id gnl|my_center|LOCUS_26470 68752 67997 gene locus_tag LOCUS_26480 68752 67997 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063645.1 protein_id gnl|my_center|LOCUS_26480 69820 68753 gene locus_tag LOCUS_26490 gene prfB 69820 68753 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926448.1 protein_id gnl|my_center|LOCUS_26490 71936 70215 gene locus_tag LOCUS_26500 gene recJ 71936 70215 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446709.1 protein_id gnl|my_center|LOCUS_26500 72871 71912 gene locus_tag LOCUS_26510 72871 71912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063646.1 protein_id gnl|my_center|LOCUS_26510 72991 74157 gene locus_tag LOCUS_26520 72991 74157 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816839.1 protein_id gnl|my_center|LOCUS_26520 74150 74854 gene locus_tag LOCUS_26530 gene lolD 74150 74854 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812422.1 protein_id gnl|my_center|LOCUS_26530 74945 75745 gene locus_tag LOCUS_26540 74945 75745 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816840.1 protein_id gnl|my_center|LOCUS_26540 75806 78277 gene locus_tag LOCUS_26550 75806 78277 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039712.1 protein_id gnl|my_center|LOCUS_26550 78330 79259 gene locus_tag LOCUS_26560 78330 79259 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039713.1 protein_id gnl|my_center|LOCUS_26560 79286 80134 gene locus_tag LOCUS_26570 79286 80134 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_26570 80138 80698 gene locus_tag LOCUS_26580 gene greB 80138 80698 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_26580 81536 80679 gene locus_tag LOCUS_26590 gene rlmJ 81536 80679 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063881.1 protein_id gnl|my_center|LOCUS_26590 82320 81565 gene locus_tag LOCUS_26600 gene ugpQ 82320 81565 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811044.1 protein_id gnl|my_center|LOCUS_26600 82517 84469 gene locus_tag LOCUS_26610 82517 84469 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063879.1 protein_id gnl|my_center|LOCUS_26610 85254 84616 gene locus_tag LOCUS_26620 85254 84616 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447512.1 protein_id gnl|my_center|LOCUS_26620 85244 85930 gene locus_tag LOCUS_26630 85244 85930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_26630 88214 85920 gene locus_tag LOCUS_26640 88214 85920 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811115.1 protein_id gnl|my_center|LOCUS_26640 88449 88243 gene locus_tag LOCUS_26650 gene rpoZ 88449 88243 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811126.1 protein_id gnl|my_center|LOCUS_26650 89127 88489 gene locus_tag LOCUS_26660 gene gmk 89127 88489 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930442.1 protein_id gnl|my_center|LOCUS_26660 89288 90049 gene locus_tag LOCUS_26670 89288 90049 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 protein_id gnl|my_center|LOCUS_26670 90163 92043 gene locus_tag LOCUS_26680 90163 92043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 92073 94532 gene locus_tag LOCUS_26690 92073 94532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 95283 96161 gene locus_tag LOCUS_26700 95283 96161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 97153 96170 gene locus_tag LOCUS_26710 97153 96170 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806967.1 protein_id gnl|my_center|LOCUS_26710 98494 97586 gene locus_tag LOCUS_26720 98494 97586 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811148.1 protein_id gnl|my_center|LOCUS_26720 98590 99387 gene locus_tag LOCUS_26730 gene rph 98590 99387 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811149.1 protein_id gnl|my_center|LOCUS_26730 99431 100036 gene locus_tag LOCUS_26740 gene rdgB 99431 100036 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930449.1 protein_id gnl|my_center|LOCUS_26740 100048 101277 gene locus_tag LOCUS_26750 gene hemW 100048 101277 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039962.1 protein_id gnl|my_center|LOCUS_26750 101467 102879 gene locus_tag LOCUS_26760 gene glnA 101467 102879 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039961.1 protein_id gnl|my_center|LOCUS_26760 102923 104008 gene locus_tag LOCUS_26770 gene glnL 102923 104008 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811167.1 protein_id gnl|my_center|LOCUS_26770 104005 105552 gene locus_tag LOCUS_26780 gene ntrC 104005 105552 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930451.1 protein_id gnl|my_center|LOCUS_26780 106332 105562 gene locus_tag LOCUS_26790 106332 105562 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811180.1 protein_id gnl|my_center|LOCUS_26790 108011 106338 gene locus_tag LOCUS_26800 108011 106338 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930454.1 protein_id gnl|my_center|LOCUS_26800 109074 108079 gene locus_tag LOCUS_26810 109074 108079 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811185.1 protein_id gnl|my_center|LOCUS_26810 109295 109681 gene locus_tag LOCUS_26820 109295 109681 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811198.1 protein_id gnl|my_center|LOCUS_26820 109753 111774 gene locus_tag LOCUS_26830 gene recG 109753 111774 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446218.1 protein_id gnl|my_center|LOCUS_26830 111904 112869 gene locus_tag LOCUS_26840 111904 112869 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_26840 112976 115054 gene locus_tag LOCUS_26850 112976 115054 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103159.1 protein_id gnl|my_center|LOCUS_26850 115237 116355 gene locus_tag LOCUS_26860 115237 116355 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811246.1 protein_id gnl|my_center|LOCUS_26860 117582 116491 gene locus_tag LOCUS_26870 117582 116491 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930289.1 protein_id gnl|my_center|LOCUS_26870 118444 117599 gene locus_tag LOCUS_26880 gene ugpE 118444 117599 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 protein_id gnl|my_center|LOCUS_26880 119349 118468 gene locus_tag LOCUS_26890 gene ugpA 119349 118468 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811262.1 protein_id gnl|my_center|LOCUS_26890 120737 119427 gene locus_tag LOCUS_26900 gene ugpB 120737 119427 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039943.1 protein_id gnl|my_center|LOCUS_26900 121107 121943 gene locus_tag LOCUS_26910 gene proC 121107 121943 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811267.1 protein_id gnl|my_center|LOCUS_26910 121943 122506 gene locus_tag LOCUS_26920 121943 122506 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039942.1 protein_id gnl|my_center|LOCUS_26920 122597 123526 gene locus_tag LOCUS_26930 gene livH 122597 123526 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811272.1 protein_id gnl|my_center|LOCUS_26930 123526 124758 gene locus_tag LOCUS_26940 123526 124758 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811274.1 protein_id gnl|my_center|LOCUS_26940 124751 125518 gene locus_tag LOCUS_26950 gene livG 124751 125518 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811277.1 protein_id gnl|my_center|LOCUS_26950 125519 126220 gene locus_tag LOCUS_26960 125519 126220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811279.1 protein_id gnl|my_center|LOCUS_26960 127217 126393 gene locus_tag LOCUS_26970 127217 126393 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 protein_id gnl|my_center|LOCUS_26970 127857 127240 gene locus_tag LOCUS_26980 127857 127240 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446818.1 protein_id gnl|my_center|LOCUS_26980 129934 127880 gene locus_tag LOCUS_26990 129934 127880 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248379.1 protein_id gnl|my_center|LOCUS_26990 130796 129948 gene locus_tag LOCUS_27000 gene folD 130796 129948 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811948.1 protein_id gnl|my_center|LOCUS_27000 131423 130818 gene locus_tag