COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..211581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(264..419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 note possible pseudo, frameshifted CDS 435..623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 946..1134 product YdiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638607.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 1992..3452 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097749.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 3452..3934 product VSPR family DNA mismatch endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786004.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene vsr CDS 4393..5307 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 5402..5581 product DUF2158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097745.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 5821..7485 product cellulose biosynthesis regulator diguanylate cyclase DgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001513322.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene dgcQ CDS complement(7827..8060) product YodD family peroxide/acid resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844798.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene yodD CDS 8226..8414 product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867218.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene dsrB CDS 8929..9093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(9689..9922) product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene yedF CDS complement(9919..11133) product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118883.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene yedE CDS 11315..11824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(11835..13322) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245699.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene amyA CDS 13512..14312 product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365902.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene tcyJ CDS 14441..15427 product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096021.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene dcyD CDS 15460..16128 product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096022.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene tcyL CDS 16125..16877 product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene yecC CDS 18077..18733 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705978.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene uvrY CDS 18796..20562 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283421.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene uvrC CDS 20620..21168 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160192.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene pgsA tRNA 21317..21392 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 21447..21520 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA 21533..21618 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(22155..22643) product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096038.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene ftnA CDS complement(22832..23155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 23405..24043 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211263.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(24274..24483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 25106..25357 product DUF2766 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365964.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(25646..26134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 27095..27712 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840119.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene otsB CDS 27687..29111 product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089042.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene otsA CDS complement(29223..30746) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010723.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene norR CDS 30932..32386 product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025997.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene norV CDS 32383..33516 product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064701.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene norW CDS 33995..35578 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096070.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 35583..36722 product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096071.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(36772..38295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(38790..41279) product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815998.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene torA CDS complement(41292..42449) product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815999.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(42682..44415) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705961.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene argS CDS 44629..45195 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365978.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(45618..46292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 note possible pseudo, frameshifted CDS complement(46231..46758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 note possible pseudo, frameshifted CDS 46848..47585 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene cutC CDS complement(47849..48178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(48371..49342) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569029.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene cmoB CDS complement(49339..50082) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019588.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene cmoA CDS complement(50120..50515) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096077.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(50632..51450) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639226.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(51447..52016) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096079.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 52302..54074 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705958.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene aspS CDS 54076..54510 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323633.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene nudB CDS 54611..55354 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907234.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 55431..55952 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974712.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene ruvC CDS 56037..56648 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365989.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene ruvA CDS 56656..57666 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568508.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene ruvB CDS complement(57716..57979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(58194..58979) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571480.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene znuB CDS complement(58976..59731) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202996.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene znuC CDS 59894..60745 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705954.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene znuA CDS 60761..62083 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184045.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene mepM CDS 62519..63481 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032705956.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene lpxM CDS complement(63947..65389) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365996.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene pyk CDS complement(65510..66382) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162677299.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 66722..68197 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301727.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene zwf CDS 68424..70271 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069461.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene edd CDS 70271..70909 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800512.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene kdgA CDS complement(71045..72226) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173461.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene purT CDS 72278..72697 product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705951.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 73103..73768 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 73902..75959 product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936951.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene ptrB CDS complement(75964..76623) product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944256.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene exoX CDS complement(76800..77030) product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 77179..77550 product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168393.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene yobA CDS 77550..78425 product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096104.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene copD CDS 78440..78778 product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722366.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(79347..80063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078137.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 80275..80919 product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705940.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene pphA CDS complement(80921..81112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(81331..81570) product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705939.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(81667..83166) product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602287.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene rsmF CDS complement(83353..85974) product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419908.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(85943..87226) product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene yebS CDS 87352..87846 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096117.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 87948..88622 product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096118.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene proQ CDS 88642..90684 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096119.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene prc CDS 91036..91917 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366028.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene htpX CDS 92330..92476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 92573..93364 product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262174.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene kdgR CDS 93919..94197 product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006860.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(94273..94470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(94483..94695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 94828..95106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 note possible pseudo, frameshifted CDS 95925..96134 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene cspE CDS 96505..97320 product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene rlmA CDS complement(97317..97886) product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene mntP CDS complement(98268..98726) product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096131.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(98781..99632) product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175979.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(99645..100445) product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene manY CDS complement(100508..101482) product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150543.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene manX CDS 101935..103494 product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421821.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene yoaE CDS complement(103507..105084) product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(105220..106584) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419892.