>Feature sequence001 <2090 1280 gene locus_tag LOCUS_00010 <2090 1280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210083.1:RHS repeat protein >Feature sequence002 246 157 gene locus_tag LOCUS_t00010 246 157 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 837 307 gene locus_tag LOCUS_00020 837 307 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888275.1 protein_id gnl|my_center|LOCUS_00020 886 1644 gene locus_tag LOCUS_00030 886 1644 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_00030 1744 1817 gene locus_tag LOCUS_t00020 1744 1817 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence003 200 718 gene locus_tag LOCUS_00040 200 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 846 1265 gene locus_tag LOCUS_00050 846 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 1337 1687 gene locus_tag LOCUS_00060 1337 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 >Feature sequence004 >Feature sequence005 713 456 gene locus_tag LOCUS_00070 713 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 <1832 725 gene locus_tag LOCUS_00080 <1832 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210083.1:RHS repeat protein >Feature sequence006 827 1486 gene locus_tag LOCUS_00090 827 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 >Feature sequence007 <1655 723 gene locus_tag LOCUS_00100 <1655 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169337322.1:IPT/TIG domain-containing protein >Feature sequence008 >Feature sequence009 >Feature sequence010 711 1049 gene locus_tag LOCUS_00110 711 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 1046 1519 gene locus_tag LOCUS_00120 1046 1519 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922068.1 protein_id gnl|my_center|LOCUS_00120 >Feature sequence011 744 121 gene locus_tag LOCUS_00130 744 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 1088 786 gene locus_tag LOCUS_00140 1088 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 1901 1326 gene locus_tag LOCUS_00150 1901 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 3290 2301 gene locus_tag LOCUS_00160 3290 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 4691 3456 gene locus_tag LOCUS_00170 4691 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 6545 4755 gene locus_tag LOCUS_00180 gene dnaK 6545 4755 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502156.1 protein_id gnl|my_center|LOCUS_00180 7220 6588 gene locus_tag LOCUS_00190 7220 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 7601 8164 gene locus_tag LOCUS_00200 7601 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 8183 9088 gene locus_tag LOCUS_00210 8183 9088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 9137 10504 gene locus_tag LOCUS_00220 9137 10504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 11294 10527 gene locus_tag LOCUS_00230 11294 10527 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664611.1 protein_id gnl|my_center|LOCUS_00230 11513 14002 gene locus_tag LOCUS_00240 11513 14002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 14059 14745 gene locus_tag LOCUS_00250 14059 14745 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932168.1 protein_id gnl|my_center|LOCUS_00250 15081 15869 gene locus_tag LOCUS_00260 15081 15869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 18348 15967 gene locus_tag LOCUS_00270 18348 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 18943 18338 gene locus_tag LOCUS_00280 18943 18338 CDS product RedB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616158.1 protein_id gnl|my_center|LOCUS_00280 19330 19704 gene locus_tag LOCUS_00290 19330 19704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 19892 26224 gene locus_tag LOCUS_00300 19892 26224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 26532 27560 gene locus_tag LOCUS_00310 26532 27560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 27557 28930 gene locus_tag LOCUS_00320 27557 28930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 29047 30159 gene locus_tag LOCUS_00330 29047 30159 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767225.1 protein_id gnl|my_center|LOCUS_00330 32329 30149 gene locus_tag LOCUS_00340 32329 30149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 33674 32322 gene locus_tag LOCUS_00350 33674 32322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 35199 33697 gene locus_tag LOCUS_00360 35199 33697 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_00360 37455 35275 gene locus_tag LOCUS_00370 37455 35275 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389244.1 protein_id gnl|my_center|LOCUS_00370 38073 37465 gene locus_tag LOCUS_00380 38073 37465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 39319 38063 gene locus_tag LOCUS_00390 39319 38063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 49879 39449 gene locus_tag LOCUS_00400 49879 39449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 50835 50089 gene locus_tag LOCUS_00410 50835 50089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 50839 52446 gene locus_tag LOCUS_00420 50839 52446 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118456.1 protein_id gnl|my_center|LOCUS_00420 52457 52999 gene locus_tag LOCUS_00430 52457 52999 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921635.1 protein_id gnl|my_center|LOCUS_00430 53643 54863 gene locus_tag LOCUS_00440 53643 54863 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119960.1 protein_id gnl|my_center|LOCUS_00440 54927 56042 gene locus_tag LOCUS_00450 54927 56042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 56046 59210 gene locus_tag LOCUS_00460 56046 59210 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_00460 59237 59743 gene locus_tag LOCUS_00470 59237 59743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 61168 59777 gene locus_tag LOCUS_00480 61168 59777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 61349 61627 gene locus_tag LOCUS_00490 61349 61627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 61697 62821 gene locus_tag LOCUS_00500 61697 62821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 63558 62833 gene locus_tag LOCUS_00510 63558 62833 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289198.1 protein_id gnl|my_center|LOCUS_00510 64884 63595 gene locus_tag LOCUS_00520 64884 63595 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_00520 66197 65181 gene locus_tag LOCUS_00530 gene pdhA 66197 65181 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531481.1 protein_id gnl|my_center|LOCUS_00530 66311 66673 gene locus_tag LOCUS_00540 66311 66673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 66689 67210 gene locus_tag LOCUS_00550 66689 67210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 68504 67173 gene locus_tag LOCUS_00560 68504 67173 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038873.1 protein_id gnl|my_center|LOCUS_00560 68924 68511 gene locus_tag LOCUS_00570 68924 68511 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145104183.1 protein_id gnl|my_center|LOCUS_00570 69567 68995 gene locus_tag LOCUS_00580 69567 68995 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941350.1 protein_id gnl|my_center|LOCUS_00580 70160 69564 gene locus_tag LOCUS_00590 70160 69564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 72200 70179 gene locus_tag LOCUS_00600 72200 70179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 73210 72236 gene locus_tag LOCUS_00610 73210 72236 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838662.1 protein_id gnl|my_center|LOCUS_00610 73527 73207 gene locus_tag LOCUS_00620 73527 73207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 73631 74566 gene locus_tag LOCUS_00630 gene deoC 73631 74566 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_00630 74600 76078 gene locus_tag LOCUS_00640 74600 76078 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_00640 76092 76349 gene locus_tag LOCUS_00650 76092 76349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 76444 77298 gene locus_tag LOCUS_00660 76444 77298 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403982.1 protein_id gnl|my_center|LOCUS_00660 80935 77327 gene locus_tag LOCUS_00670 80935 77327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 81211 81810 gene locus_tag LOCUS_00680 81211 81810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 82314 82802 gene locus_tag LOCUS_00690 82314 82802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 82803 84101 gene locus_tag LOCUS_00700 82803 84101 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_00700 84901 86214 gene locus_tag LOCUS_00710 84901 86214 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480406.1 protein_id gnl|my_center|LOCUS_00710 86367 86729 gene locus_tag LOCUS_00720 86367 86729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 87511 88560 gene locus_tag LOCUS_00730 87511 88560 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_00730 90046 88550 gene locus_tag LOCUS_00740 90046 88550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 90909 90043 gene locus_tag LOCUS_00750 90909 90043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 92660 91197 gene locus_tag LOCUS_00760 92660 91197 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257358.1 protein_id gnl|my_center|LOCUS_00760 93886 92657 gene locus_tag LOCUS_00770 93886 92657 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_00770 94964 93879 gene locus_tag LOCUS_00780 94964 93879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 95290 94985 gene locus_tag LOCUS_00790 95290 94985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 95339 96112 gene locus_tag LOCUS_00800 95339 96112 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_00800 96292 97290 gene locus_tag LOCUS_00810 96292 97290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 97287 99005 gene locus_tag LOCUS_00820 97287 99005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 99002 99376 gene locus_tag LOCUS_00830 99002 99376 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082826795.1 protein_id gnl|my_center|LOCUS_00830 99373 100518 gene locus_tag LOCUS_00840 99373 100518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 100520 101776 gene locus_tag LOCUS_00850 100520 101776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 101773 102660 gene locus_tag LOCUS_00860 101773 102660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 102657 103889 gene locus_tag LOCUS_00870 gene cotSA 102657 103889 CDS product spore coat protein CotSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229028.1 protein_id gnl|my_center|LOCUS_00870 103886 105019 gene locus_tag LOCUS_00880 103886 105019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 105195 107030 gene locus_tag LOCUS_00890 105195 107030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 107027 108061 gene locus_tag LOCUS_00900 107027 108061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 108058 109131 gene locus_tag LOCUS_00910 108058 109131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 110259 109141 gene locus_tag LOCUS_00920 110259 109141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 110390 111121 gene locus_tag LOCUS_00930 110390 111121 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203367.1 protein_id gnl|my_center|LOCUS_00930 111143 112603 gene locus_tag LOCUS_00940 111143 112603 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_00940 113219 112620 gene locus_tag LOCUS_00950 gene gmk 113219 112620 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337846.1 protein_id gnl|my_center|LOCUS_00950 113317 114006 gene locus_tag LOCUS_00960 113317 114006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 114390 115052 gene locus_tag LOCUS_00970 114390 115052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 115138 117615 gene locus_tag LOCUS_00980 115138 117615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 118542 117622 gene locus_tag LOCUS_00990 118542 117622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 118645 119559 gene locus_tag LOCUS_01000 gene rnhC 118645 119559 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883701.1 protein_id gnl|my_center|LOCUS_01000 119687 120016 gene locus_tag LOCUS_01010 119687 120016 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871614.1 protein_id gnl|my_center|LOCUS_01010 120013 120552 gene locus_tag LOCUS_01020 120013 120552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 123303 120727 gene locus_tag LOCUS_01030 gene clpB 123303 120727 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_01030 124302 123517 gene locus_tag LOCUS_01040 124302 123517 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_01040 125231 124359 gene locus_tag LOCUS_01050 125231 124359 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922125.1 protein_id gnl|my_center|LOCUS_01050 126405 125329 gene locus_tag LOCUS_01060 126405 125329 CDS product phosphatidylinositol-specific phospholipase C1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038314.1 protein_id gnl|my_center|LOCUS_01060 127428 126493 gene locus_tag LOCUS_01070 127428 126493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 128387 127530 gene locus_tag LOCUS_01080 128387 127530 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381071.1 protein_id gnl|my_center|LOCUS_01080 129422 129156 gene locus_tag LOCUS_01090 129422 129156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 129846 129463 gene locus_tag LOCUS_01100 129846 129463 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403077.1 protein_id gnl|my_center|LOCUS_01100 129948 130778 gene locus_tag LOCUS_01110 129948 130778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 131529 130786 gene locus_tag LOCUS_01120 131529 130786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 131895 132167 gene locus_tag LOCUS_01130 131895 132167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 132281 133144 gene locus_tag LOCUS_01140 132281 133144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 133155 134507 gene locus_tag LOCUS_01150 gene aroA 133155 134507 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 protein_id gnl|my_center|LOCUS_01150 134504 135172 gene locus_tag LOCUS_01160 gene cmk 134504 135172 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_01160 135244 135825 gene locus_tag LOCUS_01170 135244 135825 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869529.1 protein_id gnl|my_center|LOCUS_01170 136161 135835 gene locus_tag LOCUS_01180 136161 135835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 >Feature sequence012 1037 552 gene locus_tag LOCUS_01190 1037 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 1371 1174 gene locus_tag LOCUS_01200 1371 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 >Feature sequence013 121 831 gene locus_tag LOCUS_01210 121 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 970 1314 gene locus_tag LOCUS_01220 970 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 >Feature sequence014 609 112 gene locus_tag LOCUS_01230 609 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 >Feature sequence015 820 401 gene locus_tag LOCUS_01240 820 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 >Feature sequence016 107 724 gene locus_tag LOCUS_01250 107 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 817 1365 gene locus_tag LOCUS_01260 817 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 >Feature sequence017 395 1306 gene locus_tag LOCUS_01270 395 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 >Feature sequence018 114 1205 gene locus_tag LOCUS_01280 114 1205 CDS product DUF4062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530995.1 protein_id gnl|my_center|LOCUS_01280 1479 1300 gene locus_tag LOCUS_01290 1479 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 >Feature sequence019 382 1128 gene locus_tag LOCUS_01300 382 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 >Feature sequence020 >Feature sequence021 >Feature sequence022 343 939 gene locus_tag LOCUS_01310 gene cysC 343 939 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107257.1 protein_id gnl|my_center|LOCUS_01310 1053 1958 gene locus_tag LOCUS_01320 gene cysD 1053 1958 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_01320 2015 3259 gene locus_tag LOCUS_01330 2015 3259 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_01330 3306 4313 gene locus_tag LOCUS_01340 gene gmd 3306 4313 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941289.1 protein_id gnl|my_center|LOCUS_01340 4489 5250 gene locus_tag LOCUS_01350 4489 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 5289 6053 gene locus_tag LOCUS_01360 gene rfbF 5289 6053 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261038.1 protein_id gnl|my_center|LOCUS_01360 6038 7198 gene locus_tag LOCUS_01370 gene rfbG 6038 7198 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_01370 7226 8773 gene locus_tag LOCUS_01380 gene rfbH 7226 8773 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_01380 8777 9322 gene locus_tag LOCUS_01390 8777 9322 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167727.1 protein_id gnl|my_center|LOCUS_01390 9334 10164 gene locus_tag LOCUS_01400 9334 10164 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561952.1 protein_id gnl|my_center|LOCUS_01400 10542 11675 gene locus_tag LOCUS_01410 10542 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 15601 17049 gene locus_tag LOCUS_01420 15601 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 17218 17973 gene locus_tag LOCUS_01430 17218 17973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 18021 19043 gene locus_tag LOCUS_01440 18021 19043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 19306 20262 gene locus_tag LOCUS_01450 19306 20262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 20259 21392 gene locus_tag LOCUS_01460 20259 21392 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023661.1 protein_id gnl|my_center|LOCUS_01460 21427 22617 gene locus_tag LOCUS_01470 21427 22617 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027080.1 protein_id gnl|my_center|LOCUS_01470 22799 23347 gene locus_tag LOCUS_01480 22799 23347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 23344 24273 gene locus_tag LOCUS_01490 23344 24273 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222953.1 protein_id gnl|my_center|LOCUS_01490 24367 25773 gene locus_tag LOCUS_01500 24367 25773 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583255.1 protein_id gnl|my_center|LOCUS_01500 26066 28012 gene locus_tag LOCUS_01510 26066 28012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 28801 28067 gene locus_tag LOCUS_01520 28801 28067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 29718 28798 gene locus_tag LOCUS_01530 29718 28798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 29917 30843 gene locus_tag LOCUS_01540 29917 30843 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_01540 30966 31565 gene locus_tag LOCUS_01550 30966 31565 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266730.1 protein_id gnl|my_center|LOCUS_01550 31676 32272 gene locus_tag LOCUS_01560 gene pth 31676 32272 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140541.1 protein_id gnl|my_center|LOCUS_01560 32262 32549 gene locus_tag LOCUS_01570 32262 32549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 32625 33089 gene locus_tag LOCUS_01580 32625 33089 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_01580 34696 33173 gene locus_tag LOCUS_01590 34696 33173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 34894 35532 gene locus_tag LOCUS_01600 34894 35532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 35585 36841 gene locus_tag LOCUS_01610 35585 36841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 36927 37748 gene locus_tag LOCUS_01620 36927 37748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 37745 38860 gene locus_tag LOCUS_01630 37745 38860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 38857 39879 gene locus_tag LOCUS_01640 38857 39879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 39872 40888 gene locus_tag LOCUS_01650 39872 40888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 41058 41873 gene locus_tag LOCUS_01660 41058 41873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 41992 42912 gene locus_tag LOCUS_01670 41992 42912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 43529 42942 gene locus_tag LOCUS_01680 43529 42942 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945848.1 protein_id gnl|my_center|LOCUS_01680 43589 44563 gene locus_tag LOCUS_01690 gene waaC 43589 44563 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_01690 44606 45343 gene locus_tag LOCUS_01700 44606 45343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 45817 45350 gene locus_tag LOCUS_01710 45817 45350 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878603.1 protein_id gnl|my_center|LOCUS_01710 46362 45853 gene locus_tag LOCUS_01720 46362 45853 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421522.1 protein_id gnl|my_center|LOCUS_01720 47316 46540 gene locus_tag LOCUS_01730 47316 46540 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392394.1 protein_id gnl|my_center|LOCUS_01730 48229 47309 gene locus_tag LOCUS_01740 48229 47309 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_01740 49137 48316 gene locus_tag LOCUS_01750 49137 48316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 50159 49137 gene locus_tag LOCUS_01760 50159 49137 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964900.1 protein_id gnl|my_center|LOCUS_01760 51132 54470 gene locus_tag LOCUS_01770 51132 54470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 55947 54532 gene locus_tag LOCUS_01780 55947 54532 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_01780 56898 55963 gene locus_tag LOCUS_01790 56898 55963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 56987 57532 gene locus_tag LOCUS_01800 56987 57532 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524578.1 protein_id gnl|my_center|LOCUS_01800 57525 58412 gene locus_tag LOCUS_01810 57525 58412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 59870 58419 gene locus_tag LOCUS_01820 59870 58419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 60115 61266 gene locus_tag LOCUS_01830 60115 61266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 62151 61279 gene locus_tag LOCUS_01840 62151 61279 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_01840 62287 64431 gene locus_tag LOCUS_01850 62287 64431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 64595 68590 gene locus_tag LOCUS_01860 64595 68590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 68675 69547 gene locus_tag LOCUS_01870 68675 69547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 69873 69733 gene locus_tag LOCUS_01880 69873 69733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 69968 72508 gene locus_tag LOCUS_01890 69968 72508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 72505 73158 gene locus_tag LOCUS_01900 72505 73158 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_01900 74021 73206 gene locus_tag LOCUS_01910 gene menB 74021 73206 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_01910 75028 74246 gene locus_tag LOCUS_01920 75028 74246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 75777 75025 gene locus_tag LOCUS_01930 75777 75025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 76370 75834 gene locus_tag LOCUS_01940 76370 75834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 76519 77955 gene locus_tag LOCUS_01950 76519 77955 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267715.1 protein_id gnl|my_center|LOCUS_01950 78001 78477 gene locus_tag LOCUS_01960 78001 78477 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387043.1 protein_id gnl|my_center|LOCUS_01960 78530 79717 gene locus_tag LOCUS_01970 78530 79717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 80631 80026 gene locus_tag LOCUS_01980 80631 80026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 80824 84300 gene locus_tag LOCUS_01990 80824 84300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251825.1 protein_id gnl|my_center|LOCUS_01990 86573 84480 gene locus_tag LOCUS_02000 86573 84480 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_02000 86704 87675 gene locus_tag LOCUS_02010 86704 87675 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894961.1 protein_id gnl|my_center|LOCUS_02010 88690 87590 gene locus_tag LOCUS_02020 88690 87590 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009058447.1 protein_id gnl|my_center|LOCUS_02020 90080 88776 gene locus_tag LOCUS_02030 90080 88776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 92026 90077 gene locus_tag LOCUS_02040 92026 90077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 95509 92264 gene locus_tag LOCUS_02050 95509 92264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 97503 95716 gene locus_tag LOCUS_02060 97503 95716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 98525 97782 gene locus_tag LOCUS_02070 98525 97782 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_02070 99792 98584 gene locus_tag LOCUS_02080 99792 98584 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427756.1 protein_id gnl|my_center|LOCUS_02080 99996 101921 gene locus_tag LOCUS_02090 99996 101921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 102021 102713 gene locus_tag LOCUS_02100 102021 102713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 102905 106702 gene locus_tag LOCUS_02110 102905 106702 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226484.1 protein_id gnl|my_center|LOCUS_02110 107630 106773 gene locus_tag LOCUS_02120 107630 106773 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556107.1 protein_id gnl|my_center|LOCUS_02120 108361 107711 gene locus_tag LOCUS_02130 108361 107711 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532447.1 protein_id gnl|my_center|LOCUS_02130 108869 110173 gene locus_tag LOCUS_02140 108869 110173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 110434 111906 gene locus_tag LOCUS_02150 110434 111906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 113162 112083 gene locus_tag LOCUS_02160 113162 112083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 >Feature sequence023 764 102 gene locus_tag LOCUS_02170 764 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 >Feature sequence024 953 321 gene locus_tag LOCUS_02180 953 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 >Feature sequence025 1066 635 gene locus_tag LOCUS_02190 1066 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 1252 1124 gene locus_tag LOCUS_02200 1252 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 >Feature sequence026 696 220 gene locus_tag LOCUS_02210 696 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 >Feature sequence027 >Feature sequence028 >Feature sequence029 >Feature sequence030 >Feature sequence031 523 978 gene locus_tag LOCUS_02220 523 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 >Feature sequence032 288 52 gene locus_tag LOCUS_02230 288 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 742 296 gene locus_tag LOCUS_02240 742 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 1086 745 gene locus_tag LOCUS_02250 1086 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 >Feature sequence033 300 1070 gene locus_tag LOCUS_02260 300 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 2085 1219 gene locus_tag LOCUS_02270 2085 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 3069 2680 gene locus_tag LOCUS_02280 3069 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 3346 3074 gene locus_tag LOCUS_02290 3346 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 3624 3358 gene locus_tag LOCUS_02300 3624 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 4889 3690 gene locus_tag LOCUS_02310 4889 3690 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811750.1 protein_id gnl|my_center|LOCUS_02310 5531 4965 gene locus_tag LOCUS_02320 5531 4965 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_02320 5853 6803 gene locus_tag LOCUS_02330 5853 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 6875 7165 gene locus_tag LOCUS_02340 6875 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 7253 9052 gene locus_tag LOCUS_02350 7253 9052 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_02350 9116 9577 gene locus_tag LOCUS_02360 9116 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 11223 9601 gene locus_tag LOCUS_02370 gene murJ 11223 9601 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403272.1 protein_id gnl|my_center|LOCUS_02370 12201 11344 gene locus_tag LOCUS_02380 gene miaA 12201 11344 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_02380 13675 12248 gene locus_tag LOCUS_02390 gene ffh 13675 12248 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863461.1 protein_id gnl|my_center|LOCUS_02390 14911 13724 gene locus_tag LOCUS_02400 14911 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 15158 15541 gene locus_tag LOCUS_02410 15158 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 18511 15629 gene locus_tag LOCUS_02420 18511 15629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 18732 19502 gene locus_tag LOCUS_02430 18732 19502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 20561 19482 gene locus_tag LOCUS_02440 20561 19482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 21812 20634 gene locus_tag LOCUS_02450 21812 20634 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392555.1 protein_id gnl|my_center|LOCUS_02450 22618 21812 gene locus_tag LOCUS_02460 22618 21812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 22875 23354 gene locus_tag LOCUS_02470 22875 23354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 25142 23433 gene locus_tag LOCUS_02480 25142 23433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 26095 25172 gene locus_tag LOCUS_02490 26095 25172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 27053 26178 gene locus_tag LOCUS_02500 gene mtnP 27053 26178 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_02500 27138 27212 gene locus_tag LOCUS_t00030 27138 27212 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27237 28361 gene locus_tag LOCUS_02510 27237 28361 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_02510 28528 29871 gene locus_tag LOCUS_02520 28528 29871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 29965 30579 gene locus_tag LOCUS_02530 29965 30579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 31403 30729 gene locus_tag LOCUS_02540 31403 30729 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206288.1 protein_id gnl|my_center|LOCUS_02540 32241 31579 gene locus_tag LOCUS_02550 32241 31579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 32418 33836 gene locus_tag LOCUS_02560 32418 33836 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442740.1 protein_id gnl|my_center|LOCUS_02560 34583 33852 gene locus_tag LOCUS_02570 34583 33852 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928634.1 protein_id gnl|my_center|LOCUS_02570 35399 34602 gene locus_tag LOCUS_02580 35399 34602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 35965 35471 gene locus_tag LOCUS_02590 35965 35471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 36744 35983 gene locus_tag LOCUS_02600 36744 35983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 37460 36741 gene locus_tag LOCUS_02610 37460 36741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 38017 37484 gene locus_tag LOCUS_02620 38017 37484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 38467 38021 gene locus_tag LOCUS_02630 38467 38021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 38922 38506 gene locus_tag LOCUS_02640 38922 38506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 40081 38936 gene locus_tag LOCUS_02650 40081 38936 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869800.1 protein_id gnl|my_center|LOCUS_02650 41771 40074 gene locus_tag LOCUS_02660 gene pilB 41771 40074 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479695.1 protein_id gnl|my_center|LOCUS_02660 42340 41768 gene locus_tag LOCUS_02670 42340 41768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 44086 42359 gene locus_tag LOCUS_02680 44086 42359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 44716 44096 gene locus_tag LOCUS_02690 44716 44096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 45237 44704 gene locus_tag LOCUS_02700 45237 44704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 47020 45257 gene locus_tag LOCUS_02710 47020 45257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 47649 47152 gene locus_tag LOCUS_02720 47649 47152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 49062 47866 gene locus_tag LOCUS_02730 49062 47866 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228908.1 protein_id gnl|my_center|LOCUS_02730 50030 49149 gene locus_tag LOCUS_02740 50030 49149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 50803 50036 gene locus_tag LOCUS_02750 50803 50036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 51527 50883 gene locus_tag LOCUS_02760 51527 50883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 51676 52524 gene locus_tag LOCUS_02770 51676 52524 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882838.1 protein_id gnl|my_center|LOCUS_02770 53597 52536 gene locus_tag LOCUS_02780 gene recF 53597 52536 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662310.1 protein_id gnl|my_center|LOCUS_02780 55541 53652 gene locus_tag LOCUS_02790 55541 53652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 57097 55553 gene locus_tag LOCUS_02800 57097 55553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 57878 57126 gene locus_tag LOCUS_02810 57878 57126 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_02810 58575 57940 gene locus_tag LOCUS_02820 gene pdxH 58575 57940 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365910.1 protein_id gnl|my_center|LOCUS_02820 59402 58611 gene locus_tag LOCUS_02830 59402 58611 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_02830 59929 59399 gene locus_tag LOCUS_02840 59929 59399 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494663.1 protein_id gnl|my_center|LOCUS_02840 60467 60003 gene locus_tag LOCUS_02850 60467 60003 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_02850 61517 60480 gene locus_tag LOCUS_02860 61517 60480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 62020 61526 gene locus_tag LOCUS_02870 62020 61526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 62122 63174 gene locus_tag LOCUS_02880 gene obgE 62122 63174 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_02880 63181 63546 gene locus_tag LOCUS_02890 63181 63546 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219167.1 protein_id gnl|my_center|LOCUS_02890 64945 63623 gene locus_tag LOCUS_02900 64945 63623 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_02900 65454 65041 gene locus_tag LOCUS_02910 65454 65041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922222.1 protein_id gnl|my_center|LOCUS_02910 66404 65550 gene locus_tag LOCUS_02920 66404 65550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 67467 66412 gene locus_tag LOCUS_02930 67467 66412 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_02930 69094 67472 gene locus_tag LOCUS_02940 69094 67472 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119625.1 protein_id gnl|my_center|LOCUS_02940 69902 69117 gene locus_tag LOCUS_02950 69902 69117 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_02950 71221 69899 gene locus_tag LOCUS_02960 gene uxaC 71221 69899 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303177.1 protein_id gnl|my_center|LOCUS_02960 72279 71212 gene locus_tag LOCUS_02970 72279 71212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 72698 72276 gene locus_tag LOCUS_02980 72698 72276 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919108.1 protein_id gnl|my_center|LOCUS_02980 73729 72755 gene locus_tag LOCUS_02990 73729 72755 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974651.1 protein_id gnl|my_center|LOCUS_02990 74024 74485 gene locus_tag LOCUS_03000 74024 74485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03000 74517 74720 gene locus_tag LOCUS_03010 74517 74720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 75836 74820 gene locus_tag LOCUS_03020 75836 74820 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530581.1 protein_id gnl|my_center|LOCUS_03020 76826 75999 gene locus_tag LOCUS_03030 76826 75999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 77239 76823 gene locus_tag LOCUS_03040 77239 76823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 77384 77818 gene locus_tag LOCUS_03050 77384 77818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 79059 77932 gene locus_tag LOCUS_03060 gene aroB 79059 77932 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_03060 79113 79703 gene locus_tag LOCUS_03070 79113 79703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 79720 80346 gene locus_tag LOCUS_03080 79720 80346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 80882 80367 gene locus_tag LOCUS_03090 80882 80367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 81522 80893 gene locus_tag LOCUS_03100 81522 80893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 81665 82459 gene locus_tag LOCUS_03110 81665 82459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 82603 83250 gene locus_tag LOCUS_03120 82603 83250 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_03120 83635 83282 gene locus_tag LOCUS_03130 83635 83282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 83726 84415 gene locus_tag LOCUS_03140 gene truC 83726 84415 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705086.1 protein_id gnl|my_center|LOCUS_03140 85128 84430 gene locus_tag LOCUS_03150 85128 84430 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403305.1 protein_id gnl|my_center|LOCUS_03150 86039 85200 gene locus_tag LOCUS_03160 gene nadC 86039 85200 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085327.1 protein_id gnl|my_center|LOCUS_03160 86525 86106 gene locus_tag LOCUS_03170 86525 86106 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174926.1 protein_id gnl|my_center|LOCUS_03170 87575 86544 gene locus_tag LOCUS_03180 87575 86544 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036148.1 protein_id gnl|my_center|LOCUS_03180 88544 87591 gene locus_tag LOCUS_03190 88544 87591 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240746.1 protein_id gnl|my_center|LOCUS_03190 89214 88960 gene locus_tag LOCUS_03200 89214 88960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 89621 89211 gene locus_tag LOCUS_03210 89621 89211 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945928.1 protein_id gnl|my_center|LOCUS_03210 89684 92740 gene locus_tag LOCUS_03220 89684 92740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 94789 92747 gene locus_tag LOCUS_03230 94789 92747 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 protein_id gnl|my_center|LOCUS_03230 95328 95017 gene locus_tag LOCUS_03240 95328 95017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 95481 96350 gene locus_tag LOCUS_03250 95481 96350 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986856.1 protein_id gnl|my_center|LOCUS_03250 99043 96347 gene locus_tag LOCUS_03260 99043 96347 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141113.1 protein_id gnl|my_center|LOCUS_03260 99617 99111 gene locus_tag LOCUS_03270 gene coaD 99617 99111 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692360.1 protein_id gnl|my_center|LOCUS_03270 100470 99643 gene locus_tag LOCUS_03280 gene thiD 100470 99643 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228119.1 protein_id gnl|my_center|LOCUS_03280 100627 100827 gene locus_tag LOCUS_03290 100627 100827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 101589 101035 gene locus_tag LOCUS_03300 101589 101035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 102268 101714 gene locus_tag LOCUS_03310 102268 101714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 103245 102832 gene locus_tag LOCUS_03320 103245 102832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 103928 103281 gene locus_tag LOCUS_03330 103928 103281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 104501 104067 gene locus_tag LOCUS_03340 104501 104067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 105418 104537 gene locus_tag LOCUS_03350 105418 104537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 >Feature sequence034 >Feature sequence035 58 594 gene locus_tag LOCUS_03360 58 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 >Feature sequence036 >Feature sequence037 927 310 gene locus_tag LOCUS_03370 927 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 >Feature sequence038 >Feature sequence039 326 745 gene locus_tag LOCUS_03380 326 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence040 >Feature sequence041 772 149 gene locus_tag LOCUS_03390 772 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence042 >Feature sequence043 106 576 gene locus_tag LOCUS_03400 106 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence044 1277 441 gene locus_tag LOCUS_03410 1277 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 2185 1415 gene locus_tag LOCUS_03420 2185 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 2540 2749 gene locus_tag LOCUS_03430 2540 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 2953 3465 gene locus_tag LOCUS_03440 2953 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 3581 4756 gene locus_tag LOCUS_03450 3581 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 5350 4781 gene locus_tag LOCUS_03460 5350 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5914 6300 gene locus_tag LOCUS_03470 5914 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 7027 6311 gene locus_tag LOCUS_03480 7027 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 11351 7032 gene locus_tag LOCUS_03490 11351 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 11573 12643 gene locus_tag LOCUS_03500 gene nagZ 11573 12643 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887975.1 protein_id gnl|my_center|LOCUS_03500 12812 13069 gene locus_tag LOCUS_03510 gene rpsO 12812 13069 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081540.1 protein_id gnl|my_center|LOCUS_03510 13272 15446 gene locus_tag LOCUS_03520 gene pnp 13272 15446 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_03520 15564 17627 gene locus_tag LOCUS_03530 15564 17627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 17643 19730 gene locus_tag LOCUS_03540 17643 19730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 19806 19967 gene locus_tag LOCUS_03550 19806 19967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 21349 19964 gene locus_tag LOCUS_03560 21349 19964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 22077 21379 gene locus_tag LOCUS_03570 22077 21379 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065331.1 protein_id gnl|my_center|LOCUS_03570 23079 22168 gene locus_tag LOCUS_03580 23079 22168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 23517 24251 gene locus_tag LOCUS_03590 23517 24251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 24273 24824 gene locus_tag LOCUS_03600 24273 24824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 24847 25950 gene locus_tag LOCUS_03610 24847 25950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 27939 26098 gene locus_tag LOCUS_03620 gene htpG 27939 26098 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_03620 28555 28058 gene locus_tag LOCUS_03630 28555 28058 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400653.1 protein_id gnl|my_center|LOCUS_03630 29914 28562 gene locus_tag LOCUS_03640 29914 28562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 31173 29920 gene locus_tag LOCUS_03650 31173 29920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 32345 31287 gene locus_tag LOCUS_03660 32345 31287 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_03660 33428 32430 gene locus_tag LOCUS_03670 33428 32430 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 protein_id gnl|my_center|LOCUS_03670 33522 34562 gene locus_tag LOCUS_03680 33522 34562 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038722.1 protein_id gnl|my_center|LOCUS_03680 34574 35281 gene locus_tag LOCUS_03690 34574 35281 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640345.1 protein_id gnl|my_center|LOCUS_03690 35327 36595 gene locus_tag LOCUS_03700 35327 36595 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 protein_id gnl|my_center|LOCUS_03700 36597 36986 gene locus_tag LOCUS_03710 36597 36986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331848.1 protein_id gnl|my_center|LOCUS_03710 40354 37025 gene locus_tag LOCUS_03720 40354 37025 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084790.1 protein_id gnl|my_center|LOCUS_03720 41000 40356 gene locus_tag LOCUS_03730 41000 40356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 42490 41015 gene locus_tag LOCUS_03740 42490 41015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 42724 44808 gene locus_tag LOCUS_03750 42724 44808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 45370 44879 gene locus_tag LOCUS_03760 45370 44879 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_03760 45445 46728 gene locus_tag LOCUS_03770 45445 46728 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458682.1 protein_id gnl|my_center|LOCUS_03770 47192 46758 gene locus_tag LOCUS_03780 gene ruvX 47192 46758 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057628.1 protein_id gnl|my_center|LOCUS_03780 48271 47189 gene locus_tag LOCUS_03790 48271 47189 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_03790 48380 48703 gene locus_tag LOCUS_03800 48380 48703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 49713 48757 gene locus_tag LOCUS_03810 49713 48757 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_03810 49794 50207 gene locus_tag LOCUS_03820 49794 50207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 50566 50312 gene locus_tag LOCUS_03830 gene rpmA 50566 50312 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_03830 50905 50591 gene locus_tag LOCUS_03840 gene rplU 50905 50591 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_03840 51768 51151 gene locus_tag LOCUS_03850 51768 51151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 53670 52039 gene locus_tag LOCUS_03860 gene lnt 53670 52039 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083613.1 protein_id gnl|my_center|LOCUS_03860 54635 53787 gene locus_tag LOCUS_03870 54635 53787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 55073 54693 gene locus_tag LOCUS_03880 55073 54693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 55252 55085 gene locus_tag LOCUS_03890 55252 55085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 55364 55642 gene locus_tag LOCUS_03900 55364 55642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 55968 55732 gene locus_tag LOCUS_03910 55968 55732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 56214 55993 gene locus_tag LOCUS_03920 56214 55993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 56162 56827 gene locus_tag LOCUS_03930 56162 56827 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338008.1 protein_id gnl|my_center|LOCUS_03930 56869 57672 gene locus_tag LOCUS_03940 56869 57672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 58793 57912 gene locus_tag LOCUS_03950 58793 57912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 59640 58864 gene locus_tag LOCUS_03960 59640 58864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 60397 59618 gene locus_tag LOCUS_03970 60397 59618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 63699 60466 gene locus_tag LOCUS_03980 63699 60466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 64280 63804 gene locus_tag LOCUS_03990 64280 63804 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883561.1 protein_id gnl|my_center|LOCUS_03990 64353 64952 gene locus_tag LOCUS_04000 64353 64952 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783551.1 protein_id gnl|my_center|LOCUS_04000 64996 65517 gene locus_tag LOCUS_04010 64996 65517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 66164 65523 gene locus_tag LOCUS_04020 66164 65523 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245030.1 protein_id gnl|my_center|LOCUS_04020 66432 66635 gene locus_tag LOCUS_04030 66432 66635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 66868 68118 gene locus_tag LOCUS_04040 66868 68118 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119838.1 protein_id gnl|my_center|LOCUS_04040 68115 68807 gene locus_tag LOCUS_04050 68115 68807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_04050 68811 69950 gene locus_tag LOCUS_04060 68811 69950 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922783.1 protein_id gnl|my_center|LOCUS_04060 69989 71143 gene locus_tag LOCUS_04070 69989 71143 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922784.1 protein_id gnl|my_center|LOCUS_04070 71140 71664 gene locus_tag LOCUS_04080 71140 71664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 73785 71737 gene locus_tag LOCUS_04090 73785 71737 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 protein_id gnl|my_center|LOCUS_04090 74541 74080 gene locus_tag LOCUS_04100 74541 74080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 74666 74592 gene locus_tag LOCUS_t00040 74666 74592 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 75963 74746 gene locus_tag LOCUS_04110 gene pabB 75963 74746 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438631.1 protein_id gnl|my_center|LOCUS_04110 76962 76063 gene locus_tag LOCUS_04120 76962 76063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 77121 79211 gene locus_tag LOCUS_04130 gene fusA 77121 79211 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774533.1 protein_id gnl|my_center|LOCUS_04130 80060 79410 gene locus_tag LOCUS_04140 80060 79410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 80516 81229 gene locus_tag LOCUS_04150 80516 81229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 81384 82538 gene locus_tag LOCUS_04160 81384 82538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015834.1 protein_id gnl|my_center|LOCUS_04160 82535 83368 gene locus_tag LOCUS_04170 82535 83368 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 protein_id gnl|my_center|LOCUS_04170 83365 84147 gene locus_tag LOCUS_04180 gene potC 83365 84147 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714192.1 protein_id gnl|my_center|LOCUS_04180 84181 85224 gene locus_tag LOCUS_04190 84181 85224 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_04190 85350 86285 gene locus_tag LOCUS_04200 85350 86285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 87786 86374 gene locus_tag LOCUS_04210 87786 86374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_04210 88254 87883 gene locus_tag LOCUS_04220 88254 87883 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_04220 88330 89319 gene locus_tag LOCUS_04230 88330 89319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 89758 89339 gene locus_tag LOCUS_04240 89758 89339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 91571 89859 gene locus_tag LOCUS_04250 91571 89859 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918141.1 protein_id gnl|my_center|LOCUS_04250 92273 91908 gene locus_tag LOCUS_04260 92273 91908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 92551 92276 gene locus_tag LOCUS_04270 92551 92276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 93902 92802 gene locus_tag LOCUS_04280 93902 92802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 93896 94060 gene locus_tag LOCUS_04290 93896 94060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 96435 94177 gene locus_tag LOCUS_04300 96435 94177 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545662.1 protein_id gnl|my_center|LOCUS_04300 96373 96558 gene locus_tag LOCUS_04310 96373 96558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 96642 97643 gene locus_tag LOCUS_04320 96642 97643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 97681 98925 gene locus_tag LOCUS_04330 97681 98925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 99940 99008 gene locus_tag LOCUS_04340 gene gldA 99940 99008 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_04340 100068 102857 gene locus_tag LOCUS_04350 100068 102857 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_04350 102888 104321 gene locus_tag LOCUS_04360 gene odhB 102888 104321 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538105.1 protein_id gnl|my_center|LOCUS_04360 >Feature sequence045 >Feature sequence046 243 593 gene locus_tag LOCUS_04370 243 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence047 >Feature sequence048 >Feature sequence049 144 743 gene locus_tag LOCUS_04380 144 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence050 >Feature sequence051 >Feature sequence052 >Feature sequence053 >Feature sequence054 97 543 gene locus_tag LOCUS_04390 97 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence055 2265 370 gene locus_tag LOCUS_04400 gene ettA 2265 370 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_04400 2594 3070 gene locus_tag LOCUS_04410 2594 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 4362 3067 gene locus_tag LOCUS_04420 4362 3067 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813074.1 protein_id gnl|my_center|LOCUS_04420 4714 4448 gene locus_tag LOCUS_04430 4714 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 4850 6184 gene locus_tag LOCUS_04440 4850 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 6670 6209 gene locus_tag LOCUS_04450 gene smpB 6670 6209 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421925.1 protein_id gnl|my_center|LOCUS_04450 6974 6705 gene locus_tag LOCUS_04460 6974 6705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 7510 7115 gene locus_tag LOCUS_04470 7510 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 7580 8395 gene locus_tag LOCUS_04480 7580 8395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 9615 8401 gene locus_tag LOCUS_04490 9615 8401 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456066.1 protein_id gnl|my_center|LOCUS_04490 10373 9852 gene locus_tag LOCUS_04500 10373 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 10473 10820 gene locus_tag LOCUS_04510 10473 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 11837 12952 gene locus_tag LOCUS_04520 11837 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 14212 14760 gene locus_tag LOCUS_04530 14212 14760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 14809 15228 gene locus_tag LOCUS_04540 14809 15228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 15335 15847 gene locus_tag LOCUS_04550 15335 15847 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_04550 15869 16384 gene locus_tag LOCUS_04560 15869 16384 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065038.1 protein_id gnl|my_center|LOCUS_04560 16462 17202 gene locus_tag LOCUS_04570 16462 17202 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097624.1 protein_id gnl|my_center|LOCUS_04570 17637 17269 gene locus_tag LOCUS_04580 17637 17269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 20977 17666 gene locus_tag LOCUS_04590 20977 17666 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941986.1 protein_id gnl|my_center|LOCUS_04590 22669 20987 gene locus_tag LOCUS_04600 22669 20987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 23920 22682 gene locus_tag LOCUS_04610 23920 22682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 24464 24027 gene locus_tag LOCUS_04620 24464 24027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 24808 24461 gene locus_tag LOCUS_04630 24808 24461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 26118 24805 gene locus_tag LOCUS_04640 26118 24805 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_04640 28379 26139 gene locus_tag LOCUS_04650 28379 26139 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_04650 31340 28494 gene locus_tag LOCUS_04660 31340 28494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 31478 32497 gene locus_tag LOCUS_04670 31478 32497 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055217731.1 protein_id gnl|my_center|LOCUS_04670 32549 33868 gene locus_tag LOCUS_04680 gene serS 32549 33868 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_04680 33896 34483 gene locus_tag LOCUS_04690 33896 34483 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_04690 34557 35105 gene locus_tag LOCUS_04700 34557 35105 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 protein_id gnl|my_center|LOCUS_04700 35109 36134 gene locus_tag LOCUS_04710 gene queG 35109 36134 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388032.1 protein_id gnl|my_center|LOCUS_04710 36473 38701 gene locus_tag LOCUS_04720 36473 38701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 38704 39222 gene locus_tag LOCUS_04730 38704 39222 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_04730 41459 39282 gene locus_tag LOCUS_04740 41459 39282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 42858 41497 gene locus_tag LOCUS_04750 42858 41497 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_04750 43017 43091 gene locus_tag LOCUS_t00050 43017 43091 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 43211 44464 gene locus_tag LOCUS_04760 43211 44464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 44524 45393 gene locus_tag LOCUS_04770 gene ada 44524 45393 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154235330.1 protein_id gnl|my_center|LOCUS_04770 45398 46003 gene locus_tag LOCUS_04780 45398 46003 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_04780 46698 46000 gene locus_tag LOCUS_04790 46698 46000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 47996 47103 gene locus_tag LOCUS_04800 47996 47103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 49063 48071 gene locus_tag LOCUS_04810 49063 48071 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191342.1 protein_id gnl|my_center|LOCUS_04810 49273 49082 gene locus_tag LOCUS_04820 49273 49082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 51210 49270 gene locus_tag LOCUS_04830 51210 49270 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192976.1 protein_id gnl|my_center|LOCUS_04830 51300 52211 gene locus_tag LOCUS_04840 51300 52211 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423235.1 protein_id gnl|my_center|LOCUS_04840 52283 52987 gene locus_tag LOCUS_04850 52283 52987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085279.1 protein_id gnl|my_center|LOCUS_04850 55156 53006 gene locus_tag LOCUS_04860 55156 53006 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108622.1 protein_id gnl|my_center|LOCUS_04860 55266 56405 gene locus_tag LOCUS_04870 gene cytR 55266 56405 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815292.1 protein_id gnl|my_center|LOCUS_04870 57427 56420 gene locus_tag LOCUS_04880 57427 56420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 58110 57424 gene locus_tag LOCUS_04890 58110 57424 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211629436.1 protein_id gnl|my_center|LOCUS_04890 58262 62002 gene locus_tag LOCUS_04900 58262 62002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 63426 62107 gene locus_tag LOCUS_04910 63426 62107 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_04910 64893 63547 gene locus_tag LOCUS_04920 64893 63547 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715453.1 protein_id gnl|my_center|LOCUS_04920 66307 65252 gene locus_tag LOCUS_04930 66307 65252 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943746.1 protein_id gnl|my_center|LOCUS_04930 66880 66434 gene locus_tag LOCUS_04940 66880 66434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 67942 66893 gene locus_tag LOCUS_04950 67942 66893 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103810.1 protein_id gnl|my_center|LOCUS_04950 68044 68367 gene locus_tag LOCUS_04960 68044 68367 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855203.1 protein_id gnl|my_center|LOCUS_04960 68651 69055 gene locus_tag LOCUS_04970 gene rpsL 68651 69055 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198362.1 protein_id gnl|my_center|LOCUS_04970 69093 69566 gene locus_tag LOCUS_04980 gene rpsG 69093 69566 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892787.1 protein_id gnl|my_center|LOCUS_04980 69622 71763 gene locus_tag LOCUS_04990 gene fusA 69622 71763 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_04990 71811 72119 gene locus_tag LOCUS_05000 gene rpsJ 71811 72119 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_05000 72177 72812 gene locus_tag LOCUS_05010 gene rplC 72177 72812 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160197.1 protein_id gnl|my_center|LOCUS_05010 72850 73458 gene locus_tag LOCUS_05020 gene rplD 72850 73458 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886957.1 protein_id gnl|my_center|LOCUS_05020 73482 73766 gene locus_tag LOCUS_05030 gene rplW 73482 73766 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183022.1 protein_id gnl|my_center|LOCUS_05030 73826 74668 gene locus_tag LOCUS_05040 gene rplB 73826 74668 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_05040 74710 74982 gene locus_tag LOCUS_05050 gene rpsS 74710 74982 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_05050 75018 75731 gene locus_tag LOCUS_05060 75018 75731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 75770 76195 gene locus_tag LOCUS_05070 75770 76195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 76227 76943 gene locus_tag LOCUS_05080 gene rpsC 76227 76943 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536533.1 protein_id gnl|my_center|LOCUS_05080 76990 77409 gene locus_tag LOCUS_05090 gene rplP 76990 77409 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872721.1 protein_id gnl|my_center|LOCUS_05090 77431 77625 gene locus_tag LOCUS_05100 77431 77625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 77665 77934 gene locus_tag LOCUS_05110 77665 77934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 77996 78361 gene locus_tag LOCUS_05120 gene rplN 77996 78361 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326806.1 protein_id gnl|my_center|LOCUS_05120 78401 78634 gene locus_tag LOCUS_05130 78401 78634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 78692 79264 gene locus_tag LOCUS_05140 gene rplE 78692 79264 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549036.1 protein_id gnl|my_center|LOCUS_05140 79304 79699 gene locus_tag LOCUS_05150 gene rpsH 79304 79699 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938612.1 protein_id gnl|my_center|LOCUS_05150 79730 80269 gene locus_tag LOCUS_05160 gene rplF 79730 80269 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_05160 80311 80667 gene locus_tag LOCUS_05170 gene rplR 80311 80667 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966396.1 protein_id gnl|my_center|LOCUS_05170 80686 81309 gene locus_tag LOCUS_05180 80686 81309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 81400 81852 gene locus_tag LOCUS_05190 gene rplO 81400 81852 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393918.1 protein_id gnl|my_center|LOCUS_05190 81957 83465 gene locus_tag LOCUS_05200 gene secY 81957 83465 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_05200 83474 84133 gene locus_tag LOCUS_05210 83474 84133 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_05210 84195 84947 gene locus_tag LOCUS_05220 gene map 84195 84947 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_05220 86265 85573 gene locus_tag LOCUS_05230 86265 85573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 86937 86269 gene locus_tag LOCUS_05240 86937 86269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 88175 87129 gene locus_tag LOCUS_05250 gene ilvC 88175 87129 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_05250 89801 88422 gene locus_tag LOCUS_05260 89801 88422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 89944 91542 gene locus_tag LOCUS_05270 89944 91542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 92015 91605 gene locus_tag LOCUS_05280 92015 91605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 93023 92193 gene locus_tag LOCUS_05290 93023 92193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 94016 93042 gene locus_tag LOCUS_05300 94016 93042 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544985.1 protein_id gnl|my_center|LOCUS_05300 94588 94019 gene locus_tag LOCUS_05310 gene wcaF 94588 94019 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153597.1 protein_id gnl|my_center|LOCUS_05310 95741 94578 gene locus_tag LOCUS_05320 95741 94578 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 protein_id gnl|my_center|LOCUS_05320 97690 97502 gene locus_tag LOCUS_05330 97690 97502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 99110 98184 gene locus_tag LOCUS_05340 99110 98184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 100250 99114 gene locus_tag LOCUS_05350 100250 99114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 101086 100286 gene locus_tag LOCUS_05360 101086 100286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 101680 101321 gene locus_tag LOCUS_05370 101680 101321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 103468 102866 gene locus_tag LOCUS_05380 103468 102866 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107351.1 protein_id gnl|my_center|LOCUS_05380 >Feature sequence056 422 63 gene locus_tag LOCUS_05390 422 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229471.