LOCUS_27010 131423 130818 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930126.1 protein_id gnl|my_center|LOCUS_27010 133173 131440 gene locus_tag LOCUS_27020 133173 131440 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817147.1 protein_id gnl|my_center|LOCUS_27020 133510 136218 gene locus_tag LOCUS_27030 gene aceE 133510 136218 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930127.1 protein_id gnl|my_center|LOCUS_27030 136230 137924 gene locus_tag LOCUS_27040 gene aceF 136230 137924 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 protein_id gnl|my_center|LOCUS_27040 137940 139685 gene locus_tag LOCUS_27050 gene lpdA 137940 139685 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459591.1 protein_id gnl|my_center|LOCUS_27050 139806 141101 gene locus_tag LOCUS_27060 gene folC 139806 141101 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039854.1 protein_id gnl|my_center|LOCUS_27060 141137 142054 gene locus_tag LOCUS_27070 141137 142054 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852965.1 protein_id gnl|my_center|LOCUS_27070 142059 142550 gene locus_tag LOCUS_27080 142059 142550 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811815.1 protein_id gnl|my_center|LOCUS_27080 142710 144113 gene locus_tag LOCUS_27090 gene purF 142710 144113 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811814.1 protein_id gnl|my_center|LOCUS_27090 144603 144121 gene locus_tag LOCUS_27100 144603 144121 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811812.1 protein_id gnl|my_center|LOCUS_27100 145319 144618 gene locus_tag LOCUS_27110 145319 144618 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811810.1 protein_id gnl|my_center|LOCUS_27110 147934 145316 gene locus_tag LOCUS_27120 147934 145316 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811808.1 protein_id gnl|my_center|LOCUS_27120 148738 147938 gene locus_tag LOCUS_27130 gene map 148738 147938 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811806.1 protein_id gnl|my_center|LOCUS_27130 148948 149703 gene locus_tag LOCUS_27140 gene rpsB 148948 149703 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811803.1 protein_id gnl|my_center|LOCUS_27140 149843 150715 gene locus_tag LOCUS_27150 gene tsf 149843 150715 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926570.1 protein_id gnl|my_center|LOCUS_27150 150836 151552 gene locus_tag LOCUS_27160 gene pyrH 150836 151552 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926571.1 protein_id gnl|my_center|LOCUS_27160 151563 152123 gene locus_tag LOCUS_27170 gene frr 151563 152123 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811796.1 protein_id gnl|my_center|LOCUS_27170 152170 152925 gene locus_tag LOCUS_27180 gene uppS 152170 152925 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930350.1 protein_id gnl|my_center|LOCUS_27180 152938 153810 gene locus_tag LOCUS_27190 152938 153810 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063744.1 protein_id gnl|my_center|LOCUS_27190 153817 154992 gene locus_tag LOCUS_27200 153817 154992 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063745.1 protein_id gnl|my_center|LOCUS_27200 155010 156341 gene locus_tag LOCUS_27210 gene rseP 155010 156341 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063746.1 protein_id gnl|my_center|LOCUS_27210 156445 158814 gene locus_tag LOCUS_27220 gene bamA 156445 158814 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039863.1 protein_id gnl|my_center|LOCUS_27220 158920 159525 gene locus_tag LOCUS_27230 158920 159525 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 protein_id gnl|my_center|LOCUS_27230 159528 160613 gene locus_tag LOCUS_27240 gene lpxD 159528 160613 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930354.1 protein_id gnl|my_center|LOCUS_27240 160694 161143 gene locus_tag LOCUS_27250 gene fabZ 160694 161143 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811776.1 protein_id gnl|my_center|LOCUS_27250 161146 161937 gene locus_tag LOCUS_27260 gene lpxA 161146 161937 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063749.1 protein_id gnl|my_center|LOCUS_27260 161937 163112 gene locus_tag LOCUS_27270 gene lpxB 161937 163112 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811772.1 protein_id gnl|my_center|LOCUS_27270 163117 163722 gene locus_tag LOCUS_27280 gene rnhB 163117 163722 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811770.1 protein_id gnl|my_center|LOCUS_27280 163940 164935 gene locus_tag LOCUS_27290 163940 164935 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536249.1 protein_id gnl|my_center|LOCUS_27290 165001 165867 gene locus_tag LOCUS_27300 165001 165867 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063752.1 protein_id gnl|my_center|LOCUS_27300 166788 165958 gene locus_tag LOCUS_27310 166788 165958 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063753.1 protein_id gnl|my_center|LOCUS_27310 166955 169327 gene locus_tag LOCUS_27320 gene ppsA 166955 169327 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811764.1 protein_id gnl|my_center|LOCUS_27320 169511 169840 gene locus_tag LOCUS_27330 169511 169840 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_27330 169879 170337 gene locus_tag LOCUS_27340 169879 170337 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063756.1 protein_id gnl|my_center|LOCUS_27340 170348 171286 gene locus_tag LOCUS_27350 170348 171286 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063757.1 protein_id gnl|my_center|LOCUS_27350 171283 172914 gene locus_tag LOCUS_27360 gene mdlC 171283 172914 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727769.1 protein_id gnl|my_center|LOCUS_27360 173441 172986 gene locus_tag LOCUS_27370 gene smpB 173441 172986 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063759.1 protein_id gnl|my_center|LOCUS_27370 173684 174073 gene locus_tag LOCUS_27380 173684 174073 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811752.1 protein_id gnl|my_center|LOCUS_27380 174060 174428 gene locus_tag LOCUS_27390 174060 174428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 174457 175590 gene locus_tag LOCUS_27400 174457 175590 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063762.1 protein_id gnl|my_center|LOCUS_27400 176626 175628 gene locus_tag LOCUS_27410 176626 175628 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063766.1 protein_id gnl|my_center|LOCUS_27410 176822 177862 gene locus_tag LOCUS_27420 gene mltG 176822 177862 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446696.1 protein_id gnl|my_center|LOCUS_27420 177862 178497 gene locus_tag LOCUS_27430 gene tmk 177862 178497 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811733.1 protein_id gnl|my_center|LOCUS_27430 178484 179524 gene locus_tag LOCUS_27440 gene holB 178484 179524 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063767.1 protein_id gnl|my_center|LOCUS_27440 179553 180323 gene locus_tag LOCUS_27450 179553 180323 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930598.1 protein_id gnl|my_center|LOCUS_27450 180428 181057 gene locus_tag LOCUS_27460 180428 181057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 181070 181849 gene locus_tag LOCUS_27470 181070 181849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 181978 183273 gene locus_tag LOCUS_27480 181978 183273 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039875.1 protein_id gnl|my_center|LOCUS_27480 184071 183367 gene locus_tag LOCUS_27490 184071 183367 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930296.1 protein_id gnl|my_center|LOCUS_27490 184550 184068 gene locus_tag LOCUS_27500 184550 184068 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919598.1 protein_id gnl|my_center|LOCUS_27500 185440 184547 gene locus_tag LOCUS_27510 185440 184547 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921297.1 protein_id gnl|my_center|LOCUS_27510 186617 185637 gene locus_tag LOCUS_27520 186617 185637 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814324.1 protein_id gnl|my_center|LOCUS_27520 