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene sdaA CDS complement(106781..107362) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705928.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(107367..108743) product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978456.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene pabB CDS 108854..109036 product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457334.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(109069..109416) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096138.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 109550..111460 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705926.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 111530..112225 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221014.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene tsaB CDS 112269..112862 product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096141.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 113067..114752 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758418.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene fadD CDS 114821..115942 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645255.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene rnd CDS complement(116100..116366) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211180.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene minE CDS complement(116370..117182) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096144.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene minD CDS complement(117206..117898) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096145.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene minC CDS 118019..118294 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096146.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 118811..119470 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096147.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 119564..120010 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807626.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 120704..121147 product potassium binding protein Kbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene kbp CDS complement(121344..121931) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028084.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene dsbB CDS 122142..122861 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096152.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene fadR CDS complement(123007..124545) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 124856..126154 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705841.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(126477..128216) product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096157.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(128301..129119) product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705839.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene ldcA CDS 129313..129927 product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096159.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene emtA CDS complement(129971..131788) product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096163.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(132259..132726) product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703464.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene nanQ CDS complement(132720..133598) product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(133595..134284) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703466.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(134295..135860) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703467.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(135938..136831) product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703468.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene nanA CDS complement(136966..137748) product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369707.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene nanR CDS complement(138048..139553) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704224.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(139985..140884) product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704223.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene iolE CDS complement(140918..141802) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368532.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(141841..142854) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704222.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(142911..144851) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704221.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene iolD CDS 145343..147256 product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704220.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene iolC CDS 147399..148241 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368536.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(148294..149103) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704219.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene iolB CDS complement(149124..150629) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368538.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 150996..151817 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704218.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(152182..153273) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene ychF CDS complement(153398..153982) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705080.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene pth CDS 154255..154533 product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823874.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene ychH CDS complement(154622..155584) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene prs CDS complement(155681..156547) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367112.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene ispE CDS complement(156544..157158) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705083.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene lolB CDS 157376..158677 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096232.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene hemA CDS 158717..159799 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096233.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene prfA CDS 159799..160641 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705084.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene prmC CDS 160647..161036 product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211234.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 161040..161849 product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096236.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene sirB1 CDS 161894..162748 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811065.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene kdsA CDS 163296..164735 product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196875.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene nrfA CDS 164780..165343 product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309136.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene nrfB CDS 165340..166011 product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220290.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene nrfC CDS 166008..166940 product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195177.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene nrfD CDS 166933..168633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 168630..169019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 169016..169540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(169573..170673) product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096238.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene chaA CDS 171089..171322 product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene chaB CDS complement(171460..171813) product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179794.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 172331..173620 product YchO/YchP family invasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419841.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(173627..174277) product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705094.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene narL CDS complement(174274..176067) product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476239.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene narX CDS 176358..177773 product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019848.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene narK CDS 178165..181911 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032878.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 181908..183449 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096257.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene narH CDS 183446..184156 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571671.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene narJ CDS 184156..184833 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367083.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene narI tRNA complement(185568..185652) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(185794..186636) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191159.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene purU CDS complement(186676..187032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(187320..187616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 187784..188110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 note possible pseudo, frameshifted CDS 188208..189221 product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096265.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene rssB CDS 189422..190330 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419830.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene galU CDS 190355..191695 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210664.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(192378..192797) product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287378.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene hns CDS 193344..193949 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705104.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene tdk CDS complement(194802..197471) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705105.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene adhE CDS 197902..198561 product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615840.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 199175..200836 product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560668.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene oppA CDS 200921..201841 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367069.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene oppB CDS 201857..202765 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979661.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene oppC CDS 202775..203752 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058853.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 203749..204750 product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096274.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene oppF CDS complement(205029..205361) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096276.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(205397..206857) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206886.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene cls CDS complement(207421..207717) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367051.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 207924..208655 product TonB system transport protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069346.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene tonB CDS complement(209143..209538) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096281.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene yciA CDS complement(209648..210184) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366196.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(210244..210987) product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096283.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(211018..211407) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114955.