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence057 114 620 gene locus_tag LOCUS_05400 114 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 >Feature sequence058 >Feature sequence059 >Feature sequence060 97 543 gene locus_tag LOCUS_05410 97 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 >Feature sequence061 >Feature sequence062 694 92 gene locus_tag LOCUS_05420 694 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence063 >Feature sequence064 501 208 gene locus_tag LOCUS_05430 501 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 >Feature sequence065 191 511 gene locus_tag LOCUS_05440 191 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05440 >Feature sequence066 758 1636 gene locus_tag LOCUS_05450 gene intI1 758 1636 CDS product class 1 integron integrase IntI1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845046.1 protein_id gnl|my_center|LOCUS_05450 1683 1850 gene locus_tag LOCUS_05460 1683 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2235 4391 gene locus_tag LOCUS_05470 2235 4391 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514554.1 protein_id gnl|my_center|LOCUS_05470 4470 5150 gene locus_tag LOCUS_05480 4470 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 5218 5613 gene locus_tag LOCUS_05490 gene tsaE 5218 5613 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_05490 5591 6334 gene locus_tag LOCUS_05500 gene nagB 5591 6334 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119306.1 protein_id gnl|my_center|LOCUS_05500 6331 6870 gene locus_tag LOCUS_05510 6331 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 7951 6929 gene locus_tag LOCUS_05520 7951 6929 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_05520 8760 7963 gene locus_tag LOCUS_05530 8760 7963 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_05530 9695 8757 gene locus_tag LOCUS_05540 9695 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 10798 9701 gene locus_tag LOCUS_05550 10798 9701 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_05550 12105 10822 gene locus_tag LOCUS_05560 12105 10822 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_05560 12250 13194 gene locus_tag LOCUS_05570 12250 13194 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767026.1 protein_id gnl|my_center|LOCUS_05570 13886 13206 gene locus_tag LOCUS_05580 13886 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 14968 13883 gene locus_tag LOCUS_05590 gene rlmN 14968 13883 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 protein_id gnl|my_center|LOCUS_05590 17048 15057 gene locus_tag LOCUS_05600 17048 15057 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_05600 17244 19274 gene locus_tag LOCUS_05610 17244 19274 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_05610 19818 19288 gene locus_tag LOCUS_05620 19818 19288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 20392 19901 gene locus_tag LOCUS_05630 gene nrdR 20392 19901 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223586.1 protein_id gnl|my_center|LOCUS_05630 21205 20597 gene locus_tag LOCUS_05640 gene recR 21205 20597 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_05640 21640 21209 gene locus_tag LOCUS_05650 21640 21209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 22120 21650 gene locus_tag LOCUS_05660 gene bcp 22120 21650 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257872.1 protein_id gnl|my_center|LOCUS_05660 22210 22797 gene locus_tag LOCUS_05670 gene pgsA 22210 22797 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414035.1 protein_id gnl|my_center|LOCUS_05670 23478 22813 gene locus_tag LOCUS_05680 23478 22813 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_05680 24458 23475 gene locus_tag LOCUS_05690 24458 23475 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_05690 25171 24587 gene locus_tag LOCUS_05700 25171 24587 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_05700 26013 25168 gene locus_tag LOCUS_05710 26013 25168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 26472 26086 gene locus_tag LOCUS_05720 26472 26086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 27125 26526 gene locus_tag LOCUS_05730 gene rpoE 27125 26526 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_05730 27264 27605 gene locus_tag LOCUS_05740 27264 27605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 27648 28457 gene locus_tag LOCUS_05750 27648 28457 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707359.1 protein_id gnl|my_center|LOCUS_05750 29412 28444 gene locus_tag LOCUS_05760 29412 28444 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245931.1 protein_id gnl|my_center|LOCUS_05760 29562 30419 gene locus_tag LOCUS_05770 29562 30419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 30497 31420 gene locus_tag LOCUS_05780 30497 31420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036006.1 protein_id gnl|my_center|LOCUS_05780 32358 31429 gene locus_tag LOCUS_05790 32358 31429 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207718.1 protein_id gnl|my_center|LOCUS_05790 33938 32412 gene locus_tag LOCUS_05800 33938 32412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 34059 34685 gene locus_tag LOCUS_05810 34059 34685 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339235.1 protein_id gnl|my_center|LOCUS_05810 34749 35555 gene locus_tag LOCUS_05820 34749 35555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 36446 35571 gene locus_tag LOCUS_05830 36446 35571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 36591 37346 gene locus_tag LOCUS_05840 36591 37346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 37362 37757 gene locus_tag LOCUS_05850 37362 37757 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815873.1 protein_id gnl|my_center|LOCUS_05850 37772 38551 gene locus_tag LOCUS_05860 37772 38551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 39481 38597 gene locus_tag LOCUS_05870 gene xerD 39481 38597 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565337.1 protein_id gnl|my_center|LOCUS_05870 41164 39488 gene locus_tag LOCUS_05880 41164 39488 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_05880 42974 41229 gene locus_tag LOCUS_05890 gene argS 42974 41229 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 protein_id gnl|my_center|LOCUS_05890 43491 43009 gene locus_tag LOCUS_05900 43491 43009 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069646.1 protein_id gnl|my_center|LOCUS_05900 43671 44255 gene locus_tag LOCUS_05910 43671 44255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 44260 45405 gene locus_tag LOCUS_05920 gene dnaJ 44260 45405 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482993.1 protein_id gnl|my_center|LOCUS_05920 45419 46141 gene locus_tag LOCUS_05930 45419 46141 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_05930 46209 48581 gene locus_tag LOCUS_05940 46209 48581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 49390 48578 gene locus_tag LOCUS_05950 gene mazG 49390 48578 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_05950 50256 49387 gene locus_tag LOCUS_05960 50256 49387 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145885.1 protein_id gnl|my_center|LOCUS_05960 50459 52246 gene locus_tag LOCUS_05970 50459 52246 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258194.1 protein_id gnl|my_center|LOCUS_05970 52299 55778 gene locus_tag LOCUS_05980 52299 55778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 55906 56532 gene locus_tag LOCUS_05990 55906 56532 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_05990 56928 58085 gene locus_tag LOCUS_06000 56928 58085 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530677.1 protein_id gnl|my_center|LOCUS_06000 59147 58053 gene locus_tag LOCUS_06010 59147 58053 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920312.1 protein_id gnl|my_center|LOCUS_06010 59509 59234 gene locus_tag LOCUS_06020 59509 59234 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548299.1 protein_id gnl|my_center|LOCUS_06020 60542 59514 gene locus_tag LOCUS_06030 60542 59514 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 protein_id gnl|my_center|LOCUS_06030 61513 60527 gene locus_tag LOCUS_06040 61513 60527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083810.1 protein_id gnl|my_center|LOCUS_06040 63753 61510 gene locus_tag LOCUS_06050 63753 61510 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_06050 65333 63753 gene locus_tag LOCUS_06060 65333 63753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 66682 65336 gene locus_tag LOCUS_06070 66682 65336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 66817 68418 gene locus_tag LOCUS_06080 66817 68418 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140950.1 protein_id gnl|my_center|LOCUS_06080 68453 69385 gene locus_tag LOCUS_06090 gene oppB 68453 69385 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_06090 69406 70380 gene locus_tag LOCUS_06100 69406 70380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 70414 71106 gene locus_tag LOCUS_06110 70414 71106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 72095 71103 gene locus_tag LOCUS_06120 72095 71103 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926844.1 protein_id gnl|my_center|LOCUS_06120 72349 72092 gene locus_tag LOCUS_06130 72349 72092 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_06130 73094 72369 gene locus_tag LOCUS_06140 gene fabG 73094 72369 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420124.1 protein_id gnl|my_center|LOCUS_06140 73724 73134 gene locus_tag LOCUS_06150 73724 73134 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_06150 73823 74947 gene locus_tag LOCUS_06160 gene moeB 73823 74947 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143401.1 protein_id gnl|my_center|LOCUS_06160 77614 74990 gene locus_tag LOCUS_06170 gene gyrA 77614 74990 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_06170 80186 77643 gene locus_tag LOCUS_06180 gene gyrB 80186 77643 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871536.1 protein_id gnl|my_center|LOCUS_06180 81706 80873 gene locus_tag LOCUS_06190 81706 80873 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_06190 83497 82025 gene locus_tag LOCUS_06200 83497 82025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 84894 83671 gene locus_tag LOCUS_06210 84894 83671 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943175.1 protein_id gnl|my_center|LOCUS_06210 85040 85477 gene locus_tag LOCUS_06220 gene xcpT 85040 85477 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_06220 85452 86021 gene locus_tag LOCUS_06230 85452 86021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 86018 86437 gene locus_tag LOCUS_06240 86018 86437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 86434 87165 gene locus_tag LOCUS_06250 86434 87165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 87252 88100 gene locus_tag LOCUS_06260 87252 88100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 88097 89356 gene locus_tag LOCUS_06270 88097 89356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 89417 89953 gene locus_tag LOCUS_06280 89417 89953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 89926 90603 gene locus_tag LOCUS_06290 89926 90603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 90636 93059 gene locus_tag LOCUS_06300 90636 93059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 95286 93337 gene locus_tag LOCUS_06310 gene speA 95286 93337 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792905.1 protein_id gnl|my_center|LOCUS_06310 97838 95394 gene locus_tag LOCUS_06320 97838 95394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 98251 97835 gene locus_tag LOCUS_06330 98251 97835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 99163 98270 gene locus_tag LOCUS_06340 99163 98270 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_06340 99267 100847 gene locus_tag LOCUS_06350 99267 100847 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_06350 101076 100885 gene locus_tag LOCUS_06360 101076 100885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 101018 101725 gene locus_tag LOCUS_06370 101018 101725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence067 476 156 gene locus_tag LOCUS_06380 476 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06380 >Feature sequence068 >Feature sequence069 546 154 gene locus_tag LOCUS_06390 546 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence070 >Feature sequence071 >Feature sequence072 >Feature sequence073 >Feature sequence074 >Feature sequence075 155 346 gene locus_tag LOCUS_06400 155 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 574 401 gene locus_tag LOCUS_06410 574 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence076 286 468 gene locus_tag LOCUS_06420 286 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence077 621 547 gene locus_tag LOCUS_t00060 621 547 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2700 697 gene locus_tag LOCUS_06430 2700 697 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327900.1 protein_id gnl|my_center|LOCUS_06430 2846 4270 gene locus_tag LOCUS_06440 2846 4270 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_06440 4368 4577 gene locus_tag LOCUS_06450 gene rpmI 4368 4577 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125970.1 protein_id gnl|my_center|LOCUS_06450 4717 5097 gene locus_tag LOCUS_06460 gene rplT 4717 5097 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880587.1 protein_id gnl|my_center|LOCUS_06460 5933 5217 gene locus_tag LOCUS_06470 5933 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 6648 5944 gene locus_tag LOCUS_06480 6648 5944 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438215.1 protein_id gnl|my_center|LOCUS_06480 7776 6655 gene locus_tag LOCUS_06490 7776 6655 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_06490 8945 7881 gene locus_tag LOCUS_06500 8945 7881 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_06500 9888 8989 gene locus_tag LOCUS_06510 gene dapA 9888 8989 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921565.1 protein_id gnl|my_center|LOCUS_06510 10539 9946 gene locus_tag LOCUS_06520 10539 9946 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455144.1 protein_id gnl|my_center|LOCUS_06520 11373 10561 gene locus_tag LOCUS_06530 gene dapF 11373 10561 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927135.1 protein_id gnl|my_center|LOCUS_06530 11782 11390 gene locus_tag LOCUS_06540 11782 11390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 12033 11779 gene locus_tag LOCUS_06550 12033 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 12877 12080 gene locus_tag LOCUS_06560 gene trpA 12877 12080 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_06560 15100 12902 gene locus_tag LOCUS_06570 15100 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 16228 15155 gene locus_tag LOCUS_06580 gene prfA 16228 15155 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940174.1 protein_id gnl|my_center|LOCUS_06580 16724 17824 gene locus_tag LOCUS_06590 16724 17824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 18247 19008 gene locus_tag LOCUS_06600 18247 19008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 19439 19056 gene locus_tag LOCUS_06610 19439 19056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 20522 21415 gene locus_tag LOCUS_06620 20522 21415 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530571.1 protein_id gnl|my_center|LOCUS_06620 21730 22215 gene locus_tag LOCUS_06630 21730 22215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 23283 22240 gene locus_tag LOCUS_06640 23283 22240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 23897 23280 gene locus_tag LOCUS_06650 23897 23280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 24129 24794 gene locus_tag LOCUS_06660 24129 24794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 24784 27366 gene locus_tag LOCUS_06670 24784 27366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 27380 27793 gene locus_tag LOCUS_06680 27380 27793 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_06680 27903 29159 gene locus_tag LOCUS_06690 27903 29159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 31153 29156 gene locus_tag LOCUS_06700 31153 29156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 31291 33069 gene locus_tag LOCUS_06710 31291 33069 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_06710 33091 34812 gene locus_tag LOCUS_06720 gene cysI 33091 34812 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 protein_id gnl|my_center|LOCUS_06720 34838 35581 gene locus_tag LOCUS_06730 34838 35581 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477371.1 protein_id gnl|my_center|LOCUS_06730 35607 36566 gene locus_tag LOCUS_06740 gene cysK 35607 36566 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324150.1 protein_id gnl|my_center|LOCUS_06740 36765 37796 gene locus_tag LOCUS_06750 36765 37796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 37796 39187 gene locus_tag LOCUS_06760 37796 39187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_06760 39558 39184 gene locus_tag LOCUS_06770 39558 39184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 39991 40641 gene locus_tag LOCUS_06780 39991 40641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 40665 42203 gene locus_tag LOCUS_06790 40665 42203 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457220.1 protein_id gnl|my_center|LOCUS_06790 42209 43219 gene locus_tag LOCUS_06800 42209 43219 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 protein_id gnl|my_center|LOCUS_06800 44433 43321 gene locus_tag LOCUS_06810 44433 43321 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_06810 45567 44485 gene locus_tag LOCUS_06820 45567 44485 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_06820 46011 45580 gene locus_tag LOCUS_06830 46011 45580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 46406 45969 gene locus_tag LOCUS_06840 46406 45969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 46911 46471 gene locus_tag LOCUS_06850 46911 46471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 49499 47025 gene locus_tag LOCUS_06860 49499 47025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 50296 49586 gene locus_tag LOCUS_06870 gene radC 50296 49586 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545736.1 protein_id gnl|my_center|LOCUS_06870 51376 50342 gene locus_tag LOCUS_06880 51376 50342 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966367.1 protein_id gnl|my_center|LOCUS_06880 51472 51870 gene locus_tag LOCUS_06890 51472 51870 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190402.1 protein_id gnl|my_center|LOCUS_06890 51939 53234 gene locus_tag LOCUS_06900 gene hisS 51939 53234 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868795.1 protein_id gnl|my_center|LOCUS_06900 53261 53668 gene locus_tag LOCUS_06910 53261 53668 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_06910 53710 55512 gene locus_tag LOCUS_06920 gene aspS 53710 55512 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546812.1 protein_id gnl|my_center|LOCUS_06920 55820 57046 gene locus_tag LOCUS_06930 55820 57046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 57280 58242 gene locus_tag LOCUS_06940 57280 58242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 60501 58249 gene locus_tag LOCUS_06950 gene ligA 60501 58249 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705145.1 protein_id gnl|my_center|LOCUS_06950 60589 60840 gene locus_tag LOCUS_06960 60589 60840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 60925 62160 gene locus_tag LOCUS_06970 60925 62160 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_06970 62259 62330 gene locus_tag LOCUS_t00070 62259 62330 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 62542 63453 gene locus_tag LOCUS_06980 62542 63453 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251336.1 protein_id gnl|my_center|LOCUS_06980 65104 63470 gene locus_tag LOCUS_06990 65104 63470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 66898 65390 gene locus_tag LOCUS_07000 66898 65390 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615699.1 protein_id gnl|my_center|LOCUS_07000 67965 67087 gene locus_tag LOCUS_07010 67965 67087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 68050 68904 gene locus_tag LOCUS_07020 68050 68904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 69110 73783 gene locus_tag LOCUS_07030 gene gltB 69110 73783 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120560.1 protein_id gnl|my_center|LOCUS_07030 73976 74836 gene locus_tag LOCUS_07040 73976 74836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_07040 74833 75732 gene locus_tag LOCUS_07050 74833 75732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 75738 76715 gene locus_tag LOCUS_07060 75738 76715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 76788 77510 gene locus_tag LOCUS_07070 76788 77510 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_07070 77676 78125 gene locus_tag LOCUS_07080 77676 78125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 79269 78220 gene locus_tag LOCUS_07090 gene alr 79269 78220 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_07090 80161 79466 gene locus_tag LOCUS_07100 80161 79466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 80738 80304 gene locus_tag LOCUS_07110 80738 80304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 81383 80751 gene locus_tag LOCUS_07120 81383 80751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 82613 81561 gene locus_tag LOCUS_07130 gene mutY 82613 81561 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195232.1 protein_id gnl|my_center|LOCUS_07130 83356 82622 gene locus_tag LOCUS_07140 83356 82622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 85389 83455 gene locus_tag LOCUS_07150 gene pgcA 85389 83455 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244986.1 protein_id gnl|my_center|LOCUS_07150 85558 86997 gene locus_tag LOCUS_07160 85558 86997 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405167.1 protein_id gnl|my_center|LOCUS_07160 87055 87969 gene locus_tag LOCUS_07170 87055 87969 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985142.1 protein_id gnl|my_center|LOCUS_07170 88498 88025 gene locus_tag LOCUS_07180 88498 88025 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314356.1 protein_id gnl|my_center|LOCUS_07180 88653 88838 gene locus_tag LOCUS_07190 88653 88838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 89536 88853 gene locus_tag LOCUS_07200 gene pgsA 89536 88853 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904217.1 protein_id gnl|my_center|LOCUS_07200 89648 91066 gene locus_tag LOCUS_07210 gene gndA 89648 91066 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_07210 91280 92677 gene locus_tag LOCUS_07220 gene atpD 91280 92677 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_07220 92688 93077 gene locus_tag LOCUS_07230 92688 93077 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_07230 93070 93408 gene locus_tag LOCUS_07240 93070 93408 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 protein_id gnl|my_center|LOCUS_07240 93401 93697 gene locus_tag LOCUS_07250 93401 93697 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022409.1 protein_id gnl|my_center|LOCUS_07250 93681 94370 gene locus_tag LOCUS_07260 93681 94370 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_07260 94383 94664 gene locus_tag LOCUS_07270 94383 94664 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_07270 94669 95439 gene locus_tag LOCUS_07280 94669 95439 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_07280 95436 96980 gene locus_tag LOCUS_07290 95436 96980 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_07290 96980 97858 gene locus_tag LOCUS_07300 96980 97858 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022404.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence078 >Feature sequence079 >Feature sequence080 >Feature sequence081 521 219 gene locus_tag LOCUS_07310 521 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence082 >Feature sequence083 >Feature sequence084 >Feature sequence085 >Feature sequence086 >Feature sequence087 >Feature sequence088 2928 763 gene locus_tag LOCUS_07320 gene vpsO 2928 763 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_07320 3898 3077 gene locus_tag LOCUS_07330 3898 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 5501 4146 gene locus_tag LOCUS_07340 5501 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 6387 5584 gene locus_tag LOCUS_07350 6387 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 6997 6518 gene locus_tag LOCUS_07360 6997 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 9201 7243 gene locus_tag LOCUS_07370 9201 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 9968 9231 gene locus_tag LOCUS_07380 9968 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 10805 10017 gene locus_tag LOCUS_07390 10805 10017 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_07390 11043 12023 gene locus_tag LOCUS_07400 11043 12023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 12100 12645 gene locus_tag LOCUS_07410 12100 12645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 12642 13592 gene locus_tag LOCUS_07420 12642 13592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 13704 14723 gene locus_tag LOCUS_07430 13704 14723 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_07430 14735 15406 gene locus_tag LOCUS_07440 14735 15406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_07440 15403 16629 gene locus_tag LOCUS_07450 15403 16629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 16674 17024 gene locus_tag LOCUS_07460 16674 17024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 17021 18817 gene locus_tag LOCUS_07470 17021 18817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 19580 18783 gene locus_tag LOCUS_07480 19580 18783 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948182.1 protein_id gnl|my_center|LOCUS_07480 19996 19577 gene locus_tag LOCUS_07490 19996 19577 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017296.1 protein_id gnl|my_center|LOCUS_07490 21047 19980 gene locus_tag LOCUS_07500 21047 19980 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070071246.1 protein_id gnl|my_center|LOCUS_07500 22530 21031 gene locus_tag LOCUS_07510 22530 21031 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946372.1 protein_id gnl|my_center|LOCUS_07510 24056 22620 gene locus_tag LOCUS_07520 24056 22620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 24730 24053 gene locus_tag LOCUS_07530 24730 24053 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_07530 25611 25024 gene locus_tag LOCUS_07540 25611 25024 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804308.1 protein_id gnl|my_center|LOCUS_07540 25683 26042 gene locus_tag LOCUS_07550 25683 26042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 27481 26063 gene locus_tag LOCUS_07560 27481 26063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 28706 27474 gene locus_tag LOCUS_07570 28706 27474 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_07570 29745 28765 gene locus_tag LOCUS_07580 29745 28765 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015614.1 protein_id gnl|my_center|LOCUS_07580 30561 29788 gene locus_tag LOCUS_07590 gene lpxA 30561 29788 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071796.1 protein_id gnl|my_center|LOCUS_07590 31608 30652 gene locus_tag LOCUS_07600 31608 30652 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941617.1 protein_id gnl|my_center|LOCUS_07600 32370 31618 gene locus_tag LOCUS_07610 32370 31618 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919952.1 protein_id gnl|my_center|LOCUS_07610 33540 32374 gene locus_tag LOCUS_07620 33540 32374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 36167 33681 gene locus_tag LOCUS_07630 36167 33681 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_07630 36310 37776 gene locus_tag LOCUS_07640 36310 37776 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196631.1 protein_id gnl|my_center|LOCUS_07640 37786 39111 gene locus_tag LOCUS_07650 37786 39111 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_07650 40302 39259 gene locus_tag LOCUS_07660 gene recA 40302 39259 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504720.1 protein_id gnl|my_center|LOCUS_07660 40496 41242 gene locus_tag LOCUS_07670 40496 41242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 41561 41193 gene locus_tag LOCUS_07680 41561 41193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 41838 42722 gene locus_tag LOCUS_07690 41838 42722 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_07690 43351 42773 gene locus_tag LOCUS_07700 gene lspA 43351 42773 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 protein_id gnl|my_center|LOCUS_07700 46111 43364 gene locus_tag LOCUS_07710 gene ileS 46111 43364 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081557.1 protein_id gnl|my_center|LOCUS_07710 47432 46149 gene locus_tag LOCUS_07720 47432 46149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 47530 49665 gene locus_tag LOCUS_07730 47530 49665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 49647 50420 gene locus_tag LOCUS_07740 49647 50420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 50441 51652 gene locus_tag LOCUS_07750 50441 51652 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903914.1 protein_id gnl|my_center|LOCUS_07750 51639 52736 gene locus_tag LOCUS_07760 51639 52736 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903913.1 protein_id gnl|my_center|LOCUS_07760 52733 53545 gene locus_tag LOCUS_07770 52733 53545 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903912.1 protein_id gnl|my_center|LOCUS_07770 53654 54088 gene locus_tag LOCUS_07780 53654 54088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 54110 54862 gene locus_tag LOCUS_07790 gene sufC 54110 54862 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722442.1 protein_id gnl|my_center|LOCUS_07790 54883 56319 gene locus_tag LOCUS_07800 gene sufB 54883 56319 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118827.1 protein_id gnl|my_center|LOCUS_07800 56355 57644 gene locus_tag LOCUS_07810 gene sufD 56355 57644 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_07810 57729 58700 gene locus_tag LOCUS_07820 57729 58700 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082266.1 protein_id gnl|my_center|LOCUS_07820 58783 59151 gene locus_tag LOCUS_07830 58783 59151 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704559.1 protein_id gnl|my_center|LOCUS_07830 59434 60471 gene locus_tag LOCUS_07840 59434 60471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 60468 61724 gene locus_tag LOCUS_07850 60468 61724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 61828 63054 gene locus_tag LOCUS_07860 61828 63054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 63051 64310 gene locus_tag LOCUS_07870 63051 64310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 64502 65698 gene locus_tag LOCUS_07880 64502 65698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 65695 66948 gene locus_tag LOCUS_07890 65695 66948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 67200 68033 gene locus_tag LOCUS_07900 67200 68033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 68115 69410 gene locus_tag LOCUS_07910 68115 69410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 69457 69894 gene locus_tag LOCUS_07920 gene ndk 69457 69894 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760845.1 protein_id gnl|my_center|LOCUS_07920 69931 70692 gene locus_tag LOCUS_07930 69931 70692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 70737 72182 gene locus_tag LOCUS_07940 gene cls 70737 72182 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144064.1 protein_id gnl|my_center|LOCUS_07940 73638 72424 gene locus_tag LOCUS_07950 73638 72424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 76460 74130 gene locus_tag LOCUS_07960 76460 74130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 77800 77066 gene locus_tag LOCUS_07970 77800 77066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 82434 77878 gene locus_tag LOCUS_07980 82434 77878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 83876 82569 gene locus_tag LOCUS_07990 83876 82569 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393286.1 protein_id gnl|my_center|LOCUS_07990 84693 83935 gene locus_tag LOCUS_08000 84693 83935 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267779.1 protein_id gnl|my_center|LOCUS_08000 85902 84706 gene locus_tag LOCUS_08010 85902 84706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 86493 85915 gene locus_tag LOCUS_08020 86493 85915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 86752 87612 gene locus_tag LOCUS_08030 gene blaA 86752 87612 CDS product class A beta-lactamase BlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816299.1 protein_id gnl|my_center|LOCUS_08030 87641 88891 gene locus_tag LOCUS_08040 gene lpxK 87641 88891 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 protein_id gnl|my_center|LOCUS_08040 90430 88913 gene locus_tag LOCUS_08050 90430 88913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_08050 91308 90427 gene locus_tag LOCUS_08060 91308 90427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 91502 92614 gene locus_tag LOCUS_08070 91502 92614 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880493.1 protein_id gnl|my_center|LOCUS_08070 93482 92988 gene locus_tag LOCUS_08080 93482 92988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 93975 93514 gene locus_tag LOCUS_08090 93975 93514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 94851 95057 gene locus_tag LOCUS_08100 94851 95057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 95456 95076 gene locus_tag LOCUS_08110 95456 95076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 96516 95929 gene locus_tag LOCUS_08120 96516 95929 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974264.1 protein_id gnl|my_center|LOCUS_08120 96816 96520 gene locus_tag LOCUS_08130 96816 96520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 97093 96932 gene locus_tag LOCUS_08140 97093 96932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 97681 97211 gene locus_tag LOCUS_08150 97681 97211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence089 >Feature sequence090 105 476 gene locus_tag LOCUS_08160 105 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 >Feature sequence091 >Feature sequence092 >Feature sequence093 >Feature sequence094 >Feature sequence095 >Feature sequence096 >Feature sequence097 >Feature sequence098 >Feature sequence099 241 843 gene locus_tag LOCUS_08170 241 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 852 2123 gene locus_tag LOCUS_08180 852 2123 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092007.1 protein_id gnl|my_center|LOCUS_08180 2170 3177 gene locus_tag LOCUS_08190 2170 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 3185 4276 gene locus_tag LOCUS_08200 3185 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528388.1 protein_id gnl|my_center|LOCUS_08200 4391 5656 gene locus_tag LOCUS_08210 4391 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_08210 5689 6687 gene locus_tag LOCUS_08220 5689 6687 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_08220 6749 7900 gene locus_tag LOCUS_08230 6749 7900 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_08230 8111 8692 gene locus_tag LOCUS_08240 8111 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 8709 8999 gene locus_tag LOCUS_08250 8709 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 9204 10247 gene locus_tag LOCUS_08260 gene murG 9204 10247 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379204.1 protein_id gnl|my_center|LOCUS_08260 10247 12547 gene locus_tag LOCUS_08270 10247 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 12569 13495 gene locus_tag LOCUS_08280 12569 13495 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_08280 13526 14497 gene locus_tag LOCUS_08290 13526 14497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 14516 15727 gene locus_tag LOCUS_08300 gene ftsA 14516 15727 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_08300 16040 17743 gene locus_tag LOCUS_08310 16040 17743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 17891 18604 gene locus_tag LOCUS_08320 17891 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 19508 18681 gene locus_tag LOCUS_08330 gene yfeD 19508 18681 CDS product iron/manganese ABC transporter permease subunit YfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211845.1 protein_id gnl|my_center|LOCUS_08330 20371 19505 gene locus_tag LOCUS_08340 20371 19505 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973877.1 protein_id gnl|my_center|LOCUS_08340 21154 20372 gene locus_tag LOCUS_08350 21154 20372 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630123.1 protein_id gnl|my_center|LOCUS_08350 22020 21151 gene locus_tag LOCUS_08360 gene yfeA 22020 21151 CDS product iron/manganese ABC transporter substrate-binding protein YfeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170110.1 protein_id gnl|my_center|LOCUS_08360 22949 22224 gene locus_tag LOCUS_08370 22949 22224 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120403.1 protein_id gnl|my_center|LOCUS_08370 22948 23136 gene locus_tag LOCUS_08380 22948 23136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 23133 23915 gene locus_tag LOCUS_08390 gene rph 23133 23915 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096595.1 protein_id gnl|my_center|LOCUS_08390 26591 23922 gene locus_tag LOCUS_08400 26591 23922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 26937 26677 gene locus_tag LOCUS_08410 26937 26677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 27067 28071 gene locus_tag LOCUS_08420 27067 28071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 28043 28801 gene locus_tag LOCUS_08430 28043 28801 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_08430 29778 28810 gene locus_tag LOCUS_08440 29778 28810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 29883 31718 gene locus_tag LOCUS_08450 gene msbA 29883 31718 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_08450 33440 31701 gene locus_tag LOCUS_08460 33440 31701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_08460 33597 34388 gene locus_tag LOCUS_08470 33597 34388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 34437 35246 gene locus_tag LOCUS_08480 34437 35246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 35322 35516 gene locus_tag LOCUS_08490 35322 35516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 35984 35541 gene locus_tag LOCUS_08500 35984 35541 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227792.1 protein_id gnl|my_center|LOCUS_08500 36038 36346 gene locus_tag LOCUS_08510 36038 36346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 36343 37110 gene locus_tag LOCUS_08520 36343 37110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 37753 37052 gene locus_tag LOCUS_08530 gene tsaB 37753 37052 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086737.1 protein_id gnl|my_center|LOCUS_08530 37887 39017 gene locus_tag LOCUS_08540 gene citZ 37887 39017 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_08540 40753 39422 gene locus_tag LOCUS_08550 40753 39422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 41815 40772 gene locus_tag LOCUS_08560 41815 40772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 43448 41895 gene locus_tag LOCUS_08570 43448 41895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 44143 43445 gene locus_tag LOCUS_08580 44143 43445 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143132.1 protein_id gnl|my_center|LOCUS_08580 45200 44208 gene locus_tag LOCUS_08590 45200 44208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 45266 47872 gene locus_tag LOCUS_08600 45266 47872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 47876 48157 gene locus_tag LOCUS_08610 gene clpS 47876 48157 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229464.1 protein_id gnl|my_center|LOCUS_08610 48154 48621 gene locus_tag LOCUS_08620 48154 48621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 50457 48592 gene locus_tag LOCUS_08630 50457 48592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 51466 50447 gene locus_tag LOCUS_08640 gene rtcA 51466 50447 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827117.1 protein_id gnl|my_center|LOCUS_08640 52997 51513 gene locus_tag LOCUS_08650 52997 51513 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122265.1 protein_id gnl|my_center|LOCUS_08650 54957 53383 gene locus_tag LOCUS_08660 54957 53383 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_08660 55147 56760 gene locus_tag LOCUS_08670 gene rtcR 55147 56760 CDS product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122266.1 protein_id gnl|my_center|LOCUS_08670 56757 57122 gene locus_tag LOCUS_08680 56757 57122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 57238 59934 gene locus_tag LOCUS_08690 57238 59934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 60976 59945 gene locus_tag LOCUS_08700 gene rfbB 60976 59945 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870348.1 protein_id gnl|my_center|LOCUS_08700 61942 61193 gene locus_tag LOCUS_08710 61942 61193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 62999 62022 gene locus_tag LOCUS_08720 62999 62022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 65654 63087 gene locus_tag LOCUS_08730 65654 63087 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_08730 65765 66127 gene locus_tag LOCUS_08740 gene rsfS 65765 66127 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707026.1 protein_id gnl|my_center|LOCUS_08740 66223 69696 gene locus_tag LOCUS_08750 66223 69696 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_08750 71209 69761 gene locus_tag LOCUS_08760 71209 69761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 71419 72612 gene locus_tag LOCUS_08770 71419 72612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 72631 73851 gene locus_tag LOCUS_08780 72631 73851 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_08780 73919 74674 gene locus_tag LOCUS_08790 73919 74674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 74935 74696 gene locus_tag LOCUS_08800 74935 74696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 75620 74916 gene locus_tag LOCUS_08810 75620 74916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 76129 75698 gene locus_tag LOCUS_08820 76129 75698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 76836 76126 gene locus_tag LOCUS_08830 76836 76126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 76960 77526 gene locus_tag LOCUS_08840 gene pyrE 76960 77526 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940203.1 protein_id gnl|my_center|LOCUS_08840 77594 78214 gene locus_tag LOCUS_08850 77594 78214 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463751.1 protein_id gnl|my_center|LOCUS_08850 78800 78375 gene locus_tag LOCUS_08860 78800 78375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 78950 79024 gene locus_tag LOCUS_t00080 78950 79024 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 80463 79144 gene locus_tag LOCUS_08870 80463 79144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 80784 83939 gene locus_tag LOCUS_08880 80784 83939 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073269.1 protein_id gnl|my_center|LOCUS_08880 87148 84026 gene locus_tag LOCUS_08890 87148 84026 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086679.1 protein_id gnl|my_center|LOCUS_08890 88275 87145 gene locus_tag LOCUS_08900 88275 87145 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966871.1 protein_id gnl|my_center|LOCUS_08900 88570 88385 gene locus_tag LOCUS_08910 88570 88385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 88490 89215 gene locus_tag LOCUS_08920 88490 89215 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970997.1 protein_id gnl|my_center|LOCUS_08920 89227 90561 gene locus_tag LOCUS_08930 89227 90561 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029723090.1 protein_id gnl|my_center|LOCUS_08930 91432 90629 gene locus_tag LOCUS_08940 91432 90629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 92038 91487 gene locus_tag LOCUS_08950 92038 91487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 92282 93370 gene locus_tag LOCUS_08960 92282 93370 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797170.1 protein_id gnl|my_center|LOCUS_08960 93439 94410 gene locus_tag LOCUS_08970 93439 94410 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 protein_id gnl|my_center|LOCUS_08970 94476 94634 gene locus_tag LOCUS_08980 94476 94634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 94845 97541 gene locus_tag LOCUS_08990 94845 97541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence100 522 124 gene locus_tag LOCUS_09000 522 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence101 >Feature sequence102 531 190 gene locus_tag LOCUS_09010 531 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence103 1 168 gene locus_tag LOCUS_09020 1 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence104 136 327 gene locus_tag LOCUS_09030 136 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence105 >Feature sequence106 >Feature sequence107 >Feature sequence108 >Feature sequence109 >Feature sequence110 805 425 gene locus_tag LOCUS_09040 805 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 2406 2176 gene locus_tag LOCUS_09050 2406 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2492 3487 gene locus_tag LOCUS_09060 2492 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 6647 3567 gene locus_tag LOCUS_09070 6647 3567 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_09070 7596 6649 gene locus_tag LOCUS_09080 7596 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 8891 7596 gene locus_tag LOCUS_09090 8891 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 9270 9196 gene locus_tag LOCUS_t00090 9270 9196 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9577 9368 gene locus_tag LOCUS_09100 gene thiS 9577 9368 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326948.1 protein_id gnl|my_center|LOCUS_09100 10962 9574 gene locus_tag LOCUS_09110 10962 9574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 12557 10962 gene locus_tag LOCUS_09120 12557 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 13393 12578 gene locus_tag LOCUS_09130 13393 12578 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_09130 13420 15075 gene locus_tag LOCUS_09140 gene recN 13420 15075 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_09140 17824 15329 gene locus_tag LOCUS_09150 17824 15329 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_09150 18614 17886 gene locus_tag LOCUS_09160 18614 17886 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_09160 18608 19273 gene locus_tag LOCUS_09170 18608 19273 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458621.1 protein_id gnl|my_center|LOCUS_09170 19605 19288 gene locus_tag LOCUS_09180 19605 19288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 19976 20890 gene locus_tag LOCUS_09190 19976 20890 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_09190 20903 21796 gene locus_tag LOCUS_09200 20903 21796 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_09200 21805 22314 gene locus_tag LOCUS_09210 21805 22314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 22311 23327 gene locus_tag LOCUS_09220 22311 23327 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_09220 23331 25286 gene locus_tag LOCUS_09230 23331 25286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 25289 27736 gene locus_tag LOCUS_09240 25289 27736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 28837 27812 gene locus_tag LOCUS_09250 gene dinB 28837 27812 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086018.1 protein_id gnl|my_center|LOCUS_09250 29270 28872 gene locus_tag LOCUS_09260 29270 28872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 30103 29291 gene locus_tag LOCUS_09270 30103 29291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 30133 31152 gene locus_tag LOCUS_09280 30133 31152 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_09280 31507 31286 gene locus_tag LOCUS_09290 31507 31286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 31391 33088 gene locus_tag LOCUS_09300 31391 33088 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_09300 34802 33102 gene locus_tag LOCUS_09310 34802 33102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 35184 38957 gene locus_tag LOCUS_09320 gene smc 35184 38957 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403652.1 protein_id gnl|my_center|LOCUS_09320 39121 39684 gene locus_tag LOCUS_09330 gene efp 39121 39684 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 protein_id gnl|my_center|LOCUS_09330 39842 40747 gene locus_tag LOCUS_09340 39842 40747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 41804 40887 gene locus_tag LOCUS_09350 41804 40887 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_09350 42319 41861 gene locus_tag LOCUS_09360 42319 41861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 42508 43263 gene locus_tag LOCUS_09370 42508 43263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 44004 43264 gene locus_tag LOCUS_09380 44004 43264 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122308.1 protein_id gnl|my_center|LOCUS_09380 44064 45851 gene locus_tag LOCUS_09390 44064 45851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339026.1 protein_id gnl|my_center|LOCUS_09390 45863 46165 gene locus_tag LOCUS_09400 45863 46165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 46664 46173 gene locus_tag LOCUS_09410 46664 46173 CDS product Cj1386 family hemin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858381.1 protein_id gnl|my_center|LOCUS_09410 48215 46719 gene locus_tag LOCUS_09420 48215 46719 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390242.1 protein_id gnl|my_center|LOCUS_09420 48334 49239 gene locus_tag LOCUS_09430 48334 49239 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_09430 49324 50640 gene locus_tag LOCUS_09440 49324 50640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 51490 50585 gene locus_tag LOCUS_09450 51490 50585 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554743.1 protein_id gnl|my_center|LOCUS_09450 51591 52151 gene locus_tag LOCUS_09460 51591 52151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 52736 52323 gene locus_tag LOCUS_09470 gene rplQ 52736 52323 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919152.1 protein_id gnl|my_center|LOCUS_09470 53853 52771 gene locus_tag LOCUS_09480 53853 52771 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_09480 54114 54374 gene locus_tag LOCUS_09490 54114 54374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 54432 55847 gene locus_tag LOCUS_09500 54432 55847 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289312.1 protein_id gnl|my_center|LOCUS_09500 55925 56518 gene locus_tag LOCUS_09510 55925 56518 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_09510 57728 56541 gene locus_tag LOCUS_09520 57728 56541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 57947 58909 gene locus_tag LOCUS_09530 57947 58909 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922457.1 protein_id gnl|my_center|LOCUS_09530 62628 58897 gene locus_tag LOCUS_09540 62628 58897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 62799 63605 gene locus_tag LOCUS_09550 62799 63605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 63748 66027 gene locus_tag LOCUS_09560 63748 66027 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_09560 66932 66042 gene locus_tag LOCUS_09570 66932 66042 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_09570 67125 67838 gene locus_tag LOCUS_09580 67125 67838 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921887.1 protein_id gnl|my_center|LOCUS_09580 67965 68633 gene locus_tag LOCUS_09590 67965 68633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 71338 68636 gene locus_tag LOCUS_09600 gene uvrA 71338 68636 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389505.1 protein_id gnl|my_center|LOCUS_09600 71526 72182 gene locus_tag LOCUS_09610 71526 72182 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_09610 72190 73002 gene locus_tag LOCUS_09620 72190 73002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 73093 73491 gene locus_tag LOCUS_09630 73093 73491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 73551 74519 gene locus_tag LOCUS_09640 73551 74519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 74746 75513 gene locus_tag LOCUS_09650 74746 75513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 75723 77078 gene locus_tag LOCUS_09660 75723 77078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 78203 77064 gene locus_tag LOCUS_09670 78203 77064 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_09670 78315 78806 gene locus_tag LOCUS_09680 78315 78806 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_09680 81376 78821 gene locus_tag LOCUS_09690 81376 78821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 81513 82832 gene locus_tag LOCUS_09700 81513 82832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880001.1 protein_id gnl|my_center|LOCUS_09700 82855 83742 gene locus_tag LOCUS_09710 82855 83742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 83739 84455 gene locus_tag LOCUS_09720 83739 84455 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268769.1 protein_id gnl|my_center|LOCUS_09720 84982 84437 gene locus_tag LOCUS_09730 84982 84437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 85362 84985 gene locus_tag LOCUS_09740 gene erpA 85362 84985 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805013.1 protein_id gnl|my_center|LOCUS_09740 85759 85481 gene locus_tag LOCUS_09750 85759 85481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 85881 87041 gene locus_tag LOCUS_09760 85881 87041 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_09760 87294 87064 gene locus_tag LOCUS_09770 87294 87064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 88381 87305 gene locus_tag LOCUS_09780 88381 87305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 89400 88378 gene locus_tag LOCUS_09790 89400 88378 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_09790 90194 89421 gene locus_tag LOCUS_09800 90194 89421 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973715.1 protein_id gnl|my_center|LOCUS_09800 91089 90307 gene locus_tag LOCUS_09810 gene madM 91089 90307 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084016.1 protein_id gnl|my_center|LOCUS_09810 91447 91091 gene locus_tag LOCUS_09820 gene madL 91447 91091 CDS product malonate transporter subunit MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112671.1 protein_id gnl|my_center|LOCUS_09820 91568 92230 gene locus_tag LOCUS_09830 91568 92230 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243931.1 protein_id gnl|my_center|LOCUS_09830 92355 92903 gene locus_tag LOCUS_09840 92355 92903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 92936 93553 gene locus_tag LOCUS_09850 92936 93553 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873505.1 protein_id gnl|my_center|LOCUS_09850 93468 93926 gene locus_tag LOCUS_09860 93468 93926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 93981 95033 gene locus_tag LOCUS_09870 93981 95033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 95258 95908 gene locus_tag LOCUS_09880 95258 95908 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244073.