186923 187342 gene locus_tag LOCUS_27530 186923 187342 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389385.1 protein_id gnl|my_center|LOCUS_27530 187532 187368 gene locus_tag LOCUS_27540 187532 187368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 187675 188250 gene locus_tag LOCUS_27550 187675 188250 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532242.1 protein_id gnl|my_center|LOCUS_27550 188778 189158 gene locus_tag LOCUS_27560 188778 189158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 189152 189769 gene locus_tag LOCUS_27570 189152 189769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence37 74 1282 gene locus_tag LOCUS_27580 74 1282 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309930.1 protein_id gnl|my_center|LOCUS_27580 1710 1348 gene locus_tag LOCUS_27590 1710 1348 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017693214.1 protein_id gnl|my_center|LOCUS_27590 2650 1715 gene locus_tag LOCUS_27600 gene fmt 2650 1715 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064701.1 protein_id gnl|my_center|LOCUS_27600 2909 3781 gene locus_tag LOCUS_27610 2909 3781 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198019.1 protein_id gnl|my_center|LOCUS_27610 4765 3848 gene locus_tag LOCUS_27620 4765 3848 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 protein_id gnl|my_center|LOCUS_27620 6013 4859 gene locus_tag LOCUS_27630 gene dprA 6013 4859 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 protein_id gnl|my_center|LOCUS_27630 6395 6901 gene locus_tag LOCUS_27640 gene def 6395 6901 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807300.1 protein_id gnl|my_center|LOCUS_27640 8305 6941 gene locus_tag LOCUS_27650 8305 6941 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532501.1 protein_id gnl|my_center|LOCUS_27650 10198 8654 gene locus_tag LOCUS_27660 10198 8654 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694565.1 protein_id gnl|my_center|LOCUS_27660 11997 10195 gene locus_tag LOCUS_27670 11997 10195 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050273.1 protein_id gnl|my_center|LOCUS_27670 13027 11981 gene locus_tag LOCUS_27680 gene mdtN 13027 11981 CDS product multidrug transporter subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210376.1 protein_id gnl|my_center|LOCUS_27680 13288 13031 gene locus_tag LOCUS_27690 13288 13031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 14821 13529 gene locus_tag LOCUS_27700 14821 13529 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818460.1 protein_id gnl|my_center|LOCUS_27700 15651 14827 gene locus_tag LOCUS_27710 15651 14827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807257.1 protein_id gnl|my_center|LOCUS_27710 17086 15758 gene locus_tag LOCUS_27720 17086 15758 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448384.1 protein_id gnl|my_center|LOCUS_27720 18223 17159 gene locus_tag LOCUS_27730 18223 17159 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_27730 19178 18249 gene locus_tag LOCUS_27740 19178 18249 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807265.1 protein_id gnl|my_center|LOCUS_27740 19980 19186 gene locus_tag LOCUS_27750 19980 19186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 protein_id gnl|my_center|LOCUS_27750 21956 19983 gene locus_tag LOCUS_27760 21956 19983 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807270.1 protein_id gnl|my_center|LOCUS_27760 22155 22823 gene locus_tag LOCUS_27770 22155 22823 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807272.1 protein_id gnl|my_center|LOCUS_27770 23516 22830 gene locus_tag LOCUS_27780 23516 22830 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807283.1 protein_id gnl|my_center|LOCUS_27780 23648 24133 gene locus_tag LOCUS_27790 23648 24133 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815410.1 protein_id gnl|my_center|LOCUS_27790 25139 24186 gene locus_tag LOCUS_27800 25139 24186 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808868.1 protein_id gnl|my_center|LOCUS_27800 25546 26421 gene locus_tag LOCUS_27810 gene tesB 25546 26421 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706717.1 protein_id gnl|my_center|LOCUS_27810 26617 27945 gene locus_tag LOCUS_27820 26617 27945 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_27820 28241 29371 gene locus_tag LOCUS_27830 28241 29371 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813224.1 protein_id gnl|my_center|LOCUS_27830 29368 30105 gene locus_tag LOCUS_27840 29368 30105 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813221.1 protein_id gnl|my_center|LOCUS_27840 30352 31047 gene locus_tag LOCUS_27850 30352 31047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 31688 31143 gene locus_tag LOCUS_27860 gene rfbC 31688 31143 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_27860 32070 33350 gene locus_tag LOCUS_27870 32070 33350 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289498.1 protein_id gnl|my_center|LOCUS_27870 34220 33351 gene locus_tag LOCUS_27880 gene rfbA 34220 33351 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261023.1 protein_id gnl|my_center|LOCUS_27880 35319 34225 gene locus_tag LOCUS_27890 gene rffG 35319 34225 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261022.1 protein_id gnl|my_center|LOCUS_27890 36124 37263 gene locus_tag LOCUS_27900 36124 37263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 37322 38458 gene locus_tag LOCUS_27910 gene rffA 37322 38458 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 protein_id gnl|my_center|LOCUS_27910 38864 39922 gene locus_tag LOCUS_27920 38864 39922 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108800.1 protein_id gnl|my_center|LOCUS_27920 39924 40883 gene locus_tag LOCUS_27930 39924 40883 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407612.1 protein_id gnl|my_center|LOCUS_27930 40876 41529 gene locus_tag LOCUS_27940 40876 41529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 41526 42473 gene locus_tag LOCUS_27950 41526 42473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 42518 42895 gene locus_tag LOCUS_27960 42518 42895 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531148.1 protein_id gnl|my_center|LOCUS_27960 44954 42927 gene locus_tag LOCUS_27970 44954 42927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 46151 45018 gene locus_tag LOCUS_27980 46151 45018 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102573.1 protein_id gnl|my_center|LOCUS_27980 49145 46161 gene locus_tag LOCUS_27990 49145 46161 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877559.1 protein_id gnl|my_center|LOCUS_27990 50326 49145 gene locus_tag LOCUS_28000 50326 49145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 51546 50326 gene locus_tag LOCUS_28010 51546 50326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096884.1 protein_id gnl|my_center|LOCUS_28010 52346 51546 gene locus_tag LOCUS_28020 52346 51546 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096887.1 protein_id gnl|my_center|LOCUS_28020 53511 52381 gene locus_tag LOCUS_28030 53511 52381 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266713.1 protein_id gnl|my_center|LOCUS_28030 54442 53522 gene locus_tag LOCUS_28040 54442 53522 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035851.1 protein_id gnl|my_center|LOCUS_28040 55484 54450 gene locus_tag LOCUS_28050 gene gmd 55484 54450 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414986.1 protein_id gnl|my_center|LOCUS_28050 56968 55541 gene locus_tag LOCUS_28060 56968 55541 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706705.1 protein_id gnl|my_center|LOCUS_28060 58374 57394 gene locus_tag LOCUS_28070 gene lipA 58374 57394 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189177.1 protein_id gnl|my_center|LOCUS_28070 59791 58508 gene locus_tag LOCUS_28080 59791 58508 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065061.1 protein_id gnl|my_center|LOCUS_28080 61532 59916 gene locus_tag LOCUS_28090 61532 59916 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_28090 