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 sequence002 source 1..96955 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 384..590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 1286..2377 product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977709.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene ompF CDS 2560..3750 product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462687.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene aspC CDS complement(3982..4614) product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109449.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene gloC CDS complement(4649..5197) product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295932.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(5501..7270) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097291.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene ldtD CDS complement(7471..11922) product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704893.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene mukB CDS complement(11915..12628) product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097294.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene mukE CDS complement(12615..13937) product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288850.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene mukF CDS complement(13941..14720) product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene cmoM CDS 14854..15627 product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899546.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene elyC CDS complement(15610..16500) product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097298.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(16858..17619) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367464.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene kdsB CDS complement(17616..17798) product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350061.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene ycaR CDS complement(18254..19252) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704887.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene lpxK CDS complement(19249..20997) product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551270.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene msbA CDS complement(21033..23294) product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705794.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(23854..24138) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167336.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene ihfB CDS complement(24227..25900) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140324.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene rpsA CDS complement(26055..26741) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097305.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene cmk CDS complement(26952..28238) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097306.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene aroA CDS complement(28304..29392) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene serC CDS complement(29611..29760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 29895..31658 product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367476.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 32057..32914 product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367477.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene focA CDS 32964..35246 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292799.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene pflB CDS 35469..36212 product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367479.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene pflA CDS complement(37104..38252) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367480.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(39044..40336) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886697.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene serS CDS complement(40482..41849) product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067785.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene rarA CDS complement(41833..42444) product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367486.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene lolA CDS complement(42568..46302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(46424..46918) product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene lrp CDS 47358..48323 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537418.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene trxB CDS 48446..50209 product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097322.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene cydD CDS 50210..51931 product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene cydC CDS 51973..52674 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241650.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene aat CDS 52955..53173 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene infA CDS complement(53644..55923) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097325.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene clpA CDS complement(55952..56272) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520781.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene clpS CDS 56593..56814 product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447499.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene cspD CDS complement(56879..58822) product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene macB CDS complement(58819..59928) product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene macA CDS complement(60187..61845) product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704871.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 62281..62976 product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704870.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene aqpZ CDS 63101..63997 product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367501.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 64141..65793 product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704869.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene hcp CDS 65804..66772 product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178665.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene hcr CDS 66874..68592 product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097335.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene poxB CDS 68675..69631 product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566383.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene ltaE CDS 69632..71095 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079004.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 71186..72199 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097338.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(72349..73179) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645850.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(73176..73496) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160725.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 73681..74223 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097359.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 74422..75150 product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367515.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene artP CDS 75167..75904 product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756586.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene artJ CDS 75913..76629 product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001687.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene artQ CDS 76629..77297 product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097363.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene artM CDS 77823..78554 product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097364.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene artJ CDS complement(78636..79781) product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097367.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene rlmC CDS complement(79880..80329) product YbjO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389260.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 80554..80730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(80763..81242) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367528.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(81332..82234) product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097373.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene rimK CDS complement(82324..83046) product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189159.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene nfsA CDS complement(83360..83743) product inner membrane protein YbjM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367534.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 83947..84153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 84038..85726 product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 86134..87351 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217866.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 87608..88420 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097421.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(88556..89785) product multidrug efflux MFS transporter MdfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001330495.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene mdfA CDS 90366..90974 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704843.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene ybjG CDS 91047..91808 product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene deoR CDS complement(92045..93163) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831210.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene dacC CDS complement(94059..95219) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252735.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(95224..95610) product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259651.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene bssR CDS 95860..96075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 96255..96803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 note possible pseudo, frameshifted sequence003 source 1..2251 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(322..1770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539869.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 sequence004 source 1..2169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence005 source 1..2155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence006 source 1..2079 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence007 source 1..2020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence008 source 1..1902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(204..374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(533..898) product ribonuclease toxin immunity protein CdiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704291.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene cdiI CDS complement(910..1902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 sequence009 source 1..1891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 20..622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 619..990 product immunity 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967957.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(1029..1265) product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807562.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(1339..1734) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210018.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 sequence010 source 1..1889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 435..716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(766..1155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 misc_feature complement(1152..>1889) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098820.1:contact-dependent inhibition effector 16S rRNA endonuclease locus_tag LOCUS_02870 sequence011 source 1..1786 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(46..1214) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 73 percent of the 16S ribosomal RNA locus_tag LOCUS_r00010 sequence012 source 1..1748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(7..285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 401..628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(690..881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(1154..1390) product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878127.