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence111 551 4243 gene locus_tag LOCUS_09890 551 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 4943 4263 gene locus_tag LOCUS_09900 4943 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 5759 4998 gene locus_tag LOCUS_09910 5759 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 7134 6043 gene locus_tag LOCUS_09920 7134 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_09920 8414 7131 gene locus_tag LOCUS_09930 8414 7131 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088280.1 protein_id gnl|my_center|LOCUS_09930 9955 8411 gene locus_tag LOCUS_09940 9955 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 10730 9993 gene locus_tag LOCUS_09950 gene dapB 10730 9993 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689993.1 protein_id gnl|my_center|LOCUS_09950 13417 10829 gene locus_tag LOCUS_09960 13417 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 14103 13474 gene locus_tag LOCUS_09970 gene upp 14103 13474 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699935.1 protein_id gnl|my_center|LOCUS_09970 15490 14105 gene locus_tag LOCUS_09980 15490 14105 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_09980 16959 15574 gene locus_tag LOCUS_09990 16959 15574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 17700 17041 gene locus_tag LOCUS_10000 17700 17041 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_10000 18415 17762 gene locus_tag LOCUS_10010 18415 17762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 19083 19820 gene locus_tag LOCUS_10020 19083 19820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 19828 21396 gene locus_tag LOCUS_10030 19828 21396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 21393 22079 gene locus_tag LOCUS_10040 21393 22079 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122299.1 protein_id gnl|my_center|LOCUS_10040 23302 22616 gene locus_tag LOCUS_10050 23302 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 23456 23980 gene locus_tag LOCUS_10060 23456 23980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 24688 24002 gene locus_tag LOCUS_10070 24688 24002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 25433 24987 gene locus_tag LOCUS_10080 25433 24987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 27497 25836 gene locus_tag LOCUS_10090 27497 25836 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668661.1 protein_id gnl|my_center|LOCUS_10090 28534 27536 gene locus_tag LOCUS_10100 28534 27536 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_10100 28984 28547 gene locus_tag LOCUS_10110 28984 28547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 29376 28993 gene locus_tag LOCUS_10120 29376 28993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974119.1 protein_id gnl|my_center|LOCUS_10120 29941 29432 gene locus_tag LOCUS_10130 29941 29432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831025.1 protein_id gnl|my_center|LOCUS_10130 30156 33161 gene locus_tag LOCUS_10140 30156 33161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 34621 33218 gene locus_tag LOCUS_10150 34621 33218 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_10150 36390 34729 gene locus_tag LOCUS_10160 gene glgP 36390 34729 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_10160 37554 36463 gene locus_tag LOCUS_10170 37554 36463 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530677.1 protein_id gnl|my_center|LOCUS_10170 37764 39656 gene locus_tag LOCUS_10180 37764 39656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 40283 39738 gene locus_tag LOCUS_10190 40283 39738 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244088.1 protein_id gnl|my_center|LOCUS_10190 41680 40331 gene locus_tag LOCUS_10200 41680 40331 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_10200 44719 41900 gene locus_tag LOCUS_10210 gene polA 44719 41900 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_10210 45767 44751 gene locus_tag LOCUS_10220 45767 44751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 46728 45829 gene locus_tag LOCUS_10230 gene argF 46728 45829 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_10230 47706 46852 gene locus_tag LOCUS_10240 47706 46852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 47830 51300 gene locus_tag LOCUS_10250 47830 51300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 51664 51308 gene locus_tag LOCUS_10260 51664 51308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 52621 51791 gene locus_tag LOCUS_10270 gene accD 52621 51791 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_10270 52826 53071 gene locus_tag LOCUS_10280 52826 53071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 54436 53102 gene locus_tag LOCUS_10290 54436 53102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 55700 54501 gene locus_tag LOCUS_10300 55700 54501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 55830 56900 gene locus_tag LOCUS_10310 55830 56900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 57111 59933 gene locus_tag LOCUS_10320 gene alaS 57111 59933 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_10320 61081 59951 gene locus_tag LOCUS_10330 61081 59951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 61802 61176 gene locus_tag LOCUS_10340 61802 61176 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082920.1 protein_id gnl|my_center|LOCUS_10340 63505 61949 gene locus_tag LOCUS_10350 63505 61949 CDS product subtype B tannase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898589.1 protein_id gnl|my_center|LOCUS_10350 66705 63574 gene locus_tag LOCUS_10360 gene acrB 66705 63574 CDS product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132480.1 protein_id gnl|my_center|LOCUS_10360 67785 66718 gene locus_tag LOCUS_10370 gene acrA 67785 66718 CDS product efflux RND transporter adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158151.1 protein_id gnl|my_center|LOCUS_10370 68005 68487 gene locus_tag LOCUS_10380 68005 68487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 69891 68506 gene locus_tag LOCUS_10390 gene merA 69891 68506 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193219.1 protein_id gnl|my_center|LOCUS_10390 71062 69965 gene locus_tag LOCUS_10400 71062 69965 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557336.1 protein_id gnl|my_center|LOCUS_10400 71132 71206 gene locus_tag LOCUS_t00100 71132 71206 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 71577 71308 gene locus_tag LOCUS_10410 71577 71308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 71576 72937 gene locus_tag LOCUS_10420 71576 72937 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174195.1 protein_id gnl|my_center|LOCUS_10420 73008 74129 gene locus_tag LOCUS_10430 73008 74129 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017291357.1 protein_id gnl|my_center|LOCUS_10430 74188 75603 gene locus_tag LOCUS_10440 74188 75603 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108966.1 protein_id gnl|my_center|LOCUS_10440 75739 76818 gene locus_tag LOCUS_10450 75739 76818 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_10450 78234 76828 gene locus_tag LOCUS_10460 78234 76828 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_10460 80522 78240 gene locus_tag LOCUS_10470 80522 78240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 81518 80547 gene locus_tag LOCUS_10480 81518 80547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 81748 82212 gene locus_tag LOCUS_10490 81748 82212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 82281 83429 gene locus_tag LOCUS_10500 82281 83429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 83511 84236 gene locus_tag LOCUS_10510 83511 84236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 84247 85062 gene locus_tag LOCUS_10520 84247 85062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 85309 85070 gene locus_tag LOCUS_10530 85309 85070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 87653 85980 gene locus_tag LOCUS_10540 87653 85980 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_10540 87844 88725 gene locus_tag LOCUS_10550 87844 88725 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404319.1 protein_id gnl|my_center|LOCUS_10550 89260 88784 gene locus_tag LOCUS_10560 89260 88784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970790.1 protein_id gnl|my_center|LOCUS_10560 89941 89357 gene locus_tag LOCUS_10570 89941 89357 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086782.1 protein_id gnl|my_center|LOCUS_10570 90153 91955 gene locus_tag LOCUS_10580 gene mutL 90153 91955 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_10580 92452 92964 gene locus_tag LOCUS_10590 92452 92964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 92961 93788 gene locus_tag LOCUS_10600 92961 93788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 93870 94718 gene locus_tag LOCUS_10610 93870 94718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 94757 95302 gene locus_tag LOCUS_10620 94757 95302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 95299 96345 gene locus_tag LOCUS_10630 95299 96345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 96955 96347 gene locus_tag LOCUS_10640 96955 96347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 97037 97459 gene locus_tag LOCUS_10650 97037 97459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 97456 98019 gene locus_tag LOCUS_10660 97456 98019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 98016 99887 gene locus_tag LOCUS_10670 98016 99887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 100598 99894 gene locus_tag LOCUS_10680 100598 99894 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871750.1 protein_id gnl|my_center|LOCUS_10680 101528 100653 gene locus_tag LOCUS_10690 gene rarD 101528 100653 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103301.1 protein_id gnl|my_center|LOCUS_10690 101628 102068 gene locus_tag LOCUS_10700 101628 102068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 102137 103231 gene locus_tag LOCUS_10710 102137 103231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 103282 103467 gene locus_tag LOCUS_10720 103282 103467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 103504 106269 gene locus_tag LOCUS_10730 103504 106269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 106376 107326 gene locus_tag LOCUS_10740 106376 107326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 107399 108013 gene locus_tag LOCUS_10750 107399 108013 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977513.1 protein_id gnl|my_center|LOCUS_10750 108015 109277 gene locus_tag LOCUS_10760 108015 109277 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_10760 111457 109289 gene locus_tag LOCUS_10770 111457 109289 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839960.1 protein_id gnl|my_center|LOCUS_10770 111813 111571 gene locus_tag LOCUS_10780 111813 111571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 111906 112388 gene locus_tag LOCUS_10790 111906 112388 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762404.1 protein_id gnl|my_center|LOCUS_10790 112433 112681 gene locus_tag LOCUS_10800 112433 112681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 112704 113789 gene locus_tag LOCUS_10810 112704 113789 CDS product putative zinc-binding peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104652.1 protein_id gnl|my_center|LOCUS_10810 114937 114404 gene locus_tag LOCUS_10820 114937 114404 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083508.1 protein_id gnl|my_center|LOCUS_10820 115607 114981 gene locus_tag LOCUS_10830 115607 114981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 115760 116686 gene locus_tag LOCUS_10840 115760 116686 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190289.1 protein_id gnl|my_center|LOCUS_10840 117488 116700 gene locus_tag LOCUS_10850 117488 116700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 117639 119279 gene locus_tag LOCUS_10860 117639 119279 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_10860 119380 121353 gene locus_tag LOCUS_10870 119380 121353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 121366 122007 gene locus_tag LOCUS_10880 121366 122007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 122181 122342 gene locus_tag LOCUS_10890 122181 122342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 122573 123055 gene locus_tag LOCUS_10900 122573 123055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 123174 124028 gene locus_tag LOCUS_10910 123174 124028 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975564.1 protein_id gnl|my_center|LOCUS_10910 124307 124747 gene locus_tag LOCUS_10920 124307 124747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10920 124867 125400 gene locus_tag LOCUS_10930 124867 125400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10930 125393 127063 gene locus_tag LOCUS_10940 gene pqiB 125393 127063 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050078426.1 protein_id gnl|my_center|LOCUS_10940 127887 127096 gene locus_tag LOCUS_10950 127887 127096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 129260 127911 gene locus_tag LOCUS_10960 129260 127911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 130171 129311 gene locus_tag LOCUS_10970 130171 129311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 131506 130193 gene locus_tag LOCUS_10980 131506 130193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 131651 132868 gene locus_tag LOCUS_10990 131651 132868 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707892.1 protein_id gnl|my_center|LOCUS_10990 132882 133424 gene locus_tag LOCUS_11000 gene coaC 132882 133424 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595814.1 protein_id gnl|my_center|LOCUS_11000 133920 133411 gene locus_tag LOCUS_11010 gene uraD 133920 133411 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552526.1 protein_id gnl|my_center|LOCUS_11010 133849 134805 gene locus_tag LOCUS_11020 gene pucL 133849 134805 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057393.1 protein_id gnl|my_center|LOCUS_11020 134805 135590 gene locus_tag LOCUS_11030 gene xdhC 134805 135590 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083344.1 protein_id gnl|my_center|LOCUS_11030 135649 135918 gene locus_tag LOCUS_11040 gene rpsN 135649 135918 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085703.1 protein_id gnl|my_center|LOCUS_11040 135983 136243 gene locus_tag LOCUS_11050 135983 136243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 136256 137665 gene locus_tag LOCUS_11060 136256 137665 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_11060 137686 138357 gene locus_tag LOCUS_11070 gene trmD 137686 138357 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_11070 138776 138387 gene locus_tag LOCUS_11080 138776 138387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 143360 138798 gene locus_tag LOCUS_11090 143360 138798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 144651 143551 gene locus_tag LOCUS_11100 144651 143551 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405202.1 protein_id gnl|my_center|LOCUS_11100 145800 144697 gene locus_tag LOCUS_11110 145800 144697 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 protein_id gnl|my_center|LOCUS_11110 146968 145835 gene locus_tag LOCUS_11120 146968 145835 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_11120 147258 148007 gene locus_tag LOCUS_11130 147258 148007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 149826 148837 gene locus_tag LOCUS_11140 149826 148837 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_11140 150680 149838 gene locus_tag LOCUS_11150 150680 149838 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728286.1 protein_id gnl|my_center|LOCUS_11150 151453 150689 gene locus_tag LOCUS_11160 151453 150689 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645514.1 protein_id gnl|my_center|LOCUS_11160 151887 151450 gene locus_tag LOCUS_11170 151887 151450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 152011 153051 gene locus_tag LOCUS_11180 152011 153051 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040720.1 protein_id gnl|my_center|LOCUS_11180 153567 152980 gene locus_tag LOCUS_11190 153567 152980 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640290.1 protein_id gnl|my_center|LOCUS_11190 154805 153600 gene locus_tag LOCUS_11200 154805 153600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 155479 154802 gene locus_tag LOCUS_11210 155479 154802 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_11210 156443 155538 gene locus_tag LOCUS_11220 156443 155538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 157599 156493 gene locus_tag LOCUS_11230 157599 156493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 159714 157945 gene locus_tag LOCUS_11240 159714 157945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 161282 159711 gene locus_tag LOCUS_11250 161282 159711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 163062 161386 gene locus_tag LOCUS_11260 163062 161386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 164349 163063 gene locus_tag LOCUS_11270 164349 163063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 165212 164346 gene locus_tag LOCUS_11280 165212 164346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 167612 165780 gene locus_tag LOCUS_11290 167612 165780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 168530 167628 gene locus_tag LOCUS_11300 168530 167628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 169490 168624 gene locus_tag LOCUS_11310 169490 168624 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105037.1 protein_id gnl|my_center|LOCUS_11310 170526 169594 gene locus_tag LOCUS_11320 170526 169594 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_11320 172424 171867 gene locus_tag LOCUS_11330 172424 171867 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122333.1 protein_id gnl|my_center|LOCUS_11330 173038 172442 gene locus_tag LOCUS_11340 173038 172442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 174806 174354 gene locus_tag LOCUS_11350 174806 174354 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122331.1 protein_id gnl|my_center|LOCUS_11350 175395 174799 gene locus_tag LOCUS_11360 175395 174799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 176672 175716 gene locus_tag LOCUS_11370 176672 175716 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922242.1 protein_id gnl|my_center|LOCUS_11370 177646 176669 gene locus_tag LOCUS_11380 177646 176669 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 protein_id gnl|my_center|LOCUS_11380 179294 177711 gene locus_tag LOCUS_11390 179294 177711 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_11390 180201 179434 gene locus_tag LOCUS_11400 180201 179434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_11400 180659 180267 gene locus_tag LOCUS_11410 180659 180267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 181335 180709 gene locus_tag LOCUS_11420 181335 180709 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620669.1 protein_id gnl|my_center|LOCUS_11420 182737 181346 gene locus_tag LOCUS_11430 182737 181346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 182869 183639 gene locus_tag LOCUS_11440 gene hisA 182869 183639 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460044.1 protein_id gnl|my_center|LOCUS_11440 183771 184742 gene locus_tag LOCUS_11450 183771 184742 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_11450 184739 185707 gene locus_tag LOCUS_11460 184739 185707 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_11460 185734 186975 gene locus_tag LOCUS_11470 185734 186975 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528743.1 protein_id gnl|my_center|LOCUS_11470 186985 187623 gene locus_tag LOCUS_11480 186985 187623 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 protein_id gnl|my_center|LOCUS_11480 187625 188200 gene locus_tag LOCUS_11490 187625 188200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 188239 189480 gene locus_tag LOCUS_11500 188239 189480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 189998 189489 gene locus_tag LOCUS_11510 189998 189489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 191385 190120 gene locus_tag LOCUS_11520 191385 190120 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986777.1 protein_id gnl|my_center|LOCUS_11520 191902 191456 gene locus_tag LOCUS_11530 191902 191456 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932147.1 protein_id gnl|my_center|LOCUS_11530 192361 191915 gene locus_tag LOCUS_11540 192361 191915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 192982 192380 gene locus_tag LOCUS_11550 192982 192380 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881107.1 protein_id gnl|my_center|LOCUS_11550 194640 192988 gene locus_tag LOCUS_11560 194640 192988 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807020.1 protein_id gnl|my_center|LOCUS_11560 195253 198930 gene locus_tag LOCUS_11570 195253 198930 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241751.1 protein_id gnl|my_center|LOCUS_11570 198961 199605 gene locus_tag LOCUS_11580 198961 199605 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_11580 201024 199648 gene locus_tag LOCUS_11590 201024 199648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 201220 201041 gene locus_tag LOCUS_11600 201220 201041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 201274 201654 gene locus_tag LOCUS_11610 201274 201654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 203832 201913 gene locus_tag LOCUS_11620 203832 201913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 204770 203838 gene locus_tag LOCUS_11630 204770 203838 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 protein_id gnl|my_center|LOCUS_11630 205363 204905 gene locus_tag LOCUS_11640 205363 204905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 205551 206018 gene locus_tag LOCUS_11650 205551 206018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 207345 205975 gene locus_tag LOCUS_11660 207345 205975 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338470.1 protein_id gnl|my_center|LOCUS_11660 209980 207533 gene locus_tag LOCUS_11670 209980 207533 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266827.1 protein_id gnl|my_center|LOCUS_11670 211090 209999 gene locus_tag LOCUS_11680 211090 209999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 212058 211165 gene locus_tag LOCUS_11690 212058 211165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 212986 212099 gene locus_tag LOCUS_11700 gene metF 212986 212099 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_11700 215377 213002 gene locus_tag LOCUS_11710 gene metE 215377 213002 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114925.1 protein_id gnl|my_center|LOCUS_11710 215455 216369 gene locus_tag LOCUS_11720 215455 216369 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189234.1 protein_id gnl|my_center|LOCUS_11720 217953 216400 gene locus_tag LOCUS_11730 217953 216400 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056564.1 protein_id gnl|my_center|LOCUS_11730 218503 217979 gene locus_tag LOCUS_11740 218503 217979 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357763.1 protein_id gnl|my_center|LOCUS_11740 219125 218535 gene locus_tag LOCUS_11750 219125 218535 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684771.1 protein_id gnl|my_center|LOCUS_11750 220021 219257 gene locus_tag LOCUS_11760 220021 219257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 225025 225513 gene locus_tag LOCUS_11770 225025 225513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 227713 225545 gene locus_tag LOCUS_11780 227713 225545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 227867 228463 gene locus_tag LOCUS_11790 227867 228463 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919522.1 protein_id gnl|my_center|LOCUS_11790 228460 230139 gene locus_tag LOCUS_11800 228460 230139 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_11800 230250 230939 gene locus_tag LOCUS_11810 230250 230939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 231080 231418 gene locus_tag LOCUS_11820 231080 231418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 232006 231434 gene locus_tag LOCUS_11830 gene purN 232006 231434 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_11830 232102 233202 gene locus_tag LOCUS_11840 232102 233202 CDS product M29 family aminopeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729641.1 protein_id gnl|my_center|LOCUS_11840 233936 233283 gene locus_tag LOCUS_11850 233936 233283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11850 235111 233933 gene locus_tag LOCUS_11860 235111 233933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11860 236214 235213 gene locus_tag LOCUS_11870 236214 235213 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_11870 237447 236410 gene locus_tag LOCUS_11880 gene plsX 237447 236410 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_11880 238245 237742 gene locus_tag LOCUS_11890 238245 237742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 238679 239767 gene locus_tag LOCUS_11900 238679 239767 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903779.1 protein_id gnl|my_center|LOCUS_11900 239837 240256 gene locus_tag LOCUS_11910 239837 240256 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_11910 240324 243590 gene locus_tag LOCUS_11920 240324 243590 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873439.1 protein_id gnl|my_center|LOCUS_11920 243755 245119 gene locus_tag LOCUS_11930 243755 245119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 245116 246300 gene locus_tag LOCUS_11940 245116 246300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 248558 248343 gene locus_tag LOCUS_11950 248558 248343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 248842 250146 gene locus_tag LOCUS_11960 248842 250146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 251143 251487 gene locus_tag LOCUS_11970 251143 251487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 251554 252519 gene locus_tag LOCUS_11980 251554 252519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 252476 252802 gene locus_tag LOCUS_11990 252476 252802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 252854 253408 gene locus_tag LOCUS_12000 252854 253408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 253527 254006 gene locus_tag LOCUS_12010 253527 254006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 255000 255191 gene locus_tag LOCUS_12020 255000 255191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 255191 255943 gene locus_tag LOCUS_12030 255191 255943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 255963 256670 gene locus_tag LOCUS_12040 255963 256670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 256867 257787 gene locus_tag LOCUS_12050 256867 257787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 258114 257836 gene locus_tag LOCUS_12060 258114 257836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 258150 258554 gene locus_tag LOCUS_12070 258150 258554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 258808 260196 gene locus_tag LOCUS_12080 258808 260196 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_12080 260727 260215 gene locus_tag LOCUS_12090 260727 260215 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965933.1 protein_id gnl|my_center|LOCUS_12090 260789 263047 gene locus_tag LOCUS_12100 260789 263047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 263059 265068 gene locus_tag LOCUS_12110 263059 265068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 265155 266144 gene locus_tag LOCUS_12120 265155 266144 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_12120 266144 266371 gene locus_tag LOCUS_12130 266144 266371 CDS product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210768.1 protein_id gnl|my_center|LOCUS_12130 268547 266292 gene locus_tag LOCUS_12140 268547 266292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 269009 268554 gene locus_tag LOCUS_12150 269009 268554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 271942 269006 gene locus_tag LOCUS_12160 271942 269006 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_12160 272104 272190 gene locus_tag LOCUS_t00110 272104 272190 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 272314 273357 gene locus_tag LOCUS_12170 272314 273357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 273458 273817 gene locus_tag LOCUS_12180 273458 273817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 274647 273886 gene locus_tag LOCUS_12190 274647 273886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 274773 274952 gene locus_tag LOCUS_12200 274773 274952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 275465 274953 gene locus_tag LOCUS_12210 275465 274953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 275567 275845 gene locus_tag LOCUS_12220 275567 275845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence112 >Feature sequence113 >Feature sequence114 >Feature sequence115 >Feature sequence116 >Feature sequence117 >Feature sequence118 >Feature sequence119 >Feature sequence120 >Feature sequence121 23 379 gene locus_tag LOCUS_12230 23 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence122 236 943 gene locus_tag LOCUS_12240 gene creB 236 943 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113268.1 protein_id gnl|my_center|LOCUS_12240 962 2398 gene locus_tag LOCUS_12250 gene creC 962 2398 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037824.1 protein_id gnl|my_center|LOCUS_12250 2409 2894 gene locus_tag LOCUS_12260 gene mscL 2409 2894 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968654.1 protein_id gnl|my_center|LOCUS_12260 3418 2966 gene locus_tag LOCUS_12270 gene azu 3418 2966 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706751.1 protein_id gnl|my_center|LOCUS_12270 3694 4041 gene locus_tag LOCUS_12280 3694 4041 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205430.1 protein_id gnl|my_center|LOCUS_12280 4145 4567 gene locus_tag LOCUS_12290 4145 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 6089 4578 gene locus_tag LOCUS_12300 6089 4578 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_12300 6645 6124 gene locus_tag LOCUS_12310 6645 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 7696 6821 gene locus_tag LOCUS_12320 7696 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 8857 7766 gene locus_tag LOCUS_12330 8857 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 8888 9751 gene locus_tag LOCUS_12340 8888 9751 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_12340 10544 9837 gene locus_tag LOCUS_12350 10544 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 10998 10783 gene locus_tag LOCUS_12360 10998 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 11185 12618 gene locus_tag LOCUS_12370 11185 12618 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_12370 12644 13171 gene locus_tag LOCUS_12380 12644 13171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 13174 13920 gene locus_tag LOCUS_12390 13174 13920 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_12390 13965 14915 gene locus_tag LOCUS_12400 gene glcK 13965 14915 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_12400 17691 14926 gene locus_tag LOCUS_12410 17691 14926 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933304.1 protein_id gnl|my_center|LOCUS_12410 17780 19351 gene locus_tag LOCUS_12420 gene menD 17780 19351 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766783.1 protein_id gnl|my_center|LOCUS_12420 19378 21399 gene locus_tag LOCUS_12430 19378 21399 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932948.1 protein_id gnl|my_center|LOCUS_12430 22099 21383 gene locus_tag LOCUS_12440 22099 21383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 22235 23518 gene locus_tag LOCUS_12450 gene hemL 22235 23518 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045309.1 protein_id gnl|my_center|LOCUS_12450 23529 23816 gene locus_tag LOCUS_12460 23529 23816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 24035 23838 gene locus_tag LOCUS_12470 24035 23838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 24170 24664 gene locus_tag LOCUS_12480 24170 24664 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574643.1 protein_id gnl|my_center|LOCUS_12480 24712 25050 gene locus_tag LOCUS_12490 24712 25050 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941930.1 protein_id gnl|my_center|LOCUS_12490 25054 25617 gene locus_tag LOCUS_12500 25054 25617 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_12500 27549 25636 gene locus_tag LOCUS_12510 27549 25636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 28690 27584 gene locus_tag LOCUS_12520 28690 27584 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_12520 29344 29024 gene locus_tag LOCUS_12530 29344 29024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 29474 30064 gene locus_tag LOCUS_12540 29474 30064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 31563 30127 gene locus_tag LOCUS_12550 gene dnaB 31563 30127 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_12550 31803 32255 gene locus_tag LOCUS_12560 gene dtd 31803 32255 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_12560 32607 32284 gene locus_tag LOCUS_12570 32607 32284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 33021 33266 gene locus_tag LOCUS_12580 33021 33266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 34992 33382 gene locus_tag LOCUS_12590 34992 33382 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_12590 36127 35384 gene locus_tag LOCUS_12600 36127 35384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 36718 36140 gene locus_tag LOCUS_12610 36718 36140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 37260 36742 gene locus_tag LOCUS_12620 37260 36742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 37762 37280 gene locus_tag LOCUS_12630 37762 37280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 38111 37767 gene locus_tag LOCUS_12640 38111 37767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 38695 38108 gene locus_tag LOCUS_12650 38695 38108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 38801 40201 gene locus_tag LOCUS_12660 gene cysS 38801 40201 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_12660 40271 40549 gene locus_tag LOCUS_12670 40271 40549 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918778.1 protein_id gnl|my_center|LOCUS_12670 40604 42874 gene locus_tag LOCUS_12680 40604 42874 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918461.1 protein_id gnl|my_center|LOCUS_12680 43843 42881 gene locus_tag LOCUS_12690 43843 42881 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695267.1 protein_id gnl|my_center|LOCUS_12690 44092 45447 gene locus_tag LOCUS_12700 44092 45447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 47359 46496 gene locus_tag LOCUS_12710 47359 46496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 50113 47411 gene locus_tag LOCUS_12720 50113 47411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 50286 50876 gene locus_tag LOCUS_12730 50286 50876 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184853.1 protein_id gnl|my_center|LOCUS_12730 50883 51701 gene locus_tag LOCUS_12740 gene mutM 50883 51701 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369156.1 protein_id gnl|my_center|LOCUS_12740 51771 52544 gene locus_tag LOCUS_12750 51771 52544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 54613 52553 gene locus_tag LOCUS_12760 54613 52553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 56881 54971 gene locus_tag LOCUS_12770 56881 54971 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_12770 57493 56969 gene locus_tag LOCUS_12780 57493 56969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 57443 57640 gene locus_tag LOCUS_12790 57443 57640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 57857 59287 gene locus_tag LOCUS_12800 57857 59287 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_12800 59330 60370 gene locus_tag LOCUS_12810 59330 60370 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_12810 60367 61269 gene locus_tag LOCUS_12820 60367 61269 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888626.1 protein_id gnl|my_center|LOCUS_12820 61328 61594 gene locus_tag LOCUS_12830 61328 61594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 61625 63127 gene locus_tag LOCUS_12840 61625 63127 CDS product ribonuclease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141613167.1 protein_id gnl|my_center|LOCUS_12840 64629 63994 gene locus_tag LOCUS_12850 64629 63994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 65334 65059 gene locus_tag LOCUS_12860 65334 65059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 66146 65952 gene locus_tag LOCUS_12870 66146 65952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 66245 68902 gene locus_tag LOCUS_12880 66245 68902 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068835.1 protein_id gnl|my_center|LOCUS_12880 68903 70081 gene locus_tag LOCUS_12890 68903 70081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 70100 73270 gene locus_tag LOCUS_12900 70100 73270 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068838.1 protein_id gnl|my_center|LOCUS_12900 73295 74176 gene locus_tag LOCUS_12910 73295 74176 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385731.1 protein_id gnl|my_center|LOCUS_12910 74204 75115 gene locus_tag LOCUS_12920 74204 75115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 77355 78167 gene locus_tag LOCUS_12930 77355 78167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 78251 80674 gene locus_tag LOCUS_12940 78251 80674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 82044 82496 gene locus_tag LOCUS_12950 gene tnpA 82044 82496 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_12950 83573 82527 gene locus_tag LOCUS_12960 83573 82527 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_12960 87569 83712 gene locus_tag LOCUS_12970 87569 83712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 87669 89927 gene locus_tag LOCUS_12980 87669 89927 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729998.1 protein_id gnl|my_center|LOCUS_12980 90727 89915 gene locus_tag LOCUS_12990 gene fdhD 90727 89915 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_12990 90875 91450 gene locus_tag LOCUS_13000 90875 91450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 91961 92458 gene locus_tag LOCUS_13010 91961 92458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 92611 93900 gene locus_tag LOCUS_13020 gene lysA 92611 93900 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence123 >Feature sequence124 400 86 gene locus_tag LOCUS_13030 400 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence125 >Feature sequence126 >Feature sequence127 135 356 gene locus_tag LOCUS_13040 135 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence128 >Feature sequence129 >Feature sequence130 >Feature sequence131 >Feature sequence132 >Feature sequence133 788 603 gene locus_tag LOCUS_13050 788 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1915 2097 gene locus_tag LOCUS_13060 1915 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2417 2920 gene locus_tag LOCUS_13070 2417 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 3456 3127 gene locus_tag LOCUS_13080 3456 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 3685 4065 gene locus_tag LOCUS_13090 3685 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 5106 4198 gene locus_tag LOCUS_13100 5106 4198 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_13100 6434 5115 gene locus_tag LOCUS_13110 gene gltX 6434 5115 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082426.1 protein_id gnl|my_center|LOCUS_13110 7101 6505 gene locus_tag LOCUS_13120 gene ruvA 7101 6505 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_13120 7231 7156 gene locus_tag LOCUS_t00120 7231 7156 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7520 7594 gene locus_tag LOCUS_t00130 7520 7594 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8005 8763 gene locus_tag LOCUS_13130 8005 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 8936 9409 gene locus_tag LOCUS_13140 8936 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 9511 10290 gene locus_tag LOCUS_13150 9511 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 10388 10993 gene locus_tag LOCUS_13160 gene rutB 10388 10993 CDS product pyrimidine utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207568.1 protein_id gnl|my_center|LOCUS_13160 11039 13366 gene locus_tag LOCUS_13170 11039 13366 CDS product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_13170 13394 14707 gene locus_tag LOCUS_13180 13394 14707 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922962.1 protein_id gnl|my_center|LOCUS_13180 14844 15875 gene locus_tag LOCUS_13190 gene tdh 14844 15875 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094910.1 protein_id gnl|my_center|LOCUS_13190 15939 17123 gene locus_tag LOCUS_13200 15939 17123 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_13200 17120 17668 gene locus_tag LOCUS_13210 17120 17668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 19068 17788 gene locus_tag LOCUS_13220 gene clpX 19068 17788 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_13220 19773 19114 gene locus_tag LOCUS_13230 gene clpP 19773 19114 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_13230 21139 19790 gene locus_tag LOCUS_13240 gene tig 21139 19790 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_13240 22027 21203 gene locus_tag LOCUS_13250 gene ispE 22027 21203 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545467.1 protein_id gnl|my_center|LOCUS_13250 22746 22036 gene locus_tag LOCUS_13260 22746 22036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 23239 22778 gene locus_tag LOCUS_13270 23239 22778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 23972 23496 gene locus_tag LOCUS_13280 23972 23496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 25230 24019 gene locus_tag LOCUS_13290 25230 24019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 26847 25300 gene locus_tag LOCUS_13300 26847 25300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 28807 26897 gene locus_tag LOCUS_13310 28807 26897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 29548 28817 gene locus_tag LOCUS_13320 29548 28817 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_13320 30310 29579 gene locus_tag LOCUS_13330 30310 29579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 30515 31183 gene locus_tag LOCUS_13340 30515 31183 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143956.1 protein_id gnl|my_center|LOCUS_13340 32712 31204 gene locus_tag LOCUS_13350 gene cobA 32712 31204 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_13350 33677 32709 gene locus_tag LOCUS_13360 gene hemC 33677 32709 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260939.1 protein_id gnl|my_center|LOCUS_13360 34689 33679 gene locus_tag LOCUS_13370 gene hemA 34689 33679 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_13370 35453 34689 gene locus_tag LOCUS_13380 35453 34689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 40211 35529 gene locus_tag LOCUS_13390 40211 35529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 40451 40870 gene locus_tag LOCUS_13400 40451 40870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 43622 40890 gene locus_tag LOCUS_13410 43622 40890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 46215 43687 gene locus_tag LOCUS_13420 46215 43687 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815970.1 protein_id gnl|my_center|LOCUS_13420 47415 46303 gene locus_tag LOCUS_13430 gene dprA 47415 46303 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922340.1 protein_id gnl|my_center|LOCUS_13430 49617 47422 gene locus_tag LOCUS_13440 49617 47422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 50949 49741 gene locus_tag LOCUS_13450 50949 49741 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_13450 51110 52222 gene locus_tag LOCUS_13460 51110 52222 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460822.1 protein_id gnl|my_center|LOCUS_13460 52219 52620 gene locus_tag LOCUS_13470 52219 52620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 52706 53575 gene locus_tag LOCUS_13480 52706 53575 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_13480 53647 54426 gene locus_tag LOCUS_13490 53647 54426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 54443 57586 gene locus_tag LOCUS_13500 54443 57586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 58532 57603 gene locus_tag LOCUS_13510 58532 57603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 58567 59328 gene locus_tag LOCUS_13520 58567 59328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 59420 60874 gene locus_tag LOCUS_13530 gene guaB 59420 60874 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_13530 60909 62432 gene locus_tag LOCUS_13540 gene guaA 60909 62432 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938342.1 protein_id gnl|my_center|LOCUS_13540 62453 63706 gene locus_tag LOCUS_13550 62453 63706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 64539 63982 gene locus_tag LOCUS_13560 64539 63982 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104364.1 protein_id gnl|my_center|LOCUS_13560 64711 65055 gene locus_tag LOCUS_13570 64711 65055 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946155.1 protein_id gnl|my_center|LOCUS_13570 66321 65278 gene locus_tag LOCUS_13580 66321 65278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 68348 66318 gene locus_tag LOCUS_13590 68348 66318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 68515 69321 gene locus_tag LOCUS_13600 68515 69321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 71001 69460 gene locus_tag LOCUS_13610 gene purH 71001 69460 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909162.1 protein_id gnl|my_center|LOCUS_13610 72587 71178 gene locus_tag LOCUS_13620 gene gatA 72587 71178 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_13620 72913 72620 gene locus_tag LOCUS_13630 gene gatC 72913 72620 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086999.1 protein_id gnl|my_center|LOCUS_13630 74840 73185 gene locus_tag LOCUS_13640 74840 73185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 74923 75729 gene locus_tag LOCUS_13650 gene proC 74923 75729 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921679.1 protein_id gnl|my_center|LOCUS_13650 76584 75793 gene locus_tag LOCUS_13660 76584 75793 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867773.1 protein_id gnl|my_center|LOCUS_13660 78136 77231 gene locus_tag LOCUS_13670 78136 77231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 78647 78171 gene locus_tag LOCUS_13680 78647 78171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 80524 80024 gene locus_tag LOCUS_13690 80524 80024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 80694 80539 gene locus_tag LOCUS_13700 80694 80539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 81391 80984 gene locus_tag LOCUS_13710 81391 80984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 82332 81889 gene locus_tag LOCUS_13720 82332 81889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 82829 82419 gene locus_tag LOCUS_13730 82829 82419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 83299 82844 gene locus_tag LOCUS_13740 83299 82844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 83822 83367 gene locus_tag LOCUS_13750 83822 83367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 84250 83837 gene locus_tag LOCUS_13760 84250 83837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence134 >Feature sequence135 >Feature sequence136 >Feature sequence137 >Feature sequence138 >Feature sequence139 >Feature sequence140 >Feature sequence141 >Feature sequence142 >Feature sequence143 >Feature sequence144 768 118 gene locus_tag LOCUS_13770 768 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1377 817 gene locus_tag LOCUS_13780 1377 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2710 1418 gene locus_tag LOCUS_13790 2710 1418 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_13790 4476 2812 gene locus_tag LOCUS_13800 4476 2812 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_13800 6175 4496 gene locus_tag LOCUS_13810 6175 4496 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_13810 7516 6368 gene locus_tag LOCUS_13820 gene ftsW 7516 6368 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545997.1 protein_id gnl|my_center|LOCUS_13820 8320 7532 gene locus_tag LOCUS_13830 8320 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 9647 8337 gene locus_tag LOCUS_13840 gene murD 9647 8337 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_13840 10883 9651 gene locus_tag LOCUS_13850 gene mraY 10883 9651 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167069.1 protein_id gnl|my_center|LOCUS_13850 12250 10877 gene locus_tag LOCUS_13860 12250 10877 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_13860 13746 12247 gene locus_tag LOCUS_13870 13746 12247 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_13870 15623 13743 gene locus_tag LOCUS_13880 15623 13743 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_13880 16021 15680 gene locus_tag LOCUS_13890 16021 15680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 17290 16028 gene locus_tag LOCUS_13900 17290 16028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 17967 17626 gene locus_tag LOCUS_13910 17967 17626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 18381 18758 gene locus_tag LOCUS_13920 18381 18758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 19846 18767 gene locus_tag LOCUS_13930 19846 18767 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288096.1 protein_id gnl|my_center|LOCUS_13930 21364 19895 gene locus_tag LOCUS_13940 21364 19895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 22043 21375 gene locus_tag LOCUS_13950 22043 21375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 22362 22087 gene locus_tag LOCUS_13960 22362 22087 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325406.1 protein_id gnl|my_center|LOCUS_13960 22595 23218 gene locus_tag LOCUS_13970 22595 23218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 23215 23574 gene locus_tag LOCUS_13980 23215 23574 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_13980 23637 24854 gene locus_tag LOCUS_13990 23637 24854 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_13990 24865 26223 gene locus_tag LOCUS_14000 24865 26223 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_14000 26260 28083 gene locus_tag LOCUS_14010 26260 28083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 28086 28418 gene locus_tag LOCUS_14020 28086 28418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 28396 30300 gene locus_tag LOCUS_14030 gene dxs 28396 30300 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245985.1 protein_id gnl|my_center|LOCUS_14030 30902 32275 gene locus_tag LOCUS_14040 gene algB 30902 32275 CDS product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102840.1 protein_id gnl|my_center|LOCUS_14040 32294 34111 gene locus_tag LOCUS_14050 32294 34111 CDS product KinB sensor domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114120.1 protein_id gnl|my_center|LOCUS_14050 34095 34724 gene locus_tag LOCUS_14060 34095 34724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 34747 35676 gene locus_tag LOCUS_14070 34747 35676 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391037.1 protein_id gnl|my_center|LOCUS_14070 35691 36530 gene locus_tag LOCUS_14080 35691 36530 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391038.1 protein_id gnl|my_center|LOCUS_14080 37554 36598 gene locus_tag LOCUS_14090 37554 36598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 38966 37875 gene locus_tag LOCUS_14100 38966 37875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 39191 41149 gene locus_tag LOCUS_14110 gene acs 39191 41149 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140163.1 protein_id gnl|my_center|LOCUS_14110 41247 42047 gene locus_tag LOCUS_14120 41247 42047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 43362 42058 gene locus_tag LOCUS_14130 43362 42058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 43960 43382 gene locus_tag LOCUS_14140 43960 43382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 44067 44861 gene locus_tag LOCUS_14150 gene folP 44067 44861 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082506.1 protein_id gnl|my_center|LOCUS_14150 45922 44864 gene locus_tag LOCUS_14160 45922 44864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 46559 46107 gene locus_tag LOCUS_14170 46559 46107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 47426 46587 gene locus_tag LOCUS_14180 47426 46587 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_14180 48659 47430 gene locus_tag LOCUS_14190 48659 47430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 49504 48872 gene locus_tag LOCUS_14200 49504 48872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 50548 49529 gene locus_tag LOCUS_14210 50548 49529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 51736 50795 gene locus_tag LOCUS_14220 51736 50795 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_14220 52380 51748 gene locus_tag LOCUS_14230 gene thiE 52380 51748 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172766.1 protein_id gnl|my_center|LOCUS_14230 53777 52419 gene locus_tag LOCUS_14240 gene accC 53777 52419 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_14240 54299 53829 gene locus_tag LOCUS_14250 gene accB 54299 53829 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_14250 54480 55106 gene locus_tag LOCUS_14260 54480 55106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 57351 55096 gene locus_tag LOCUS_14270 57351 55096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 58044 57358 gene locus_tag LOCUS_14280 58044 57358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 58524 58162 gene locus_tag LOCUS_14290 58524 58162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 58644 59558 gene locus_tag LOCUS_14300 58644 59558 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_14300 59902 60891 gene locus_tag LOCUS_14310 59902 60891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 60904 62178 gene locus_tag LOCUS_14320 60904 62178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 62393 63430 gene locus_tag LOCUS_14330 62393 63430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 63430 64395 gene locus_tag LOCUS_14340 63430 64395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 64479 65687 gene locus_tag LOCUS_14350 64479 65687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 65695 66981 gene locus_tag LOCUS_14360 65695 66981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 67109 68401 gene locus_tag LOCUS_14370 67109 68401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 68398 69663 gene locus_tag LOCUS_14380 68398 69663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 69786 70751 gene locus_tag LOCUS_14390 gene pfkA 69786 70751 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082880.1 protein_id gnl|my_center|LOCUS_14390 74316 70756 gene locus_tag LOCUS_14400 74316 70756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 74909 74451 gene locus_tag LOCUS_14410 74909 74451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 75241 75044 gene locus_tag LOCUS_14420 75241 75044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 76889 75246 gene locus_tag LOCUS_14430 76889 75246 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_14430 77702 76956 gene locus_tag LOCUS_14440 77702 76956 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_14440 78843 77722 gene locus_tag LOCUS_14450 78843 77722 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038761.1 protein_id gnl|my_center|LOCUS_14450 79240 80514 gene locus_tag LOCUS_14460 gene bioA 79240 80514 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939829.1 protein_id gnl|my_center|LOCUS_14460 80562 80636 gene locus_tag LOCUS_t00140 80562 80636 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence145 >Feature sequence146 >Feature sequence147 >Feature sequence148 >Feature sequence149 >Feature sequence150 >Feature sequence151 >Feature sequence152 >Feature sequence153 >Feature sequence154 60 311 gene locus_tag LOCUS_14470 60 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence155 <1 510 gene locus_tag LOCUS_14480 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_188825379.1:IS3 family transposase 985 1665 gene locus_tag LOCUS_14490 985 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2982 1681 gene locus_tag LOCUS_14500 2982 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 3320 2982 gene locus_tag LOCUS_14510 3320 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 3709 3963 gene locus_tag LOCUS_14520 3709 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 3973 4284 gene locus_tag LOCUS_14530 3973 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 5207 4353 gene locus_tag LOCUS_14540 5207 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 5811 5518 gene locus_tag LOCUS_14550 5811 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 6701 5808 gene locus_tag LOCUS_14560 6701 5808 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263960.1 protein_id gnl|my_center|LOCUS_14560 7005 7349 gene locus_tag LOCUS_14570 7005 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 7276 7917 gene locus_tag LOCUS_14580 7276 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 