62358 61735 gene locus_tag LOCUS_28100 gene lipB 62358 61735 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064724.1 protein_id gnl|my_center|LOCUS_28100 62641 62363 gene locus_tag LOCUS_28110 62641 62363 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 protein_id gnl|my_center|LOCUS_28110 63507 62638 gene locus_tag LOCUS_28120 63507 62638 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_28120 65011 63722 gene locus_tag LOCUS_28130 65011 63722 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_28130 65772 65122 gene locus_tag LOCUS_28140 65772 65122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807136.1 protein_id gnl|my_center|LOCUS_28140 65942 65778 gene locus_tag LOCUS_28150 65942 65778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 66751 65945 gene locus_tag LOCUS_28160 66751 65945 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807125.1 protein_id gnl|my_center|LOCUS_28160 67624 66761 gene locus_tag LOCUS_28170 67624 66761 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447888.1 protein_id gnl|my_center|LOCUS_28170 69018 67654 gene locus_tag LOCUS_28180 69018 67654 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929616.1 protein_id gnl|my_center|LOCUS_28180 69974 69021 gene locus_tag LOCUS_28190 gene waaC 69974 69021 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905414.1 protein_id gnl|my_center|LOCUS_28190 70219 71538 gene locus_tag LOCUS_28200 70219 71538 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190374.1 protein_id gnl|my_center|LOCUS_28200 71657 72181 gene locus_tag LOCUS_28210 71657 72181 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808796.1 protein_id gnl|my_center|LOCUS_28210 73506 72523 gene locus_tag LOCUS_28220 73506 72523 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807040.1 protein_id gnl|my_center|LOCUS_28220 74166 73522 gene locus_tag LOCUS_28230 74166 73522 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447056.1 protein_id gnl|my_center|LOCUS_28230 74462 75373 gene locus_tag LOCUS_28240 74462 75373 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_28240 75569 76942 gene locus_tag LOCUS_28250 75569 76942 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194222.1 protein_id gnl|my_center|LOCUS_28250 77055 77714 gene locus_tag LOCUS_28260 gene maiA 77055 77714 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781198.1 protein_id gnl|my_center|LOCUS_28260 78843 77935 gene locus_tag LOCUS_28270 78843 77935 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706106.1 protein_id gnl|my_center|LOCUS_28270 79377 78919 gene locus_tag LOCUS_28280 gene hpaR 79377 78919 CDS product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194637.1 protein_id gnl|my_center|LOCUS_28280 80549 79374 gene locus_tag LOCUS_28290 80549 79374 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194462.1 protein_id gnl|my_center|LOCUS_28290 81390 80590 gene locus_tag LOCUS_28300 81390 80590 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194455.1 protein_id gnl|my_center|LOCUS_28300 82549 81662 gene locus_tag LOCUS_28310 82549 81662 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213466.1 protein_id gnl|my_center|LOCUS_28310 82951 83271 gene locus_tag LOCUS_28320 82951 83271 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207911.1 protein_id gnl|my_center|LOCUS_28320 83264 84937 gene locus_tag LOCUS_28330 83264 84937 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202721.1 protein_id gnl|my_center|LOCUS_28330 85014 86975 gene locus_tag LOCUS_28340 gene acs 85014 86975 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926941.1 protein_id gnl|my_center|LOCUS_28340 88895 87105 gene locus_tag LOCUS_28350 gene aspS 88895 87105 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807038.1 protein_id gnl|my_center|LOCUS_28350 89201 88968 gene locus_tag LOCUS_28360 89201 88968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 90655 89339 gene locus_tag LOCUS_28370 90655 89339 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929970.1 protein_id gnl|my_center|LOCUS_28370 90934 91860 gene locus_tag LOCUS_28380 gene ubiA 90934 91860 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931589.1 protein_id gnl|my_center|LOCUS_28380 91976 95800 gene locus_tag LOCUS_28390 gene putA 91976 95800 CDS product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064076.1 protein_id gnl|my_center|LOCUS_28390 96988 95951 gene locus_tag LOCUS_28400 96988 95951 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812403.1 protein_id gnl|my_center|LOCUS_28400 98325 97027 gene locus_tag LOCUS_28410 98325 97027 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931068.1 protein_id gnl|my_center|LOCUS_28410 98867 98322 gene locus_tag LOCUS_28420 98867 98322 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816847.1 protein_id gnl|my_center|LOCUS_28420 99219 100715 gene locus_tag LOCUS_28430 gene putP 99219 100715 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689473.1 protein_id gnl|my_center|LOCUS_28430 101371 100784 gene locus_tag LOCUS_28440 101371 100784 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_28440 102131 101415 gene locus_tag LOCUS_28450 102131 101415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446410.1 protein_id gnl|my_center|LOCUS_28450 102877 102128 gene locus_tag LOCUS_28460 102877 102128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040563.1 protein_id gnl|my_center|LOCUS_28460 103788 102874 gene locus_tag LOCUS_28470 103788 102874 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815011.1 protein_id gnl|my_center|LOCUS_28470 104793 103873 gene locus_tag LOCUS_28480 104793 103873 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815013.1 protein_id gnl|my_center|LOCUS_28480 105990 104824 gene locus_tag LOCUS_28490 105990 104824 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 protein_id gnl|my_center|LOCUS_28490 106225 106899 gene locus_tag LOCUS_28500 106225 106899 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820519.1 protein_id gnl|my_center|LOCUS_28500 107819 106968 gene locus_tag LOCUS_28510 gene cysW 107819 106968 CDS product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141290.1 protein_id gnl|my_center|LOCUS_28510 108635 107829 gene locus_tag LOCUS_28520 gene cysT 108635 107829 CDS product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458420.1 protein_id gnl|my_center|LOCUS_28520 109698 108688 gene locus_tag LOCUS_28530 gene cysP 109698 108688 CDS product thiosulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973096.1 protein_id gnl|my_center|LOCUS_28530 111166 110057 gene locus_tag LOCUS_28540 111166 110057 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096677.1 protein_id gnl|my_center|LOCUS_28540 112050 111256 gene locus_tag LOCUS_28550 112050 111256 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183806887.1 protein_id gnl|my_center|LOCUS_28550 112323 112922 gene locus_tag LOCUS_28560 112323 112922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_28560 113196 114593 gene locus_tag LOCUS_28570 113196 114593 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 protein_id gnl|my_center|LOCUS_28570 114613 116154 gene locus_tag LOCUS_28580 gene gadC 114613 116154 CDS product acid resistance gamma-aminobutyrate antiporter GadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246015.1 protein_id gnl|my_center|LOCUS_28580 116910 116419 gene locus_tag LOCUS_28590 gene ssb 116910 116419 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_28590 118239 117004 gene locus_tag LOCUS_28600 118239 117004 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806952.1 protein_id gnl|my_center|LOCUS_28600 118377 121262 gene locus_tag LOCUS_28610 gene uvrA 118377 121262 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925694.1 protein_id gnl|my_center|LOCUS_28610 122864 121242 gene locus_tag LOCUS_28620 122864 121242 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534776.1 protein_id gnl|my_center|LOCUS_28620 123110 123616 gene locus_tag LOCUS_28630 