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(1506..1670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 sequence013 source 1..94115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1743..2339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 2912..3424 product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171589.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene eco CDS complement(3945..4466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 5377..5712 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056482.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(5903..6412) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366911.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(6414..8354) product formate-dependent uric acid utilization protein YgfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene ygfT CDS 8709..11936 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705205.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 11947..12408 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366918.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 12427..13041 product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817484.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene mocA CDS complement(13150..14994) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366900.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 15209..16399 product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366901.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene ygeW CDS 16454..17656 product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110493.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene dpaL CDS 17676..18893 product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 18939..20339 product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706021.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene hydA CDS 20336..21271 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366905.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene arcC CDS complement(21517..22353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 22652..25750 product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502377.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene ygfK CDS 25753..27081 product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706028.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene ssnA CDS 27469..28941 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366914.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 28941..29069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(29217..30002) product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene lipA CDS 30138..32285 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077681898.1 transl_table 11 codon_start 1 transl_except (pos:30555..30557,aa:Sec) note codon on position 140 is selenocysteine opal codon. locus_tag LOCUS_03140 gene fdhF CDS complement(32345..33658) product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368716.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene gltP CDS 34077..36035 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene acs CDS 36214..36528 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 36525..38174 product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095079.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene actP CDS 38414..39295 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095076.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(39701..41347) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095075.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(41493..42842) product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106892.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene ghxP CDS complement(43128..43799) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958574.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(43867..44334) product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095072.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene soxR CDS 44416..44739 product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368734.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene soxS CDS 45006..45284 product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(45939..47066) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(47063..48217) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098671.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(48199..49170) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(49369..50880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(53342..53884) product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168305.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene ssb1 CDS 54105..56936 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368747.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene uvrA CDS complement(57088..57444) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(57447..57863) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(58141..59334) product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486998.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene tyrB CDS complement(59457..60536) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene alr CDS complement(60654..61994) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918353.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene dnaB CDS 62138..63121 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704044.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(63326..63610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(63740..64738) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110630.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene dusA CDS 64974..65495 product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416263.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene zur CDS complement(65564..65773) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030593.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(65979..67304) product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418457.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene dinF CDS complement(67400..68008) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646079.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene lexA CDS complement(68203..68571) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095052.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 68705..71170 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301502.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene plsB CDS complement(71239..72111) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene ubiA CDS complement(72111..72623) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704038.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene ubiC CDS complement(72861..73274) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309131.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene psiE CDS complement(73768..75417) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790033.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene pgi CDS 76074..77435 product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136394.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene lysC CDS 77734..78399 product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221495.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene qseB CDS 78392..79768 product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673357.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene qseC CDS 79874..80824 product ketopantoate/pantoate/pantothenate transporter PanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene panS CDS complement(81140..81301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 note possible pseudo, frameshifted CDS complement(81969..85652) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096047.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene metH CDS 85845..86678 product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene iclR CDS 86738..86926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(87286..89034) product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137261.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene aceK CDS complement(89172..90476) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857854.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene aceA CDS complement(90621..92222) product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138870.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene aceB CDS complement(92471..93334) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122786.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene metA CDS 93557..94000 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237004.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 sequence014 source 1..1669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 60..272 product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213866.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(323..877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(874..1539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 sequence015 source 1..1647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 10..1625 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgcgagcggggataaaccg sequence016 source 1..1645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(31..198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(191..1525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 sequence017 source 1..1632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1044 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206782626.1:DNA/RNA non-specific endonuclease locus_tag LOCUS_03680 CDS 1041..1373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 sequence018 source 1..1599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(300..632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 misc_feature complement(632..>1599) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206782626.1:DNA/RNA non-specific endonuclease locus_tag LOCUS_03710 sequence019 source 1..1574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 820..1287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 sequence020 source 1..1568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence021 source 1..1506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence022 source 1..1501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence023 source 1..1494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 70..468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 519..797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 794..1099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 sequence024 source 1..91870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(58..558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(913..1380) product DUF6392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(1377..2045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(2429..3865) product PTS N-acetylmuramic acid transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817229.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene murP CDS complement(3868..4776) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704387.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene murQ CDS complement(4818..5390) product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704384.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(5446..6528) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704385.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 8412..9332 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094814.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(9779..10480) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 10553..12067 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369093.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(12205..13467) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(13460..13729) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368424.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(13726..14838) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704298.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(14835..15776) product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704299.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 16082..16912 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368421.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 17133..18053 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807565.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 18066..19652 product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704300.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 19671..21272 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704301.