7917 8111 gene locus_tag LOCUS_14590 7917 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 8420 8118 gene locus_tag LOCUS_14600 8420 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 8494 8967 gene locus_tag LOCUS_14610 8494 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 8964 9614 gene locus_tag LOCUS_14620 8964 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 11177 9621 gene locus_tag LOCUS_14630 11177 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 12042 11374 gene locus_tag LOCUS_14640 12042 11374 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087143.1 protein_id gnl|my_center|LOCUS_14640 13836 12364 gene locus_tag LOCUS_14650 13836 12364 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_14650 15851 13833 gene locus_tag LOCUS_14660 15851 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 17330 15870 gene locus_tag LOCUS_14670 17330 15870 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122924.1 protein_id gnl|my_center|LOCUS_14670 18445 17333 gene locus_tag LOCUS_14680 18445 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 21264 18454 gene locus_tag LOCUS_14690 21264 18454 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_14690 22280 21828 gene locus_tag LOCUS_14700 22280 21828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 22475 22699 gene locus_tag LOCUS_14710 22475 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 23049 22705 gene locus_tag LOCUS_14720 23049 22705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 23570 24949 gene locus_tag LOCUS_14730 23570 24949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 24895 24819 gene locus_tag LOCUS_t00150 24895 24819 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 24971 26014 gene locus_tag LOCUS_14740 gene argC 24971 26014 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937798.1 protein_id gnl|my_center|LOCUS_14740 26052 27305 gene locus_tag LOCUS_14750 gene argJ 26052 27305 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_14750 27461 31435 gene locus_tag LOCUS_14760 27461 31435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 32044 34428 gene locus_tag LOCUS_14770 32044 34428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 34460 35269 gene locus_tag LOCUS_14780 34460 35269 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_14780 35266 36900 gene locus_tag LOCUS_14790 35266 36900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 37147 36902 gene locus_tag LOCUS_14800 37147 36902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 38379 37198 gene locus_tag LOCUS_14810 gene tyrS 38379 37198 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881135.1 protein_id gnl|my_center|LOCUS_14810 38809 41955 gene locus_tag LOCUS_14820 38809 41955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 43611 42025 gene locus_tag LOCUS_14830 43611 42025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 44483 43770 gene locus_tag LOCUS_14840 44483 43770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 45502 44789 gene locus_tag LOCUS_14850 45502 44789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 47994 45667 gene locus_tag LOCUS_14860 47994 45667 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123669.1 protein_id gnl|my_center|LOCUS_14860 48463 47981 gene locus_tag LOCUS_14870 48463 47981 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_14870 48549 49415 gene locus_tag LOCUS_14880 48549 49415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_14880 49420 51783 gene locus_tag LOCUS_14890 49420 51783 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090710.1 protein_id gnl|my_center|LOCUS_14890 51799 53016 gene locus_tag LOCUS_14900 51799 53016 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090709.1 protein_id gnl|my_center|LOCUS_14900 53066 53350 gene locus_tag LOCUS_14910 53066 53350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 53347 53910 gene locus_tag LOCUS_14920 53347 53910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 57352 53936 gene locus_tag LOCUS_14930 57352 53936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 59789 57408 gene locus_tag LOCUS_14940 59789 57408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 59971 60204 gene locus_tag LOCUS_14950 59971 60204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 60286 61152 gene locus_tag LOCUS_14960 60286 61152 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_14960 61136 61939 gene locus_tag LOCUS_14970 61136 61939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 61939 62409 gene locus_tag LOCUS_14980 61939 62409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 62420 63016 gene locus_tag LOCUS_14990 62420 63016 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_14990 63064 63372 gene locus_tag LOCUS_15000 63064 63372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 63465 63540 gene locus_tag LOCUS_t00160 63465 63540 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 63606 64292 gene locus_tag LOCUS_15010 gene rnc 63606 64292 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_15010 64293 64685 gene locus_tag LOCUS_15020 64293 64685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 65542 64709 gene locus_tag LOCUS_15030 65542 64709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 66637 65807 gene locus_tag LOCUS_15040 66637 65807 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240198.1 protein_id gnl|my_center|LOCUS_15040 66868 67458 gene locus_tag LOCUS_15050 66868 67458 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510041.1 protein_id gnl|my_center|LOCUS_15050 68043 69074 gene locus_tag LOCUS_15060 68043 69074 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931757.1 protein_id gnl|my_center|LOCUS_15060 69094 70026 gene locus_tag LOCUS_15070 69094 70026 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_15070 70023 70592 gene locus_tag LOCUS_15080 70023 70592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 70589 71599 gene locus_tag LOCUS_15090 70589 71599 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence156 >Feature sequence157 >Feature sequence158 >Feature sequence159 >Feature sequence160 >Feature sequence161 >Feature sequence162 >Feature sequence163 >Feature sequence164 >Feature sequence165 >Feature sequence166 595 212 gene locus_tag LOCUS_15100 595 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1721 1263 gene locus_tag LOCUS_15110 1721 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 2579 2223 gene locus_tag LOCUS_tm00010 2579 2223 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3249 2620 gene locus_tag LOCUS_15120 gene can 3249 2620 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072441.1 protein_id gnl|my_center|LOCUS_15120 3994 3317 gene locus_tag LOCUS_15130 3994 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 4853 4029 gene locus_tag LOCUS_15140 4853 4029 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902785.1 protein_id gnl|my_center|LOCUS_15140 4963 5613 gene locus_tag LOCUS_15150 4963 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 6479 5610 gene locus_tag LOCUS_15160 6479 5610 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_15160 6579 7844 gene locus_tag LOCUS_15170 6579 7844 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258147.1 protein_id gnl|my_center|LOCUS_15170 7887 9308 gene locus_tag LOCUS_15180 7887 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921337.1 protein_id gnl|my_center|LOCUS_15180 11753 9543 gene locus_tag LOCUS_15190 11753 9543 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258146.1 protein_id gnl|my_center|LOCUS_15190 15427 11930 gene locus_tag LOCUS_15200 15427 11930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 16085 15567 gene locus_tag LOCUS_15210 16085 15567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 16955 16092 gene locus_tag LOCUS_15220 16955 16092 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_15220 18901 17018 gene locus_tag LOCUS_15230 18901 17018 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_15230 19039 20646 gene locus_tag LOCUS_15240 19039 20646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 20606 21442 gene locus_tag LOCUS_15250 20606 21442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 22026 21448 gene locus_tag LOCUS_15260 gene aat 22026 21448 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259206.1 protein_id gnl|my_center|LOCUS_15260 22131 23108 gene locus_tag LOCUS_15270 gene trpS 22131 23108 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_15270 23151 23687 gene locus_tag LOCUS_15280 23151 23687 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_15280 23758 24531 gene locus_tag LOCUS_15290 23758 24531 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_15290 24869 24693 gene locus_tag LOCUS_15300 24869 24693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 25654 27210 gene locus_tag LOCUS_15310 25654 27210 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245514.1 protein_id gnl|my_center|LOCUS_15310 27425 28726 gene locus_tag LOCUS_15320 27425 28726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 28884 30068 gene locus_tag LOCUS_15330 28884 30068 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931799.1 protein_id gnl|my_center|LOCUS_15330 30095 31648 gene locus_tag LOCUS_15340 30095 31648 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090321.1 protein_id gnl|my_center|LOCUS_15340 31727 32545 gene locus_tag LOCUS_15350 gene lpxI 31727 32545 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_15350 33163 32558 gene locus_tag LOCUS_15360 33163 32558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 33806 33249 gene locus_tag LOCUS_15370 33806 33249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 36308 33846 gene locus_tag LOCUS_15380 gene hrpB 36308 33846 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294574.1 protein_id gnl|my_center|LOCUS_15380 36926 36510 gene locus_tag LOCUS_15390 36926 36510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 37706 38860 gene locus_tag LOCUS_15400 37706 38860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 39577 38894 gene locus_tag LOCUS_15410 39577 38894 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932717.1 protein_id gnl|my_center|LOCUS_15410 41535 39577 gene locus_tag LOCUS_15420 41535 39577 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932716.1 protein_id gnl|my_center|LOCUS_15420 42518 41634 gene locus_tag LOCUS_15430 42518 41634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 43020 42544 gene locus_tag LOCUS_15440 43020 42544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 43508 43017 gene locus_tag LOCUS_15450 43508 43017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 43609 44166 gene locus_tag LOCUS_15460 43609 44166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 44906 44178 gene locus_tag LOCUS_15470 44906 44178 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943290.1 protein_id gnl|my_center|LOCUS_15470 45660 44896 gene locus_tag LOCUS_15480 45660 44896 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943289.1 protein_id gnl|my_center|LOCUS_15480 46096 45725 gene locus_tag LOCUS_15490 46096 45725 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 protein_id gnl|my_center|LOCUS_15490 46933 46154 gene locus_tag LOCUS_15500 46933 46154 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460480.1 protein_id gnl|my_center|LOCUS_15500 49692 47005 gene locus_tag LOCUS_15510 49692 47005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 51517 49712 gene locus_tag LOCUS_15520 51517 49712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 52431 51538 gene locus_tag LOCUS_15530 52431 51538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 53837 52431 gene locus_tag LOCUS_15540 53837 52431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 54835 53834 gene locus_tag LOCUS_15550 54835 53834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 56602 54848 gene locus_tag LOCUS_15560 56602 54848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 57649 56642 gene locus_tag LOCUS_15570 57649 56642 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_15570 58739 57861 gene locus_tag LOCUS_15580 58739 57861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 59417 59034 gene locus_tag LOCUS_15590 59417 59034 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 protein_id gnl|my_center|LOCUS_15590 59545 61992 gene locus_tag LOCUS_15600 59545 61992 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_15600 62060 62140 gene locus_tag LOCUS_t00170 62060 62140 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 62539 62940 gene locus_tag LOCUS_15610 62539 62940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 63779 62994 gene locus_tag LOCUS_15620 63779 62994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 64111 64365 gene locus_tag LOCUS_15630 64111 64365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence167 >Feature sequence168 >Feature sequence169 >Feature sequence170 >Feature sequence171 >Feature sequence172 1336 536 gene locus_tag LOCUS_15640 1336 536 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_15640 1627 1361 gene locus_tag LOCUS_15650 1627 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1733 2767 gene locus_tag LOCUS_15660 1733 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 3284 2775 gene locus_tag LOCUS_15670 3284 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 3486 5933 gene locus_tag LOCUS_15680 3486 5933 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_15680 6060 6135 gene locus_tag LOCUS_t00180 6060 6135 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6196 7713 gene locus_tag LOCUS_15690 6196 7713 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922064.1 protein_id gnl|my_center|LOCUS_15690 7748 9967 gene locus_tag LOCUS_15700 7748 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 9933 10334 gene locus_tag LOCUS_15710 9933 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 10676 10326 gene locus_tag LOCUS_15720 10676 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 11335 10673 gene locus_tag LOCUS_15730 11335 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 11724 11383 gene locus_tag LOCUS_15740 11724 11383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 12368 11721 gene locus_tag LOCUS_15750 12368 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 13583 12408 gene locus_tag LOCUS_15760 13583 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 14975 13590 gene locus_tag LOCUS_15770 14975 13590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 16926 15256 gene locus_tag LOCUS_15780 16926 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 17861 17391 gene locus_tag LOCUS_15790 17861 17391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 18733 17864 gene locus_tag LOCUS_15800 18733 17864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 20277 18730 gene locus_tag LOCUS_15810 20277 18730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 20688 20287 gene locus_tag LOCUS_15820 20688 20287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 21108 20698 gene locus_tag LOCUS_15830 21108 20698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 22633 21161 gene locus_tag LOCUS_15840 22633 21161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 23807 22728 gene locus_tag LOCUS_15850 23807 22728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 23872 24465 gene locus_tag LOCUS_15860 23872 24465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 24467 25405 gene locus_tag LOCUS_15870 24467 25405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 25713 25402 gene locus_tag LOCUS_15880 25713 25402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 27914 25710 gene locus_tag LOCUS_15890 27914 25710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 40856 27921 gene locus_tag LOCUS_15900 40856 27921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 41921 40959 gene locus_tag LOCUS_15910 41921 40959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 43741 41963 gene locus_tag LOCUS_15920 43741 41963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 43981 43907 gene locus_tag LOCUS_t00190 43981 43907 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 44057 43985 gene locus_tag LOCUS_t00200 44057 43985 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 44141 44067 gene locus_tag LOCUS_t00210 44141 44067 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 44551 44312 gene locus_tag LOCUS_15930 44551 44312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 46264 45938 gene locus_tag LOCUS_15940 46264 45938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 46351 46276 gene locus_tag LOCUS_t00220 46351 46276 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 47088 46453 gene locus_tag LOCUS_15950 47088 46453 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_15950 47662 47216 gene locus_tag LOCUS_15960 47662 47216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 48447 48827 gene locus_tag LOCUS_15970 48447 48827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 48871 49467 gene locus_tag LOCUS_15980 48871 49467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 49464 49982 gene locus_tag LOCUS_15990 49464 49982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 49979 50626 gene locus_tag LOCUS_16000 49979 50626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 50623 51087 gene locus_tag LOCUS_16010 50623 51087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 51084 51284 gene locus_tag LOCUS_16020 51084 51284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 51346 51948 gene locus_tag LOCUS_16030 51346 51948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 53173 53532 gene locus_tag LOCUS_16040 53173 53532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 53529 53804 gene locus_tag LOCUS_16050 53529 53804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 54464 55516 gene locus_tag LOCUS_16060 54464 55516 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268012.1 protein_id gnl|my_center|LOCUS_16060 55527 55817 gene locus_tag LOCUS_16070 55527 55817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 55814 56044 gene locus_tag LOCUS_16080 55814 56044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 56406 56702 gene locus_tag LOCUS_16090 56406 56702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 57186 56704 gene locus_tag LOCUS_16100 57186 56704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 57300 57488 gene locus_tag LOCUS_16110 57300 57488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 57485 57859 gene locus_tag LOCUS_16120 57485 57859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 57966 58193 gene locus_tag LOCUS_16130 57966 58193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 58190 59167 gene locus_tag LOCUS_16140 58190 59167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 59179 59544 gene locus_tag LOCUS_16150 59179 59544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 59549 60376 gene locus_tag LOCUS_16160 59549 60376 CDS product DUF2303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972629.1 protein_id gnl|my_center|LOCUS_16160 60373 60873 gene locus_tag LOCUS_16170 60373 60873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 61341 62624 gene locus_tag LOCUS_16180 61341 62624 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922059.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence173 2330 1380 gene locus_tag LOCUS_16190 2330 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 3655 2450 gene locus_tag LOCUS_16200 3655 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 8837 3735 gene locus_tag LOCUS_16210 8837 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 8983 9441 gene locus_tag LOCUS_16220 8983 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 9775 10143 gene locus_tag LOCUS_16230 9775 10143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 10180 11634 gene locus_tag LOCUS_16240 10180 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 12215 11820 gene locus_tag LOCUS_16250 gene rpsI 12215 11820 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638099.1 protein_id gnl|my_center|LOCUS_16250 12664 12233 gene locus_tag LOCUS_16260 gene rplM 12664 12233 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393902.1 protein_id gnl|my_center|LOCUS_16260 13050 14420 gene locus_tag LOCUS_16270 13050 14420 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_16270 15081 14422 gene locus_tag LOCUS_16280 15081 14422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 15401 16678 gene locus_tag LOCUS_16290 gene nusA 15401 16678 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309913.1 protein_id gnl|my_center|LOCUS_16290 16748 18886 gene locus_tag LOCUS_16300 16748 18886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 18953 19318 gene locus_tag LOCUS_16310 18953 19318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 20542 19445 gene locus_tag LOCUS_16320 gene dnaN 20542 19445 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_16320 22076 20649 gene locus_tag LOCUS_16330 gene dnaA 22076 20649 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815138.1 protein_id gnl|my_center|LOCUS_16330 24111 22525 gene locus_tag LOCUS_16340 24111 22525 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060927.1 protein_id gnl|my_center|LOCUS_16340 24232 26226 gene locus_tag LOCUS_16350 24232 26226 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_16350 26236 27198 gene locus_tag LOCUS_16360 gene hprK 26236 27198 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127250.1 protein_id gnl|my_center|LOCUS_16360 27298 29016 gene locus_tag LOCUS_16370 27298 29016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 29053 29895 gene locus_tag LOCUS_16380 29053 29895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 32901 29911 gene locus_tag LOCUS_16390 32901 29911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 33852 33220 gene locus_tag LOCUS_16400 33852 33220 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185693707.1 protein_id gnl|my_center|LOCUS_16400 34649 33969 gene locus_tag LOCUS_16410 34649 33969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 35461 34679 gene locus_tag LOCUS_16420 gene pstB 35461 34679 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538553.1 protein_id gnl|my_center|LOCUS_16420 36249 35461 gene locus_tag LOCUS_16430 gene pstB 36249 35461 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706615.1 protein_id gnl|my_center|LOCUS_16430 37888 36251 gene locus_tag LOCUS_16440 gene pstA 37888 36251 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_16440 40156 37892 gene locus_tag LOCUS_16450 40156 37892 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706617.1 protein_id gnl|my_center|LOCUS_16450 41198 40239 gene locus_tag LOCUS_16460 41198 40239 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071729.1 protein_id gnl|my_center|LOCUS_16460 41370 42620 gene locus_tag LOCUS_16470 41370 42620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 42759 45071 gene locus_tag LOCUS_16480 42759 45071 CDS product catecholate siderophore receptor Fiu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000430039.1 protein_id gnl|my_center|LOCUS_16480 45166 45855 gene locus_tag LOCUS_16490 45166 45855 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812970.1 protein_id gnl|my_center|LOCUS_16490 45865 46530 gene locus_tag LOCUS_16500 45865 46530 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920895.1 protein_id gnl|my_center|LOCUS_16500 46527 47036 gene locus_tag LOCUS_16510 46527 47036 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930254.1 protein_id gnl|my_center|LOCUS_16510 47044 47859 gene locus_tag LOCUS_16520 47044 47859 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 protein_id gnl|my_center|LOCUS_16520 47856 48887 gene locus_tag LOCUS_16530 47856 48887 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265901.1 protein_id gnl|my_center|LOCUS_16530 49967 48879 gene locus_tag LOCUS_16540 49967 48879 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_16540 50964 49984 gene locus_tag LOCUS_16550 50964 49984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 52295 50961 gene locus_tag LOCUS_16560 52295 50961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 54289 52364 gene locus_tag LOCUS_16570 54289 52364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 55255 54350 gene locus_tag LOCUS_16580 55255 54350 CDS product lactate/malate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324694.1 protein_id gnl|my_center|LOCUS_16580 55670 55287 gene locus_tag LOCUS_16590 55670 55287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 56713 55667 gene locus_tag LOCUS_16600 56713 55667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 57128 56760 gene locus_tag LOCUS_16610 57128 56760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 57478 57149 gene locus_tag LOCUS_16620 57478 57149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 57517 58629 gene locus_tag LOCUS_16630 57517 58629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 58636 59463 gene locus_tag LOCUS_16640 58636 59463 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832113.1 protein_id gnl|my_center|LOCUS_16640 59542 60903 gene locus_tag LOCUS_16650 59542 60903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence174 510 2960 gene locus_tag LOCUS_16660 510 2960 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146849784.1 protein_id gnl|my_center|LOCUS_16660 3272 3051 gene locus_tag LOCUS_16670 3272 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 3599 3871 gene locus_tag LOCUS_16680 3599 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 5693 4011 gene locus_tag LOCUS_16690 gene thrS 5693 4011 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888712.1 protein_id gnl|my_center|LOCUS_16690 6861 6034 gene locus_tag LOCUS_16700 6861 6034 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_16700 7110 6874 gene locus_tag LOCUS_16710 7110 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 7499 7107 gene locus_tag LOCUS_16720 7499 7107 CDS product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927253.1 protein_id gnl|my_center|LOCUS_16720 9570 9860 gene locus_tag LOCUS_16730 9570 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 11475 10078 gene locus_tag LOCUS_16740 gene cysS 11475 10078 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_16740 11753 11523 gene locus_tag LOCUS_16750 11753 11523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 12926 11889 gene locus_tag LOCUS_16760 12926 11889 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081179.1 protein_id gnl|my_center|LOCUS_16760 13920 12919 gene locus_tag LOCUS_16770 13920 12919 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830339.1 protein_id gnl|my_center|LOCUS_16770 14391 13924 gene locus_tag LOCUS_16780 gene hisI 14391 13924 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971841.1 protein_id gnl|my_center|LOCUS_16780 14731 14513 gene locus_tag LOCUS_16790 14731 14513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 16011 14752 gene locus_tag LOCUS_16800 16011 14752 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124033.1 protein_id gnl|my_center|LOCUS_16800 17651 16008 gene locus_tag LOCUS_16810 17651 16008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 17943 18395 gene locus_tag LOCUS_16820 17943 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 19135 20340 gene locus_tag LOCUS_16830 19135 20340 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 protein_id gnl|my_center|LOCUS_16830 20408 20854 gene locus_tag LOCUS_16840 20408 20854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 22531 21965 gene locus_tag LOCUS_16850 22531 21965 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227196.1 protein_id gnl|my_center|LOCUS_16850 23397 22546 gene locus_tag LOCUS_16860 23397 22546 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900117.1 protein_id gnl|my_center|LOCUS_16860 23770 23949 gene locus_tag LOCUS_16870 23770 23949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 24189 24398 gene locus_tag LOCUS_16880 24189 24398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 24733 25062 gene locus_tag LOCUS_16890 24733 25062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 25131 25481 gene locus_tag LOCUS_16900 25131 25481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 25618 26535 gene locus_tag LOCUS_16910 25618 26535 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263960.1 protein_id gnl|my_center|LOCUS_16910 26522 26812 gene locus_tag LOCUS_16920 26522 26812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 27963 26698 gene locus_tag LOCUS_16930 27963 26698 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209929.1 protein_id gnl|my_center|LOCUS_16930 28538 28846 gene locus_tag LOCUS_16940 28538 28846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 28846 29403 gene locus_tag LOCUS_16950 28846 29403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 30026 30214 gene locus_tag LOCUS_16960 30026 30214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 31023 36665 gene locus_tag LOCUS_16970 31023 36665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 36698 37630 gene locus_tag LOCUS_16980 36698 37630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 37705 43302 gene locus_tag LOCUS_16990 37705 43302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 43332 43889 gene locus_tag LOCUS_17000 43332 43889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 45557 44232 gene locus_tag LOCUS_17010 45557 44232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 46211 49012 gene locus_tag LOCUS_17020 46211 49012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 49014 50672 gene locus_tag LOCUS_17030 49014 50672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 50672 52312 gene locus_tag LOCUS_17040 50672 52312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 52309 54360 gene locus_tag LOCUS_17050 52309 54360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 54365 55453 gene locus_tag LOCUS_17060 54365 55453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123253.1 protein_id gnl|my_center|LOCUS_17060 55970 56326 gene locus_tag LOCUS_17070 55970 56326 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967147.1 protein_id gnl|my_center|LOCUS_17070 59431 56351 gene locus_tag LOCUS_17080 59431 56351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 59648 59920 gene locus_tag LOCUS_17090 59648 59920 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389965.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence175 159 85 gene locus_tag LOCUS_t00230 159 85 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1868 306 gene locus_tag LOCUS_17100 1868 306 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613941.1 protein_id gnl|my_center|LOCUS_17100 2251 1892 gene locus_tag LOCUS_17110 2251 1892 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932426.1 protein_id gnl|my_center|LOCUS_17110 2734 2264 gene locus_tag LOCUS_17120 2734 2264 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_17120 3201 2731 gene locus_tag LOCUS_17130 3201 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 3671 3234 gene locus_tag LOCUS_17140 3671 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3842 4909 gene locus_tag LOCUS_17150 3842 4909 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_17150 5009 6997 gene locus_tag LOCUS_17160 5009 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 7076 7687 gene locus_tag LOCUS_17170 7076 7687 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228812.1 protein_id gnl|my_center|LOCUS_17170 7794 10427 gene locus_tag LOCUS_17180 7794 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 10424 11065 gene locus_tag LOCUS_17190 10424 11065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 11062 12051 gene locus_tag LOCUS_17200 11062 12051 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122104.1 protein_id gnl|my_center|LOCUS_17200 12048 13574 gene locus_tag LOCUS_17210 12048 13574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 13552 14907 gene locus_tag LOCUS_17220 13552 14907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 14904 16292 gene locus_tag LOCUS_17230 14904 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 18231 16276 gene locus_tag LOCUS_17240 18231 16276 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117877.1 protein_id gnl|my_center|LOCUS_17240 19146 18472 gene locus_tag LOCUS_17250 19146 18472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 20662 20120 gene locus_tag LOCUS_17260 20662 20120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 22474 20726 gene locus_tag LOCUS_17270 22474 20726 CDS product NirA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117878.1 protein_id gnl|my_center|LOCUS_17270 24344 22614 gene locus_tag LOCUS_17280 24344 22614 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_17280 25836 24355 gene locus_tag LOCUS_17290 25836 24355 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_17290 26857 26045 gene locus_tag LOCUS_17300 26857 26045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 27180 28109 gene locus_tag LOCUS_17310 27180 28109 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 protein_id gnl|my_center|LOCUS_17310 29308 28106 gene locus_tag LOCUS_17320 29308 28106 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_17320 29497 30396 gene locus_tag LOCUS_17330 29497 30396 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463396.1 protein_id gnl|my_center|LOCUS_17330 30750 31076 gene locus_tag LOCUS_17340 30750 31076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 31073 33259 gene locus_tag LOCUS_17350 31073 33259 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123669.1 protein_id gnl|my_center|LOCUS_17350 33451 34284 gene locus_tag LOCUS_17360 33451 34284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 34416 37007 gene locus_tag LOCUS_17370 34416 37007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 38480 37095 gene locus_tag LOCUS_17380 38480 37095 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118042.1 protein_id gnl|my_center|LOCUS_17380 39612 38641 gene locus_tag LOCUS_17390 39612 38641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 39766 41196 gene locus_tag LOCUS_17400 39766 41196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 42240 41230 gene locus_tag LOCUS_17410 42240 41230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 42551 43855 gene locus_tag LOCUS_17420 42551 43855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 44554 43907 gene locus_tag LOCUS_17430 44554 43907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 44824 44600 gene locus_tag LOCUS_17440 44824 44600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 44860 45675 gene locus_tag LOCUS_17450 44860 45675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081034.1 protein_id gnl|my_center|LOCUS_17450 45790 46488 gene locus_tag LOCUS_17460 45790 46488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 46659 47363 gene locus_tag LOCUS_17470 46659 47363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 48525 47410 gene locus_tag LOCUS_17480 gene ychF 48525 47410 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 protein_id gnl|my_center|LOCUS_17480 49776 48598 gene locus_tag LOCUS_17490 gene galK 49776 48598 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_17490 51978 49846 gene locus_tag LOCUS_17500 51978 49846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 52572 51979 gene locus_tag LOCUS_17510 52572 51979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 54191 52548 gene locus_tag LOCUS_17520 54191 52548 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921572.1 protein_id gnl|my_center|LOCUS_17520 54952 54185 gene locus_tag LOCUS_17530 54952 54185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 55099 56577 gene locus_tag LOCUS_17540 gene trpE 55099 56577 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_17540 56589 57152 gene locus_tag LOCUS_17550 56589 57152 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035720.1 protein_id gnl|my_center|LOCUS_17550 57204 57410 gene locus_tag LOCUS_17560 57204 57410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence176 225 722 gene locus_tag LOCUS_17570 225 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 710 964 gene locus_tag LOCUS_17580 710 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 939 1433 gene locus_tag LOCUS_17590 939 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1683 2882 gene locus_tag LOCUS_17600 1683 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2919 3353 gene locus_tag LOCUS_17610 2919 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 3453 4007 gene locus_tag LOCUS_17620 3453 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 4221 4400 gene locus_tag LOCUS_17630 4221 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 4815 5072 gene locus_tag LOCUS_17640 4815 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 5552 6565 gene locus_tag LOCUS_17650 5552 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 6851 7858 gene locus_tag LOCUS_17660 6851 7858 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922099.1 protein_id gnl|my_center|LOCUS_17660 8752 7868 gene locus_tag LOCUS_17670 8752 7868 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921962.1 protein_id gnl|my_center|LOCUS_17670 9470 8898 gene locus_tag LOCUS_17680 9470 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 9759 12155 gene locus_tag LOCUS_17690 9759 12155 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265628.1 protein_id gnl|my_center|LOCUS_17690 13325 12177 gene locus_tag LOCUS_17700 13325 12177 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688516.1 protein_id gnl|my_center|LOCUS_17700 13826 13329 gene locus_tag LOCUS_17710 gene purE 13826 13329 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_17710 13993 14664 gene locus_tag LOCUS_17720 13993 14664 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815117.1 protein_id gnl|my_center|LOCUS_17720 14661 16043 gene locus_tag LOCUS_17730 14661 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 17970 16288 gene locus_tag LOCUS_17740 gene leuA 17970 16288 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_17740 19252 18209 gene locus_tag LOCUS_17750 gene lpxD 19252 18209 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882950.1 protein_id gnl|my_center|LOCUS_17750 19942 19289 gene locus_tag LOCUS_17760 19942 19289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 20739 22163 gene locus_tag LOCUS_17770 gene leuC 20739 22163 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173294.1 protein_id gnl|my_center|LOCUS_17770 22281 22880 gene locus_tag LOCUS_17780 gene leuD 22281 22880 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228533.1 protein_id gnl|my_center|LOCUS_17780 22890 23762 gene locus_tag LOCUS_17790 22890 23762 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707670.1 protein_id gnl|my_center|LOCUS_17790 24184 23720 gene locus_tag LOCUS_17800 24184 23720 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567255.1 protein_id gnl|my_center|LOCUS_17800 24301 24837 gene locus_tag LOCUS_17810 24301 24837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 24928 25821 gene locus_tag LOCUS_17820 24928 25821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 25863 30119 gene locus_tag LOCUS_17830 25863 30119 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921311.1 protein_id gnl|my_center|LOCUS_17830 30216 30833 gene locus_tag LOCUS_17840 30216 30833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303162.1 protein_id gnl|my_center|LOCUS_17840 30833 31132 gene locus_tag LOCUS_17850 30833 31132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 31277 32077 gene locus_tag LOCUS_17860 31277 32077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 32514 32083 gene locus_tag LOCUS_17870 32514 32083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 32613 35039 gene locus_tag LOCUS_17880 32613 35039 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_17880 35036 35683 gene locus_tag LOCUS_17890 gene pdeM 35036 35683 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922347.1 protein_id gnl|my_center|LOCUS_17890 35974 35702 gene locus_tag LOCUS_17900 35974 35702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 36307 37689 gene locus_tag LOCUS_17910 gene lpdA 36307 37689 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_17910 37812 39938 gene locus_tag LOCUS_17920 37812 39938 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_17920 40413 39961 gene locus_tag LOCUS_17930 40413 39961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 40579 40944 gene locus_tag LOCUS_17940 40579 40944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 40993 41427 gene locus_tag LOCUS_17950 40993 41427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 41503 42045 gene locus_tag LOCUS_17960 41503 42045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 42038 42316 gene locus_tag LOCUS_17970 42038 42316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 42370 42783 gene locus_tag LOCUS_17980 42370 42783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 42837 43220 gene locus_tag LOCUS_17990 gene gloA 42837 43220 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017084654.1 protein_id gnl|my_center|LOCUS_17990 43340 43720 gene locus_tag LOCUS_18000 43340 43720 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336246.1 protein_id gnl|my_center|LOCUS_18000 43722 46058 gene locus_tag LOCUS_18010 43722 46058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 46207 47301 gene locus_tag LOCUS_18020 46207 47301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 48179 47412 gene locus_tag LOCUS_18030 48179 47412 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_18030 49232 48198 gene locus_tag LOCUS_18040 gene queA 49232 48198 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460358.1 protein_id gnl|my_center|LOCUS_18040 51613 49514 gene locus_tag LOCUS_18050 51613 49514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 52417 51740 gene locus_tag LOCUS_18060 52417 51740 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525154.1 protein_id gnl|my_center|LOCUS_18060 52502 52855 gene locus_tag LOCUS_18070 52502 52855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence177 1168 158 gene locus_tag LOCUS_18080 1168 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2125 1337 gene locus_tag LOCUS_18090 2125 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2854 2624 gene locus_tag LOCUS_18100 2854 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 2853 3632 gene locus_tag LOCUS_18110 2853 3632 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_18110 3732 4979 gene locus_tag LOCUS_18120 3732 4979 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_18120 5668 4976 gene locus_tag LOCUS_18130 5668 4976 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921845.1 protein_id gnl|my_center|LOCUS_18130 5671 6744 gene locus_tag LOCUS_18140 5671 6744 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206386.1 protein_id gnl|my_center|LOCUS_18140 6780 7685 gene locus_tag LOCUS_18150 6780 7685 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_18150 7722 9287 gene locus_tag LOCUS_18160 7722 9287 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178932430.1 protein_id gnl|my_center|LOCUS_18160 9296 11782 gene locus_tag LOCUS_18170 9296 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 12386 13552 gene locus_tag LOCUS_18180 12386 13552 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_18180 15369 13630 gene locus_tag LOCUS_18190 15369 13630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 15544 16221 gene locus_tag LOCUS_18200 15544 16221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 16808 16224 gene locus_tag LOCUS_18210 16808 16224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 19083 16840 gene locus_tag LOCUS_18220 19083 16840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 20258 19200 gene locus_tag LOCUS_18230 20258 19200 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393512.1 protein_id gnl|my_center|LOCUS_18230 21996 20476 gene locus_tag LOCUS_18240 21996 20476 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920646.1 protein_id gnl|my_center|LOCUS_18240 22187 23068 gene locus_tag LOCUS_18250 22187 23068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 23994 23170 gene locus_tag LOCUS_18260 23994 23170 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294582.1 protein_id gnl|my_center|LOCUS_18260 24107 24784 gene locus_tag LOCUS_18270 24107 24784 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798139.1 protein_id gnl|my_center|LOCUS_18270 25243 25917 gene locus_tag LOCUS_18280 25243 25917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 25914 26684 gene locus_tag LOCUS_18290 25914 26684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 26677 26970 gene locus_tag LOCUS_18300 26677 26970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 27049 27441 gene locus_tag LOCUS_18310 27049 27441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 27453 27917 gene locus_tag LOCUS_18320 27453 27917 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252527.1 protein_id gnl|my_center|LOCUS_18320 28010 28612 gene locus_tag LOCUS_18330 28010 28612 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191635.1 protein_id gnl|my_center|LOCUS_18330 28654 29400 gene locus_tag LOCUS_18340 gene plsY 28654 29400 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_18340 29393 30403 gene locus_tag LOCUS_18350 29393 30403 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986847.1 protein_id gnl|my_center|LOCUS_18350 30413 31024 gene locus_tag LOCUS_18360 30413 31024 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533195.1 protein_id gnl|my_center|LOCUS_18360 31033 31656 gene locus_tag LOCUS_18370 31033 31656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 35461 31736 gene locus_tag LOCUS_18380 35461 31736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 38713 35552 gene locus_tag LOCUS_18390 38713 35552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 39431 38739 gene locus_tag LOCUS_18400 39431 38739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 39875 40462 gene locus_tag LOCUS_18410 39875 40462 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_18410 40614 42167 gene locus_tag LOCUS_18420 40614 42167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 43384 42503 gene locus_tag LOCUS_18430 43384 42503 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105232.1 protein_id gnl|my_center|LOCUS_18430 44185 43457 gene locus_tag LOCUS_18440 44185 43457 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_18440 44292 45365 gene locus_tag LOCUS_18450 gene aroG 44292 45365 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813056.1 protein_id gnl|my_center|LOCUS_18450 45380 46480 gene locus_tag LOCUS_18460 gene aroG 45380 46480 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_18460 46716 48155 gene locus_tag LOCUS_18470 46716 48155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 48148 50856 gene locus_tag LOCUS_18480 48148 50856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 50899 51957 gene locus_tag LOCUS_18490 50899 51957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 52122 52526 gene locus_tag LOCUS_18500 52122 52526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 53386 52562 gene locus_tag LOCUS_18510 53386 52562 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921011.1 protein_id gnl|my_center|LOCUS_18510 54218 53400 gene locus_tag LOCUS_18520 54218 53400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 55396 54218 gene locus_tag LOCUS_18530 55396 54218 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938556.1 protein_id gnl|my_center|LOCUS_18530 56431 55499 gene locus_tag LOCUS_18540 gene trxB 56431 55499 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_18540 57488 56529 gene locus_tag LOCUS_18550 57488 56529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 58669 57539 gene locus_tag LOCUS_18560 58669 57539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 61449 58720 gene locus_tag LOCUS_18570 61449 58720 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839534.1 protein_id gnl|my_center|LOCUS_18570 62520 61462 gene locus_tag LOCUS_18580 62520 61462 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_18580 63161 62787 gene locus_tag LOCUS_18590 63161 62787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 64362 63238 gene locus_tag LOCUS_18600 64362 63238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 65467 64313 gene locus_tag LOCUS_18610 65467 64313 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028856.1 protein_id gnl|my_center|LOCUS_18610 65640 66476 gene locus_tag LOCUS_18620 gene prmC 65640 66476 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886891.1 protein_id gnl|my_center|LOCUS_18620 66503 67771 gene locus_tag LOCUS_18630 gene murA 66503 67771 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393852.1 protein_id gnl|my_center|LOCUS_18630 70011 68086 gene locus_tag LOCUS_18640 70011 68086 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_18640 71026 70031 gene locus_tag LOCUS_18650 gene purM 71026 70031 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057648.1 protein_id gnl|my_center|LOCUS_18650 71439 73259 gene locus_tag LOCUS_18660 71439 73259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 73576 74118 gene locus_tag LOCUS_18670 73576 74118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 74427 75131 gene locus_tag LOCUS_18680 74427 75131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 75137 76162 gene locus_tag LOCUS_18690 75137 76162 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804101.1 protein_id gnl|my_center|LOCUS_18690 77321 76164 gene locus_tag LOCUS_18700 77321 76164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 77543 79720 gene locus_tag LOCUS_18710 77543 79720 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303083.1 protein_id gnl|my_center|LOCUS_18710 79717 81618 gene locus_tag LOCUS_18720 79717 81618 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_18720 82388 81633 gene locus_tag LOCUS_18730 82388 81633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 85995 82405 gene locus_tag LOCUS_18740 85995 82405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 89755 86090 gene locus_tag LOCUS_18750 89755 86090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 91056 90322 gene locus_tag LOCUS_18760 91056 90322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 91735 91100 gene locus_tag LOCUS_18770 91735 91100 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025687389.1 protein_id gnl|my_center|LOCUS_18770 92770 91766 gene locus_tag LOCUS_18780 gene tsaD 92770 91766 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_18780 93652 92801 gene locus_tag LOCUS_18790 93652 92801 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479587.1 protein_id gnl|my_center|LOCUS_18790 94488 93649 gene locus_tag LOCUS_18800 94488 93649 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266186.1 protein_id gnl|my_center|LOCUS_18800 95332 94493 gene locus_tag LOCUS_18810 95332 94493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 95693 96445 gene locus_tag LOCUS_18820 95693 96445 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869672.1 protein_id gnl|my_center|LOCUS_18820 96457 98307 gene locus_tag LOCUS_18830 96457 98307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 98317 98628 gene locus_tag LOCUS_18840 98317 98628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 99411 98794 gene locus_tag LOCUS_18850 99411 98794 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206301.1 protein_id gnl|my_center|LOCUS_18850 99513 101150 gene locus_tag LOCUS_18860 99513 101150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 102895 101129 gene locus_tag LOCUS_18870 gene ptsP 102895 101129 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_18870 103266 103000 gene locus_tag LOCUS_18880 103266 103000 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_18880 109402 103349 gene locus_tag LOCUS_18890 109402 103349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 110207 109827 gene locus_tag LOCUS_18900 110207 109827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072486.1 protein_id gnl|my_center|LOCUS_18900 115465 110348 gene locus_tag LOCUS_18910 115465 110348 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121034.1 protein_id gnl|my_center|LOCUS_18910 117566 115524 gene locus_tag LOCUS_18920 117566 115524 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121033.1 protein_id gnl|my_center|LOCUS_18920 118291 117605 gene locus_tag LOCUS_18930 118291 117605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 119491 118343 gene locus_tag LOCUS_18940 119491 118343 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_18940 119726 120337 gene locus_tag LOCUS_18950 gene lexA 119726 120337 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803693.1 protein_id gnl|my_center|LOCUS_18950 120835 121809 gene locus_tag LOCUS_18960 120835 121809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 122239 121793 gene locus_tag LOCUS_18970 122239 121793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 122907 122236 gene locus_tag LOCUS_18980 122907 122236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 123666 122989 gene locus_tag LOCUS_18990 123666 122989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 124182 123667 gene locus_tag LOCUS_19000 124182 123667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 124814 124179 gene locus_tag LOCUS_19010 124814 124179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 125457 124798 gene locus_tag LOCUS_19020 gene rpoE 125457 124798 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_19020 126039 125554 gene locus_tag LOCUS_19030 126039 125554 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_19030 127132 126059 gene locus_tag LOCUS_19040 127132 126059 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256167.1 protein_id gnl|my_center|LOCUS_19040 128108 127155 gene locus_tag LOCUS_19050 128108 127155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 128481 129014 gene locus_tag LOCUS_19060 128481 129014 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832028.1 protein_id gnl|my_center|LOCUS_19060 129617 129877 gene locus_tag LOCUS_19070 129617 129877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 129885 130475 gene locus_tag LOCUS_19080 129885 130475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 131029 130565 gene locus_tag LOCUS_19090 gene ispF 131029 130565 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583827.1 protein_id gnl|my_center|LOCUS_19090 131802 131053 gene locus_tag LOCUS_19100 131802 131053 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_19100 132385 131807 gene locus_tag LOCUS_19110 132385 131807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 133409 132537 gene locus_tag LOCUS_19120 133409 132537 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423235.1 protein_id gnl|my_center|LOCUS_19120 133480 134661 gene locus_tag LOCUS_19130 133480 134661 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388935.1 protein_id gnl|my_center|LOCUS_19130 134724 135152 gene locus_tag LOCUS_19140 gene rpiB 134724 135152 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_19140 135234 136451 gene locus_tag LOCUS_19150 135234 136451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 136652 137515 gene locus_tag LOCUS_19160 gene hflK 136652 137515 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_19160 137529 138506 gene locus_tag LOCUS_19170 gene hflC 137529 138506 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_19170 139382 138633 gene locus_tag LOCUS_19180 139382 138633 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090604.1 protein_id gnl|my_center|LOCUS_19180 142531 139379 gene locus_tag LOCUS_19190 gene mexF 142531 139379 CDS product multidrug efflux RND transporter permease subunit MexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089834.1 protein_id gnl|my_center|LOCUS_19190 143755 142565 gene locus_tag LOCUS_19200 143755 142565 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203095.1 protein_id gnl|my_center|LOCUS_19200 144411 143809 gene locus_tag LOCUS_19210 144411 143809 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 protein_id gnl|my_center|LOCUS_19210 145997 144489 gene locus_tag LOCUS_19220 145997 144489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 147081 146062 gene locus_tag LOCUS_19230 147081 146062 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_19230 147267 147791 gene locus_tag LOCUS_19240 147267 147791 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 protein_id gnl|my_center|LOCUS_19240 149086 147794 gene locus_tag LOCUS_19250 149086 147794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 149280 150104 gene locus_tag LOCUS_19260 gene tcdA 149280 150104 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703318.1 protein_id gnl|my_center|LOCUS_19260 150459 150235 gene locus_tag LOCUS_19270 150459 150235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 151398 150598 gene locus_tag LOCUS_19280 151398 150598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 154279 151526 gene locus_tag LOCUS_19290 154279 151526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 156872 154272 gene locus_tag LOCUS_19300 156872 154272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 160076 157050 gene locus_tag LOCUS_19310 160076 157050 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804715.1 protein_id gnl|my_center|LOCUS_19310 160497 160279 gene locus_tag LOCUS_19320 160497 160279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 161791 160508 gene locus_tag LOCUS_19330 161791 160508 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_19330 161932 164097 gene locus_tag LOCUS_19340 161932 164097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 165261 164113 gene locus_tag LOCUS_19350 gene nifS 165261 164113 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_19350 167302 165323 gene locus_tag LOCUS_19360 167302 165323 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_19360 168624 167407 gene locus_tag LOCUS_19370 168624 167407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 169651 168743 gene locus_tag LOCUS_19380 169651 168743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 171335 170433 gene locus_tag LOCUS_19390 171335 170433 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260609.1 protein_id gnl|my_center|LOCUS_19390 171720 171343 gene locus_tag LOCUS_19400 171720 171343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 171910 172401 gene locus_tag LOCUS_19410 171910 172401 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_19410 172624 173385 gene locus_tag LOCUS_19420 172624 173385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 174392 173601 gene locus_tag LOCUS_19430 174392 173601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 176184 174505 gene locus_tag LOCUS_19440 176184 174505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 176329 177618 gene locus_tag LOCUS_19450 176329 177618 CDS product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888443.1 protein_id gnl|my_center|LOCUS_19450 177707 179830 gene locus_tag LOCUS_19460 177707 179830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 180457 179831 gene locus_tag LOCUS_19470 180457 179831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 180558 181040 gene locus_tag LOCUS_19480 180558 181040 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832373.1 protein_id