123110 123616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 123640 124221 gene locus_tag LOCUS_28640 123640 124221 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_28640 124214 124681 gene locus_tag LOCUS_28650 124214 124681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 124687 125136 gene locus_tag LOCUS_28660 124687 125136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 125929 125210 gene locus_tag LOCUS_28670 125929 125210 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_28670 126302 125919 gene locus_tag LOCUS_28680 126302 125919 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084165.1 protein_id gnl|my_center|LOCUS_28680 127244 126366 gene locus_tag LOCUS_28690 127244 126366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 128459 127335 gene locus_tag LOCUS_28700 128459 127335 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806949.1 protein_id gnl|my_center|LOCUS_28700 129548 128466 gene locus_tag LOCUS_28710 gene aroB 129548 128466 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806948.1 protein_id gnl|my_center|LOCUS_28710 130040 129552 gene locus_tag LOCUS_28720 130040 129552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 130392 132719 gene locus_tag LOCUS_28730 130392 132719 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038661.1 protein_id gnl|my_center|LOCUS_28730 133185 132856 gene locus_tag LOCUS_28740 gene cyaY 133185 132856 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806945.1 protein_id gnl|my_center|LOCUS_28740 133223 133468 gene locus_tag LOCUS_28750 133223 133468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 133514 134806 gene locus_tag LOCUS_28760 gene lysA 133514 134806 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806944.1 protein_id gnl|my_center|LOCUS_28760 135171 136739 gene locus_tag LOCUS_28770 135171 136739 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815168.1 protein_id gnl|my_center|LOCUS_28770 136751 137911 gene locus_tag LOCUS_28780 gene cydB 136751 137911 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567834.1 protein_id gnl|my_center|LOCUS_28780 138018 139772 gene locus_tag LOCUS_28790 gene cydD 138018 139772 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064910.1 protein_id gnl|my_center|LOCUS_28790 139769 141469 gene locus_tag LOCUS_28800 gene cydC 139769 141469 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815160.1 protein_id gnl|my_center|LOCUS_28800 142977 141625 gene locus_tag LOCUS_28810 gene ccsB 142977 141625 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806943.1 protein_id gnl|my_center|LOCUS_28810 145077 142987 gene locus_tag LOCUS_28820 145077 142987 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806942.1 protein_id gnl|my_center|LOCUS_28820 145889 145191 gene locus_tag LOCUS_28830 145889 145191 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806941.1 protein_id gnl|my_center|LOCUS_28830 146063 146686 gene locus_tag LOCUS_28840 gene yihA 146063 146686 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806940.1 protein_id gnl|my_center|LOCUS_28840 146683 147696 gene locus_tag LOCUS_28850 gene hemB 146683 147696 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064749.1 protein_id gnl|my_center|LOCUS_28850 147910 148173 gene locus_tag LOCUS_28860 147910 148173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 148237 148602 gene locus_tag LOCUS_28870 148237 148602 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038658.1 protein_id gnl|my_center|LOCUS_28870 148612 150504 gene locus_tag LOCUS_28880 gene dsbD 148612 150504 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806937.1 protein_id gnl|my_center|LOCUS_28880 151161 150520 gene locus_tag LOCUS_28890 151161 150520 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970671.1 protein_id gnl|my_center|LOCUS_28890 152873 151170 gene locus_tag LOCUS_28900 152873 151170 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967786.1 protein_id gnl|my_center|LOCUS_28900 153756 152914 gene locus_tag LOCUS_28910 153756 152914 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968114.1 protein_id gnl|my_center|LOCUS_28910 154416 154027 gene locus_tag LOCUS_28920 gene rplQ 154416 154027 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806934.1 protein_id gnl|my_center|LOCUS_28920 155556 154573 gene locus_tag LOCUS_28930 gene rpoA 155556 154573 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064754.1 protein_id gnl|my_center|LOCUS_28930 156397 155774 gene locus_tag LOCUS_28940 gene rpsD 156397 155774 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806931.1 protein_id gnl|my_center|LOCUS_28940 156813 156415 gene locus_tag LOCUS_28950 gene rpsK 156813 156415 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806930.1 protein_id gnl|my_center|LOCUS_28950 157194 156829 gene locus_tag LOCUS_28960 gene rpsM 157194 156829 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806929.1 protein_id gnl|my_center|LOCUS_28960 157583 157365 gene locus_tag LOCUS_28970 gene infA 157583 157365 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521905.1 protein_id gnl|my_center|LOCUS_28970 158923 157589 gene locus_tag LOCUS_28980 gene secY 158923 157589 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_28980 159376 158936 gene locus_tag LOCUS_28990 gene rplO 159376 158936 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806925.1 protein_id gnl|my_center|LOCUS_28990 159575 159387 gene locus_tag LOCUS_29000 gene rpmD 159575 159387 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806924.1 protein_id gnl|my_center|LOCUS_29000 160100 159579 gene locus_tag LOCUS_29010 gene rpsE 160100 159579 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806923.1 protein_id gnl|my_center|LOCUS_29010 160481 160116 gene locus_tag LOCUS_29020 gene rplR 160481 160116 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806922.1 protein_id gnl|my_center|LOCUS_29020 161036 160503 gene locus_tag LOCUS_29030 gene rplF 161036 160503 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064757.1 protein_id gnl|my_center|LOCUS_29030 161442 161047 gene locus_tag LOCUS_29040 gene rpsH 161442 161047 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806920.1 protein_id gnl|my_center|LOCUS_29040 161758 161453 gene locus_tag LOCUS_29050 gene rpsN 161758 161453 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806919.1 protein_id gnl|my_center|LOCUS_29050 162309 161770 gene locus_tag LOCUS_29060 gene rplE 162309 161770 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806918.1 protein_id gnl|my_center|LOCUS_29060 162643 162323 gene locus_tag LOCUS_29070 gene rplX 162643 162323 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038655.1 protein_id gnl|my_center|LOCUS_29070 163022 162654 gene locus_tag LOCUS_29080 gene rplN 163022 162654 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806916.1 protein_id gnl|my_center|LOCUS_29080 164249 163410 gene locus_tag LOCUS_29090 164249 163410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768044.1 protein_id gnl|my_center|LOCUS_29090 165505 164246 gene locus_tag LOCUS_29100 165505 164246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113206.1 protein_id gnl|my_center|LOCUS_29100 166675 165557 gene locus_tag LOCUS_29110 gene potA 166675 165557 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085109.1 protein_id gnl|my_center|LOCUS_29110 168058 166688 gene locus_tag LOCUS_29120 168058 166688 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086907.1 protein_id gnl|my_center|LOCUS_29120 169670 168192 gene locus_tag LOCUS_29130 169670 168192 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555084.1 protein_id gnl|my_center|LOCUS_29130 169991 171034 gene locus_tag LOCUS_29140 169991 171034 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099539.1 protein_id gnl|my_center|LOCUS_29140 171193 172383 gene locus_tag LOCUS_29150 171193 172383 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704591.1 protein_id gnl|my_center|LOCUS_29150 172444 173877 gene locus_tag LOCUS_29160 172444 173877 