gnl|my_center|LOCUS_19480 181607 181062 gene locus_tag LOCUS_19490 gene sufT 181607 181062 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_19490 181717 182556 gene locus_tag LOCUS_19500 gene cdaA 181717 182556 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_19500 183484 182636 gene locus_tag LOCUS_19510 gene panC 183484 182636 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939719.1 protein_id gnl|my_center|LOCUS_19510 183610 184035 gene locus_tag LOCUS_19520 183610 184035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 184186 184725 gene locus_tag LOCUS_19530 184186 184725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 184747 186861 gene locus_tag LOCUS_19540 184747 186861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 187053 187979 gene locus_tag LOCUS_19550 187053 187979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 189850 188003 gene locus_tag LOCUS_19560 189850 188003 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_19560 192129 189916 gene locus_tag LOCUS_19570 192129 189916 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336886.1 protein_id gnl|my_center|LOCUS_19570 194195 192126 gene locus_tag LOCUS_19580 194195 192126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 194947 194336 gene locus_tag LOCUS_19590 gene rpsD 194947 194336 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_19590 195545 194973 gene locus_tag LOCUS_19600 195545 194973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 195967 195566 gene locus_tag LOCUS_19610 gene rpsM 195967 195566 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_19610 196153 197172 gene locus_tag LOCUS_19620 196153 197172 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122095.1 protein_id gnl|my_center|LOCUS_19620 197345 198238 gene locus_tag LOCUS_19630 197345 198238 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_19630 198263 200242 gene locus_tag LOCUS_19640 198263 200242 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122098.1 protein_id gnl|my_center|LOCUS_19640 200250 202460 gene locus_tag LOCUS_19650 200250 202460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_19650 202565 203167 gene locus_tag LOCUS_19660 202565 203167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 203164 204012 gene locus_tag LOCUS_19670 203164 204012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 204025 204456 gene locus_tag LOCUS_19680 gene mntR 204025 204456 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003236923.1 protein_id gnl|my_center|LOCUS_19680 206137 204470 gene locus_tag LOCUS_19690 gene ilvD 206137 204470 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_19690 209216 206301 gene locus_tag LOCUS_19700 gene ppdK 209216 206301 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_19700 211260 209314 gene locus_tag LOCUS_19710 211260 209314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 213978 211372 gene locus_tag LOCUS_19720 213978 211372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 215107 214055 gene locus_tag LOCUS_19730 215107 214055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 216109 215111 gene locus_tag LOCUS_19740 216109 215111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 217975 216134 gene locus_tag LOCUS_19750 217975 216134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 218712 218086 gene locus_tag LOCUS_19760 218712 218086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 218866 219579 gene locus_tag LOCUS_19770 218866 219579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 221590 219590 gene locus_tag LOCUS_19780 221590 219590 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_19780 221779 223068 gene locus_tag LOCUS_19790 221779 223068 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583663.1 protein_id gnl|my_center|LOCUS_19790 223093 223818 gene locus_tag LOCUS_19800 223093 223818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 224297 223815 gene locus_tag LOCUS_19810 224297 223815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19810 224538 224314 gene locus_tag LOCUS_19820 224538 224314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 224477 224863 gene locus_tag LOCUS_19830 224477 224863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 224948 225889 gene locus_tag LOCUS_19840 224948 225889 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_19840 225918 227222 gene locus_tag LOCUS_19850 gene thrC 225918 227222 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_19850 229343 227442 gene locus_tag LOCUS_19860 229343 227442 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706272.1 protein_id gnl|my_center|LOCUS_19860 229429 229866 gene locus_tag LOCUS_19870 229429 229866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 229912 230355 gene locus_tag LOCUS_19880 229912 230355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 231444 230452 gene locus_tag LOCUS_19890 231444 230452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 233215 231860 gene locus_tag LOCUS_19900 gene argH 233215 231860 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_19900 233393 233836 gene locus_tag LOCUS_19910 233393 233836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 233936 234190 gene locus_tag LOCUS_19920 233936 234190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 234203 236092 gene locus_tag LOCUS_19930 gene feoB 234203 236092 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640041.1 protein_id gnl|my_center|LOCUS_19930 236838 236275 gene locus_tag LOCUS_19940 236838 236275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 236981 237718 gene locus_tag LOCUS_19950 236981 237718 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357427.1 protein_id gnl|my_center|LOCUS_19950 237715 239184 gene locus_tag LOCUS_19960 237715 239184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 239507 239250 gene locus_tag LOCUS_19970 239507 239250 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529551.1 protein_id gnl|my_center|LOCUS_19970 240310 239675 gene locus_tag LOCUS_19980 240310 239675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 240386 241543 gene locus_tag LOCUS_19990 240386 241543 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_19990 241566 241829 gene locus_tag LOCUS_20000 241566 241829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 243131 241986 gene locus_tag LOCUS_20010 243131 241986 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109096.1 protein_id gnl|my_center|LOCUS_20010 244348 243128 gene locus_tag LOCUS_20020 gene rlmD 244348 243128 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_20020 245263 244397 gene locus_tag LOCUS_20030 gene folP 245263 244397 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_20030 245349 246431 gene locus_tag LOCUS_20040 gene aroC 245349 246431 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_20040 246431 247201 gene locus_tag LOCUS_20050 246431 247201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 247205 248656 gene locus_tag LOCUS_20060 gene gatB 247205 248656 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_20060 248923 252222 gene locus_tag LOCUS_20070 248923 252222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 252646 252212 gene locus_tag LOCUS_20080 252646 252212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 252879 252643 gene locus_tag LOCUS_20090 252879 252643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 252932 253852 gene locus_tag LOCUS_20100 252932 253852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 253852 254154 gene locus_tag LOCUS_20110 gene cas2 253852 254154 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_20110 254215 255239 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtttgctccgctcggtttctgaatcaaggcaaagc >Feature sequence178 166 1245 gene locus_tag LOCUS_20120 166 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1446 2444 gene locus_tag LOCUS_20130 gene dusB 1446 2444 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_20130 2499 2999 gene locus_tag LOCUS_20140 2499 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 4042 3026 gene locus_tag LOCUS_20150 4042 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 5208 4039 gene locus_tag LOCUS_20160 gene fabF 5208 4039 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257800.1 protein_id gnl|my_center|LOCUS_20160 5362 6609 gene locus_tag LOCUS_20170 5362 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 6584 7162 gene locus_tag LOCUS_20180 6584 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 8718 7183 gene locus_tag LOCUS_20190 8718 7183 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124559.1 protein_id gnl|my_center|LOCUS_20190 10443 8731 gene locus_tag LOCUS_20200 10443 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 11481 10456 gene locus_tag LOCUS_20210 gene wspF 11481 10456 CDS product Wsp signal transduction system protein-glutamate methylesterase WspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092534.1 protein_id gnl|my_center|LOCUS_20210 13727 11478 gene locus_tag LOCUS_20220 13727 11478 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525365.1 protein_id gnl|my_center|LOCUS_20220 14254 13724 gene locus_tag LOCUS_20230 14254 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 15483 14251 gene locus_tag LOCUS_20240 15483 14251 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266948.1 protein_id gnl|my_center|LOCUS_20240 15947 15480 gene locus_tag LOCUS_20250 15947 15480 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525368.1 protein_id gnl|my_center|LOCUS_20250 17818 15956 gene locus_tag LOCUS_20260 17818 15956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 17944 19179 gene locus_tag LOCUS_20270 17944 19179 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124078.1 protein_id gnl|my_center|LOCUS_20270 19623 22001 gene locus_tag LOCUS_20280 19623 22001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 22200 22661 gene locus_tag LOCUS_20290 22200 22661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 23154 22717 gene locus_tag LOCUS_20300 23154 22717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 23288 23572 gene locus_tag LOCUS_20310 23288 23572 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980242.1 protein_id gnl|my_center|LOCUS_20310 24440 23667 gene locus_tag LOCUS_20320 24440 23667 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_20320 25549 24518 gene locus_tag LOCUS_20330 gene fbaA 25549 24518 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_20330 25744 26502 gene locus_tag LOCUS_20340 25744 26502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 26613 26855 gene locus_tag LOCUS_20350 gene acpP 26613 26855 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_20350 26952 27488 gene locus_tag LOCUS_20360 26952 27488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 27565 28461 gene locus_tag LOCUS_20370 27565 28461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 28478 29431 gene locus_tag LOCUS_20380 28478 29431 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_20380 29445 29960 gene locus_tag LOCUS_20390 gene gntK 29445 29960 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420757.1 protein_id gnl|my_center|LOCUS_20390 30801 29929 gene locus_tag LOCUS_20400 gene gluQRS 30801 29929 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_20400 30917 31441 gene locus_tag LOCUS_20410 30917 31441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 31466 32035 gene locus_tag LOCUS_20420 31466 32035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 32101 32892 gene locus_tag LOCUS_20430 32101 32892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 33445 33603 gene locus_tag LOCUS_20440 33445 33603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 33872 34888 gene locus_tag LOCUS_20450 gene galE 33872 34888 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615363.1 protein_id gnl|my_center|LOCUS_20450 35021 35656 gene locus_tag LOCUS_20460 35021 35656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 35661 36386 gene locus_tag LOCUS_20470 35661 36386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 36432 37514 gene locus_tag LOCUS_20480 36432 37514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 39006 37519 gene locus_tag LOCUS_20490 39006 37519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 39674 39003 gene locus_tag LOCUS_20500 39674 39003 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_20500 40911 39694 gene locus_tag LOCUS_20510 40911 39694 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069319778.1 protein_id gnl|my_center|LOCUS_20510 41652 40933 gene locus_tag LOCUS_20520 41652 40933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531071.1 protein_id gnl|my_center|LOCUS_20520 42999 41701 gene locus_tag LOCUS_20530 42999 41701 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924854.1 protein_id gnl|my_center|LOCUS_20530 44426 43035 gene locus_tag LOCUS_20540 44426 43035 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924853.1 protein_id gnl|my_center|LOCUS_20540 44573 45211 gene locus_tag LOCUS_20550 44573 45211 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_20550 45339 46919 gene locus_tag LOCUS_20560 gene glgA 45339 46919 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246015.1 protein_id gnl|my_center|LOCUS_20560 47891 46914 gene locus_tag LOCUS_20570 47891 46914 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989071.1 protein_id gnl|my_center|LOCUS_20570 48799 47951 gene locus_tag LOCUS_20580 48799 47951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 49005 49718 gene locus_tag LOCUS_20590 gene aqpZ 49005 49718 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140371.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence179 398 216 gene locus_tag LOCUS_20600 398 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 1005 781 gene locus_tag LOCUS_20610 1005 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 1170 1012 gene locus_tag LOCUS_20620 1170 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 1833 1366 gene locus_tag LOCUS_20630 1833 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 3334 2462 gene locus_tag LOCUS_20640 3334 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 6003 3331 gene locus_tag LOCUS_20650 6003 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 6968 6021 gene locus_tag LOCUS_20660 6968 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 7118 8116 gene locus_tag LOCUS_20670 7118 8116 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_20670 8161 9042 gene locus_tag LOCUS_20680 8161 9042 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_20680 9050 9808 gene locus_tag LOCUS_20690 gene truA 9050 9808 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_20690 10694 9780 gene locus_tag LOCUS_20700 10694 9780 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532208.1 protein_id gnl|my_center|LOCUS_20700 10809 11432 gene locus_tag LOCUS_20710 10809 11432 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140192.1 protein_id gnl|my_center|LOCUS_20710 11487 12119 gene locus_tag LOCUS_20720 11487 12119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 12246 15200 gene locus_tag LOCUS_20730 12246 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 15210 16313 gene locus_tag LOCUS_20740 15210 16313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 16306 17130 gene locus_tag LOCUS_20750 16306 17130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 17153 17566 gene locus_tag LOCUS_20760 17153 17566 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118238.1 protein_id gnl|my_center|LOCUS_20760 17578 18024 gene locus_tag LOCUS_20770 17578 18024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 18026 19066 gene locus_tag LOCUS_20780 18026 19066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 19176 21152 gene locus_tag LOCUS_20790 19176 21152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 21169 22422 gene locus_tag LOCUS_20800 21169 22422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 23205 22441 gene locus_tag LOCUS_20810 gene lptB 23205 22441 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417497.1 protein_id gnl|my_center|LOCUS_20810 24498 23236 gene locus_tag LOCUS_20820 24498 23236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 25326 24511 gene locus_tag LOCUS_20830 gene kdsA 25326 24511 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_20830 25625 25374 gene locus_tag LOCUS_20840 25625 25374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 28294 26138 gene locus_tag LOCUS_20850 28294 26138 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108651.1 protein_id gnl|my_center|LOCUS_20850 30902 28392 gene locus_tag LOCUS_20860 30902 28392 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_20860 30949 31416 gene locus_tag LOCUS_20870 30949 31416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 32068 31424 gene locus_tag LOCUS_20880 32068 31424 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_20880 34530 32077 gene locus_tag LOCUS_20890 34530 32077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 34638 35534 gene locus_tag LOCUS_20900 34638 35534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 35577 37322 gene locus_tag LOCUS_20910 35577 37322 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546696.1 protein_id gnl|my_center|LOCUS_20910 38086 37400 gene locus_tag LOCUS_20920 38086 37400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 38364 39809 gene locus_tag LOCUS_20930 38364 39809 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_20930 40958 39756 gene locus_tag LOCUS_20940 40958 39756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 41104 41985 gene locus_tag LOCUS_20950 41104 41985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 42072 42929 gene locus_tag LOCUS_20960 42072 42929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 43006 43956 gene locus_tag LOCUS_20970 43006 43956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 43962 44789 gene locus_tag LOCUS_20980 43962 44789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 44813 45772 gene locus_tag LOCUS_20990 44813 45772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 45921 46571 gene locus_tag LOCUS_21000 45921 46571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 46790 49405 gene locus_tag LOCUS_21010 46790 49405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence180 2006 159 gene locus_tag LOCUS_21020 2006 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 2713 2372 gene locus_tag LOCUS_21030 2713 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2965 2780 gene locus_tag LOCUS_21040 2965 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 3639 3427 gene locus_tag LOCUS_21050 3639 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 4739 3762 gene locus_tag LOCUS_21060 4739 3762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_21060 5547 4804 gene locus_tag LOCUS_21070 5547 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 6722 5601 gene locus_tag LOCUS_21080 gene deoB 6722 5601 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046079.1 protein_id gnl|my_center|LOCUS_21080 7653 6832 gene locus_tag LOCUS_21090 7653 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 8271 7804 gene locus_tag LOCUS_21100 gene sixA 8271 7804 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141750.1 protein_id gnl|my_center|LOCUS_21100 9036 8290 gene locus_tag LOCUS_21110 gene fabG 9036 8290 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_21110 9141 9551 gene locus_tag LOCUS_21120 9141 9551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 9923 13639 gene locus_tag LOCUS_21130 9923 13639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 14379 13621 gene locus_tag LOCUS_21140 gene eutC 14379 13621 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524484.1 protein_id gnl|my_center|LOCUS_21140 15767 14376 gene locus_tag LOCUS_21150 15767 14376 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 protein_id gnl|my_center|LOCUS_21150 18109 15881 gene locus_tag LOCUS_21160 18109 15881 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 protein_id gnl|my_center|LOCUS_21160 19536 18202 gene locus_tag LOCUS_21170 19536 18202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 20743 19631 gene locus_tag LOCUS_21180 20743 19631 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_21180 21469 20759 gene locus_tag LOCUS_21190 21469 20759 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720869.1 protein_id gnl|my_center|LOCUS_21190 22709 21522 gene locus_tag LOCUS_21200 22709 21522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 23939 22767 gene locus_tag LOCUS_21210 23939 22767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 24460 23936 gene locus_tag LOCUS_21220 24460 23936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 25219 24464 gene locus_tag LOCUS_21230 25219 24464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 25578 26462 gene locus_tag LOCUS_21240 gene cyoE 25578 26462 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_21240 26498 27226 gene locus_tag LOCUS_21250 26498 27226 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_21250 28088 27234 gene locus_tag LOCUS_21260 28088 27234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 28779 28261 gene locus_tag LOCUS_21270 28779 28261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 29893 28817 gene locus_tag LOCUS_21280 gene mgrA 29893 28817 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_21280 31136 29874 gene locus_tag LOCUS_21290 31136 29874 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_21290 31177 31776 gene locus_tag LOCUS_21300 31177 31776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 31787 33943 gene locus_tag LOCUS_21310 gene mrdA 31787 33943 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583753.1 protein_id gnl|my_center|LOCUS_21310 34069 34500 gene locus_tag LOCUS_21320 34069 34500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 34527 35336 gene locus_tag LOCUS_21330 34527 35336 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_21330 35362 35892 gene locus_tag LOCUS_21340 35362 35892 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926982.1 protein_id gnl|my_center|LOCUS_21340 35920 36324 gene locus_tag LOCUS_21350 35920 36324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 37149 36400 gene locus_tag LOCUS_21360 37149 36400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 37453 37538 gene locus_tag LOCUS_t00240 37453 37538 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 38332 37856 gene locus_tag LOCUS_21370 38332 37856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 38959 38714 gene locus_tag LOCUS_21380 38959 38714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 40218 39868 gene locus_tag LOCUS_21390 40218 39868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 40658 40215 gene locus_tag LOCUS_21400 40658 40215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 41037 40693 gene locus_tag LOCUS_21410 41037 40693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 41893 41201 gene locus_tag LOCUS_21420 41893 41201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 42889 42371 gene locus_tag LOCUS_21430 42889 42371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 43480 42998 gene locus_tag LOCUS_21440 43480 42998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 43744 43499 gene locus_tag LOCUS_21450 43744 43499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence181 1539 787 gene locus_tag LOCUS_21460 1539 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2171 1707 gene locus_tag LOCUS_21470 2171 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 3251 2541 gene locus_tag LOCUS_21480 3251 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 4743 3604 gene locus_tag LOCUS_21490 4743 3604 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526219.1 protein_id gnl|my_center|LOCUS_21490 5619 4774 gene locus_tag LOCUS_21500 5619 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 6738 6052 gene locus_tag LOCUS_21510 6738 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 8830 6992 gene locus_tag LOCUS_21520 8830 6992 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968009.1 protein_id gnl|my_center|LOCUS_21520 9565 8885 gene locus_tag LOCUS_21530 9565 8885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 9691 10242 gene locus_tag LOCUS_21540 9691 10242 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329713.1 protein_id gnl|my_center|LOCUS_21540 11943 10249 gene locus_tag LOCUS_21550 11943 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 13148 11940 gene locus_tag LOCUS_21560 13148 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 13288 14310 gene locus_tag LOCUS_21570 gene add 13288 14310 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259176.1 protein_id gnl|my_center|LOCUS_21570 15589 14315 gene locus_tag LOCUS_21580 15589 14315 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764196.1 protein_id gnl|my_center|LOCUS_21580 15875 16687 gene locus_tag LOCUS_21590 15875 16687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 17538 16783 gene locus_tag LOCUS_21600 17538 16783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 20446 17669 gene locus_tag LOCUS_21610 20446 17669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 20600 21124 gene locus_tag LOCUS_21620 20600 21124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 21478 23763 gene locus_tag LOCUS_21630 21478 23763 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108165.1 protein_id gnl|my_center|LOCUS_21630 24254 23889 gene locus_tag LOCUS_21640 24254 23889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 24888 24295 gene locus_tag LOCUS_21650 24888 24295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 25066 24899 gene locus_tag LOCUS_21660 25066 24899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 25531 25208 gene locus_tag LOCUS_21670 25531 25208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 25599 27203 gene locus_tag LOCUS_21680 25599 27203 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816130.1 protein_id gnl|my_center|LOCUS_21680 27200 27934 gene locus_tag LOCUS_21690 27200 27934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 34069 28655 gene locus_tag LOCUS_21700 34069 28655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 36739 34298 gene locus_tag LOCUS_21710 gene rnr 36739 34298 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829677.1 protein_id gnl|my_center|LOCUS_21710 36918 37484 gene locus_tag LOCUS_21720 36918 37484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 38451 37582 gene locus_tag LOCUS_21730 gene argB 38451 37582 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335411.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence182 1910 150 gene locus_tag LOCUS_21740 1910 150 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_21740 2334 2017 gene locus_tag LOCUS_21750 2334 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2715 2344 gene locus_tag LOCUS_21760 2715 2344 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_21760 3178 2855 gene locus_tag LOCUS_21770 3178 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 3389 3658 gene locus_tag LOCUS_21780 3389 3658 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882762.1 protein_id gnl|my_center|LOCUS_21780 3714 4541 gene locus_tag LOCUS_21790 gene hisF 3714 4541 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_21790 7922 4881 gene locus_tag LOCUS_21800 7922 4881 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120396.1 protein_id gnl|my_center|LOCUS_21800 10654 7886 gene locus_tag LOCUS_21810 10654 7886 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120395.1 protein_id gnl|my_center|LOCUS_21810 11028 10801 gene locus_tag LOCUS_21820 11028 10801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 11252 12376 gene locus_tag LOCUS_21830 11252 12376 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 protein_id gnl|my_center|LOCUS_21830 12583 13692 gene locus_tag LOCUS_21840 gene lptF 12583 13692 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_21840 13707 15581 gene locus_tag LOCUS_21850 13707 15581 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937364.1 protein_id gnl|my_center|LOCUS_21850 15591 16076 gene locus_tag LOCUS_21860 15591 16076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 16769 16095 gene locus_tag LOCUS_21870 16769 16095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 16948 17379 gene locus_tag LOCUS_21880 16948 17379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 17489 18379 gene locus_tag LOCUS_21890 17489 18379 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_21890 18532 18951 gene locus_tag LOCUS_21900 18532 18951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 20109 18991 gene locus_tag LOCUS_21910 20109 18991 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073850.1 protein_id gnl|my_center|LOCUS_21910 21634 20234 gene locus_tag LOCUS_21920 21634 20234 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705969.1 protein_id gnl|my_center|LOCUS_21920 21822 22823 gene locus_tag LOCUS_21930 21822 22823 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035526.1 protein_id gnl|my_center|LOCUS_21930 23848 22910 gene locus_tag LOCUS_21940 23848 22910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 24051 25442 gene locus_tag LOCUS_21950 24051 25442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 25439 26188 gene locus_tag LOCUS_21960 25439 26188 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_21960 26399 28330 gene locus_tag LOCUS_21970 26399 28330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 29822 28452 gene locus_tag LOCUS_21980 29822 28452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 30667 30005 gene locus_tag LOCUS_21990 30667 30005 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 protein_id gnl|my_center|LOCUS_21990 31048 30701 gene locus_tag LOCUS_22000 31048 30701 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_22000 34059 31069 gene locus_tag LOCUS_22010 34059 31069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence183 1850 162 gene locus_tag LOCUS_22020 1850 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 3553 1850 gene locus_tag LOCUS_22030 3553 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 4256 3558 gene locus_tag LOCUS_22040 4256 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 4781 4269 gene locus_tag LOCUS_22050 4781 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 5270 4788 gene locus_tag LOCUS_22060 5270 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 5836 5297 gene locus_tag LOCUS_22070 5836 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 6078 5872 gene locus_tag LOCUS_22080 6078 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 6557 6075 gene locus_tag LOCUS_22090 6557 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 7151 6561 gene locus_tag LOCUS_22100 7151 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 7764 7156 gene locus_tag LOCUS_22110 7764 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 8056 7805 gene locus_tag LOCUS_22120 8056 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 9594 8116 gene locus_tag LOCUS_22130 9594 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 10409 9591 gene locus_tag LOCUS_22140 10409 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 11354 10428 gene locus_tag LOCUS_22150 11354 10428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 13985 11358 gene locus_tag LOCUS_22160 13985 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 14338 13982 gene locus_tag LOCUS_22170 14338 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 16549 14345 gene locus_tag LOCUS_22180 16549 14345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 16758 16546 gene locus_tag LOCUS_22190 16758 16546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 18268 16751 gene locus_tag LOCUS_22200 18268 16751 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889353.1 protein_id gnl|my_center|LOCUS_22200 18843 18265 gene locus_tag LOCUS_22210 18843 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 19104 18844 gene locus_tag LOCUS_22220 19104 18844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 19643 19101 gene locus_tag LOCUS_22230 19643 19101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 19849 19640 gene locus_tag LOCUS_22240 19849 19640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 20475 19846 gene locus_tag LOCUS_22250 20475 19846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 21033 20560 gene locus_tag LOCUS_22260 21033 20560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 22007 21405 gene locus_tag LOCUS_22270 22007 21405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 22255 22013 gene locus_tag LOCUS_22280 22255 22013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 22254 22433 gene locus_tag LOCUS_22290 22254 22433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 22678 22920 gene locus_tag LOCUS_22300 22678 22920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 23142 23351 gene locus_tag LOCUS_22310 23142 23351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 23415 23651 gene locus_tag LOCUS_22320 23415 23651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 23648 23956 gene locus_tag LOCUS_22330 23648 23956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 23960 24154 gene locus_tag LOCUS_22340 23960 24154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 24418 24603 gene locus_tag LOCUS_22350 24418 24603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 24635 25159 gene locus_tag LOCUS_22360 24635 25159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 25189 25650 gene locus_tag LOCUS_22370 25189 25650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 25689 25985 gene locus_tag LOCUS_22380 25689 25985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 25987 26313 gene locus_tag LOCUS_22390 25987 26313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 26317 26619 gene locus_tag LOCUS_22400 26317 26619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 26616 26927 gene locus_tag LOCUS_22410 26616 26927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 27264 28028 gene locus_tag LOCUS_22420 27264 28028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 28045 28362 gene locus_tag LOCUS_22430 28045 28362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 28382 28660 gene locus_tag LOCUS_22440 28382 28660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 28666 28947 gene locus_tag LOCUS_22450 28666 28947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 28974 29444 gene locus_tag LOCUS_22460 28974 29444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 29707 29537 gene locus_tag LOCUS_22470 29707 29537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 29710 30036 gene locus_tag LOCUS_22480 29710 30036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 30033 31598 gene locus_tag LOCUS_22490 30033 31598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 31617 32564 gene locus_tag LOCUS_22500 31617 32564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 32568 32909 gene locus_tag LOCUS_22510 32568 32909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence184 350 48 gene locus_tag LOCUS_22520 350 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 978 382 gene locus_tag LOCUS_22530 978 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 1103 2188 gene locus_tag LOCUS_22540 1103 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 4757 2319 gene locus_tag LOCUS_22550 4757 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 7147 6545 gene locus_tag LOCUS_22560 7147 6545 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226070.1 protein_id gnl|my_center|LOCUS_22560 7394 8449 gene locus_tag LOCUS_22570 7394 8449 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466614.1 protein_id gnl|my_center|LOCUS_22570 9459 9375 gene locus_tag LOCUS_t00250 9459 9375 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9600 10667 gene locus_tag LOCUS_22580 9600 10667 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_22580 10678 12174 gene locus_tag LOCUS_22590 10678 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 12171 13877 gene locus_tag LOCUS_22600 12171 13877 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930368.1 protein_id gnl|my_center|LOCUS_22600 13968 14735 gene locus_tag LOCUS_22610 13968 14735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 14863 15771 gene locus_tag LOCUS_22620 gene rimK 14863 15771 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_22620 16204 15779 gene locus_tag LOCUS_22630 16204 15779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 17572 16220 gene locus_tag LOCUS_22640 17572 16220 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 protein_id gnl|my_center|LOCUS_22640 18442 17666 gene locus_tag LOCUS_22650 18442 17666 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420966.1 protein_id gnl|my_center|LOCUS_22650 18768 18439 gene locus_tag LOCUS_22660 18768 18439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 21833 18807 gene locus_tag LOCUS_22670 21833 18807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 21959 23311 gene locus_tag LOCUS_22680 21959 23311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 23352 25241 gene locus_tag LOCUS_22690 23352 25241 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669321.1 protein_id gnl|my_center|LOCUS_22690 25268 26299 gene locus_tag LOCUS_22700 25268 26299 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892596.1 protein_id gnl|my_center|LOCUS_22700 27061 26372 gene locus_tag LOCUS_22710 27061 26372 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529987.1 protein_id gnl|my_center|LOCUS_22710 27307 28602 gene locus_tag LOCUS_22720 27307 28602 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464136.1 protein_id gnl|my_center|LOCUS_22720 29747 28626 gene locus_tag LOCUS_22730 29747 28626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 31072 29828 gene locus_tag LOCUS_22740 31072 29828 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_22740 31308 32957 gene locus_tag LOCUS_22750 31308 32957 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928779.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence185 547 296 gene locus_tag LOCUS_22760 547 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 709 551 gene locus_tag LOCUS_22770 709 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 822 1625 gene locus_tag LOCUS_22780 822 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 1622 2881 gene locus_tag LOCUS_22790 1622 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 3010 2928 gene locus_tag LOCUS_t00260 3010 2928 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3281 4843 gene locus_tag LOCUS_22800 3281 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 6044 4854 gene locus_tag LOCUS_22810 6044 4854 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_22810 6043 8469 gene locus_tag LOCUS_22820 6043 8469 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942207.1 protein_id gnl|my_center|LOCUS_22820 8632 9315 gene locus_tag LOCUS_22830 gene rpsB 8632 9315 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_22830 9391 10260 gene locus_tag LOCUS_22840 gene tsf 9391 10260 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938172.1 protein_id gnl|my_center|LOCUS_22840 10793 10993 gene locus_tag LOCUS_22850 10793 10993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 11051 12205 gene locus_tag LOCUS_22860 11051 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 12372 13757 gene locus_tag LOCUS_22870 12372 13757 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_22870 14004 15992 gene locus_tag LOCUS_22880 14004 15992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 16019 17383 gene locus_tag LOCUS_22890 16019 17383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 19006 17999 gene locus_tag LOCUS_22900 19006 17999 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463386.1 protein_id gnl|my_center|LOCUS_22900 19290 23141 gene locus_tag LOCUS_22910 19290 23141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 23262 24851 gene locus_tag LOCUS_22920 23262 24851 CDS product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039214.1 protein_id gnl|my_center|LOCUS_22920 26385 24898 gene locus_tag LOCUS_22930 gene mqo 26385 24898 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099345.1 protein_id gnl|my_center|LOCUS_22930 27232 26474 gene locus_tag LOCUS_22940 27232 26474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 27379 30672 gene locus_tag LOCUS_22950 gene carB 27379 30672 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_22950 30778 32112 gene locus_tag LOCUS_22960 30778 32112 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065247.1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence186 600 2372 gene locus_tag LOCUS_22970 600 2372 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405278.1 protein_id gnl|my_center|LOCUS_22970 2369 3115 gene locus_tag LOCUS_22980 2369 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 3455 4297 gene locus_tag LOCUS_22990 3455 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 4326 5183 gene locus_tag LOCUS_23000 4326 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 6616 5375 gene locus_tag LOCUS_23010 6616 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 7604 6600 gene locus_tag LOCUS_23020 7604 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 7865 8137 gene locus_tag LOCUS_23030 7865 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 9466 8081 gene locus_tag LOCUS_23040 gene mpl 9466 8081 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_23040 9593 10264 gene locus_tag LOCUS_23050 9593 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 10504 14925 gene locus_tag LOCUS_23060 10504 14925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 15052 18339 gene locus_tag LOCUS_23070 15052 18339 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_23070 18390 20108 gene locus_tag LOCUS_23080 18390 20108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 20205 20984 gene locus_tag LOCUS_23090 20205 20984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 20981 22423 gene locus_tag LOCUS_23100 20981 22423 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_23100 22436 23044 gene locus_tag LOCUS_23110 22436 23044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 23060 23467 gene locus_tag LOCUS_23120 23060 23467 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_23120 23533 24141 gene locus_tag LOCUS_23130 23533 24141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 24147 25601 gene locus_tag LOCUS_23140 24147 25601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 25601 26920 gene locus_tag LOCUS_23150 25601 26920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 26933 27529 gene locus_tag LOCUS_23160 26933 27529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 27592 28743 gene locus_tag LOCUS_23170 27592 28743 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266425.1 protein_id gnl|my_center|LOCUS_23170 29087 29680 gene locus_tag LOCUS_23180 gene rlmB 29087 29680 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 protein_id gnl|my_center|LOCUS_23180 29677 30477 gene locus_tag LOCUS_23190 29677 30477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence187 970 2010 gene locus_tag LOCUS_23200 970 2010 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_23200 2039 3124 gene locus_tag LOCUS_23210 2039 3124 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833582.1 protein_id gnl|my_center|LOCUS_23210 3166 4296 gene locus_tag LOCUS_23220 3166 4296 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_23220 5213 4335 gene locus_tag LOCUS_23230 5213 4335 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816885.1 protein_id gnl|my_center|LOCUS_23230 6374 5259 gene locus_tag LOCUS_23240 6374 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 6581 6378 gene locus_tag LOCUS_23250 gene tatA 6581 6378 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933280.1 protein_id gnl|my_center|LOCUS_23250 6802 8115 gene locus_tag LOCUS_23260 6802 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 8485 8102 gene locus_tag LOCUS_23270 8485 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 8736 8506 gene locus_tag LOCUS_23280 8736 8506 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036202.1 protein_id gnl|my_center|LOCUS_23280 9015 9887 gene locus_tag LOCUS_23290 9015 9887 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_23290 12535 11762 gene locus_tag LOCUS_23300 12535 11762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 13406 13131 gene locus_tag LOCUS_23310 13406 13131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 14761 14180 gene locus_tag LOCUS_23320 14761 14180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 15476 15135 gene locus_tag LOCUS_23330 15476 15135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 16131 15610 gene locus_tag LOCUS_23340 16131 15610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 16578 16210 gene locus_tag LOCUS_23350 16578 16210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 18741 18268 gene locus_tag LOCUS_23360 18741 18268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 20065 19712 gene locus_tag LOCUS_23370 20065 19712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 20595 20245 gene locus_tag LOCUS_23380 20595 20245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 20969 21154 gene locus_tag LOCUS_23390 20969 21154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 21728 21348 gene locus_tag LOCUS_23400 21728 21348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 21908 22093 gene locus_tag LOCUS_23410 21908 22093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 23657 23214 gene locus_tag LOCUS_23420 23657 23214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 24011 23706 gene locus_tag LOCUS_23430 24011 23706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 24594 24046 gene locus_tag LOCUS_23440 24594 24046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 25433 24867 gene locus_tag LOCUS_23450 25433 24867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 25937 25584 gene locus_tag LOCUS_23460 25937 25584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 26252 26022 gene locus_tag LOCUS_23470 26252 26022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 27081 26578 gene locus_tag LOCUS_23480 27081 26578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 27745 27200 gene locus_tag LOCUS_23490 27745 27200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence188 4047 2671 gene locus_tag LOCUS_23500 4047 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 4257 4559 gene locus_tag LOCUS_23510 4257 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 5439 4660 gene locus_tag LOCUS_23520 5439 4660 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_23520 5673 7133 gene locus_tag LOCUS_23530 5673 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 7357 7169 gene locus_tag LOCUS_23540 7357 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 7897 7499 gene locus_tag LOCUS_23550 7897 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 8097 8666 gene locus_tag LOCUS_23560 8097 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 8676 9044 gene locus_tag LOCUS_23570 8676 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 9165 10238 gene locus_tag LOCUS_23580 9165 10238 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_23580 10319 11161 gene locus_tag LOCUS_23590 gene yaeI 10319 11161 CDS product phosphodiesterase YaeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625631.1 protein_id gnl|my_center|LOCUS_23590 11170 11793 gene locus_tag LOCUS_23600 11170 11793 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 protein_id gnl|my_center|LOCUS_23600 15088 11873 gene locus_tag LOCUS_23610 15088 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 15657 16658 gene locus_tag LOCUS_23620 15657 16658 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_23620 16729 17562 gene locus_tag LOCUS_23630 16729 17562 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219159941.1 protein_id gnl|my_center|LOCUS_23630 18379 17888 gene locus_tag LOCUS_23640 18379 17888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 19564 18437 gene locus_tag LOCUS_23650 19564 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 19942 19661 gene locus_tag LOCUS_23660 19942 19661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 20855 19977 gene locus_tag LOCUS_23670 20855 19977 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_23670 21685 20939 gene locus_tag LOCUS_23680 21685 20939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 22102 24090 gene locus_tag LOCUS_23690 22102 24090 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796237.1 protein_id gnl|my_center|LOCUS_23690 24142 25440 gene locus_tag LOCUS_23700 24142 25440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 25745 25449 gene locus_tag LOCUS_23710 25745 25449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 25915 25766 gene locus_tag LOCUS_23720 25915 25766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 27179 26100 gene locus_tag LOCUS_23730 27179 26100 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_23730 28706 27273 gene locus_tag LOCUS_23740 28706 27273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 29359 28703 gene locus_tag LOCUS_23750 29359 28703 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313598.1 protein_id gnl|my_center|LOCUS_23750 29472 30833 gene locus_tag LOCUS_23760 29472 30833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 30830 31804 gene locus_tag LOCUS_23770 30830 31804 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940539.1 protein_id gnl|my_center|LOCUS_23770 33539 31812 gene locus_tag LOCUS_23780 33539 31812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 33556 35058 gene locus_tag LOCUS_23790 33556 35058 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227115.1 protein_id gnl|my_center|LOCUS_23790 36515 35070 gene locus_tag LOCUS_23800 36515 35070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 36729 38357 gene locus_tag LOCUS_23810 36729 38357 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183489.1 protein_id gnl|my_center|LOCUS_23810 39238 38387 gene locus_tag LOCUS_23820 39238 38387 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_23820 39402 40670 gene locus_tag LOCUS_23830 39402 40670 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625669.1 protein_id gnl|my_center|LOCUS_23830 41590 40667 gene locus_tag LOCUS_23840 41590 40667 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142979.1 protein_id gnl|my_center|LOCUS_23840 41666 42397 gene locus_tag LOCUS_23850 41666 42397 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140539.1 protein_id gnl|my_center|LOCUS_23850 43340 42417 gene locus_tag LOCUS_23860 gene metF 43340 42417 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_23860 43473 44165 gene locus_tag LOCUS_23870 43473 44165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 46700 44262 gene locus_tag LOCUS_23880 gene secDF 46700 44262 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971714.1 protein_id gnl|my_center|LOCUS_23880 47080 46757 gene locus_tag LOCUS_23890 gene yajC 47080 46757 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_23890 48219 47077 gene locus_tag LOCUS_23900 gene tgt 48219 47077 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_23900 48419 48688 gene locus_tag LOCUS_23910 48419 48688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 48844 49155 gene locus_tag LOCUS_23920 48844 49155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 49203 51137 gene locus_tag LOCUS_23930 49203 51137 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816805.1 protein_id gnl|my_center|LOCUS_23930 51169 52482 gene locus_tag LOCUS_23940 51169 52482 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_23940 52599 53273 gene locus_tag LOCUS_23950 52599 53273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 54016 53324 gene locus_tag LOCUS_23960 54016 53324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 55603 54026 gene locus_tag LOCUS_23970 gene cimA 55603 54026 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880180.1 protein_id gnl|my_center|LOCUS_23970 56860 55664 gene locus_tag LOCUS_23980 gene trpB 56860 55664 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_23980 57164 56958 gene locus_tag LOCUS_23990 57164 56958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 58839 57352 gene locus_tag LOCUS_24000 58839 57352 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_24000 59011 60435 gene locus_tag LOCUS_24010 59011 60435 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922306.1 protein_id gnl|my_center|LOCUS_24010 61003 60440 gene locus_tag LOCUS_24020 61003 60440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 62709 61000 gene locus_tag LOCUS_24030 62709 61000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 62853 63644 gene locus_tag LOCUS_24040 62853 63644 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368130.1 protein_id gnl|my_center|LOCUS_24040 63699 64028 gene locus_tag LOCUS_24050 gene uraH 63699 64028 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528242.1 protein_id gnl|my_center|LOCUS_24050 64042 65262 gene locus_tag LOCUS_24060 64042 65262 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966724.1 protein_id gnl|my_center|LOCUS_24060 65259 66590 gene locus_tag LOCUS_24070 65259 66590 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_24070 66594 67331 gene locus_tag LOCUS_24080 gene allE 66594 67331 CDS product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887795.1 protein_id gnl|my_center|LOCUS_24080 67328 68569 gene locus_tag LOCUS_24090 67328 68569 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694560.1 protein_id gnl|my_center|LOCUS_24090 68566 72258 gene locus_tag LOCUS_24100 68566 72258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 72277 73224 gene locus_tag LOCUS_24110 72277 73224 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_24110 73268 73618 gene locus_tag LOCUS_24120 73268 73618 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 protein_id gnl|my_center|LOCUS_24120 73615 74646 gene locus_tag LOCUS_24130 gene rsmH 73615 74646 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_24130 75596 74676 gene locus_tag LOCUS_24140 75596 74676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 76465 75596 gene locus_tag LOCUS_24150 76465 75596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 77034 77846 gene locus_tag LOCUS_24160 77034 77846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 79508 77919 gene locus_tag LOCUS_24170 gene metG 79508 77919 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017027.1 protein_id gnl|my_center|LOCUS_24170 80836 79598 gene locus_tag LOCUS_24180 80836 79598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 81122 81910 gene locus_tag LOCUS_24190 81122 81910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 81931 82740 gene locus_tag LOCUS_24200 81931 82740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 83643 82921 gene locus_tag LOCUS_24210 83643 82921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 85105 83807 gene locus_tag LOCUS_24220 85105 83807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 85597 85262 gene locus_tag LOCUS_24230 85597 85262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 87246 85594 gene locus_tag LOCUS_24240 87246 85594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 88055 87357 gene locus_tag LOCUS_24250 88055 87357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 88228 90042 gene locus_tag LOCUS_24260 88228 90042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 91295 90054 gene locus_tag LOCUS_24270 91295 90054 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_24270 92034 91333 gene locus_tag LOCUS_24280 92034 91333 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111142.1 protein_id gnl|my_center|LOCUS_24280 93290 92046 gene locus_tag LOCUS_24290 93290 92046 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_24290 93895 93287 gene locus_tag LOCUS_24300 gene ispD 93895 93287 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_24300 94957 94013 gene locus_tag LOCUS_24310 94957 94013 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446740.1 protein_id gnl|my_center|LOCUS_24310 95015 95674 gene locus_tag LOCUS_24320 95015 95674 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_24320 95862 97025 gene locus_tag LOCUS_24330 95862 97025 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763971.1 protein_id gnl|my_center|LOCUS_24330 97022 102460 gene locus_tag LOCUS_24340 97022 102460 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463281.1 protein_id gnl|my_center|LOCUS_24340 103304 102570 gene locus_tag LOCUS_24350 103304 102570 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 protein_id gnl|my_center|LOCUS_24350 103481 104062 gene locus_tag LOCUS_24360 103481 104062 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_24360 104059 105609 gene locus_tag LOCUS_24370 104059 105609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 105700 106407 gene locus_tag LOCUS_24380 105700 106407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 106633 109989 gene locus_tag LOCUS_24390 106633 109989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 110769 110140 gene locus_tag LOCUS_24400 110769 110140 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939818.1 protein_id gnl|my_center|LOCUS_24400 111613 110789 gene locus_tag LOCUS_24410 111613 110789 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 protein_id gnl|my_center|LOCUS_24410 114703 111758 gene locus_tag LOCUS_24420 114703 111758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 116539 114734 gene locus_tag LOCUS_24430 116539 114734 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941997.1 protein_id gnl|my_center|LOCUS_24430 117020 116547 gene locus_tag LOCUS_24440 117020 116547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 118471 117176 gene locus_tag LOCUS_24450 118471 117176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 119145 118468 gene locus_tag LOCUS_24460 119145 118468 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941996.1 protein_id gnl|my_center|LOCUS_24460 122310 119239 gene locus_tag LOCUS_24470 122310 119239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 123091 122357 gene locus_tag LOCUS_24480 123091 122357 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_24480 123359 123637 gene locus_tag LOCUS_24490 123359 123637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 123689 125794 gene locus_tag LOCUS_24500 123689 125794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 125816 126490 gene locus_tag LOCUS_24510 125816 126490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 126588 127319 gene locus_tag LOCUS_24520 126588 127319 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_24520 127903 127358 gene locus_tag LOCUS_24530 127903 127358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 128513 128046 gene locus_tag LOCUS_24540 gene rnhA 128513 128046 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705464.1 protein_id gnl|my_center|LOCUS_24540 128582 130132 gene locus_tag LOCUS_24550 128582 130132 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039072.1 protein_id gnl|my_center|LOCUS_24550 130221 130544 gene locus_tag LOCUS_24560 130221 130544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 131499 130558 gene locus_tag LOCUS_24570 131499 130558 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_24570 131627 135088 gene locus_tag LOCUS_24580 131627 135088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 135089 137086 gene locus_tag LOCUS_24590 135089 137086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 137162 137467 gene locus_tag LOCUS_24600 137162 137467 CDS product DUF6172 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275192.1 protein_id gnl|my_center|LOCUS_24600 137994 137773 gene locus_tag LOCUS_24610 137994 137773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 138208 138528 gene locus_tag LOCUS_24620 138208 138528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 138525 140276 gene locus_tag LOCUS_24630 138525 140276 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730352.1 protein_id gnl|my_center|LOCUS_24630 140371 141486 gene locus_tag LOCUS_24640 140371 141486 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_24640 142621 141551 gene locus_tag LOCUS_24650 gene pheA 142621 141551 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_24650 143364 142627 gene locus_tag LOCUS_24660 gene scpB 143364 142627 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404243.1 protein_id gnl|my_center|LOCUS_24660 143573 144289 gene locus_tag LOCUS_24670 143573 144289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 144319 144492 gene locus_tag LOCUS_24680 gene rpmG 144319 144492 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963553.1 protein_id gnl|my_center|LOCUS_24680 144499 144741 gene locus_tag LOCUS_24690 gene rpsR 144499 144741 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983142.1 protein_id gnl|my_center|LOCUS_24690 144896 145681 gene locus_tag LOCUS_24700 gene folE2 144896 145681 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629168.1 protein_id gnl|my_center|LOCUS_24700 145791 146840 gene locus_tag LOCUS_24710 gene gap 145791 146840 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668968.1 protein_id gnl|my_center|LOCUS_24710 147001 148452 gene locus_tag LOCUS_24720 147001 148452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 149855 148500 gene locus_tag LOCUS_24730 149855 148500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 151288 149930 gene locus_tag LOCUS_24740 151288 149930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 152665 151319 gene locus_tag LOCUS_24750 152665 151319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 154889 152709 gene locus_tag LOCUS_24760 154889 152709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108861.1 protein_id gnl|my_center|LOCUS_24760 155028 156377 gene locus_tag LOCUS_24770 155028 156377 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921570.1 protein_id gnl|my_center|LOCUS_24770 156548 156390 gene locus_tag LOCUS_24780 156548 156390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 156858 156646 gene locus_tag LOCUS_24790 156858 156646 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388930.1 protein_id gnl|my_center|LOCUS_24790 157169 157537 gene locus_tag LOCUS_24800 157169 157537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 158890 157550 gene locus_tag LOCUS_24810 158890 157550 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_24810 159989 158982 gene locus_tag LOCUS_24820 159989 158982 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392766.1 protein_id gnl|my_center|LOCUS_24820 160194 162563 gene locus_tag LOCUS_24830 160194 162563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 162585 163292 gene locus_tag LOCUS_24840 gene tsaA 162585 163292 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 protein_id gnl|my_center|LOCUS_24840 163317 164909 gene locus_tag LOCUS_24850 163317 164909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 164923 165381 gene locus_tag LOCUS_24860 164923 165381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 165436 167274 gene locus_tag LOCUS_24870 165436 167274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 167612 167280 gene locus_tag LOCUS_24880 167612 167280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 168141 167671 gene locus_tag LOCUS_24890 168141 167671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 168567 170105 gene locus_tag LOCUS_24900 gene glgA 168567 170105 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944464.1 protein_id gnl|my_center|LOCUS_24900 170357 171058 gene locus_tag LOCUS_24910 170357 171058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 171632 171030 gene locus_tag LOCUS_24920 171632 171030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 171701 173563 gene locus_tag LOCUS_24930 171701 173563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 174179 173580 gene locus_tag LOCUS_24940 gene tmk 174179 173580 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039005.1 protein_id gnl|my_center|LOCUS_24940 175749 174283 gene locus_tag LOCUS_24950 175749 174283 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_24950 176479 175802 gene locus_tag LOCUS_24960 gene modB 176479 175802 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367643.1 protein_id gnl|my_center|LOCUS_24960 177231 176476 gene locus_tag LOCUS_24970 gene modA 177231 176476 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031846.1 protein_id gnl|my_center|LOCUS_24970 177713 177228 gene locus_tag LOCUS_24980 177713 177228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 179643 177703 gene locus_tag LOCUS_24990 179643 177703 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390968.1 protein_id gnl|my_center|LOCUS_24990 180042 179704 gene locus_tag LOCUS_25000 180042 179704 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206717.1 protein_id gnl|my_center|LOCUS_25000 180713 180048 gene locus_tag LOCUS_25010 180713 180048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 182009 181344 gene locus_tag LOCUS_25020 182009 181344 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_25020 182390 182031 gene locus_tag LOCUS_25030 182390 182031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 182667 183773 gene locus_tag LOCUS_25040 182667 183773 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975831.1 protein_id gnl|my_center|LOCUS_25040 183767 184471 gene locus_tag LOCUS_25050 183767 184471 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975830.1 protein_id gnl|my_center|LOCUS_25050 185915 184668 gene locus_tag LOCUS_25060 185915 184668 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_25060 187303 186002 gene locus_tag LOCUS_25070 187303 186002 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_25070 188165 187464 gene locus_tag LOCUS_25080 188165 187464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 191130 188149 gene locus_tag LOCUS_25090 191130 188149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 191881 191111 gene locus_tag LOCUS_25100 191881 191111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 192387 191878 gene locus_tag LOCUS_25110 192387 191878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 192986 192384 gene locus_tag LOCUS_25120 192986 192384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 194017 193343 gene locus_tag LOCUS_25130 194017 193343 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112398.1 protein_id gnl|my_center|LOCUS_25130 193910 194176 gene locus_tag LOCUS_25140 193910 194176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 194293 195189 gene locus_tag LOCUS_25150 194293 195189 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035556.1 protein_id gnl|my_center|LOCUS_25150 196733 195306 gene locus_tag LOCUS_25160 196733 195306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 198602 196962 gene locus_tag LOCUS_25170 gene groL 198602 196962 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_25170 198933 198643 gene locus_tag LOCUS_25180 gene groES 198933 198643 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_25180 199174 199019 gene locus_tag LOCUS_25190 199174 199019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 201117 199201 gene locus_tag LOCUS_25200 gene dnaK 201117 199201 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067591.1 protein_id gnl|my_center|LOCUS_25200 201586 203094 gene locus_tag LOCUS_25210 gene recJ 201586 203094 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_25210 203248 204921 gene locus_tag LOCUS_25220 203248 204921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 204976 206505 gene locus_tag LOCUS_25230 gene zwf 204976 206505 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_25230 206525 207574 gene locus_tag LOCUS_25240 206525 207574 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143171.1 protein_id gnl|my_center|LOCUS_25240 208571 207576 gene locus_tag LOCUS_25250 208571 207576 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_25250 209832 208645 gene locus_tag LOCUS_25260 209832 208645 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086738.1 protein_id gnl|my_center|LOCUS_25260 210875 209838 gene locus_tag LOCUS_25270 210875 209838 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_25270 210927 211481 gene locus_tag LOCUS_25280 210927 211481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 211556 212293 gene locus_tag LOCUS_25290 gene pyrH 211556 212293 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_25290 212317 212883 gene locus_tag LOCUS_25300 gene frr 212317 212883 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 protein_id gnl|my_center|LOCUS_25300 213090 214034 gene locus_tag LOCUS_25310 213090 214034 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385205.1 protein_id gnl|my_center|LOCUS_25310 214256 216655 gene locus_tag LOCUS_25320 214256 216655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 216742 217725 gene locus_tag LOCUS_25330 216742 217725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 220442 217749 gene locus_tag LOCUS_25340 gene rapA 220442 217749 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692755.1 protein_id gnl|my_center|LOCUS_25340 220644 222410 gene locus_tag LOCUS_25350 220644 222410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 224954 222837 gene locus_tag LOCUS_25360 224954 222837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 226986 225040 gene locus_tag LOCUS_25370 226986 225040 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 protein_id gnl|my_center|LOCUS_25370 228046 227150 gene locus_tag LOCUS_25380 228046 227150 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_25380 228187 229158 gene locus_tag LOCUS_25390 228187 229158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 229769 229575 gene locus_tag LOCUS_25400 229769 229575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 230446 229928 gene locus_tag LOCUS_25410 230446 229928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 231815 230757 gene locus_tag LOCUS_25420 231815 230757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919009.1 protein_id gnl|my_center|LOCUS_25420 231918 232784 gene locus_tag LOCUS_25430 231918 232784 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_25430 232858 233514 gene locus_tag LOCUS_25440 232858 233514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 233618 235138 gene locus_tag LOCUS_25450 233618 235138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 235251 235793 gene locus_tag LOCUS_25460 235251 235793 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_25460 235762 236772 gene locus_tag LOCUS_25470 235762 236772 CDS product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761173.1 protein_id gnl|my_center|LOCUS_25470 236775 237356 gene locus_tag LOCUS_25480 236775 237356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 237520 237876 gene locus_tag LOCUS_25490 237520 237876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 238002 239600 gene locus_tag LOCUS_25500 238002 239600 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_25500 239656 240120 gene locus_tag LOCUS_25510 239656 240120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence189 1227 127 gene locus_tag LOCUS_25520 gene mnmA 1227 127 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268273.1 protein_id gnl|my_center|LOCUS_25520 1286 2161 gene locus_tag LOCUS_25530 1286 2161 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_25530 2281 3777 gene locus_tag LOCUS_25540 2281 3777 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_25540 4576 3812 gene locus_tag LOCUS_25550 4576 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 5749 4583 gene locus_tag LOCUS_25560 5749 4583 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_25560 5925 6542 gene locus_tag LOCUS_25570 5925 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 7916 6621 gene locus_tag LOCUS_25580 gene eno 7916 6621 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103949.1 protein_id gnl|my_center|LOCUS_25580 9833 7956 gene locus_tag LOCUS_25590 9833 7956 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873253.1 protein_id gnl|my_center|LOCUS_25590 10673 9855 gene locus_tag LOCUS_25600 10673 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 11173 10676 gene locus_tag LOCUS_25610 11173 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 11690 11160 gene locus_tag LOCUS_25620 11690 11160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 12131 11760 gene locus_tag LOCUS_25630 12131 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 13189 12182 gene locus_tag LOCUS_25640 13189 12182 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 protein_id gnl|my_center|LOCUS_25640 13291 13998 gene locus_tag LOCUS_25650 13291 13998 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_25650 14051 14977 gene locus_tag LOCUS_25660 gene fabD 14051 14977 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765648.1 protein_id gnl|my_center|LOCUS_25660 15123 15199 gene locus_tag LOCUS_t00270 15123 15199 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 15278 16675 gene locus_tag LOCUS_25670 gene der 15278 16675 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016201.1 protein_id gnl|my_center|LOCUS_25670 18134 16914 gene locus_tag LOCUS_25680 18134 16914 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 protein_id gnl|my_center|LOCUS_25680 19137 18733 gene locus_tag LOCUS_25690 19137 18733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 20127 19777 gene locus_tag LOCUS_25700 20127 19777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 20323 20111 gene locus_tag LOCUS_25710 20323 20111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 20934 20551 gene locus_tag LOCUS_25720 20934 20551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 21230 21634 gene locus_tag LOCUS_25730 21230 21634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 21628 21981 gene locus_tag LOCUS_25740 gene tnpB 21628 21981 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084591.1 protein_id gnl|my_center|LOCUS_25740 22050 23309 gene locus_tag LOCUS_25750 22050 23309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 25803 24460 gene locus_tag LOCUS_25760 25803 24460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence190 588 1343 gene locus_tag LOCUS_25770 588 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 2016 1393 gene locus_tag LOCUS_25780 2016 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 3665 3051 gene locus_tag LOCUS_25790 3665 3051 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766953.1 protein_id gnl|my_center|LOCUS_25790 4234 3752 gene locus_tag LOCUS_25800 4234 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 5848 5522 gene locus_tag LOCUS_25810 5848 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 5995 6387 gene locus_tag LOCUS_25820 5995 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 8411 8710 gene locus_tag LOCUS_25830 8411 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 8857 10005 gene locus_tag LOCUS_25840 8857 10005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 10021 11202 gene locus_tag LOCUS_25850 10021 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 11362 12084 gene locus_tag LOCUS_25860 11362 12084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 12084 12803 gene locus_tag LOCUS_25870 12084 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 12826 14016 gene locus_tag LOCUS_25880 12826 14016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 14013 15545 gene locus_tag LOCUS_25890 14013 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 15689 16351 gene locus_tag LOCUS_25900 15689 16351 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324116.1 protein_id gnl|my_center|LOCUS_25900 17655 16447 gene locus_tag LOCUS_25910 gene eboE 17655 16447 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_25910 17724 18767 gene locus_tag LOCUS_25920 17724 18767 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_25920 18917 21997 gene locus_tag LOCUS_25930 18917 21997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 21994 22620 gene locus_tag LOCUS_25940 21994 22620 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_25940 22690 23040 gene locus_tag LOCUS_25950 22690 23040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 23589 24257 gene locus_tag LOCUS_25960 23589 24257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 24364 24978 gene locus_tag LOCUS_25970 24364 24978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 25518 25727 gene locus_tag LOCUS_25980 25518 25727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence191 6647 177 gene locus_tag LOCUS_25990 6647 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 7814 8125 gene locus_tag LOCUS_26000 7814 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 8212 8703 gene locus_tag LOCUS_26010 8212 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 8882 9310 gene locus_tag LOCUS_26020 8882 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 9405 10178 gene locus_tag LOCUS_26030 9405 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 10640 10894 gene locus_tag LOCUS_26040 10640 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 13593 11200 gene locus_tag LOCUS_26050 13593 11200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 14358 13654 gene locus_tag LOCUS_26060 14358 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 15963 14410 gene locus_tag LOCUS_26070 15963 14410 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921865.1 protein_id gnl|my_center|LOCUS_26070 16499 15960 gene locus_tag LOCUS_26080 16499 15960 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_26080 16484 16705 gene locus_tag LOCUS_26090 16484 16705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 17976 16738 gene locus_tag LOCUS_26100 17976 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 18377 19492 gene locus_tag LOCUS_26110 18377 19492 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_26110 19496 20281 gene locus_tag LOCUS_26120 19496 20281 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_26120 20278 21288 gene locus_tag LOCUS_26130 20278 21288 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_26130 21285 21869 gene locus_tag LOCUS_26140 21285 21869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 21921 23039 gene locus_tag LOCUS_26150 gene ald 21921 23039 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926910.1 protein_id gnl|my_center|LOCUS_26150 24550 23138 gene locus_tag LOCUS_26160 gene mgtE 24550 23138 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933513.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence192 255 181 gene locus_tag LOCUS_t00280 255 181 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 382 1188 gene locus_tag LOCUS_26170 gene trpC 382 1188 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975565.1 protein_id gnl|my_center|LOCUS_26170 1963 1208 gene locus_tag LOCUS_26180 1963 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 2565 1963 gene locus_tag LOCUS_26190 2565 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 3851 2562 gene locus_tag LOCUS_26200 gene hisD 3851 2562 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968703.1 protein_id gnl|my_center|LOCUS_26200 4299 5165 gene locus_tag LOCUS_26210 4299 5165 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 protein_id gnl|my_center|LOCUS_26210 5178 6089 gene locus_tag LOCUS_26220 5178 6089 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090088.1 protein_id gnl|my_center|LOCUS_26220 6688 6080 gene locus_tag LOCUS_26230 6688 6080 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231280.1 protein_id gnl|my_center|LOCUS_26230 7413 6688 gene locus_tag LOCUS_26240 7413 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 8195 7410 gene locus_tag LOCUS_26250 8195 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 9630 8293 gene locus_tag LOCUS_26260 9630 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 9728 10642 gene locus_tag LOCUS_26270 9728 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 10746 12512 gene locus_tag LOCUS_26280 10746 12512 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_26280 12806 13741 gene locus_tag LOCUS_26290 12806 13741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 13793 14299 gene locus_tag LOCUS_26300 13793 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 17004 14317 gene locus_tag LOCUS_26310 17004 14317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 17086 17778 gene locus_tag LOCUS_26320 17086 17778 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530139.1 protein_id gnl|my_center|LOCUS_26320 17832 17905 gene locus_tag LOCUS_t00290 17832 17905 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18229 18017 gene locus_tag LOCUS_26330 18229 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 18622 18296 gene locus_tag LOCUS_26340 18622 18296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 19435 19064 gene locus_tag LOCUS_26350 19435 19064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 19973 19536 gene locus_tag LOCUS_26360 19973 19536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 21133 20255 gene locus_tag LOCUS_26370 21133 20255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 21609 21217 gene locus_tag LOCUS_26380 21609 21217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 23131 22685 gene locus_tag LOCUS_26390 23131 22685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 23741 23247 gene locus_tag LOCUS_26400 23741 23247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 24000 23773 gene locus_tag LOCUS_26410 24000 23773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence193 151 717 gene locus_tag LOCUS_26420 151 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 1027 2328 gene locus_tag LOCUS_26430 gene xseA 1027 2328 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_26430 2350 3141 gene locus_tag LOCUS_26440 2350 3141 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211996.1 protein_id gnl|my_center|LOCUS_26440 3246 3557 gene locus_tag LOCUS_26450 3246 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 3913 4623 gene locus_tag LOCUS_26460 3913 4623 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_26460 4674 8033 gene locus_tag LOCUS_26470 4674 8033 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_26470 8078 9574 gene locus_tag LOCUS_26480 gene nrfD 8078 9574 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_26480 9608 10162 gene locus_tag LOCUS_26490 9608 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26490 10201 10857 gene locus_tag LOCUS_26500 10201 10857 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_26500 10878 12188 gene locus_tag LOCUS_26510 10878 12188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922553.1 protein_id gnl|my_center|LOCUS_26510 12220 12975 gene locus_tag LOCUS_26520 12220 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 13005 14501 gene locus_tag LOCUS_26530 13005 14501 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_26530 14528 15229 gene locus_tag LOCUS_26540 14528 15229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 15264 16049 gene locus_tag LOCUS_26550 15264 16049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 16092 17993 gene locus_tag LOCUS_26560 16092 17993 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_26560 18050 19651 gene locus_tag LOCUS_26570 18050 19651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 19692 20105 gene locus_tag LOCUS_26580 19692 20105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 20129 20329 gene locus_tag LOCUS_26590 20129 20329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 20342 20557 gene locus_tag LOCUS_26600 20342 20557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 20578 21348 gene locus_tag LOCUS_26610 20578 21348 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136496851.1 protein_id gnl|my_center|LOCUS_26610 21384 21698 gene locus_tag LOCUS_26620 21384 21698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence194 1140 562 gene locus_tag LOCUS_26630 1140 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 1516 2268 gene locus_tag LOCUS_26640 1516 2268 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783491.1 protein_id gnl|my_center|LOCUS_26640 2364 2936 gene locus_tag LOCUS_26650 2364 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 2996 3688 gene locus_tag LOCUS_26660 2996 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 5169 3685 gene locus_tag LOCUS_26670 gene nuoN 5169 3685 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975095.1 protein_id gnl|my_center|LOCUS_26670 6656 5223 gene locus_tag LOCUS_26680 6656 5223 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_26680 8469 6682 gene locus_tag LOCUS_26690 gene nuoL 8469 6682 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_26690 8807 8490 gene locus_tag LOCUS_26700 gene nuoK 8807 8490 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100078.1 protein_id gnl|my_center|LOCUS_26700 9428 8865 gene locus_tag LOCUS_26710 9428 8865 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061937.1 protein_id gnl|my_center|LOCUS_26710 9853 9446 gene locus_tag LOCUS_26720 9853 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 10455 9889 gene locus_tag LOCUS_26730 10455 9889 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537600.1 protein_id gnl|my_center|LOCUS_26730 11741 10491 gene locus_tag LOCUS_26740 gene nuoH 11741 10491 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_26740 13523 11766 gene locus_tag LOCUS_26750 13523 11766 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_26750 15023 13674 gene locus_tag LOCUS_26760 gene ilvA 15023 13674 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269260.1 protein_id gnl|my_center|LOCUS_26760 14919 15326 gene locus_tag LOCUS_26770 14919 15326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 15967 15284 gene locus_tag LOCUS_26780 15967 15284 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945974.1 protein_id gnl|my_center|LOCUS_26780 16358 15951 gene locus_tag LOCUS_26790 16358 15951 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707491.1 protein_id gnl|my_center|LOCUS_26790 16413 17327 gene locus_tag LOCUS_26800 16413 17327 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939388.1 protein_id gnl|my_center|LOCUS_26800 17835 17344 gene locus_tag LOCUS_26810 17835 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 18838 18347 gene locus_tag LOCUS_26820 18838 18347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 19483 18872 gene locus_tag LOCUS_26830 19483 18872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 20714 20481 gene locus_tag LOCUS_26840 20714 20481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 21324 21145 gene locus_tag LOCUS_26850 21324 21145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 22084 21659 gene locus_tag LOCUS_26860 22084 21659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence195 405 1757 gene locus_tag LOCUS_26870 405 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2688 3488 gene locus_tag LOCUS_26880 2688 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 3491 4327 gene locus_tag LOCUS_26890 3491 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 4425 4739 gene locus_tag LOCUS_26900 4425 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 5623 4919 gene locus_tag LOCUS_26910 5623 4919 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 protein_id gnl|my_center|LOCUS_26910 5779 7668 gene locus_tag LOCUS_26920 5779 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 7729 7923 gene locus_tag LOCUS_26930 7729 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 7923 8645 gene locus_tag LOCUS_26940 7923 8645 CDS product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148341.1 protein_id gnl|my_center|LOCUS_26940 8858 8688 gene locus_tag LOCUS_26950 8858 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 8954 9568 gene locus_tag LOCUS_26960 8954 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 9565 10380 gene locus_tag LOCUS_26970 9565 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 10699 13134 gene locus_tag LOCUS_26980 10699 13134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 13433 14017 gene locus_tag LOCUS_26990 13433 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 14787 15203 gene locus_tag LOCUS_27000 14787 15203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 15266 15772 gene locus_tag LOCUS_27010 15266 15772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 15836 16483 gene locus_tag LOCUS_27020 15836 16483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 16681 16606 gene locus_tag LOCUS_t00300 16681 16606 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17460 16792 gene locus_tag LOCUS_27030 17460 16792 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389465.1 protein_id gnl|my_center|LOCUS_27030 18915 17647 gene locus_tag LOCUS_27040 18915 17647 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_27040 20102 18954 gene locus_tag LOCUS_27050 gene carA 20102 18954 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence196 3517 4242 gene locus_tag LOCUS_27060 3517 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 4246 4701 gene locus_tag LOCUS_27070 4246 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 4719 6161 gene locus_tag LOCUS_27080 4719 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 6508 6146 gene locus_tag LOCUS_27090 6508 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 8137 6557 gene locus_tag LOCUS_27100 8137 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021016.1 protein_id gnl|my_center|LOCUS_27100 9554 8127 gene locus_tag LOCUS_27110 9554 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 11530 9581 gene locus_tag LOCUS_27120 11530 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 11750 11589 gene locus_tag LOCUS_27130 11750 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 12322 11912 gene locus_tag LOCUS_27140 12322 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 13773 12916 gene locus_tag LOCUS_27150 13773 12916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 14384 13770 gene locus_tag LOCUS_27160 14384 13770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 15430 14381 gene locus_tag LOCUS_27170 15430 14381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 16246 15443 gene locus_tag LOCUS_27180 16246 15443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 16554 16243 gene locus_tag LOCUS_27190 16554 16243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 19264 16616 gene locus_tag LOCUS_27200 19264 16616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence197 694 338 gene locus_tag LOCUS_27210 694 338 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_27210 1680 742 gene locus_tag LOCUS_27220 1680 742 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118908.1 protein_id gnl|my_center|LOCUS_27220 2879 1704 gene locus_tag LOCUS_27230 gene glf 2879 1704 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639966.1 protein_id gnl|my_center|LOCUS_27230 3629 3081 gene locus_tag LOCUS_27240 gene nusG 3629 3081 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630512.1 protein_id gnl|my_center|LOCUS_27240 4132 3626 gene locus_tag LOCUS_27250 4132 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 4245 5180 gene locus_tag LOCUS_27260 4245 5180 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_27260 6011 11566 gene locus_tag LOCUS_27270 6011 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 11766 12587 gene locus_tag LOCUS_27280 11766 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 12619 18009 gene locus_tag LOCUS_27290 12619 18009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 18006 18434 gene locus_tag LOCUS_27300 18006 18434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 18860 19282 gene locus_tag LOCUS_27310 18860 19282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence198 354 267 gene locus_tag LOCUS_t00310 354 267 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 582 1178 gene locus_tag LOCUS_27320 582 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 1709 3796 gene locus_tag LOCUS_27330 1709 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 3908 10618 gene locus_tag LOCUS_27340 3908 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 10661 11374 gene locus_tag LOCUS_27350 10661 11374 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240575.1 protein_id gnl|my_center|LOCUS_27350 12093 11386 gene locus_tag LOCUS_27360 12093 11386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 12358 13350 gene locus_tag LOCUS_27370 12358 13350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 13343 14275 gene locus_tag LOCUS_27380 13343 14275 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943321.1 protein_id gnl|my_center|LOCUS_27380 14930 16279 gene locus_tag LOCUS_27390 14930 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 16276 18030 gene locus_tag LOCUS_27400 16276 18030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence199 1 342 gene locus_tag LOCUS_27410 1 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 1026 571 gene locus_tag LOCUS_27420 1026 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 2321 1047 gene locus_tag LOCUS_27430 2321 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 3185 2613 gene locus_tag LOCUS_27440 3185 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 3739 4713 gene locus_tag LOCUS_27450 3739 4713 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066627.1 protein_id gnl|my_center|LOCUS_27450 4710 5348 gene locus_tag LOCUS_27460 4710 5348 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086030.1 protein_id gnl|my_center|LOCUS_27460 5362 5754 gene locus_tag LOCUS_27470 5362 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 6084 5884 gene locus_tag LOCUS_27480 6084 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 6438 6085 gene locus_tag LOCUS_27490 6438 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 7092 6550 gene locus_tag LOCUS_27500 7092 6550 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 protein_id gnl|my_center|LOCUS_27500 7417 8226 gene locus_tag LOCUS_27510 7417 8226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 8289 9764 gene locus_tag LOCUS_27520 8289 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 10751 9786 gene locus_tag LOCUS_27530 10751 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 11257 11087 gene locus_tag LOCUS_27540 11257 11087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 11509 11345 gene locus_tag LOCUS_27550 11509 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27550 11753 12820 gene locus_tag LOCUS_27560 11753 12820 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 protein_id gnl|my_center|LOCUS_27560 13293 12958 gene locus_tag LOCUS_27570 13293 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 13400 14956 gene locus_tag LOCUS_27580 13400 14956 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224909.1 protein_id gnl|my_center|LOCUS_27580 14984 16426 gene locus_tag LOCUS_27590 gene hydA 14984 16426 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651148.1 protein_id gnl|my_center|LOCUS_27590 16430 17893 gene locus_tag LOCUS_27600 16430 17893 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_27600 17890 19224 gene locus_tag LOCUS_27610 17890 19224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 20341 19229 gene locus_tag LOCUS_27620 20341 19229 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704809.1 protein_id gnl|my_center|LOCUS_27620 21465 20338 gene locus_tag LOCUS_27630 21465 20338 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070131.1 protein_id gnl|my_center|LOCUS_27630 23183 21465 gene locus_tag LOCUS_27640 23183 21465 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168099.1 protein_id gnl|my_center|LOCUS_27640 24169 23183 gene locus_tag LOCUS_27650 gene hlyD 24169 23183 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158910.1 protein_id gnl|my_center|LOCUS_27650 24861 24166 gene locus_tag LOCUS_27660 gene cecR 24861 24166 CDS product transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168102.1 protein_id gnl|my_center|LOCUS_27660 26141 24951 gene locus_tag LOCUS_27670 gene mrdB 26141 24951 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131719.1 protein_id gnl|my_center|LOCUS_27670 26294 27325 gene locus_tag LOCUS_27680 gene ruvB 26294 27325 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220958.1 protein_id gnl|my_center|LOCUS_27680 27406 27831 gene locus_tag LOCUS_27690 27406 27831 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_27690 27856 28419 gene locus_tag LOCUS_27700 27856 28419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 30534 28456 gene locus_tag LOCUS_27710 30534 28456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 30834 31514 gene locus_tag LOCUS_27720 30834 31514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 31964 31593 gene locus_tag LOCUS_27730 31964 31593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 32127 32660 gene locus_tag LOCUS_27740 32127 32660 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_27740 32657 34198 gene locus_tag LOCUS_27750 32657 34198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 34315 35082 gene locus_tag LOCUS_27760 34315 35082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 35125 37569 gene locus_tag LOCUS_27770 35125 37569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 37875 40625 gene locus_tag LOCUS_27780 37875 40625 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_27780 40736 43849 gene locus_tag LOCUS_27790 40736 43849 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942010.1 protein_id gnl|my_center|LOCUS_27790 44148 44738 gene locus_tag LOCUS_27800 44148 44738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143443.1 protein_id gnl|my_center|LOCUS_27800 44744 44947 gene locus_tag LOCUS_27810 44744 44947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 45132 47969 gene locus_tag LOCUS_27820 gene acnA 45132 47969 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_27820 47976 49004 gene locus_tag LOCUS_27830 47976 49004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 49704 50681 gene locus_tag LOCUS_27840 49704 50681 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840510.1 protein_id gnl|my_center|LOCUS_27840 51316 50693 gene locus_tag LOCUS_27850 51316 50693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 51788 51408 gene locus_tag LOCUS_27860 51788 51408 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080623.1 protein_id gnl|my_center|LOCUS_27860 52755 51817 gene locus_tag LOCUS_27870 52755 51817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 54745 52757 gene locus_tag LOCUS_27880 54745 52757 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071109.1 protein_id gnl|my_center|LOCUS_27880 55531 54761 gene locus_tag LOCUS_27890 55531 54761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 56613 57800 gene locus_tag LOCUS_27900 gene zigA 56613 57800 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_27900 59026 57944 gene locus_tag LOCUS_27910 59026 57944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 60059 60748 gene locus_tag LOCUS_27920 60059 60748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 61274 60756 gene locus_tag LOCUS_27930 61274 60756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 61558 61346 gene locus_tag LOCUS_27940 61558 61346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 63993 61612 gene locus_tag LOCUS_27950 gene pheT 63993 61612 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016058.1 protein_id gnl|my_center|LOCUS_27950 65112 64096 gene locus_tag LOCUS_27960 gene pheS 65112 64096 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_27960 66007 65186 gene locus_tag LOCUS_27970 66007 65186 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040207.1 protein_id gnl|my_center|LOCUS_27970 66142 66372 gene locus_tag LOCUS_27980 66142 66372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 66424 69849 gene locus_tag LOCUS_27990 66424 69849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 71906 69852 gene locus_tag LOCUS_28000 71906 69852 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_28000 72255 74321 gene locus_tag LOCUS_28010 72255 74321 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776819.1 protein_id gnl|my_center|LOCUS_28010 74878 74318 gene locus_tag LOCUS_28020 74878 74318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 75179 75769 gene locus_tag LOCUS_28030 75179 75769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 75750 75953 gene locus_tag LOCUS_28040 75750 75953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 76146 77309 gene locus_tag LOCUS_28050 76146 77309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 77338 78351 gene locus_tag LOCUS_28060 77338 78351 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918175.1 protein_id gnl|my_center|LOCUS_28060 78367 79131 gene locus_tag LOCUS_28070 78367 79131 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329973.1 protein_id gnl|my_center|LOCUS_28070 79137 79955 gene locus_tag LOCUS_28080 gene cysT 79137 79955 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_28080 80023 80808 gene locus_tag LOCUS_28090 gene cysW 80023 80808 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_28090 80813 81805 gene locus_tag LOCUS_28100 80813 81805 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942002.1 protein_id gnl|my_center|LOCUS_28100 82286 84448 gene locus_tag LOCUS_28110 82286 84448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 84476 85615 gene locus_tag LOCUS_28120 84476 85615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 86143 85664 gene locus_tag LOCUS_28130 86143 85664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 87240 86230 gene locus_tag LOCUS_28140 87240 86230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 87705 87247 gene locus_tag LOCUS_28150 87705 87247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 87843 88697 gene locus_tag LOCUS_28160 gene pdxA 87843 88697 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969073.1 protein_id gnl|my_center|LOCUS_28160 89703 88726 gene locus_tag LOCUS_28170 89703 88726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 90597 89728 gene locus_tag LOCUS_28180 gene cysE 90597 89728 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094922.1 protein_id gnl|my_center|LOCUS_28180 90596 91009 gene locus_tag LOCUS_28190 90596 91009 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943207.1 protein_id gnl|my_center|LOCUS_28190 91068 94253 gene locus_tag LOCUS_28200 91068 94253 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_28200 94332 94964 gene locus_tag LOCUS_28210 94332 94964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 94978 95298 gene locus_tag LOCUS_28220 94978 95298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 95384 96274 gene locus_tag LOCUS_28230 95384 96274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 96866 96303 gene locus_tag LOCUS_28240 96866 96303 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551114.1 protein_id gnl|my_center|LOCUS_28240 97469 96879 gene locus_tag LOCUS_28250 97469 96879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 97623 98522 gene locus_tag LOCUS_28260 97623 98522 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_28260 98807 98526 gene locus_tag LOCUS_28270 98807 98526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 99784 98813 gene locus_tag LOCUS_28280 99784 98813 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_28280 99881 101509 gene locus_tag LOCUS_28290 99881 101509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 101512 102351 gene locus_tag LOCUS_28300 101512 102351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 102929 102450 gene locus_tag LOCUS_28310 102929 102450 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314430.1 protein_id gnl|my_center|LOCUS_28310 105149 103002 gene locus_tag LOCUS_28320 105149 103002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 107476 105191 gene locus_tag LOCUS_28330 107476 105191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 107654 108298 gene locus_tag LOCUS_28340 107654 108298 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122034.1 protein_id gnl|my_center|LOCUS_28340 109026 108304 gene locus_tag LOCUS_28350 109026 108304 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941357.1 protein_id gnl|my_center|LOCUS_28350 109631 109023 gene locus_tag LOCUS_28360 gene nudK 109631 109023 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 protein_id gnl|my_center|LOCUS_28360 111351 109660 gene locus_tag LOCUS_28370 111351 109660 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087605.1 protein_id gnl|my_center|LOCUS_28370 112822 111395 gene locus_tag LOCUS_28380 112822 111395 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_28380 112889 114484 gene locus_tag LOCUS_28390 gene serA 112889 114484 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_28390 114556 114987 gene locus_tag LOCUS_28400 114556 114987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 117028 115127 gene locus_tag LOCUS_28410 117028 115127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 117204 117278 gene locus_tag LOCUS_t00320 117204 117278 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 118592 117327 gene locus_tag LOCUS_28420 118592 117327 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_28420 119321 118602 gene locus_tag LOCUS_28430 119321 118602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_28430 120867 119314 gene locus_tag LOCUS_28440 120867 119314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 122645 120864 gene locus_tag LOCUS_28450 122645 120864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 122916 123284 gene locus_tag LOCUS_28460 122916 123284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 124402 123395 gene locus_tag LOCUS_28470 124402 123395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 124490 124948 gene locus_tag LOCUS_28480 gene hisI 124490 124948 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088269.1 protein_id gnl|my_center|LOCUS_28480 125034 125429 gene locus_tag LOCUS_28490 gene rplS 125034 125429 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_28490 125681 125836 gene locus_tag LOCUS_28500 125681 125836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 125917 126687 gene locus_tag LOCUS_28510 125917 126687 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227785.1 protein_id gnl|my_center|LOCUS_28510 126897 126724 gene locus_tag LOCUS_28520 126897 126724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 127360 127088 gene locus_tag LOCUS_28530 127360 127088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 127504 128787 gene locus_tag LOCUS_28540 127504 128787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 129137 128874 gene locus_tag LOCUS_28550 gene rpmB 129137 128874 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556947.1 protein_id gnl|my_center|LOCUS_28550 130215 129229 gene locus_tag LOCUS_28560 130215 129229 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908986.1 protein_id gnl|my_center|LOCUS_28560 130357 136101 gene locus_tag LOCUS_28570 130357 136101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 136345 138924 gene locus_tag LOCUS_28580 136345 138924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 139040 142297 gene locus_tag LOCUS_28590 139040 142297 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_28590 142303 143832 gene locus_tag LOCUS_28600 142303 143832 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_28600 143863 144747 gene locus_tag LOCUS_28610 143863 144747 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332819.1 protein_id gnl|my_center|LOCUS_28610 144895 145284 gene locus_tag LOCUS_28620 144895 145284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 145552 146760 gene locus_tag LOCUS_28630 145552 146760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 146760 147893 gene locus_tag LOCUS_28640 gene trpD 146760 147893 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723937.1 protein_id gnl|my_center|LOCUS_28640 147910 150567 gene locus_tag LOCUS_28650 147910 150567 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_28650 150660 151841 gene locus_tag LOCUS_28660 gene sucC 150660 151841 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083287.1 protein_id gnl|my_center|LOCUS_28660 151878 152774 gene locus_tag LOCUS_28670 gene sucD 151878 152774 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110253.1 protein_id gnl|my_center|LOCUS_28670 152841 153827 gene locus_tag LOCUS_28680 152841 153827 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891769.1 protein_id gnl|my_center|LOCUS_28680 154964 153828 gene locus_tag LOCUS_28690 154964 153828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 155118 156194 gene locus_tag LOCUS_28700 155118 156194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 156900 157175 gene locus_tag LOCUS_28710 156900 157175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 157278 158285 gene locus_tag LOCUS_28720 157278 158285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 158416 158973 gene locus_tag LOCUS_28730 gene def 158416 158973 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940621.1 protein_id gnl|my_center|LOCUS_28730 159483 159959 gene locus_tag LOCUS_28740 159483 159959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 159990 163643 gene locus_tag LOCUS_28750 159990 163643 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 protein_id gnl|my_center|LOCUS_28750 167194 163727 gene locus_tag LOCUS_28760 167194 163727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 168348 167638 gene locus_tag LOCUS_28770 168348 167638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 171863 168345 gene locus_tag LOCUS_28780 171863 168345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 176804 172653 gene locus_tag LOCUS_28790 gene rpoC 176804 172653 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871661.1 protein_id gnl|my_center|LOCUS_28790 180794 176847 gene locus_tag LOCUS_28800 gene rpoB 180794 176847 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012263639.1 protein_id gnl|my_center|LOCUS_28800 181371 180997 gene locus_tag LOCUS_28810 gene rplL 181371 180997 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931848.1 protein_id gnl|my_center|LOCUS_28810 182021 181506 gene locus_tag LOCUS_28820 gene rplJ 182021 181506 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112001.1 protein_id gnl|my_center|LOCUS_28820 182747 182040 gene locus_tag LOCUS_28830 gene rplA 182747 182040 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811658.1 protein_id gnl|my_center|LOCUS_28830 183268 182840 gene locus_tag LOCUS_28840 gene rplK 183268 182840 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085792.1 protein_id gnl|my_center|LOCUS_28840 183892 183323 gene locus_tag LOCUS_28850 gene nusG 183892 183323 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_28850 184158 183931 gene locus_tag LOCUS_28860 184158 183931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 184262 184187 gene locus_tag LOCUS_t00330 184262 184187 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 185540 184356 gene locus_tag LOCUS_28870 gene tuf 185540 184356 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919120.1 protein_id gnl|my_center|LOCUS_28870 185667 185593 gene locus_tag LOCUS_t00340 185667 185593 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 185876 185658 gene locus_tag LOCUS_28880 185876 185658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 186685 185873 gene locus_tag LOCUS_28890 186685 185873 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_28890 186758 188068 gene locus_tag LOCUS_28900 186758 188068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 188065 188733 gene locus_tag LOCUS_28910 188065 188733 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328012.1 protein_id gnl|my_center|LOCUS_28910 189429 188800 gene locus_tag LOCUS_28920 189429 188800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 190527 189586 gene locus_tag LOCUS_28930 190527 189586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 191247 190660 gene locus_tag LOCUS_28940 191247 190660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 191765 191295 gene locus_tag LOCUS_28950 191765 191295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 193520 191784 gene locus_tag LOCUS_28960 193520 191784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 194107 193712 gene locus_tag LOCUS_28970 194107 193712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 194294 195301 gene locus_tag LOCUS_28980 194294 195301 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_28980 195360 196079 gene locus_tag LOCUS_28990 195360 196079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 196091 197008 gene locus_tag LOCUS_29000 gene ribF 196091 197008 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_29000 197238 199709 gene locus_tag LOCUS_29010 197238 199709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 199769 201346 gene locus_tag LOCUS_29020 199769 201346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 201515 202105 gene locus_tag LOCUS_29030 gene raiA 201515 202105 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_29030 202854 202171 gene locus_tag LOCUS_29040 202854 202171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 204748 203039 gene locus_tag LOCUS_29050 gene rpsA 204748 203039 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872374.1 protein_id gnl|my_center|LOCUS_29050 204967 206130 gene locus_tag LOCUS_29060 204967 206130 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_29060 206164 206784 gene locus_tag LOCUS_29070 206164 206784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 208890 206827 gene locus_tag LOCUS_29080 gene recG 208890 206827 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545417.1 protein_id gnl|my_center|LOCUS_29080 209192 208887 gene locus_tag LOCUS_29090 209192 208887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 209929 209213 gene locus_tag LOCUS_29100 209929 209213 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_29100 212067 209926 gene locus_tag LOCUS_29110 212067 209926 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_29110 213146 212580 gene locus_tag LOCUS_29120 213146 212580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 215221 213164 gene locus_tag LOCUS_29130 215221 213164 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_29130 216671 215451 gene locus_tag LOCUS_29140 216671 215451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 217305 216721 gene locus_tag LOCUS_29150 217305 216721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 217412 217339 gene locus_tag LOCUS_t00350 217412 217339 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 218199 217618 gene locus_tag LOCUS_29160 218199 217618 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972952.1 protein_id gnl|my_center|LOCUS_29160 218949 218200 gene locus_tag LOCUS_29170 218949 218200 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250523.1 protein_id gnl|my_center|LOCUS_29170 219756 218959 gene locus_tag LOCUS_29180 219756 218959 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017868968.1 protein_id gnl|my_center|LOCUS_29180 220927 220043 gene locus_tag LOCUS_29190 gene hisG 220927 220043 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_29190 221049 221906 gene locus_tag LOCUS_29200 221049 221906 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_29200 226027 221909 gene locus_tag LOCUS_29210 226027 221909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 226131 227546 gene locus_tag LOCUS_29220 226131 227546 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 protein_id gnl|my_center|LOCUS_29220 227691 229454 gene locus_tag LOCUS_29230 227691 229454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 229451 230215 gene locus_tag LOCUS_29240 229451 230215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 230360 231175 gene locus_tag LOCUS_29250 230360 231175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 231192 232202 gene locus_tag LOCUS_29260 231192 232202 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_29260 232207 233097 gene locus_tag LOCUS_29270 232207 233097 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_29270 233094 235019 gene locus_tag LOCUS_29280 233094 235019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 >Feature sequence200 954 1358 gene locus_tag LOCUS_29290 954 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1898 2242 gene locus_tag LOCUS_29300 1898 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 3252 3566 gene locus_tag LOCUS_29310 3252 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 4292 4699 gene locus_tag LOCUS_29320 4292 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 5884 6372 gene locus_tag LOCUS_29330 5884 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 6674 6901 gene locus_tag LOCUS_29340 6674 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 6844 7062 gene locus_tag LOCUS_29350 6844 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 7173 7655 gene locus_tag LOCUS_29360 7173 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 7719 8309 gene locus_tag LOCUS_29370 7719 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 9590 10066 gene locus_tag LOCUS_29380 9590 10066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 11139 10222 gene locus_tag LOCUS_29390 11139 10222 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021671.1 protein_id gnl|my_center|LOCUS_29390 11807 11136 gene locus_tag LOCUS_29400 11807 11136 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593392.1 protein_id gnl|my_center|LOCUS_29400 12527 11913 gene locus_tag LOCUS_29410 12527 11913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 15120 14473 gene locus_tag LOCUS_29420 15120 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 15447 15989 gene locus_tag LOCUS_29430 15447 15989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 15986 16642 gene locus_tag LOCUS_29440 15986 16642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence201 620 405 gene locus_tag LOCUS_29450 620 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 1883 846 gene locus_tag LOCUS_29460 1883 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 3056 2277 gene locus_tag LOCUS_29470 3056 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 4074 4664 gene locus_tag LOCUS_29480 4074 4664 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_29480 4710 5669 gene locus_tag LOCUS_29490 4710 5669 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_29490 7292 5673 gene locus_tag LOCUS_29500 7292 5673 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_29500 8066 7311 gene locus_tag LOCUS_29510 gene kdsB 8066 7311 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_29510 8355 9608 gene locus_tag LOCUS_29520 gene purD 8355 9608 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404599.1 