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806915.1 protein_id gnl|my_center|LOCUS_29160 174061 173906 gene locus_tag LOCUS_29170 174061 173906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 174103 174882 gene locus_tag LOCUS_29180 174103 174882 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821323.1 protein_id gnl|my_center|LOCUS_29180 174884 175603 gene locus_tag LOCUS_29190 174884 175603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813858.1 protein_id gnl|my_center|LOCUS_29190 175635 176852 gene locus_tag LOCUS_29200 175635 176852 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040237.1 protein_id gnl|my_center|LOCUS_29200 176960 177847 gene locus_tag LOCUS_29210 176960 177847 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813860.1 protein_id gnl|my_center|LOCUS_29210 177844 178827 gene locus_tag LOCUS_29220 177844 178827 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813861.1 protein_id gnl|my_center|LOCUS_29220 179006 179980 gene locus_tag LOCUS_29230 179006 179980 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814324.1 protein_id gnl|my_center|LOCUS_29230 180173 180631 gene locus_tag LOCUS_29240 180173 180631 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820744.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence38 194 961 gene locus_tag LOCUS_29250 194 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 1200 1934 gene locus_tag LOCUS_29260 1200 1934 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 protein_id gnl|my_center|LOCUS_29260 2472 1999 gene locus_tag LOCUS_29270 2472 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 3000 2530 gene locus_tag LOCUS_29280 3000 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 3112 5385 gene locus_tag LOCUS_29290 3112 5385 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206223.1 protein_id gnl|my_center|LOCUS_29290 5404 5808 gene locus_tag LOCUS_29300 gene cueR 5404 5808 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613681.1 protein_id gnl|my_center|LOCUS_29300 7042 5789 gene locus_tag LOCUS_29310 7042 5789 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196258.1 protein_id gnl|my_center|LOCUS_29310 7857 7066 gene locus_tag LOCUS_29320 7857 7066 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813551.1 protein_id gnl|my_center|LOCUS_29320 7928 8923 gene locus_tag LOCUS_29330 7928 8923 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974587.1 protein_id gnl|my_center|LOCUS_29330 9039 10655 gene locus_tag LOCUS_29340 9039 10655 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064742.1 protein_id gnl|my_center|LOCUS_29340 10858 11649 gene locus_tag LOCUS_29350 10858 11649 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_29350 11689 12639 gene locus_tag LOCUS_29360 gene cysD 11689 12639 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213549.1 protein_id gnl|my_center|LOCUS_29360 12643 13965 gene locus_tag LOCUS_29370 12643 13965 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522575.1 protein_id gnl|my_center|LOCUS_29370 14277 15272 gene locus_tag LOCUS_29380 gene rhuM 14277 15272 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_29380 15687 15887 gene locus_tag LOCUS_29390 15687 15887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 16077 17633 gene locus_tag LOCUS_29400 16077 17633 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933539.1 protein_id gnl|my_center|LOCUS_29400 17630 18772 gene locus_tag LOCUS_29410 17630 18772 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870274.1 protein_id gnl|my_center|LOCUS_29410 18785 19822 gene locus_tag LOCUS_29420 18785 19822 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939813.1 protein_id gnl|my_center|LOCUS_29420 19819 22917 gene locus_tag LOCUS_29430 19819 22917 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141537.1 protein_id gnl|my_center|LOCUS_29430 24239 23172 gene locus_tag LOCUS_29440 24239 23172 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027092.1 protein_id gnl|my_center|LOCUS_29440 24531 26327 gene locus_tag LOCUS_29450 24531 26327 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668011.1 protein_id gnl|my_center|LOCUS_29450 26759 26379 gene locus_tag LOCUS_29460 26759 26379 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_29460 26907 27668 gene locus_tag LOCUS_29470 26907 27668 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664344.1 protein_id gnl|my_center|LOCUS_29470 27803 30262 gene locus_tag LOCUS_29480 gene rnr 27803 30262 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931522.1 protein_id gnl|my_center|LOCUS_29480 30284 31024 gene locus_tag LOCUS_29490 gene rlmB 30284 31024 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812973.1 protein_id gnl|my_center|LOCUS_29490 31054 32310 gene locus_tag LOCUS_29500 31054 32310 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812972.1 protein_id gnl|my_center|LOCUS_29500 32513 32785 gene locus_tag LOCUS_29510 32513 32785 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_29510 32968 33942 gene locus_tag LOCUS_29520 gene moaA 32968 33942 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083204.1 protein_id gnl|my_center|LOCUS_29520 34562 33999 gene locus_tag LOCUS_29530 gene mog 34562 33999 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602158.1 protein_id gnl|my_center|LOCUS_29530 34666 35148 gene locus_tag LOCUS_29540 gene moaC 34666 35148 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_29540 35212 35955 gene locus_tag LOCUS_29550 gene modA 35212 35955 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205679.1 protein_id gnl|my_center|LOCUS_29550 35974 36636 gene locus_tag LOCUS_29560 gene modB 35974 36636 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553595.1 protein_id gnl|my_center|LOCUS_29560 36638 37318 gene locus_tag LOCUS_29570 36638 37318 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190506.1 protein_id gnl|my_center|LOCUS_29570 37595 40708 gene locus_tag LOCUS_29580 gene fdnG 37595 40708 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830448.1 protein_id gnl|my_center|LOCUS_29580 40720 41634 gene locus_tag LOCUS_29590 gene fdxH 40720 41634 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528944.1 protein_id gnl|my_center|LOCUS_29590 41634 42281 gene locus_tag LOCUS_29600 gene fdoI 41634 42281 CDS product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209610.1 protein_id gnl|my_center|LOCUS_29600 42395 43201 gene locus_tag LOCUS_29610 gene fdhD 42395 43201 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209612.1 protein_id gnl|my_center|LOCUS_29610 43212 44138 gene locus_tag LOCUS_29620 gene fdhE 43212 44138 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551971.1 protein_id gnl|my_center|LOCUS_29620 45487 44279 gene locus_tag LOCUS_29630 gene moeA 45487 44279 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693918.1 protein_id gnl|my_center|LOCUS_29630 46092 45487 gene locus_tag LOCUS_29640 gene mobA 46092 45487 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693194.1 protein_id gnl|my_center|LOCUS_29640 46553 46089 gene locus_tag LOCUS_29650 gene moaE 46553 46089 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350081.1 protein_id gnl|my_center|LOCUS_29650 46802 46554 gene locus_tag LOCUS_29660 gene moaD 46802 46554 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193789.1 protein_id gnl|my_center|LOCUS_29660 47031 47106 gene locus_tag LOCUS_t00470 47031 47106 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 47488 47264 gene locus_tag LOCUS_29670 47488 47264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 47947 49086 gene locus_tag LOCUS_29680 47947 49086 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670244.1 protein_id gnl|my_center|LOCUS_29680 49083 52139 gene locus_tag LOCUS_29690 49083 52139 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072762.1 protein_id gnl|my_center|LOCUS_29690 52593 52165 gene locus_tag LOCUS_29700 gene arsC 52593 52165 CDS product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007372636.1 