protein_id gnl|my_center|LOCUS_29520 9628 10161 gene locus_tag LOCUS_29530 gene pyrR 9628 10161 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295862.1 protein_id gnl|my_center|LOCUS_29530 10158 10781 gene locus_tag LOCUS_29540 10158 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 10771 11688 gene locus_tag LOCUS_29550 10771 11688 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_29550 13028 11706 gene locus_tag LOCUS_29560 13028 11706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 13195 14475 gene locus_tag LOCUS_29570 13195 14475 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460659.1 protein_id gnl|my_center|LOCUS_29570 14945 14472 gene locus_tag LOCUS_29580 14945 14472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 15218 15922 gene locus_tag LOCUS_29590 15218 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence202 202 126 gene locus_tag LOCUS_t00360 202 126 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 341 1261 gene locus_tag LOCUS_29600 341 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 1251 2189 gene locus_tag LOCUS_29610 1251 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 2518 4506 gene locus_tag LOCUS_29620 gene thiC 2518 4506 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193963.1 protein_id gnl|my_center|LOCUS_29620 4772 5161 gene locus_tag LOCUS_29630 4772 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 5252 5905 gene locus_tag LOCUS_29640 5252 5905 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989716.1 protein_id gnl|my_center|LOCUS_29640 6314 5937 gene locus_tag LOCUS_29650 6314 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 7084 6317 gene locus_tag LOCUS_29660 7084 6317 CDS product TIGR02587 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142149.1 protein_id gnl|my_center|LOCUS_29660 7325 8470 gene locus_tag LOCUS_29670 7325 8470 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_29670 9583 8486 gene locus_tag LOCUS_29680 9583 8486 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878480.1 protein_id gnl|my_center|LOCUS_29680 10115 9696 gene locus_tag LOCUS_29690 10115 9696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 10228 10935 gene locus_tag LOCUS_29700 10228 10935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 10999 12300 gene locus_tag LOCUS_29710 10999 12300 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_29710 13226 12309 gene locus_tag LOCUS_29720 13226 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 14101 13238 gene locus_tag LOCUS_29730 14101 13238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 14554 14225 gene locus_tag LOCUS_29740 14554 14225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 >Feature sequence203 145 957 gene locus_tag LOCUS_29750 145 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 1367 978 gene locus_tag LOCUS_29760 1367 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 1645 2514 gene locus_tag LOCUS_29770 gene ilvE 1645 2514 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_29770 2917 3096 gene locus_tag LOCUS_29780 2917 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 3133 4260 gene locus_tag LOCUS_29790 3133 4260 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_29790 4257 6794 gene locus_tag LOCUS_29800 4257 6794 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_29800 8258 8461 gene locus_tag LOCUS_29810 8258 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 11071 10742 gene locus_tag LOCUS_29820 11071 10742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 11700 11134 gene locus_tag LOCUS_29830 11700 11134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 13009 12311 gene locus_tag LOCUS_29840 13009 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 13668 13192 gene locus_tag LOCUS_29850 13668 13192 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119659.1 protein_id gnl|my_center|LOCUS_29850 14367 13810 gene locus_tag LOCUS_29860 14367 13810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 15009 14449 gene locus_tag LOCUS_29870 15009 14449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 >Feature sequence204 1108 2355 gene locus_tag LOCUS_29880 1108 2355 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 protein_id gnl|my_center|LOCUS_29880 2352 4727 gene locus_tag LOCUS_29890 2352 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 4739 5125 gene locus_tag LOCUS_29900 4739 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 5227 5727 gene locus_tag LOCUS_29910 5227 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 5765 7144 gene locus_tag LOCUS_29920 gene miaB 5765 7144 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_29920 7137 7598 gene locus_tag LOCUS_29930 7137 7598 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145171248.1 protein_id gnl|my_center|LOCUS_29930 7691 9142 gene locus_tag LOCUS_29940 7691 9142 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_29940 9604 11247 gene locus_tag LOCUS_29950 9604 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 11471 11917 gene locus_tag LOCUS_29960 11471 11917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 11924 13687 gene locus_tag LOCUS_29970 11924 13687 CDS product ClcB-like voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192418.1 protein_id gnl|my_center|LOCUS_29970 14100 13915 gene locus_tag LOCUS_29980 14100 13915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 >Feature sequence205 398 772 gene locus_tag LOCUS_29990 398 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29990 872 1015 gene locus_tag LOCUS_30000 872 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 1338 1559 gene locus_tag LOCUS_30010 1338 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 1636 2010 gene locus_tag LOCUS_30020 1636 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 2220 2492 gene locus_tag LOCUS_30030 2220 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 2726 2550 gene locus_tag LOCUS_30040 2726 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 3108 3476 gene locus_tag LOCUS_30050 3108 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146462549.1 protein_id gnl|my_center|LOCUS_30050 3840 4217 gene locus_tag LOCUS_30060 3840 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 4785 5285 gene locus_tag LOCUS_30070 4785 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 5365 5835 gene locus_tag LOCUS_30080 5365 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 5938 6231 gene locus_tag LOCUS_30090 5938 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 7260 7802 gene locus_tag LOCUS_30100 7260 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 8290 8703 gene locus_tag LOCUS_30110 8290 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 9140 9586 gene locus_tag LOCUS_30120 9140 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 9648 10058 gene locus_tag LOCUS_30130 9648 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence206 231 656 gene locus_tag LOCUS_30140 231 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 800 1378 gene locus_tag LOCUS_30150 800 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 2008 2379 gene locus_tag LOCUS_30160 2008 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 2886 3284 gene locus_tag LOCUS_30170 2886 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 3338 3910 gene locus_tag LOCUS_30180 3338 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 4089 4814 gene locus_tag LOCUS_30190 4089 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 4846 5367 gene locus_tag LOCUS_30200 4846 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 6213 5512 gene locus_tag LOCUS_30210 6213 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 7826 6243 gene locus_tag LOCUS_30220 7826 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 8483 8950 gene locus_tag LOCUS_30230 8483 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 8993 9718 gene locus_tag LOCUS_30240 8993 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 >Feature sequence207 59 1453 gene locus_tag LOCUS_30250 gene nuoF 59 1453 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969255.1 protein_id gnl|my_center|LOCUS_30250 1450 1923 gene locus_tag LOCUS_30260 1450 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 1920 2354 gene locus_tag LOCUS_30270 1920 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 2412 3188 gene locus_tag LOCUS_30280 gene pyrF 2412 3188 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931823.1 protein_id gnl|my_center|LOCUS_30280 3211 4146 gene locus_tag LOCUS_30290 3211 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 4190 4822 gene locus_tag LOCUS_30300 gene msrA 4190 4822 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434146.1 protein_id gnl|my_center|LOCUS_30300 4901 5875 gene locus_tag LOCUS_30310 4901 5875 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_30310 6317 5880 gene locus_tag LOCUS_30320 6317 5880 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393272.1 protein_id gnl|my_center|LOCUS_30320 6408 7475 gene locus_tag LOCUS_30330 6408 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 7476 8378 gene locus_tag LOCUS_30340 7476 8378 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931779.1 protein_id gnl|my_center|LOCUS_30340 8677 8360 gene locus_tag LOCUS_30350 8677 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 9405 9481 gene locus_tag LOCUS_t00370 9405 9481 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence208 495 181 gene locus_tag LOCUS_30360 495 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 1962 1219 gene locus_tag LOCUS_30370 1962 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 2862 2407 gene locus_tag LOCUS_30380 2862 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 2791 2982 gene locus_tag LOCUS_30390 2791 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 2979 3464 gene locus_tag LOCUS_30400 2979 3464 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022592.1 protein_id gnl|my_center|LOCUS_30400 3602 4582 gene locus_tag LOCUS_30410 3602 4582 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919490.1 protein_id gnl|my_center|LOCUS_30410 5748 4603 gene locus_tag LOCUS_30420 5748 4603 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037252469.1 protein_id gnl|my_center|LOCUS_30420 6410 5745 gene locus_tag LOCUS_30430 6410 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 7347 6418 gene locus_tag LOCUS_30440 7347 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 8570 7419 gene locus_tag LOCUS_30450 8570 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117732.1 protein_id gnl|my_center|LOCUS_30450 >Feature sequence209 392 66 gene locus_tag LOCUS_30460 392 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 799 1251 gene locus_tag LOCUS_30470 799 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 1937 2923 gene locus_tag LOCUS_30480 1937 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 3825 3139 gene locus_tag LOCUS_30490 3825 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 4265 4053 gene locus_tag LOCUS_30500 4265 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 4865 4269 gene locus_tag LOCUS_30510 4865 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 5452 4976 gene locus_tag LOCUS_30520 5452 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 6938 5502 gene locus_tag LOCUS_30530 6938 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 7519 6935 gene locus_tag LOCUS_30540 7519 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence210 228 154 gene locus_tag LOCUS_t00380 228 154 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 427 2403 gene locus_tag LOCUS_30550 gene tkt 427 2403 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_30550 4490 2466 gene locus_tag LOCUS_30560 4490 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 5970 4561 gene locus_tag LOCUS_30570 5970 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 6920 5985 gene locus_tag LOCUS_30580 6920 5985 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 protein_id gnl|my_center|LOCUS_30580 7955 6930 gene locus_tag LOCUS_30590 7955 6930 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243962.1 protein_id gnl|my_center|LOCUS_30590 8287 9144 gene locus_tag LOCUS_30600 8287 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 9271 10227 gene locus_tag LOCUS_30610 9271 10227 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969887.1 protein_id gnl|my_center|LOCUS_30610 10718 10212 gene locus_tag LOCUS_30620 gene folK 10718 10212 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209351.1 protein_id gnl|my_center|LOCUS_30620 12152 10719 gene locus_tag LOCUS_30630 12152 10719 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_30630 12288 12587 gene locus_tag LOCUS_30640 12288 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 12909 12592 gene locus_tag LOCUS_30650 12909 12592 CDS product sulfite:cytochrome C oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172935.1 protein_id gnl|my_center|LOCUS_30650 14142 12913 gene locus_tag LOCUS_30660 14142 12913 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965461.1 protein_id gnl|my_center|LOCUS_30660 14428 14156 gene locus_tag LOCUS_30670 14428 14156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 15390 14425 gene locus_tag LOCUS_30680 15390 14425 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140077.1 protein_id gnl|my_center|LOCUS_30680 15480 17726 gene locus_tag LOCUS_30690 15480 17726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 18512 17748 gene locus_tag LOCUS_30700 gene rhaR 18512 17748 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_30700 18841 19527 gene locus_tag LOCUS_30710 18841 19527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 19570 20346 gene locus_tag LOCUS_30720 19570 20346 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081684.1 protein_id gnl|my_center|LOCUS_30720 20386 21882 gene locus_tag LOCUS_30730 gene glpK 20386 21882 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_30730 21879 23444 gene locus_tag LOCUS_30740 21879 23444 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_30740 24208 23441 gene locus_tag LOCUS_30750 24208 23441 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_30750 24620 24345 gene locus_tag LOCUS_30760 24620 24345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 26259 24628 gene locus_tag LOCUS_30770 gene fumA 26259 24628 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209418.1 protein_id gnl|my_center|LOCUS_30770 26389 28008 gene locus_tag LOCUS_30780 26389 28008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 28932 28027 gene locus_tag LOCUS_30790 28932 28027 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071271.1 protein_id gnl|my_center|LOCUS_30790 29111 29599 gene locus_tag LOCUS_30800 29111 29599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 30893 29700 gene locus_tag LOCUS_30810 30893 29700 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706445.1 protein_id gnl|my_center|LOCUS_30810 31052 31639 gene locus_tag LOCUS_30820 31052 31639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 34458 32089 gene locus_tag LOCUS_30830 34458 32089 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967072.1 protein_id gnl|my_center|LOCUS_30830 35128 34544 gene locus_tag LOCUS_30840 35128 34544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 35649 35125 gene locus_tag LOCUS_30850 35649 35125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 36470 35646 gene locus_tag LOCUS_30860 36470 35646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 38434 36467 gene locus_tag LOCUS_30870 38434 36467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 39459 38473 gene locus_tag LOCUS_30880 39459 38473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 39693 40292 gene locus_tag LOCUS_30890 39693 40292 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_30890 40312 42234 gene locus_tag LOCUS_30900 40312 42234 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_30900 42262 43149 gene locus_tag LOCUS_30910 42262 43149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 43212 43844 gene locus_tag LOCUS_30920 43212 43844 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583365.1 protein_id gnl|my_center|LOCUS_30920 43859 44779 gene locus_tag LOCUS_30930 gene fmt 43859 44779 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_30930 45931 44768 gene locus_tag LOCUS_30940 45931 44768 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257518.1 protein_id gnl|my_center|LOCUS_30940 47190 46003 gene locus_tag LOCUS_30950 gene nspC 47190 46003 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943174.1 protein_id gnl|my_center|LOCUS_30950 48651 47251 gene locus_tag LOCUS_30960 gene rpoN 48651 47251 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_30960 48941 49909 gene locus_tag LOCUS_30970 48941 49909 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173331.1 protein_id gnl|my_center|LOCUS_30970 49948 50721 gene locus_tag LOCUS_30980 49948 50721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 50725 51390 gene locus_tag LOCUS_30990 50725 51390 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 protein_id gnl|my_center|LOCUS_30990 51397 51819 gene locus_tag LOCUS_31000 51397 51819 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812950.1 protein_id gnl|my_center|LOCUS_31000 51816 52256 gene locus_tag LOCUS_31010 51816 52256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 53586 52291 gene locus_tag LOCUS_31020 53586 52291 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_31020 53921 53583 gene locus_tag LOCUS_31030 53921 53583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 57758 54060 gene locus_tag LOCUS_31040 57758 54060 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_31040 61833 57865 gene locus_tag LOCUS_31050 61833 57865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 62486 61845 gene locus_tag LOCUS_31060 62486 61845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 65222 62499 gene locus_tag LOCUS_31070 65222 62499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 67358 65247 gene locus_tag LOCUS_31080 67358 65247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404150.1 protein_id gnl|my_center|LOCUS_31080 69406 67466 gene locus_tag LOCUS_31090 69406 67466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 70284 69403 gene locus_tag LOCUS_31100 70284 69403 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_31100 71264 70284 gene locus_tag LOCUS_31110 71264 70284 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_31110 74148 71296 gene locus_tag LOCUS_31120 74148 71296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 75431 74238 gene locus_tag LOCUS_31130 75431 74238 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479718.1 protein_id gnl|my_center|LOCUS_31130 76477 75566 gene locus_tag LOCUS_31140 76477 75566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 77362 76487 gene locus_tag LOCUS_31150 77362 76487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 77875 77501 gene locus_tag LOCUS_31160 77875 77501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 78027 79433 gene locus_tag LOCUS_31170 78027 79433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 80492 79557 gene locus_tag LOCUS_31180 gene nadA 80492 79557 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_31180 81047 80523 gene locus_tag LOCUS_31190 81047 80523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 81950 81378 gene locus_tag LOCUS_31200 81950 81378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 82889 81999 gene locus_tag LOCUS_31210 82889 81999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 82995 84152 gene locus_tag LOCUS_31220 gene lpxB 82995 84152 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_31220 84272 84451 gene locus_tag LOCUS_31230 84272 84451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 84940 84458 gene locus_tag LOCUS_31240 84940 84458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 85224 87059 gene locus_tag LOCUS_31250 85224 87059 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720836.1 protein_id gnl|my_center|LOCUS_31250 87136 88293 gene locus_tag LOCUS_31260 87136 88293 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966180.1 protein_id gnl|my_center|LOCUS_31260 88290 88898 gene locus_tag LOCUS_31270 88290 88898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 89019 89714 gene locus_tag LOCUS_31280 89019 89714 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912209.1 protein_id gnl|my_center|LOCUS_31280 90157 89870 gene locus_tag LOCUS_31290 90157 89870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 90723 91466 gene locus_tag LOCUS_31300 90723 91466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 91475 92014 gene locus_tag LOCUS_31310 91475 92014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 92260 92487 gene locus_tag LOCUS_31320 92260 92487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 92584 93039 gene locus_tag LOCUS_31330 92584 93039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 97539 93736 gene locus_tag LOCUS_31340 97539 93736 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108747.1 protein_id gnl|my_center|LOCUS_31340 97695 98552 gene locus_tag LOCUS_31350 97695 98552 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_31350 100415 98565 gene locus_tag LOCUS_31360 100415 98565 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119431.1 protein_id gnl|my_center|LOCUS_31360 104947 100457 gene locus_tag LOCUS_31370 104947 100457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 105371 105793 gene locus_tag LOCUS_31380 105371 105793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 105798 106109 gene locus_tag LOCUS_31390 105798 106109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 109298 106155 gene locus_tag LOCUS_31400 gene acrB 109298 106155 CDS product multidrug efflux RND transporter permease subunit AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704610.1 protein_id gnl|my_center|LOCUS_31400 110571 109363 gene locus_tag LOCUS_31410 110571 109363 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_31410 111131 110808 gene locus_tag LOCUS_31420 111131 110808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 112497 111409 gene locus_tag LOCUS_31430 112497 111409 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084062.1 protein_id gnl|my_center|LOCUS_31430 112543 115770 gene locus_tag LOCUS_31440 gene mfd 112543 115770 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 protein_id gnl|my_center|LOCUS_31440 115784 116788 gene locus_tag LOCUS_31450 115784 116788 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_31450 117279 116818 gene locus_tag LOCUS_31460 117279 116818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 117416 118318 gene locus_tag LOCUS_31470 gene hpaA 117416 118318 CDS product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113010.1 protein_id gnl|my_center|LOCUS_31470 118373 119596 gene locus_tag LOCUS_31480 118373 119596 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_31480 119966 120460 gene locus_tag LOCUS_31490 119966 120460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 121116 120466 gene locus_tag LOCUS_31500 121116 120466 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038464.1 protein_id gnl|my_center|LOCUS_31500 121886 121113 gene locus_tag LOCUS_31510 121886 121113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 122830 121967 gene locus_tag LOCUS_31520 122830 121967 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074021.1 protein_id gnl|my_center|LOCUS_31520 122914 123336 gene locus_tag LOCUS_31530 122914 123336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 124255 123446 gene locus_tag LOCUS_31540 124255 123446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 125225 124551 gene locus_tag LOCUS_31550 125225 124551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 125814 125239 gene locus_tag LOCUS_31560 125814 125239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 126386 125922 gene locus_tag LOCUS_31570 126386 125922 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887211.1 protein_id gnl|my_center|LOCUS_31570 127374 126391 gene locus_tag LOCUS_31580 gene lipA 127374 126391 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166373.1 protein_id gnl|my_center|LOCUS_31580 127499 128314 gene locus_tag LOCUS_31590 gene murI 127499 128314 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_31590 128407 130698 gene locus_tag LOCUS_31600 128407 130698 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764319.1 protein_id gnl|my_center|LOCUS_31600 130817 132163 gene locus_tag LOCUS_31610 gene glmM 130817 132163 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_31610 132191 133036 gene locus_tag LOCUS_31620 132191 133036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 133044 134885 gene locus_tag LOCUS_31630 gene glmS 133044 134885 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_31630 135968 134949 gene locus_tag LOCUS_31640 135968 134949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 138510 136147 gene locus_tag LOCUS_31650 138510 136147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 138837 142259 gene locus_tag LOCUS_31660 138837 142259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 143063 142311 gene locus_tag LOCUS_31670 143063 142311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 143852 143064 gene locus_tag LOCUS_31680 143852 143064 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721721.1 protein_id gnl|my_center|LOCUS_31680 143970 146144 gene locus_tag LOCUS_31690 143970 146144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 146183 147250 gene locus_tag LOCUS_31700 146183 147250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 147287 147880 gene locus_tag LOCUS_31710 gene hisB 147287 147880 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 protein_id gnl|my_center|LOCUS_31710 147877 148527 gene locus_tag LOCUS_31720 gene hisH 147877 148527 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_31720 148647 149120 gene locus_tag LOCUS_31730 gene rplI 148647 149120 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_31730 149234 149311 gene locus_tag LOCUS_t00390 149234 149311 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 151253 149898 gene locus_tag LOCUS_31740 gene mnmE 151253 149898 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_31740 152363 151266 gene locus_tag LOCUS_31750 152363 151266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 153846 152668 gene locus_tag LOCUS_31760 gene hisC 153846 152668 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_31760 154178 153825 gene locus_tag LOCUS_31770 154178 153825 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971937.1 protein_id gnl|my_center|LOCUS_31770 154229 154687 gene locus_tag LOCUS_31780 154229 154687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 protein_id gnl|my_center|LOCUS_31780 155360 154680 gene locus_tag LOCUS_31790 gene ubiE 155360 154680 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_31790 155916 155416 gene locus_tag LOCUS_31800 155916 155416 CDS product rhodanese family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703230.1 protein_id gnl|my_center|LOCUS_31800 156017 156376 gene locus_tag LOCUS_31810 156017 156376 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_31810 158209 156410 gene locus_tag LOCUS_31820 158209 156410 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_31820 158345 159883 gene locus_tag LOCUS_31830 gene gpmI 158345 159883 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_31830 159880 160296 gene locus_tag LOCUS_31840 159880 160296 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016656.1 protein_id gnl|my_center|LOCUS_31840 160363 161043 gene locus_tag LOCUS_31850 160363 161043 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_31850 161049 161630 gene locus_tag LOCUS_31860 161049 161630 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_31860 163097 161631 gene locus_tag LOCUS_31870 163097 161631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 163759 163106 gene locus_tag LOCUS_31880 163759 163106 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_31880 166631 163893 gene locus_tag LOCUS_31890 166631 163893 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124854.1 protein_id gnl|my_center|LOCUS_31890 167839 166664 gene locus_tag LOCUS_31900 167839 166664 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124855.1 protein_id gnl|my_center|LOCUS_31900 168369 167833 gene locus_tag LOCUS_31910 168369 167833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 169771 168542 gene locus_tag LOCUS_31920 gene rsmB 169771 168542 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704264.1 protein_id gnl|my_center|LOCUS_31920 170421 169786 gene locus_tag LOCUS_31930 gene bioD 170421 169786 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398591.1 protein_id gnl|my_center|LOCUS_31930 170517 172130 gene locus_tag LOCUS_31940 gene nadB 170517 172130 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_31940 172332 172937 gene locus_tag LOCUS_31950 172332 172937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 173043 173948 gene locus_tag LOCUS_31960 173043 173948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 174673 173945 gene locus_tag LOCUS_31970 174673 173945 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_31970 174744 176129 gene locus_tag LOCUS_31980 174744 176129 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_31980 177518 176133 gene locus_tag LOCUS_31990 gene mgtE 177518 176133 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870202.1 protein_id gnl|my_center|LOCUS_31990 177601 180150 gene locus_tag LOCUS_32000 177601 180150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 181081 180134 gene locus_tag LOCUS_32010 181081 180134 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 protein_id gnl|my_center|LOCUS_32010 181846 181085 gene locus_tag LOCUS_32020 181846 181085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 183748 181901 gene locus_tag LOCUS_32030 183748 181901 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883393.1 protein_id gnl|my_center|LOCUS_32030 184239 185858 gene locus_tag LOCUS_32040 184239 185858 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_32040 186937 185900 gene locus_tag LOCUS_32050 186937 185900 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_32050 188417 187059 gene locus_tag LOCUS_32060 188417 187059 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_32060 189517 188477 gene locus_tag LOCUS_32070 gene apbC 189517 188477 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_32070 190317 189571 gene locus_tag LOCUS_32080 190317 189571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 190802 190380 gene locus_tag LOCUS_32090 190802 190380 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_32090 191781 190855 gene locus_tag LOCUS_32100 191781 190855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 192092 191778 gene locus_tag LOCUS_32110 192092 191778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 192415 193806 gene locus_tag LOCUS_32120 192415 193806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 194767 193808 gene locus_tag LOCUS_32130 194767 193808 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_32130 195126 194869 gene locus_tag LOCUS_32140 gene rpsP 195126 194869 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720111.1 protein_id gnl|my_center|LOCUS_32140 197992 195233 gene locus_tag LOCUS_32150 197992 195233 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970834.1 protein_id gnl|my_center|LOCUS_32150 198924 198031 gene locus_tag LOCUS_32160 198924 198031 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922152.1 protein_id gnl|my_center|LOCUS_32160 199020 199613 gene locus_tag LOCUS_32170 199020 199613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 199709 200881 gene locus_tag LOCUS_32180 199709 200881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 200874 202928 gene locus_tag LOCUS_32190 200874 202928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 202915 204390 gene locus_tag LOCUS_32200 gene purB 202915 204390 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_32200 204415 205494 gene locus_tag LOCUS_32210 204415 205494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 205525 206925 gene locus_tag LOCUS_32220 205525 206925 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_32220 207068 207979 gene locus_tag LOCUS_32230 gene moaA 207068 207979 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076572118.1 protein_id gnl|my_center|LOCUS_32230 209813 207996 gene locus_tag LOCUS_32240 209813 207996 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_32240 210970 210611 gene locus_tag LOCUS_32250 210970 210611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 >Feature sequence211 351 2294 gene locus_tag LOCUS_32260 gene kdpB 351 2294 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816820.1 protein_id gnl|my_center|LOCUS_32260 2299 3942 gene locus_tag LOCUS_32270 gene kdpA 2299 3942 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161471071.1 protein_id gnl|my_center|LOCUS_32270 3947 4444 gene locus_tag LOCUS_32280 gene kdpC 3947 4444 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391518.1 protein_id gnl|my_center|LOCUS_32280 4462 7113 gene locus_tag LOCUS_32290 4462 7113 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_32290 7110 7811 gene locus_tag LOCUS_32300 gene kdpE 7110 7811 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191774710.1 protein_id gnl|my_center|LOCUS_32300 >Feature sequence212 4 480 gene locus_tag LOCUS_32310 4 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 477 1859 gene locus_tag LOCUS_32320 477 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 2218 2715 gene locus_tag LOCUS_32330 2218 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 2826 3422 gene locus_tag LOCUS_32340 2826 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 3429 3707 gene locus_tag LOCUS_32350 3429 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 5844 4588 gene locus_tag LOCUS_32360 5844 4588 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212977785.1 protein_id gnl|my_center|LOCUS_32360 6185 5844 gene locus_tag LOCUS_32370 6185 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 7397 7744 gene locus_tag LOCUS_32380 7397 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 >Feature sequence213 189 404 gene locus_tag LOCUS_32390 189 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 592 996 gene locus_tag LOCUS_32400 592 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 1532 2029 gene locus_tag LOCUS_32410 1532 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 2095 3009 gene locus_tag LOCUS_32420 2095 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 3122 3463 gene locus_tag LOCUS_32430 3122 3463 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084050946.1 protein_id gnl|my_center|LOCUS_32430 3486 4007 gene locus_tag LOCUS_32440 3486 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 4043 4546 gene locus_tag LOCUS_32450 4043 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 5121 5339 gene locus_tag LOCUS_32460 5121 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 5388 5891 gene locus_tag LOCUS_32470 5388 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 >Feature sequence214 3863 1857 gene locus_tag LOCUS_32480 3863 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 4177 3908 gene locus_tag LOCUS_32490 4177 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 5391 4252 gene locus_tag LOCUS_32500 5391 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 5938 5684 gene locus_tag LOCUS_32510 5938 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 >Feature sequence215 858 520 gene locus_tag LOCUS_32520 858 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32520 1818 886 gene locus_tag LOCUS_32530 1818 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 2265 1858 gene locus_tag LOCUS_32540 2265 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 3402 2302 gene locus_tag LOCUS_32550 3402 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 3562 4899 gene locus_tag LOCUS_32560 3562 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 4896 5726 gene locus_tag LOCUS_32570 4896 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 6590 5712 gene locus_tag LOCUS_32580 6590 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 >Feature sequence216 368 18 gene locus_tag LOCUS_32590 368 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 484 1470 gene locus_tag LOCUS_32600 484 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 1549 1791 gene locus_tag LOCUS_32610 1549 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 2249 2848 gene locus_tag LOCUS_32620 2249 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 3291 3013 gene locus_tag LOCUS_32630 3291 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 3894 3298 gene locus_tag LOCUS_32640 3894 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 4481 4005 gene locus_tag LOCUS_32650 4481 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 5913 4531 gene locus_tag LOCUS_32660 5913 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 6386 5910 gene locus_tag LOCUS_32670 6386 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence217 918 646 gene locus_tag LOCUS_32680 918 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 1575 1087 gene locus_tag LOCUS_32690 1575 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 3011 2475 gene locus_tag LOCUS_32700 3011 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 3578 3123 gene locus_tag LOCUS_32710 3578 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 4159 3680 gene locus_tag LOCUS_32720 4159 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 5232 4801 gene locus_tag LOCUS_32730 5232 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 >Feature sequence218 624 797 gene locus_tag LOCUS_32740 624 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 1300 893 gene locus_tag LOCUS_32750 1300 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 2718 1297 gene locus_tag LOCUS_32760 2718 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 3352 2711 gene locus_tag LOCUS_32770 3352 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 3976 3482 gene locus_tag LOCUS_32780 3976 3482 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022822.1 protein_id gnl|my_center|LOCUS_32780 4724 4188 gene locus_tag LOCUS_32790 4724 4188 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262493.1 protein_id gnl|my_center|LOCUS_32790 5286 4795 gene locus_tag LOCUS_32800 5286 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 6046 5336 gene locus_tag LOCUS_32810 6046 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 >Feature sequence219 783 271 gene locus_tag LOCUS_32820 783 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 1471 863 gene locus_tag LOCUS_32830 1471 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 2084 1548 gene locus_tag LOCUS_32840 2084 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 2247 2522 gene locus_tag LOCUS_32850 2247 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3789 2680 gene locus_tag LOCUS_32860 3789 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 4157 3864 gene locus_tag LOCUS_32870 4157 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 4370 4161 gene locus_tag LOCUS_32880 4370 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 4940 4461 gene locus_tag LOCUS_32890 4940 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 5621 4944 gene locus_tag LOCUS_32900 5621 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 >Feature sequence220 476 153 gene locus_tag LOCUS_32910 476 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 937 725 gene locus_tag LOCUS_32920 937 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 1461 1066 gene locus_tag LOCUS_32930 1461 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 1777 1568 gene locus_tag LOCUS_32940 1777 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 2596 2156 gene locus_tag LOCUS_32950 2596 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 3182 2676 gene locus_tag LOCUS_32960 3182 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 3847 3209 gene locus_tag LOCUS_32970 3847 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 4369 3926 gene locus_tag LOCUS_32980 4369 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 5400 4969 gene locus_tag LOCUS_32990 5400 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 >Feature sequence221 1032 1499 gene locus_tag LOCUS_33000 1032 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 1521 3251 gene locus_tag LOCUS_33010 1521 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 3330 3734 gene locus_tag LOCUS_33020 3330 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 3750 5627 gene locus_tag LOCUS_33030 3750 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 6626 5655 gene locus_tag LOCUS_33040 6626 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 6879 7925 gene locus_tag LOCUS_33050 6879 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 8059 11997 gene locus_tag LOCUS_33060 8059 11997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 12131 13378 gene locus_tag LOCUS_33070 gene fabF 12131 13378 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_33070 13383 13781 gene locus_tag LOCUS_33080 13383 13781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 13778 14476 gene locus_tag LOCUS_33090 13778 14476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 15728 14493 gene locus_tag LOCUS_33100 15728 14493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 17227 15824 gene locus_tag LOCUS_33110 17227 15824 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119342.1 protein_id gnl|my_center|LOCUS_33110 18241 17321 gene locus_tag LOCUS_33120 18241 17321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 18750 18328 gene locus_tag LOCUS_33130 18750 18328 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760582.1 protein_id gnl|my_center|LOCUS_33130 19404 18754 gene locus_tag LOCUS_33140 19404 18754 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812889.1 protein_id gnl|my_center|LOCUS_33140 20583 19414 gene locus_tag LOCUS_33150 20583 19414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 20855 22582 gene locus_tag LOCUS_33160 gene ilvB 20855 22582 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 protein_id gnl|my_center|LOCUS_33160 22627 23169 gene locus_tag LOCUS_33170 gene ilvN 22627 23169 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810756.1 protein_id gnl|my_center|LOCUS_33170 23323 23970 gene locus_tag LOCUS_33180 23323 23970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 26113 24044 gene locus_tag LOCUS_33190 26113 24044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 26462 26884 gene locus_tag LOCUS_33200 26462 26884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 27606 26953 gene locus_tag LOCUS_33210 27606 26953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 28389 27640 gene locus_tag LOCUS_33220 28389 27640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 29308 28418 gene locus_tag LOCUS_33230 gene xerC 29308 28418 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_33230 30232 29333 gene locus_tag LOCUS_33240 gene thiL 30232 29333 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392671.1 protein_id gnl|my_center|LOCUS_33240 31188 30232 gene locus_tag LOCUS_33250 31188 30232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 31258 32676 gene locus_tag LOCUS_33260 31258 32676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 33068 32673 gene locus_tag LOCUS_33270 33068 32673 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015129.1 protein_id gnl|my_center|LOCUS_33270 33261 34967 gene locus_tag LOCUS_33280 33261 34967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 35039 40660 gene locus_tag LOCUS_33290 gene uvrA 35039 40660 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814283.1 protein_id gnl|my_center|LOCUS_33290 41649 40708 gene locus_tag LOCUS_33300 41649 40708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 46349 41694 gene locus_tag LOCUS_33310 46349 41694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 47094 46468 gene locus_tag LOCUS_33320 47094 46468 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_33320 49202 47091 gene locus_tag LOCUS_33330 49202 47091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 49453 50487 gene locus_tag LOCUS_33340 49453 50487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 50484 51635 gene locus_tag LOCUS_33350 50484 51635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 51808 51650 gene locus_tag LOCUS_33360 51808 51650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 53032 52022 gene locus_tag LOCUS_33370 gene prfB 53032 52022 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130963.1 protein_id gnl|my_center|LOCUS_33370 53600 54133 gene locus_tag LOCUS_33380 53600 54133 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905064.1 protein_id gnl|my_center|LOCUS_33380 55041 54106 gene locus_tag LOCUS_33390 55041 54106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 57473 55206 gene locus_tag LOCUS_33400 57473 55206 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119344.1 protein_id gnl|my_center|LOCUS_33400 57692 58219 gene locus_tag LOCUS_33410 57692 58219 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119049.1 protein_id gnl|my_center|LOCUS_33410 58216 59586 gene locus_tag LOCUS_33420 58216 59586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 59842 63738 gene locus_tag LOCUS_33430 59842 63738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 64156 63836 gene locus_tag LOCUS_33440 gene trxA 64156 63836 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_33440 64573 64361 gene locus_tag LOCUS_33450 64573 64361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 64572 65012 gene locus_tag LOCUS_33460 64572 65012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 65189 66706 gene locus_tag LOCUS_33470 gene proS 65189 66706 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_33470 66995 66765 gene locus_tag LOCUS_33480 66995 66765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 67290 67214 gene locus_tag LOCUS_t00400 67290 67214 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 68180 67383 gene locus_tag LOCUS_33490 68180 67383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 68652 68194 gene locus_tag LOCUS_33500 68652 68194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 69095 68658 gene locus_tag LOCUS_33510 69095 68658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 69900 69136 gene locus_tag LOCUS_33520 69900 69136 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_33520 70799 69945 gene locus_tag LOCUS_33530 70799 69945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 73702 70811 gene locus_tag LOCUS_33540 73702 70811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 75143 73809 gene locus_tag LOCUS_33550 75143 73809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 75995 75318 gene locus_tag LOCUS_33560 75995 75318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 76046 76375 gene locus_tag LOCUS_33570 76046 76375 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056973.1 protein_id gnl|my_center|LOCUS_33570 76782 76468 gene locus_tag LOCUS_33580 76782 76468 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043860.1 protein_id gnl|my_center|LOCUS_33580 76980 78317 gene locus_tag LOCUS_33590 76980 78317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 78582 79334 gene locus_tag LOCUS_33600 gene atpB 78582 79334 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142904.1 protein_id gnl|my_center|LOCUS_33600 79406 79633 gene locus_tag LOCUS_33610 79406 79633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 79727 80284 gene locus_tag LOCUS_33620 79727 80284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 80308 80700 gene locus_tag LOCUS_33630 80308 80700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 80743 82284 gene locus_tag LOCUS_33640 gene atpA 80743 82284 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_33640 82388 83233 gene locus_tag LOCUS_33650 gene atpG 82388 83233 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_33650 83316 83636 gene locus_tag LOCUS_33660 83316 83636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 83685 85148 gene locus_tag LOCUS_33670 gene atpD 83685 85148 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_33670 85233 85646 gene locus_tag LOCUS_33680 85233 85646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 85722 86540 gene locus_tag LOCUS_33690 85722 86540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 86546 87808 gene locus_tag LOCUS_33700 86546 87808 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268988.1 protein_id gnl|my_center|LOCUS_33700 88525 90780 gene locus_tag LOCUS_33710 88525 90780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 91906 90848 gene locus_tag LOCUS_33720 91906 90848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 93056 91917 gene locus_tag LOCUS_33730 93056 91917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 94377 93076 gene locus_tag LOCUS_33740 gene hflX 94377 93076 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121200.1 protein_id gnl|my_center|LOCUS_33740 94786 94445 gene locus_tag LOCUS_33750 94786 94445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 95189 94770 gene locus_tag LOCUS_33760 95189 94770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 95546 97021 gene locus_tag LOCUS_33770 gene lysS 95546 97021 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369668.1 protein_id gnl|my_center|LOCUS_33770 97088 98314 gene locus_tag LOCUS_33780 97088 98314 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115333.1 protein_id gnl|my_center|LOCUS_33780 99183 98329 gene locus_tag LOCUS_33790 99183 98329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 100451 99597 gene locus_tag LOCUS_33800 100451 99597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 100820 102082 gene locus_tag LOCUS_33810 100820 102082 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_33810 103242 102094 gene locus_tag LOCUS_33820 gene holA 103242 102094 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468790.1 protein_id gnl|my_center|LOCUS_33820 104913 103315 gene locus_tag LOCUS_33830 104913 103315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 106894 104930 gene locus_tag LOCUS_33840 106894 104930 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107987.1 protein_id gnl|my_center|LOCUS_33840 107625 107074 gene locus_tag LOCUS_33850 gene tadA 107625 107074 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674836.1 protein_id gnl|my_center|LOCUS_33850 107707 108375 gene locus_tag LOCUS_33860 gene rpe 107707 108375 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058202.1 protein_id gnl|my_center|LOCUS_33860 108678 109274 gene locus_tag LOCUS_33870 108678 109274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 110203 109271 gene locus_tag LOCUS_33880 110203 109271 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531039.1 protein_id gnl|my_center|LOCUS_33880 110371 111105 gene locus_tag LOCUS_33890 110371 111105 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 protein_id gnl|my_center|LOCUS_33890 111135 111896 gene locus_tag LOCUS_33900 111135 111896 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705962.1 protein_id gnl|my_center|LOCUS_33900 112047 113642 gene locus_tag LOCUS_33910 112047 113642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 113852 115009 gene locus_tag LOCUS_33920 113852 115009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 115110 118217 gene locus_tag LOCUS_33930 115110 118217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 118229 119824 gene locus_tag LOCUS_33940 118229 119824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 119821 120498 gene locus_tag LOCUS_33950 119821 120498 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_33950 120549 121877 gene locus_tag LOCUS_33960 120549 121877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 123287 121896 gene locus_tag LOCUS_33970 123287 121896 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405167.1 protein_id gnl|my_center|LOCUS_33970 124022 123426 gene locus_tag LOCUS_33980 124022 123426 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 protein_id gnl|my_center|LOCUS_33980 124907 124107 gene locus_tag LOCUS_33990 124907 124107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 125786 125001 gene locus_tag LOCUS_34000 125786 125001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 125924 126520 gene locus_tag LOCUS_34010 125924 126520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 128926 126527 gene locus_tag LOCUS_34020 128926 126527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 130033 128930 gene locus_tag LOCUS_34030 gene rsgA 130033 128930 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_34030 130193 130690 gene locus_tag LOCUS_34040 130193 130690 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_34040 131239 133506 gene locus_tag LOCUS_34050 131239 133506 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067022.1 protein_id gnl|my_center|LOCUS_34050 136179 133624 gene locus_tag LOCUS_34060 gene mutS 136179 133624 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_34060 136420 138495 gene locus_tag LOCUS_34070 136420 138495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 138527 139627 gene locus_tag LOCUS_34080 138527 139627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 141259 139694 gene locus_tag LOCUS_34090 141259 139694 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_34090 143021 141495 gene locus_tag LOCUS_34100 143021 141495 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_34100 144417 143305 gene locus_tag LOCUS_34110 144417 143305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 145376 144399 gene locus_tag LOCUS_34120 145376 144399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 146456 145410 gene locus_tag LOCUS_34130 gene ribD 146456 145410 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707100.1 protein_id gnl|my_center|LOCUS_34130 147992 146514 gene locus_tag LOCUS_34140 147992 146514 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_34140 148103 148525 gene locus_tag LOCUS_34150 148103 148525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 149294 148530 gene locus_tag LOCUS_34160 gene rhaR 149294 148530 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_34160 149482 150987 gene locus_tag LOCUS_34170 gene mqo 149482 150987 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099345.1 protein_id gnl|my_center|LOCUS_34170 151409 152503 gene locus_tag LOCUS_34180 151409 152503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 152581 153561 gene locus_tag LOCUS_34190 152581 153561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 153970 153566 gene locus_tag LOCUS_34200 153970 153566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 155662 154091 gene locus_tag LOCUS_34210 155662 154091 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_34210 155959 157977 gene locus_tag LOCUS_34220 155959 157977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 158291 159352 gene locus_tag LOCUS_34230 158291 159352 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_34230 159535 160140 gene locus_tag LOCUS_34240 159535 160140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 160875 160264 gene locus_tag LOCUS_34250 160875 160264 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_34250 162730 160931 gene locus_tag LOCUS_34260 gene lepA 162730 160931 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030950.1 protein_id gnl|my_center|LOCUS_34260 162928 163854 gene locus_tag LOCUS_34270 162928 163854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 164045 166507 gene locus_tag LOCUS_34280 164045 166507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 166597 167307 gene locus_tag LOCUS_34290 166597 167307 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780603.1 protein_id gnl|my_center|LOCUS_34290 167402 168139 gene locus_tag LOCUS_34300 167402 168139 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763217.1 protein_id gnl|my_center|LOCUS_34300 168290 169885 gene locus_tag LOCUS_34310 168290 169885 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_34310 169902 170531 gene locus_tag LOCUS_34320 169902 170531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 170620 170883 gene locus_tag LOCUS_34330 gene rpsT 170620 170883 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948336.1 protein_id gnl|my_center|LOCUS_34330 170954 171187 gene locus_tag LOCUS_34340 170954 171187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 171191 171751 gene locus_tag LOCUS_34350 171191 171751 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_34350 171933 172907 gene locus_tag LOCUS_34360 171933 172907 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223214.1 protein_id gnl|my_center|LOCUS_34360 172962 173567 gene locus_tag LOCUS_34370 172962 173567 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405272.1 protein_id gnl|my_center|LOCUS_34370 175364 173640 gene locus_tag LOCUS_34380 175364 173640 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405524.1 protein_id gnl|my_center|LOCUS_34380 175659 175913 gene locus_tag LOCUS_34390 175659 175913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 175917 176327 gene locus_tag LOCUS_34400 175917 176327 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_34400 179008 176330 gene locus_tag LOCUS_34410 179008 176330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 179111 180472 gene locus_tag LOCUS_34420 gene asnS 179111 180472 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_34420 180472 180822 gene locus_tag LOCUS_34430 180472 180822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 181015 182133 gene locus_tag LOCUS_34440 181015 182133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 182261 183004 gene locus_tag LOCUS_34450 182261 183004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 183001 184338 gene locus_tag LOCUS_34460 183001 184338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 184646 184341 gene locus_tag LOCUS_34470 184646 184341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 184877 186913 gene locus_tag LOCUS_34480 184877 186913 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921333.1 protein_id gnl|my_center|LOCUS_34480 188086 186974 gene locus_tag LOCUS_34490 188086 186974 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888425.1 protein_id gnl|my_center|LOCUS_34490 188272 189609 gene locus_tag LOCUS_34500 188272 189609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 189715 191586 gene locus_tag LOCUS_34510 189715 191586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 192249 191599 gene locus_tag LOCUS_34520 192249 191599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 193114 192494 gene locus_tag LOCUS_34530 193114 192494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 194142 193111 gene locus_tag LOCUS_34540 194142 193111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 194463 194840 gene locus_tag LOCUS_34550 194463 194840 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804865.1 protein_id gnl|my_center|LOCUS_34550 195938 194850 gene locus_tag LOCUS_34560 195938 194850 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_34560 199107 195928 gene locus_tag LOCUS_34570 199107 195928 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_34570 >Feature sequence222 33 1570 gene locus_tag LOCUS_r00010 33 1570 