protein_id gnl|my_center|LOCUS_29700 53125 52568 gene locus_tag LOCUS_29710 gene ogt 53125 52568 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816337.1 protein_id gnl|my_center|LOCUS_29710 53223 53897 gene locus_tag LOCUS_29720 53223 53897 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820363.1 protein_id gnl|my_center|LOCUS_29720 53961 55082 gene locus_tag LOCUS_29730 53961 55082 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064110.1 protein_id gnl|my_center|LOCUS_29730 57222 55069 gene locus_tag LOCUS_29740 57222 55069 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966626.1 protein_id gnl|my_center|LOCUS_29740 59196 57853 gene locus_tag LOCUS_29750 gene argG 59196 57853 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223213.1 protein_id gnl|my_center|LOCUS_29750 60197 59253 gene locus_tag LOCUS_29760 gene argF 60197 59253 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064107.1 protein_id gnl|my_center|LOCUS_29760 60352 60666 gene locus_tag LOCUS_29770 60352 60666 CDS product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812933.1 protein_id gnl|my_center|LOCUS_29770 60991 60728 gene locus_tag LOCUS_29780 gene rpsT 60991 60728 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812908.1 protein_id gnl|my_center|LOCUS_29780 62638 61130 gene locus_tag LOCUS_29790 gene murJ 62638 61130 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039578.1 protein_id gnl|my_center|LOCUS_29790 63597 62839 gene locus_tag LOCUS_29800 63597 62839 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812901.1 protein_id gnl|my_center|LOCUS_29800 64272 63616 gene locus_tag LOCUS_29810 gene adk 64272 63616 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812899.1 protein_id gnl|my_center|LOCUS_29810 65110 64346 gene locus_tag LOCUS_29820 gene kdsB 65110 64346 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_29820 65295 65110 gene locus_tag LOCUS_29830 65295 65110 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196455.1 protein_id gnl|my_center|LOCUS_29830 66404 65316 gene locus_tag LOCUS_29840 gene lpxK 66404 65316 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931123.1 protein_id gnl|my_center|LOCUS_29840 66854 68110 gene locus_tag LOCUS_29850 gene xseA 66854 68110 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812887.1 protein_id gnl|my_center|LOCUS_29850 68145 68723 gene locus_tag LOCUS_29860 gene sodB 68145 68723 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931119.1 protein_id gnl|my_center|LOCUS_29860 69170 68829 gene locus_tag LOCUS_29870 69170 68829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 69706 69215 gene locus_tag LOCUS_29880 69706 69215 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039582.1 protein_id gnl|my_center|LOCUS_29880 69966 69721 gene locus_tag LOCUS_29890 69966 69721 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812875.1 protein_id gnl|my_center|LOCUS_29890 70210 70518 gene locus_tag LOCUS_29900 gene clpS 70210 70518 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820400.1 protein_id gnl|my_center|LOCUS_29900 70571 72871 gene locus_tag LOCUS_29910 gene clpA 70571 72871 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447476.1 protein_id gnl|my_center|LOCUS_29910 72871 74151 gene locus_tag LOCUS_29920 72871 74151 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064079.1 protein_id gnl|my_center|LOCUS_29920 74210 75931 gene locus_tag LOCUS_29930 74210 75931 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928611.1 protein_id gnl|my_center|LOCUS_29930 76058 76618 gene locus_tag LOCUS_29940 76058 76618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 76708 77829 gene locus_tag LOCUS_29950 76708 77829 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812588.1 protein_id gnl|my_center|LOCUS_29950 78908 77898 gene locus_tag LOCUS_29960 78908 77898 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931671.1 protein_id gnl|my_center|LOCUS_29960 79376 78930 gene locus_tag LOCUS_29970 gene dut 79376 78930 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 protein_id gnl|my_center|LOCUS_29970 79798 79373 gene locus_tag LOCUS_29980 79798 79373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 80483 79827 gene locus_tag LOCUS_29990 80483 79827 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816758.1 protein_id gnl|my_center|LOCUS_29990 81713 80517 gene locus_tag LOCUS_30000 gene coaBC 81713 80517 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928305.1 protein_id gnl|my_center|LOCUS_30000 82222 81710 gene locus_tag LOCUS_30010 gene lspA 82222 81710 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812559.1 protein_id gnl|my_center|LOCUS_30010 85076 82215 gene locus_tag LOCUS_30020 gene ileS 85076 82215 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064040.1 protein_id gnl|my_center|LOCUS_30020 86031 85066 gene locus_tag LOCUS_30030 86031 85066 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930543.1 protein_id gnl|my_center|LOCUS_30030 86079 86741 gene locus_tag LOCUS_30040 gene purN 86079 86741 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064038.1 protein_id gnl|my_center|LOCUS_30040 86747 88321 gene locus_tag LOCUS_30050 86747 88321 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450216.1 protein_id gnl|my_center|LOCUS_30050 88594 89799 gene locus_tag LOCUS_30060 88594 89799 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812548.1 protein_id gnl|my_center|LOCUS_30060 89796 92063 gene locus_tag LOCUS_30070 89796 92063 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812546.1 protein_id gnl|my_center|LOCUS_30070 92120 92281 gene locus_tag LOCUS_30080 92120 92281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 92360 92436 gene locus_tag LOCUS_t00480 92360 92436 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 93740 93255 gene locus_tag LOCUS_30090 93740 93255 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_30090 95751 93724 gene locus_tag LOCUS_30100 95751 93724 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969242.1 protein_id gnl|my_center|LOCUS_30100 96450 96214 gene locus_tag LOCUS_30110 96450 96214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 96784 96545 gene locus_tag LOCUS_30120 96784 96545 CDS product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673491.1 protein_id gnl|my_center|LOCUS_30120 97313 97684 gene locus_tag LOCUS_30130 97313 97684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 97808 98065 gene locus_tag LOCUS_30140 97808 98065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 98377 98126 gene locus_tag LOCUS_30150 98377 98126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 98807 99238 gene locus_tag LOCUS_30160 98807 99238 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 protein_id gnl|my_center|LOCUS_30160 99990 99235 gene locus_tag LOCUS_30170 99990 99235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 102160 100235 gene locus_tag LOCUS_30180 102160 100235 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810990.1 protein_id gnl|my_center|LOCUS_30180 102783 102157 gene locus_tag LOCUS_30190 102783 102157 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810992.1 protein_id gnl|my_center|LOCUS_30190 104069 102903 gene locus_tag LOCUS_30200 104069 102903 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969663.1 protein_id gnl|my_center|LOCUS_30200 105135 105494 gene locus_tag LOCUS_30210 gene flhD 105135 105494 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811931.1 protein_id gnl|my_center|LOCUS_30210 105491 106081 gene locus_tag LOCUS_30220 gene flhC 105491 106081 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811929.1 protein_id gnl|my_center|LOCUS_30220 106310 107893 gene locus_tag LOCUS_30230 106310 107893 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811863.1 protein_id gnl|my_center|LOCUS_30230 108018 108881 gene locus_tag LOCUS_30240 gene motA 108018 108881 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039839.1 protein_id gnl|my_center|LOCUS_30240 108891 110675 gene locus_tag LOCUS_30250 108891 110675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 110687 112915 gene locus_tag LOCUS_30260 gene cheA 110687 112915 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205291.1 protein_id gnl|my_center|LOCUS_30260 112918 113397 gene locus_tag LOCUS_30270 112918 113397 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083938.1 protein_id gnl|my_center|LOCUS_30270 113397 114218 gene locus_tag LOCUS_30280 113397 114218 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525698.1 protein_id gnl|my_center|LOCUS_30280 114236 115318 gene locus_tag LOCUS_30290 114236 115318 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811913.1 protein_id gnl|my_center|LOCUS_30290 115358 115762 gene locus_tag LOCUS_30300 gene cheY 115358 115762 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811911.1 protein_id gnl|my_center|LOCUS_30300 115820 116494 gene locus_tag LOCUS_30310 gene cheZ 115820 116494 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817162.1 protein_id gnl|my_center|LOCUS_30310 116647 117816 gene locus_tag LOCUS_30320 gene flhB 116647 117816 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930321.1 protein_id gnl|my_center|LOCUS_30320 117854 119956 gene locus_tag LOCUS_30330 gene flhA 117854 119956 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811905.1 protein_id gnl|my_center|LOCUS_30330 120548 120036 gene locus_tag LOCUS_30340 120548 120036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 120858 120562 gene locus_tag LOCUS_30350 120858 120562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 121738 121022 gene locus_tag LOCUS_30360 121738 121022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 121910 122317 gene locus_tag LOCUS_30370 gene flgB 121910 122317 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811894.1 protein_id gnl|my_center|LOCUS_30370 122333 122752 gene locus_tag LOCUS_30380 gene flgC 122333 122752 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197251.1 protein_id gnl|my_center|LOCUS_30380 122769 123443 gene locus_tag LOCUS_30390 122769 123443 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811889.1 protein_id gnl|my_center|LOCUS_30390 123474 124928 gene locus_tag LOCUS_30400 123474 124928 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817180.1 protein_id gnl|my_center|LOCUS_30400 124947 125717 gene locus_tag LOCUS_30410 124947 125717 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817181.1 protein_id gnl|my_center|LOCUS_30410 125776 126561 gene locus_tag LOCUS_30420 gene flgG 125776 126561 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811883.1 protein_id gnl|my_center|LOCUS_30420 126591 127289 gene locus_tag LOCUS_30430 126591 127289 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447174.1 protein_id gnl|my_center|LOCUS_30430 127329 128444 gene locus_tag LOCUS_30440 127329 128444 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817185.1 protein_id gnl|my_center|LOCUS_30440 128460 129503 gene locus_tag LOCUS_30450 gene flgJ 128460 129503 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811877.1 protein_id gnl|my_center|LOCUS_30450 129601 131253 gene locus_tag LOCUS_30460 gene flgK 129601 131253 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811875.1 protein_id gnl|my_center|LOCUS_30460 131265 132500 gene locus_tag LOCUS_30470 gene flgL 131265 132500 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037107.1 protein_id gnl|my_center|LOCUS_30470 132517 133953 gene locus_tag LOCUS_30480 132517 133953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 134733 133954 gene locus_tag LOCUS_30490 gene fliR 134733 133954 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_30490 135043 134774 gene locus_tag LOCUS_30500 gene fliQ 135043 134774 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811859.1 protein_id gnl|my_center|LOCUS_30500 136155 135076 gene locus_tag LOCUS_30510 136155 135076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 136618 136187 gene locus_tag LOCUS_30520 gene fliN 136618 136187 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282098.1 protein_id gnl|my_center|LOCUS_30520 137731 136631 gene locus_tag LOCUS_30530 gene fliM 137731 136631 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811852.1 protein_id gnl|my_center|LOCUS_30530 138240 137734 gene locus_tag LOCUS_30540 gene fliL 138240 137734 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_30540 139789 138389 gene locus_tag LOCUS_30550 139789 138389 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063739.1 protein_id gnl|my_center|LOCUS_30550 140255 139794 gene locus_tag LOCUS_30560 140255 139794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 141706 140252 gene locus_tag LOCUS_30570 gene fliI 141706 140252 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039848.1 protein_id gnl|my_center|LOCUS_30570 142501 141710 gene locus_tag LOCUS_30580 gene fliH 142501 141710 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063740.1 protein_id gnl|my_center|LOCUS_30580 143471 142488 gene locus_tag LOCUS_30590 gene fliG 143471 142488 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817203.1 protein_id gnl|my_center|LOCUS_30590 145107 143473 gene locus_tag LOCUS_30600 gene fliF 145107 143473 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930339.1 protein_id gnl|my_center|LOCUS_30600 145449 145850 gene locus_tag LOCUS_30610 gene fliE 145449 145850 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367290.1 protein_id gnl|my_center|LOCUS_30610 146328 146044 gene locus_tag LOCUS_30620 146328 146044 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811829.1 protein_id gnl|my_center|LOCUS_30620 147811 146444 gene locus_tag LOCUS_30630 147811 146444 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063742.1 protein_id gnl|my_center|LOCUS_30630 148225 147821 gene locus_tag LOCUS_30640 148225 147821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 148682 148266 gene locus_tag LOCUS_30650 gene fliS 148682 148266 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930344.1 protein_id gnl|my_center|LOCUS_30650 150080 148713 gene locus_tag LOCUS_30660 gene fliD 150080 148713 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096008.1 protein_id gnl|my_center|LOCUS_30660 150488 151246 gene locus_tag LOCUS_30670 150488 151246 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811933.1 protein_id gnl|my_center|LOCUS_30670 151391 152563 gene locus_tag LOCUS_30680 151391 152563 CDS product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039838.1 protein_id gnl|my_center|LOCUS_30680 153132 152683 gene locus_tag LOCUS_30690 153132 152683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 153797 154171 gene locus_tag LOCUS_30700 153797 154171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 154302 154835 gene locus_tag LOCUS_30710 154302 154835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 155439 157544 gene locus_tag LOCUS_30720 155439 157544 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022388.1 protein_id gnl|my_center|LOCUS_30720 157626 159182 gene locus_tag LOCUS_30730 157626 159182 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933539.1 protein_id gnl|my_center|LOCUS_30730 159179 160459 gene locus_tag LOCUS_30740 159179 160459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 160472 161491 gene locus_tag LOCUS_30750 160472 161491 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939813.1 protein_id gnl|my_center|LOCUS_30750 161488 164586 gene locus_tag LOCUS_30760 161488 164586 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141537.1 protein_id gnl|my_center|LOCUS_30760 164827 165498 gene locus_tag LOCUS_30770 164827 165498 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065267398.1 protein_id gnl|my_center|LOCUS_30770 165554 166015 gene locus_tag LOCUS_30780 165554 166015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 <167011 166397 gene locus_tag LOCUS_30790 <167011 166397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000998051.1:IS66-like element ISEc8 family transposase