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1830 1905 gene locus_tag LOCUS_t00410 1830 1905 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1996 2072 gene locus_tag LOCUS_t00420 1996 2072 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2349 5180 gene locus_tag LOCUS_r00020 2349 5180 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5472 5582 gene locus_tag LOCUS_r00030 5472 5582 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence223 570 88 gene locus_tag LOCUS_34580 570 88 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922068.1 protein_id gnl|my_center|LOCUS_34580 675 947 gene locus_tag LOCUS_34590 675 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 1738 950 gene locus_tag LOCUS_34600 1738 950 CDS product DUF4942 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087275.1 protein_id gnl|my_center|LOCUS_34600 2106 1735 gene locus_tag LOCUS_34610 2106 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 2798 2103 gene locus_tag LOCUS_34620 2798 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 3787 2795 gene locus_tag LOCUS_34630 3787 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 4641 3790 gene locus_tag LOCUS_34640 gene recT 4641 3790 CDS product recombination protein RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166313.1 protein_id gnl|my_center|LOCUS_34640 >Feature sequence224 222 1013 gene locus_tag LOCUS_34650 222 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 1013 1213 gene locus_tag LOCUS_34660 1013 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 1203 1607 gene locus_tag LOCUS_34670 1203 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 1604 1990 gene locus_tag LOCUS_34680 1604 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 1987 2142 gene locus_tag LOCUS_34690 1987 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 2139 2396 gene locus_tag LOCUS_34700 2139 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 2880 3203 gene locus_tag LOCUS_34710 2880 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 3231 3461 gene locus_tag LOCUS_34720 3231 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 4463 3444 gene locus_tag LOCUS_34730 4463 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 >Feature sequence225 1183 2181 gene locus_tag LOCUS_34740 1183 2181 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943400.1 protein_id gnl|my_center|LOCUS_34740 2921 3829 gene locus_tag LOCUS_34750 2921 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368614.1 protein_id gnl|my_center|LOCUS_34750 >Feature sequence226 2 346 gene locus_tag LOCUS_34760 2 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 1587 1018 gene locus_tag LOCUS_34770 1587 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 1698 1886 gene locus_tag LOCUS_34780 1698 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 2356 1868 gene locus_tag LOCUS_34790 2356 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 2942 3298 gene locus_tag LOCUS_34800 2942 3298 CDS product DUF2958 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533281.1 protein_id gnl|my_center|LOCUS_34800 3367 3777 gene locus_tag LOCUS_34810 3367 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 3834 4106 gene locus_tag LOCUS_34820 3834 4106 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389965.1 protein_id gnl|my_center|LOCUS_34820 >Feature sequence227 675 887 gene locus_tag LOCUS_34830 675 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 1626 916 gene locus_tag LOCUS_34840 1626 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 1755 2396 gene locus_tag LOCUS_34850 1755 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 2389 3810 gene locus_tag LOCUS_34860 2389 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 >Feature sequence228 1588 167 gene locus_tag LOCUS_34870 1588 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 2222 1581 gene locus_tag LOCUS_34880 2222 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 2838 2299 gene locus_tag LOCUS_34890 2838 2299 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262493.1 protein_id gnl|my_center|LOCUS_34890 3492 3007 gene locus_tag LOCUS_34900 3492 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 >Feature sequence229 525 947 gene locus_tag LOCUS_34910 525 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 1127 1942 gene locus_tag LOCUS_34920 1127 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 1959 2429 gene locus_tag LOCUS_34930 1959 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 2986 3369 gene locus_tag LOCUS_34940 2986 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 >Feature sequence230 600 199 gene locus_tag LOCUS_34950 600 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 1448 672 gene locus_tag LOCUS_34960 1448 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 3043 2603 gene locus_tag LOCUS_34970 3043 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 3499 3128 gene locus_tag LOCUS_34980 3499 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 >Feature sequence231 <1 975 gene locus_tag LOCUS_34990 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_218468372.1:RHS repeat-associated core domain-containing protein 1839 2270 gene locus_tag LOCUS_35000 1839 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 2824 3336 gene locus_tag LOCUS_35010 2824 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 >Feature sequence232 203 679 gene locus_tag LOCUS_35020 203 679 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031144.1 protein_id gnl|my_center|LOCUS_35020 676 993 gene locus_tag LOCUS_35030 676 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 1094 1480 gene locus_tag LOCUS_35040 1094 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 1644 1805 gene locus_tag LOCUS_35050 1644 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 1807 2106 gene locus_tag LOCUS_35060 1807 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 2192 2665 gene locus_tag LOCUS_35070 2192 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 3145 2900 gene locus_tag LOCUS_35080 3145 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 3062 3544 gene locus_tag LOCUS_35090 3062 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 3738 4034 gene locus_tag LOCUS_35100 3738 4034 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087738.1 protein_id gnl|my_center|LOCUS_35100 4204 4563 gene locus_tag LOCUS_35110 4204 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 4695 4994 gene locus_tag LOCUS_35120 4695 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 5094 5768 gene locus_tag LOCUS_35130 5094 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 7222 7761 gene locus_tag LOCUS_35140 7222 7761 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 protein_id gnl|my_center|LOCUS_35140 7777 8190 gene locus_tag LOCUS_35150 7777 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 8245 8706 gene locus_tag LOCUS_35160 8245 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 8810 9259 gene locus_tag LOCUS_35170 8810 9259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 9483 9959 gene locus_tag LOCUS_35180 9483 9959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 10011 10409 gene locus_tag LOCUS_35190 10011 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 10582 11007 gene locus_tag LOCUS_35200 10582 11007 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111004.1 protein_id gnl|my_center|LOCUS_35200 11254 11742 gene locus_tag LOCUS_35210 11254 11742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 12068 13060 gene locus_tag LOCUS_35220 12068 13060 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_35220 13065 13931 gene locus_tag LOCUS_35230 13065 13931 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678741.1 protein_id gnl|my_center|LOCUS_35230 13936 14748 gene locus_tag LOCUS_35240 13936 14748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 14766 15680 gene locus_tag LOCUS_35250 14766 15680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 15674 16690 gene locus_tag LOCUS_35260 15674 16690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 16698 17402 gene locus_tag LOCUS_35270 16698 17402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 17444 21346 gene locus_tag LOCUS_35280 17444 21346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 21841 21368 gene locus_tag LOCUS_35290 gene mog 21841 21368 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707146.1 protein_id gnl|my_center|LOCUS_35290 22290 21838 gene locus_tag LOCUS_35300 22290 21838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35300 23488 22307 gene locus_tag LOCUS_35310 23488 22307 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_35310 24111 23509 gene locus_tag LOCUS_35320 gene purN 24111 23509 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020374.1 protein_id gnl|my_center|LOCUS_35320 25358 24108 gene locus_tag LOCUS_35330 gene hpxK 25358 24108 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705408.1 protein_id gnl|my_center|LOCUS_35330 25866 25396 gene locus_tag LOCUS_35340 gene dfrA 25866 25396 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637205.1 protein_id gnl|my_center|LOCUS_35340 26722 25910 gene locus_tag LOCUS_35350 26722 25910 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_35350 27084 26788 gene locus_tag LOCUS_35360 27084 26788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 27243 28202 gene locus_tag LOCUS_35370 27243 28202 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056320.1 protein_id gnl|my_center|LOCUS_35370 28321 28962 gene locus_tag LOCUS_35380 28321 28962 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920592.1 protein_id gnl|my_center|LOCUS_35380 29152 30219 gene locus_tag LOCUS_35390 gene thiH 29152 30219 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465071.1 protein_id gnl|my_center|LOCUS_35390 30579 30250 gene locus_tag LOCUS_35400 30579 30250 CDS product low molecular weight protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087185.1 protein_id gnl|my_center|LOCUS_35400 31232 30576 gene locus_tag LOCUS_35410 31232 30576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 31401 33155 gene locus_tag LOCUS_35420 31401 33155 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_35420 33163 33840 gene locus_tag LOCUS_35430 33163 33840 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760381.1 protein_id gnl|my_center|LOCUS_35430 33927 34289 gene locus_tag LOCUS_35440 33927 34289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 34309 35220 gene locus_tag LOCUS_35450 34309 35220 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011235810.1 protein_id gnl|my_center|LOCUS_35450 35889 35299 gene locus_tag LOCUS_35460 35889 35299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 36138 36695 gene locus_tag LOCUS_35470 36138 36695 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666025.1 protein_id gnl|my_center|LOCUS_35470 38032 36752 gene locus_tag LOCUS_35480 38032 36752 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_35480 38281 39492 gene locus_tag LOCUS_35490 38281 39492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 40618 39500 gene locus_tag LOCUS_35500 40618 39500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 41941 40646 gene locus_tag LOCUS_35510 41941 40646 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120796.1 protein_id gnl|my_center|LOCUS_35510 42086 43402 gene locus_tag LOCUS_35520 42086 43402 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_35520 43448 45322 gene locus_tag LOCUS_35530 gene thrS 43448 45322 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_35530 45388 46167 gene locus_tag LOCUS_35540 45388 46167 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_35540 46915 46175 gene locus_tag LOCUS_35550 46915 46175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 47315 46935 gene locus_tag LOCUS_35560 47315 46935 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384189.1 protein_id gnl|my_center|LOCUS_35560 47580 49226 gene locus_tag LOCUS_35570 47580 49226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 49325 51082 gene locus_tag LOCUS_35580 49325 51082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 51094 52032 gene locus_tag LOCUS_35590 51094 52032 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113077.1 protein_id gnl|my_center|LOCUS_35590 52039 53142 gene locus_tag LOCUS_35600 52039 53142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 53139 55040 gene locus_tag LOCUS_35610 53139 55040 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113075.1 protein_id gnl|my_center|LOCUS_35610 55275 56810 gene locus_tag LOCUS_35620 55275 56810 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229498.1 protein_id gnl|my_center|LOCUS_35620 56813 56962 gene locus_tag LOCUS_35630 56813 56962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 57946 57374 gene locus_tag LOCUS_35640 57946 57374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 58038 59261 gene locus_tag LOCUS_35650 58038 59261 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_35650 60254 59793 gene locus_tag LOCUS_35660 60254 59793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 60738 60397 gene locus_tag LOCUS_35670 60738 60397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 61463 61140 gene locus_tag LOCUS_35680 61463 61140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 62330 61683 gene locus_tag LOCUS_35690 62330 61683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 62968 62411 gene locus_tag LOCUS_35700 62968 62411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 63471 64412 gene locus_tag LOCUS_35710 63471 64412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 66651 64435 gene locus_tag LOCUS_35720 66651 64435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 66666 68393 gene locus_tag LOCUS_35730 gene polX 66666 68393 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_35730 68435 68890 gene locus_tag LOCUS_35740 68435 68890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 70110 68905 gene locus_tag LOCUS_35750 70110 68905 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_35750 70455 73112 gene locus_tag LOCUS_35760 70455 73112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 73182 74378 gene locus_tag LOCUS_35770 73182 74378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35770 74418 75212 gene locus_tag LOCUS_35780 gene tpiA 74418 75212 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583495.1 protein_id gnl|my_center|LOCUS_35780 75333 76031 gene locus_tag LOCUS_35790 75333 76031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 76085 77095 gene locus_tag LOCUS_35800 gene bioB 76085 77095 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125254.1 protein_id gnl|my_center|LOCUS_35800 77177 77965 gene locus_tag LOCUS_35810 77177 77965 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071372.1 protein_id gnl|my_center|LOCUS_35810 79403 78030 gene locus_tag LOCUS_35820 79403 78030 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121489.1 protein_id gnl|my_center|LOCUS_35820 79794 79441 gene locus_tag LOCUS_35830 gene queD 79794 79441 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845978.1 protein_id gnl|my_center|LOCUS_35830 83524 79835 gene locus_tag LOCUS_35840 gene hrpA 83524 79835 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_35840 85583 83538 gene locus_tag LOCUS_35850 85583 83538 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583112.1 protein_id gnl|my_center|LOCUS_35850 86327 85599 gene locus_tag LOCUS_35860 86327 85599 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_35860 87231 86344 gene locus_tag LOCUS_35870 87231 86344 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763004.1 protein_id gnl|my_center|LOCUS_35870 89668 87284 gene locus_tag LOCUS_35880 89668 87284 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974204.1 protein_id gnl|my_center|LOCUS_35880 90845 89673 gene locus_tag LOCUS_35890 gene cax 90845 89673 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242902.1 protein_id gnl|my_center|LOCUS_35890 91439 90966 gene locus_tag LOCUS_35900 91439 90966 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153437081.1 protein_id gnl|my_center|LOCUS_35900 93725 91458 gene locus_tag LOCUS_35910 93725 91458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 93844 96201 gene locus_tag LOCUS_35920 93844 96201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 96198 96824 gene locus_tag LOCUS_35930 96198 96824 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104866.1 protein_id gnl|my_center|LOCUS_35930 98693 96837 gene locus_tag LOCUS_35940 98693 96837 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_35940 100495 98690 gene locus_tag LOCUS_35950 100495 98690 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_35950 101885 100884 gene locus_tag LOCUS_35960 101885 100884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 102178 101945 gene locus_tag LOCUS_35970 102178 101945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 102337 103857 gene locus_tag LOCUS_35980 102337 103857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 105435 103876 gene locus_tag LOCUS_35990 105435 103876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 105716 107062 gene locus_tag LOCUS_36000 gene pyk 105716 107062 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834388.1 protein_id gnl|my_center|LOCUS_36000 107093 107905 gene locus_tag LOCUS_36010 107093 107905 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871021.1 protein_id gnl|my_center|LOCUS_36010 108014 110305 gene locus_tag LOCUS_36020 108014 110305 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_36020 110498 111700 gene locus_tag LOCUS_36030 110498 111700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 111795 114794 gene locus_tag LOCUS_36040 111795 114794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 115345 114812 gene locus_tag LOCUS_36050 gene hpt 115345 114812 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705261.1 protein_id gnl|my_center|LOCUS_36050 115746 115408 gene locus_tag LOCUS_36060 115746 115408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 115869 122606 gene locus_tag LOCUS_36070 115869 122606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 125069 122610 gene locus_tag LOCUS_36080 125069 122610 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112286.1 protein_id gnl|my_center|LOCUS_36080 128352 125098 gene locus_tag LOCUS_36090 128352 125098 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205417.1 protein_id gnl|my_center|LOCUS_36090 128674 129546 gene locus_tag LOCUS_36100 128674 129546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120857.1 protein_id gnl|my_center|LOCUS_36100 130178 129864 gene locus_tag LOCUS_36110 130178 129864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 130816 131595 gene locus_tag LOCUS_36120 130816 131595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 131774 133813 gene locus_tag LOCUS_36130 131774 133813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 134389 133826 gene locus_tag LOCUS_36140 134389 133826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 134502 135809 gene locus_tag LOCUS_36150 134502 135809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 136244 135789 gene locus_tag LOCUS_36160 136244 135789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 136810 137172 gene locus_tag LOCUS_36170 136810 137172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 137169 139955 gene locus_tag LOCUS_36180 137169 139955 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_36180 139948 141318 gene locus_tag LOCUS_36190 gene nrfD 139948 141318 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_36190 141315 141821 gene locus_tag LOCUS_36200 141315 141821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 141908 142405 gene locus_tag LOCUS_36210 141908 142405 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256521.1 protein_id gnl|my_center|LOCUS_36210 142402 143406 gene locus_tag LOCUS_36220 142402 143406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_36220 143393 143725 gene locus_tag LOCUS_36230 143393 143725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 143722 144513 gene locus_tag LOCUS_36240 143722 144513 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_36240 144510 145511 gene locus_tag LOCUS_36250 gene coxB 144510 145511 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 protein_id gnl|my_center|LOCUS_36250 145508 147127 gene locus_tag LOCUS_36260 gene ctaD 145508 147127 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258008.1 protein_id gnl|my_center|LOCUS_36260 147124 147795 gene locus_tag LOCUS_36270 147124 147795 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100797.1 protein_id gnl|my_center|LOCUS_36270 147792 148055 gene locus_tag LOCUS_36280 147792 148055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 148910 148071 gene locus_tag LOCUS_36290 148910 148071 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115216.1 protein_id gnl|my_center|LOCUS_36290 149035 150312 gene locus_tag LOCUS_36300 149035 150312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328267.1 protein_id gnl|my_center|LOCUS_36300 150325 150837 gene locus_tag LOCUS_36310 150325 150837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 151099 152796 gene locus_tag LOCUS_36320 151099 152796 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921802.1 protein_id gnl|my_center|LOCUS_36320 152918 152835 gene locus_tag LOCUS_t00430 152918 152835 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 154062 153133 gene locus_tag LOCUS_36330 154062 153133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 154986 154162 gene locus_tag LOCUS_36340 154986 154162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 156178 155039 gene locus_tag LOCUS_36350 156178 155039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 157674 156406 gene locus_tag LOCUS_36360 gene dinB 157674 156406 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392743.1 protein_id gnl|my_center|LOCUS_36360 158024 158389 gene locus_tag LOCUS_36370 158024 158389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 158461 158901 gene locus_tag LOCUS_36380 158461 158901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 159189 161240 gene locus_tag LOCUS_36390 159189 161240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 161376 162113 gene locus_tag LOCUS_36400 161376 162113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 162118 163596 gene locus_tag LOCUS_36410 162118 163596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 163593 164156 gene locus_tag LOCUS_36420 gene rsmD 163593 164156 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104349.1 protein_id gnl|my_center|LOCUS_36420 164200 165480 gene locus_tag LOCUS_36430 gene waaA 164200 165480 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891574.1 protein_id gnl|my_center|LOCUS_36430 165535 165783 gene locus_tag LOCUS_36440 165535 165783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 165936 167270 gene locus_tag LOCUS_36450 165936 167270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 167360 167450 gene locus_tag LOCUS_t00440 167360 167450 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence233 164 2326 gene locus_tag LOCUS_36460 164 2326 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022963022.1 protein_id gnl|my_center|LOCUS_36460 2405 2941 gene locus_tag LOCUS_36470 2405 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 >Feature sequence234 1218 688 gene locus_tag LOCUS_36480 1218 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 1941 1249 gene locus_tag LOCUS_36490 1941 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 >Feature sequence235 2149 1814 gene locus_tag LOCUS_36500 2149 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 >Feature sequence236 1063 620 gene locus_tag LOCUS_36510 1063 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 1461 1123 gene locus_tag LOCUS_36520 1461 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 2041 1532 gene locus_tag LOCUS_36530 2041 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 >Feature sequence237 577 284 gene locus_tag LOCUS_36540 577 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 1848 1633 gene locus_tag LOCUS_36550 1848 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 >Feature sequence238 1599 787 gene locus_tag LOCUS_36560 1599 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 2719 2171 gene locus_tag LOCUS_36570 2719 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119862.1 protein_id gnl|my_center|LOCUS_36570 >Feature sequence239 >Feature sequence240 750 2288 gene locus_tag LOCUS_36580 750 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 >Feature sequence241 950 555 gene locus_tag LOCUS_36590 950 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 1435 965 gene locus_tag LOCUS_36600 1435 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 1844 1485 gene locus_tag LOCUS_36610 1844 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 2566 2378 gene locus_tag LOCUS_36620 2566 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence242 649 1389 gene locus_tag LOCUS_36630 649 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 1463 2254 gene locus_tag LOCUS_36640 1463 2254 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016994.1 protein_id gnl|my_center|LOCUS_36640 >Feature sequence243 134 295 gene locus_tag LOCUS_36650 134 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 392 303 gene locus_tag LOCUS_t00450 392 303 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1103 483 gene locus_tag LOCUS_36660 1103 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 1351 1181 gene locus_tag LOCUS_36670 1351 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 1941 3179 gene locus_tag LOCUS_36680 1941 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 4796 3444 gene locus_tag LOCUS_36690 4796 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 5762 4869 gene locus_tag LOCUS_36700 5762 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 6276 5755 gene locus_tag LOCUS_36710 gene ribE 6276 5755 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351731.1 protein_id gnl|my_center|LOCUS_36710 7340 6435 gene locus_tag LOCUS_36720 7340 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 9610 7427 gene locus_tag LOCUS_36730 9610 7427 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120873.1 protein_id gnl|my_center|LOCUS_36730 10482 9778 gene locus_tag LOCUS_36740 10482 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 12077 10668 gene locus_tag LOCUS_36750 gene ccoG 12077 10668 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_36750 12731 12084 gene locus_tag LOCUS_36760 12731 12084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 12911 12744 gene locus_tag LOCUS_36770 12911 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 15451 12917 gene locus_tag LOCUS_36780 gene ccoN 15451 12917 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_36780 15745 17151 gene locus_tag LOCUS_36790 15745 17151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 17225 18643 gene locus_tag LOCUS_36800 17225 18643 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_36800 19327 18644 gene locus_tag LOCUS_36810 19327 18644 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957443.1 protein_id gnl|my_center|LOCUS_36810 24939 19327 gene locus_tag LOCUS_36820 24939 19327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 25254 25673 gene locus_tag LOCUS_36830 25254 25673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037917.1 protein_id gnl|my_center|LOCUS_36830 26051 26545 gene locus_tag LOCUS_36840 26051 26545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 26485 27330 gene locus_tag LOCUS_36850 26485 27330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 27327 28088 gene locus_tag LOCUS_36860 27327 28088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 28745 28212 gene locus_tag LOCUS_36870 28745 28212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 30525 28891 gene locus_tag LOCUS_36880 30525 28891 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086957.1 protein_id gnl|my_center|LOCUS_36880 30652 33006 gene locus_tag LOCUS_36890 gene bamA 30652 33006 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_36890 35266 33065 gene locus_tag LOCUS_36900 gene uvrB 35266 33065 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403914.1 protein_id gnl|my_center|LOCUS_36900 35976 35353 gene locus_tag LOCUS_36910 35976 35353 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_36910 35990 37711 gene locus_tag LOCUS_36920 35990 37711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 37777 39033 gene locus_tag LOCUS_36930 gene nuoD 37777 39033 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_36930 39076 39651 gene locus_tag LOCUS_36940 39076 39651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 39730 42375 gene locus_tag LOCUS_36950 gene mprF 39730 42375 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706484.1 protein_id gnl|my_center|LOCUS_36950 42372 43175 gene locus_tag LOCUS_36960 42372 43175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 44126 43194 gene locus_tag LOCUS_36970 44126 43194 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120520.1 protein_id gnl|my_center|LOCUS_36970 44661 44269 gene locus_tag LOCUS_36980 44661 44269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 46334 45240 gene locus_tag LOCUS_36990 gene hemW 46334 45240 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460876.1 protein_id gnl|my_center|LOCUS_36990 47152 46340 gene locus_tag LOCUS_37000 gene panB 47152 46340 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763099.1 protein_id gnl|my_center|LOCUS_37000 47445 47209 gene locus_tag LOCUS_37010 47445 47209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 47423 48889 gene locus_tag LOCUS_37020 47423 48889 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243123.1 protein_id gnl|my_center|LOCUS_37020 49307 48948 gene locus_tag LOCUS_37030 49307 48948 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526549.1 protein_id gnl|my_center|LOCUS_37030 49689 49315 gene locus_tag LOCUS_37040 49689 49315 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670499.1 protein_id gnl|my_center|LOCUS_37040 51468 49876 gene locus_tag LOCUS_37050 51468 49876 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028844369.1 protein_id gnl|my_center|LOCUS_37050 53774 51528 gene locus_tag LOCUS_37060 gene mrdA 53774 51528 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_37060 54375 53785 gene locus_tag LOCUS_37070 54375 53785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 55189 54383 gene locus_tag LOCUS_37080 gene mreC 55189 54383 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_37080 56245 55217 gene locus_tag LOCUS_37090 56245 55217 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_37090 57251 56463 gene locus_tag LOCUS_37100 57251 56463 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921580.1 protein_id gnl|my_center|LOCUS_37100 57447 57980 gene locus_tag LOCUS_37110 57447 57980 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_37110 58316 59218 gene locus_tag LOCUS_37120 58316 59218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 59215 62673 gene locus_tag LOCUS_37130 59215 62673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 62731 64941 gene locus_tag LOCUS_37140 62731 64941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 65231 67843 gene locus_tag LOCUS_37150 65231 67843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 67985 68851 gene locus_tag LOCUS_37160 67985 68851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 69619 69086 gene locus_tag LOCUS_37170 69619 69086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 72923 69750 gene locus_tag LOCUS_37180 gene secA 72923 69750 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_37180 73846 73058 gene locus_tag LOCUS_37190 73846 73058 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_37190 73937 74887 gene locus_tag LOCUS_37200 73937 74887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 75618 74884 gene locus_tag LOCUS_37210 75618 74884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 76021 75689 gene locus_tag LOCUS_37220 76021 75689 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_37220 76453 76028 gene locus_tag LOCUS_37230 76453 76028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 76350 76571 gene locus_tag LOCUS_37240 76350 76571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 77727 76564 gene locus_tag LOCUS_37250 77727 76564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 78178 77828 gene locus_tag LOCUS_37260 78178 77828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 78616 78326 gene locus_tag LOCUS_37270 78616 78326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 79889 78660 gene locus_tag LOCUS_37280 79889 78660 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_37280 81376 79991 gene locus_tag LOCUS_37290 81376 79991 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035535025.1 protein_id gnl|my_center|LOCUS_37290 81910 81464 gene locus_tag LOCUS_37300 81910 81464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 83035 81932 gene locus_tag LOCUS_37310 gene leuB 83035 81932 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943508.1 protein_id gnl|my_center|LOCUS_37310 84110 83097 gene locus_tag LOCUS_37320 84110 83097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 84440 84135 gene locus_tag LOCUS_37330 84440 84135 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_37330 84940 84497 gene locus_tag LOCUS_37340 84940 84497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 86514 84937 gene locus_tag LOCUS_37350 86514 84937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 86643 88178 gene locus_tag LOCUS_37360 86643 88178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 88632 88231 gene locus_tag LOCUS_37370 88632 88231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 89449 88721 gene locus_tag LOCUS_37380 89449 88721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 89849 90004 gene locus_tag LOCUS_37390 89849 90004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 90001 91203 gene locus_tag LOCUS_37400 90001 91203 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337623.1 protein_id gnl|my_center|LOCUS_37400 91203 92285 gene locus_tag LOCUS_37410 91203 92285 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227959.1 protein_id gnl|my_center|LOCUS_37410 92294 92731 gene locus_tag LOCUS_37420 92294 92731 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334532.1 protein_id gnl|my_center|LOCUS_37420 94062 92734 gene locus_tag LOCUS_37430 94062 92734 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921646.1 protein_id gnl|my_center|LOCUS_37430 94139 94978 gene locus_tag LOCUS_37440 94139 94978 CDS product branched chain amino acid--2-keto-4-methylthiobutyrate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393599.1 protein_id gnl|my_center|LOCUS_37440 95459 96187 gene locus_tag LOCUS_37450 95459 96187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 96980 96306 gene locus_tag LOCUS_37460 96980 96306 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074040.1 protein_id gnl|my_center|LOCUS_37460 98521 96977 gene locus_tag LOCUS_37470 98521 96977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 99926 98526 gene locus_tag LOCUS_37480 99926 98526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 101348 100035 gene locus_tag LOCUS_37490 101348 100035 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_37490 102038 101349 gene locus_tag LOCUS_37500 102038 101349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 102717 102085 gene locus_tag LOCUS_37510 gene lipB 102717 102085 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 protein_id gnl|my_center|LOCUS_37510 103227 102724 gene locus_tag LOCUS_37520 gene ruvC 103227 102724 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084351.1 protein_id gnl|my_center|LOCUS_37520 104480 103287 gene locus_tag LOCUS_37530 104480 103287 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_37530 104706 105131 gene locus_tag LOCUS_37540 gene apaG 104706 105131 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610901.1 protein_id gnl|my_center|LOCUS_37540 105506 106252 gene locus_tag LOCUS_37550 gene pdxJ 105506 106252 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192885.1 protein_id gnl|my_center|LOCUS_37550 106262 106648 gene locus_tag LOCUS_37560 106262 106648 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_37560 106775 107716 gene locus_tag LOCUS_37570 gene hemB 106775 107716 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_37570 107767 109104 gene locus_tag LOCUS_37580 107767 109104 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169951.1 protein_id gnl|my_center|LOCUS_37580 109076 110212 gene locus_tag LOCUS_37590 109076 110212 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 protein_id gnl|my_center|LOCUS_37590 110343 111110 gene locus_tag LOCUS_37600 110343 111110 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463673.1 protein_id gnl|my_center|LOCUS_37600 111107 112081 gene locus_tag LOCUS_37610 111107 112081 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112783.1 protein_id gnl|my_center|LOCUS_37610 112473 113552 gene locus_tag LOCUS_37620 112473 113552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 113549 114643 gene locus_tag LOCUS_37630 113549 114643 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268795.1 protein_id gnl|my_center|LOCUS_37630 114654 115643 gene locus_tag LOCUS_37640 114654 115643 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_37640 115694 116998 gene locus_tag LOCUS_37650 115694 116998 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418379.1 protein_id gnl|my_center|LOCUS_37650 117139 120255 gene locus_tag LOCUS_37660 117139 120255 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036382.1 protein_id gnl|my_center|LOCUS_37660 120252 121091 gene locus_tag LOCUS_37670 120252 121091 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538167.1 protein_id gnl|my_center|LOCUS_37670 121088 121684 gene locus_tag LOCUS_37680 121088 121684 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104154.1 protein_id gnl|my_center|LOCUS_37680 121681 123252 gene locus_tag LOCUS_37690 121681 123252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 123786 123262 gene locus_tag LOCUS_37700 123786 123262 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707003.1 protein_id gnl|my_center|LOCUS_37700 125586 123949 gene locus_tag LOCUS_37710 125586 123949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 126800 125640 gene locus_tag LOCUS_37720 126800 125640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 127555 126806 gene locus_tag LOCUS_37730 127555 126806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 129000 127642 gene locus_tag LOCUS_37740 129000 127642 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339980.1 protein_id gnl|my_center|LOCUS_37740 129415 133722 gene locus_tag LOCUS_37750 129415 133722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 134429 133902 gene locus_tag LOCUS_37760 134429 133902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 135000 134443 gene locus_tag LOCUS_37770 135000 134443 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094783.1 protein_id gnl|my_center|LOCUS_37770 137112 135013 gene locus_tag LOCUS_37780 gene ppk1 137112 135013 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922240.1 protein_id gnl|my_center|LOCUS_37780 138723 137152 gene locus_tag LOCUS_37790 138723 137152 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_37790 138833 139660 gene locus_tag LOCUS_37800 138833 139660 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_37800 140805 139669 gene locus_tag LOCUS_37810 140805 139669 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261546.1 protein_id gnl|my_center|LOCUS_37810 142456 140834 gene locus_tag LOCUS_37820 142456 140834 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962666.1 protein_id gnl|my_center|LOCUS_37820 143087 142467 gene locus_tag LOCUS_37830 143087 142467 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038060574.1 protein_id gnl|my_center|LOCUS_37830 144483 143386 gene locus_tag LOCUS_37840 144483 143386 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_37840 144632 145807 gene locus_tag LOCUS_37850 144632 145807 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_37850 145993 146586 gene locus_tag LOCUS_37860 145993 146586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 146583 147620 gene locus_tag LOCUS_37870 146583 147620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 147679 148668 gene locus_tag LOCUS_37880 147679 148668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 148655 149635 gene locus_tag LOCUS_37890 148655 149635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 149690 149953 gene locus_tag LOCUS_37900 149690 149953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 149950 151182 gene locus_tag LOCUS_37910 149950 151182 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726980.1 protein_id gnl|my_center|LOCUS_37910 151703 151188 gene locus_tag LOCUS_37920 151703 151188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 154535 151707 gene locus_tag LOCUS_37930 gene gcvP 154535 151707 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089349.1 protein_id gnl|my_center|LOCUS_37930 154953 154576 gene locus_tag LOCUS_37940 gene gcvH 154953 154576 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228002.1 protein_id gnl|my_center|LOCUS_37940 156068 154989 gene locus_tag LOCUS_37950 gene gcvT 156068 154989 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_37950 156151 156933 gene locus_tag LOCUS_37960 156151 156933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 157807 156956 gene locus_tag LOCUS_37970 157807 156956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 158512 157859 gene locus_tag LOCUS_37980 158512 157859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 159668 158520 gene locus_tag LOCUS_37990 gene bioF 159668 158520 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_37990 160576 159680 gene locus_tag LOCUS_38000 160576 159680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 160969 160628 gene locus_tag LOCUS_38010 160969 160628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 161772 161053 gene locus_tag LOCUS_38020 161772 161053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 162881 161961 gene locus_tag LOCUS_38030 162881 161961 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507354.1 protein_id gnl|my_center|LOCUS_38030 162938 164131 gene locus_tag LOCUS_38040 gene metK 162938 164131 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 protein_id gnl|my_center|LOCUS_38040 164167 165624 gene locus_tag LOCUS_38050 gene ahcY 164167 165624 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035988.1 protein_id gnl|my_center|LOCUS_38050 166168 166494 gene locus_tag LOCUS_38060 166168 166494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 >Feature sequence244 738 1067 gene locus_tag LOCUS_38070 738 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 2009 1092 gene locus_tag LOCUS_38080 2009 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 >Feature sequence245 1054 1581 gene locus_tag LOCUS_38090 1054 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 2123 1866 gene locus_tag LOCUS_38100 2123 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 >Feature sequence246 >Feature sequence247 >Feature sequence248 146 1210 gene locus_tag LOCUS_38110 146 1210 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_38110 1221 1985 gene locus_tag LOCUS_38120 1221 1985 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_38120 >Feature sequence249 824 609 gene locus_tag LOCUS_38130 824 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 <2210 1109 gene locus_tag LOCUS_38140 <2210 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210083.1:RHS repeat protein >Feature sequence250 1058 609 gene locus_tag LOCUS_38150 1058 609 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096306.1 protein_id gnl|my_center|LOCUS_38150 1465 1055 gene locus_tag LOCUS_38160 1465 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 >Feature sequence251 626 979 gene locus_tag LOCUS_38170 626 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 1095 1541 gene locus_tag LOCUS_38180 1095 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 1685 2035 gene locus_tag LOCUS_38190 1685 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 >Feature sequence252 >Feature sequence253 1019 213 gene locus_tag LOCUS_38200 1019 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 1475 1095 gene locus_tag LOCUS_38210 1475 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 1934 1728 gene locus_tag LOCUS_38220 1934 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 >Feature sequence254 706 284 gene locus_tag LOCUS_38230 706 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 1729 779 gene locus_tag LOCUS_38240 1729 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 2356 1883 gene locus_tag LOCUS_38250 2356 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 3579 2353 gene locus_tag LOCUS_38260 3579 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 4209 3607 gene locus_tag LOCUS_38270 gene yihA 4209 3607 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_38270 5277 4291 gene locus_tag LOCUS_38280 5277 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 5390 6157 gene locus_tag LOCUS_38290 5390 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 6768 6163 gene locus_tag LOCUS_38300 6768 6163 CDS product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388352.1 protein_id gnl|my_center|LOCUS_38300 7742 6777 gene locus_tag LOCUS_38310 gene msrP 7742 6777 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257868.1 protein_id gnl|my_center|LOCUS_38310 8012 10093 gene locus_tag LOCUS_38320 8012 10093 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154897.1 protein_id gnl|my_center|LOCUS_38320 10166 11245 gene locus_tag LOCUS_38330 10166 11245 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080345.1 protein_id gnl|my_center|LOCUS_38330 14769 11242 gene locus_tag LOCUS_38340 14769 11242 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121781.1 protein_id gnl|my_center|LOCUS_38340 14851 15591 gene locus_tag LOCUS_38350 14851 15591 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188202.1 protein_id gnl|my_center|LOCUS_38350 15662 16405 gene locus_tag LOCUS_38360 15662 16405 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_38360 16436 17989 gene locus_tag LOCUS_38370 16436 17989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 18973 17990 gene locus_tag LOCUS_38380 18973 17990 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243992.1 protein_id gnl|my_center|LOCUS_38380 19105 19314 gene locus_tag LOCUS_38390 19105 19314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 19404 20450 gene locus_tag LOCUS_38400 19404 20450 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_38400 21863 20469 gene locus_tag LOCUS_38410 21863 20469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 21982 23673 gene locus_tag LOCUS_38420 21982 23673 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_38420 26587 23744 gene locus_tag LOCUS_38430 26587 23744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 27890 26658 gene locus_tag LOCUS_38440 27890 26658 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_38440 28402 28953 gene locus_tag LOCUS_38450 28402 28953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 28950 30485 gene locus_tag LOCUS_38460 28950 30485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 30545 31348 gene locus_tag LOCUS_38470 30545 31348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 32529 31483 gene locus_tag LOCUS_38480 32529 31483 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_38480 32687 33928 gene locus_tag LOCUS_38490 32687 33928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 33936 35264 gene locus_tag LOCUS_38500 33936 35264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 35295 36131 gene locus_tag LOCUS_38510 35295 36131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 36085 36531 gene locus_tag LOCUS_38520 36085 36531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 36785 37837 gene locus_tag LOCUS_38530 36785 37837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 40558 37841 gene locus_tag LOCUS_38540 40558 37841 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_38540 41218 41291 gene locus_tag LOCUS_t00460 41218 41291 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 41360 42901 gene locus_tag LOCUS_38550 41360 42901 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256441.1 protein_id gnl|my_center|LOCUS_38550 43368 42898 gene locus_tag LOCUS_38560 43368 42898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 45967 43391 gene locus_tag LOCUS_38570 45967 43391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 46404 45964 gene locus_tag LOCUS_38580 46404 45964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 47334 46558 gene locus_tag LOCUS_38590 47334 46558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 50438 47370 gene locus_tag LOCUS_38600 50438 47370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 50640 51404 gene locus_tag LOCUS_38610 50640 51404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 53973 51487 gene locus_tag LOCUS_38620 53973 51487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 54148 55911 gene locus_tag LOCUS_38630 gene ggt 54148 55911 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038421.1 protein_id gnl|my_center|LOCUS_38630 56273 57709 gene locus_tag LOCUS_38640 56273 57709 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_38640 59089 57713 gene locus_tag LOCUS_38650 59089 57713 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_38650 59905 59234 gene locus_tag LOCUS_38660 59905 59234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 60391 62151 gene locus_tag LOCUS_38670 60391 62151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 62161 63543 gene locus_tag LOCUS_38680 62161 63543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 65034 63556 gene locus_tag LOCUS_38690 65034 63556 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742165.1 protein_id gnl|my_center|LOCUS_38690 65930 65031 gene locus_tag LOCUS_38700 65930 65031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 66420 65932 gene locus_tag LOCUS_38710 66420 65932 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345343.1 protein_id gnl|my_center|LOCUS_38710 67434 66604 gene locus_tag LOCUS_38720 67434 66604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 70727 67446 gene locus_tag LOCUS_38730 70727 67446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 72405 70834 gene locus_tag LOCUS_38740 72405 70834 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_38740 73394 72408 gene locus_tag LOCUS_38750 73394 72408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 74713 73391 gene locus_tag LOCUS_38760 74713 73391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 75816 74710 gene locus_tag LOCUS_38770 75816 74710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 78254 75813 gene locus_tag LOCUS_38780 78254 75813 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836868.1 protein_id gnl|my_center|LOCUS_38780 79157 78258 gene locus_tag LOCUS_38790 79157 78258 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906717.1 protein_id gnl|my_center|LOCUS_38790 80461 79178 gene locus_tag LOCUS_38800 80461 79178 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263659.1 protein_id gnl|my_center|LOCUS_38800 82463 80616 gene locus_tag LOCUS_38810 gene typA 82463 80616 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141519.1 protein_id gnl|my_center|LOCUS_38810 87435 82597 gene locus_tag LOCUS_38820 87435 82597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 92383 87539 gene locus_tag LOCUS_38830 92383 87539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 92565 93428 gene locus_tag LOCUS_38840 92565 93428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 93931 93443 gene locus_tag LOCUS_38850 93931 93443 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_38850 94326 93928 gene locus_tag LOCUS_38860 94326 93928 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393696.1 protein_id gnl|my_center|LOCUS_38860 94500 95714 gene locus_tag LOCUS_38870 94500 95714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 95778 96596 gene locus_tag LOCUS_38880 95778 96596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 97147 96602 gene locus_tag LOCUS_38890 97147 96602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 97948 97220 gene locus_tag LOCUS_38900 97948 97220 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530016.1 protein_id gnl|my_center|LOCUS_38900 99036 97945 gene locus_tag LOCUS_38910 gene rlmN 99036 97945 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392423.1 protein_id gnl|my_center|LOCUS_38910 99132 99341 gene locus_tag LOCUS_38920 99132 99341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 99900 100196 gene locus_tag LOCUS_38930 99900 100196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 100297 101127 gene locus_tag LOCUS_38940 100297 101127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 102057 101131 gene locus_tag LOCUS_38950 102057 101131 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922558.1 protein_id gnl|my_center|LOCUS_38950 102755 102129 gene locus_tag LOCUS_38960 gene nth 102755 102129 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_38960 102833 103615 gene locus_tag LOCUS_38970 102833 103615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 103666 104913 gene locus_tag LOCUS_38980 103666 104913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 104970 105446 gene locus_tag LOCUS_38990 gene trmL 104970 105446 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_38990 106217 105447 gene locus_tag LOCUS_39000 106217 105447 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228666.1 protein_id gnl|my_center|LOCUS_39000 107042 106251 gene locus_tag LOCUS_39010 107042 106251 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227679.1 protein_id gnl|my_center|LOCUS_39010 107158 108060 gene locus_tag LOCUS_39020 107158 108060 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_39020 109533 108115 gene locus_tag LOCUS_39030 gene rseP 109533 108115 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_39030 110161 109619 gene locus_tag LOCUS_39040 110161 109619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 111177 110173 gene locus_tag LOCUS_39050 gene floA 111177 110173 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_39050 111653 111174 gene locus_tag LOCUS_39060 111653 111174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 113182 111650 gene locus_tag LOCUS_39070 113182 111650 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926053.1 protein_id gnl|my_center|LOCUS_39070 114122 113151 gene locus_tag LOCUS_39080 114122 113151 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035286.1 protein_id gnl|my_center|LOCUS_39080 114919 114170 gene locus_tag LOCUS_39090 114919 114170 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_39090 115662 114937 gene locus_tag LOCUS_39100 gene fabG 115662 114937 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_39100 117364 116072 gene locus_tag LOCUS_39110 117364 116072 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919597.1 protein_id gnl|my_center|LOCUS_39110 117909 117523 gene locus_tag LOCUS_39120 117909 117523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 118456 118100 gene locus_tag LOCUS_39130 118456 118100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 119485 118499 gene locus_tag LOCUS_39140 119485 118499 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_39140 120618 119542 gene locus_tag LOCUS_39150 gene pdhA 120618 119542 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_39150 120949 121134 gene locus_tag LOCUS_39160 120949 121134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 121344 121736 gene locus_tag LOCUS_39170 121344 121736 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262221.1 protein_id gnl|my_center|LOCUS_39170 121811 123688 gene locus_tag LOCUS_39180 gene mnmG 121811 123688 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_39180 124132 123701 gene locus_tag LOCUS_39190 124132 123701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 124271 126490 gene locus_tag LOCUS_39200 124271 126490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 127250 126513 gene locus_tag LOCUS_39210 127250 126513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 128299 127265 gene locus_tag LOCUS_39220 128299 127265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 129483 128632 gene locus_tag LOCUS_39230 129483 128632 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690802.1 protein_id gnl|my_center|LOCUS_39230 129587 130429 gene locus_tag LOCUS_39240 129587 130429 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740539.1 protein_id gnl|my_center|LOCUS_39240 131769 130474 gene locus_tag LOCUS_39250 131769 130474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 132681 131794 gene locus_tag LOCUS_39260 gene folD 132681 131794 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530231.1 protein_id gnl|my_center|LOCUS_39260 133380 132712 gene locus_tag LOCUS_39270 133380 132712 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367246.1 protein_id gnl|my_center|LOCUS_39270 134981 133380 gene locus_tag LOCUS_39280 gene xylB 134981 133380 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036931.1 protein_id gnl|my_center|LOCUS_39280 135569 135000 gene locus_tag LOCUS_39290 135569 135000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 135678 136814 gene locus_tag LOCUS_39300 135678 136814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 136861 137418 gene locus_tag LOCUS_39310 136861 137418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 137520 139040 gene locus_tag LOCUS_39320 137520 139040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 139429 143586 gene locus_tag LOCUS_39330 139429 143586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 143862 145076 gene locus_tag LOCUS_39340 143862 145076 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368546.1 protein_id gnl|my_center|LOCUS_39340 145415 146116 gene locus_tag LOCUS_39350 145415 146116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 146978 146178 gene locus_tag LOCUS_39360 gene oppF 146978 146178 CDS product murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164170.1 protein_id gnl|my_center|LOCUS_39360 147199 149037 gene locus_tag LOCUS_39370 147199 149037 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203736.1 protein_id gnl|my_center|LOCUS_39370 149153 150868 gene locus_tag LOCUS_39380 149153 150868 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_39380 150905 152227 gene locus_tag LOCUS_39390 gene gspF 150905 152227 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_39390 153049 153822 gene locus_tag LOCUS_39400 153049 153822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 154047 153895 gene locus_tag LOCUS_39410 154047 153895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 154072 155490 gene locus_tag LOCUS_39420 154072 155490 CDS product heme peroxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089962.1 protein_id gnl|my_center|LOCUS_39420 155566 156498 gene locus_tag LOCUS_39430 155566 156498 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263039.1 protein_id gnl|my_center|LOCUS_39430