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 21285..22292 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(22615..23559) product DNA-binding transcriptional regulator LysR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene lysR CDS 23763..25010 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120720.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene lysA CDS complement(25012..26040) product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098559.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene galR CDS 26865..29024 product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098558.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene aas CDS 29017..30219 product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene lplT CDS complement(30258..31298) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098556.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(31452..31670) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758664.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(31805..32518) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895635.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(32611..33246) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369924.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene mutH CDS 33980..34510 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564489.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene rppH CDS 34522..36768 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098552.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene ptsP CDS 36932..37807 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204645.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene lgt CDS 37815..38609 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369929.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene thyA CDS 39089..39559 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 39559..40086 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144322.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 40107..40487 product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 40475..40819 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 40963..44343 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946906.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene recC CDS 44609..47494 product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098545.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene ptrA CDS 47494..51045 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703321.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene recB CDS 51042..52889 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703320.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene recD CDS complement(53151..54482) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369939.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene argA CDS 54710..55960 product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703319.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene amiC tRNA complement(56164..56240) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(56303..56379) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 56587..57690 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678645.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene mltA CDS 57757..58566 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117716.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene tcdA CDS complement(58574..59014) product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene csdE CDS complement(59017..60222) product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene csdA CDS 60422..60643 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750393.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 60980..61897 product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044409.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene gcvA CDS 61943..62338 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862756.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 62331..63434 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene rlmM CDS complement(63431..64186) product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703315.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene xni CDS 64718..65494 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442141.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(66051..67418) product L-serine ammonia-lyase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626422.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene sdaB CDS complement(67474..68763) product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859030.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene sdaC CDS complement(69304..70668) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene ppnN CDS complement(70764..71609) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703314.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene queF CDS 71676..72221 product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene syd CDS 72583..72780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 72873..73196 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098527.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 73196..73987 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703313.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene truC CDS 73994..74446 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369957.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 75073..76461 product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098524.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene gudP CDS 76430..77770 product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235392.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 77793..79127 product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098522.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene gudD CDS 79216..80358 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098521.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(80533..83289) product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186405.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene barA CDS 83347..84645 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098519.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene rlmD CDS 84700..86931 product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 86985..87779 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703306.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene mazG CDS 88195..89832 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703305.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene pyrG CDS 90044..91342 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036734.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene eno sequence025 source 1..1478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..831 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704285.1:hemagglutinin repeat-containing protein locus_tag LOCUS_04470 CDS 835..1299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 sequence026 source 1..1470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence027 source 1..1451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(163..705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 misc_feature complement(705..>1451) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054181051.1:hemagglutinin repeat-containing protein locus_tag LOCUS_04500 sequence028 source 1..1411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(447..710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 misc_feature complement(694..>1411) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236626684.1:hemagglutinin repeat-containing protein locus_tag LOCUS_04520 sequence029 source 1..1409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 899..1099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 1208..1381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 sequence030 source 1..1390 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 72..473 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536902.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 470..817 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612626.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene tnpB sequence031 source 1..1384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence032 source 1..1383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..999 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054181051.1:hemagglutinin repeat-containing protein locus_tag LOCUS_04570 sequence033 source 1..1373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 71..772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 772..1113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 sequence034 source 1..1314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 71..1279 product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209743.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 sequence035 source 1..90727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(88..633) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099226.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene hemG CDS complement(646..2097) product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099227.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene trkH CDS complement(2142..2753) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(2753..4084) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444545.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene pepQ CDS 4275..6464 product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099230.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene fadB CDS 6475..7638 product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438702.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene fadA CDS complement(7705..8406) product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807928.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene fre CDS complement(8469..9938) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368839.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene ubiD CDS 10130..10618 product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene rfaH CDS complement(10627..11409) product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277865.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene tatD CDS complement(11616..12392) product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257554.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene tatC CDS complement(12395..12949) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459611.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene tatB CDS complement(12953..13219) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099238.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene tatA CDS complement(13287..14927) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187543.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene ubiB CDS complement(14924..15532) product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099240.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene ubiJ CDS complement(15545..16300) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229009.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene ubiE CDS complement(16437..17840) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099242.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene rmuC CDS complement(18081..19358) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208223.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(19424..20185) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860792.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene udp CDS 20442..21269 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703993.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(21533..22825) product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(23010..23735) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435717.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(23779..25524) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644028.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(25540..26955) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(27381..29642) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153917.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene metE CDS 29875..30828 product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099245.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene metR CDS complement(30716..31654) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099246.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(31785..32600) product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099247.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene yigL CDS complement(32622..33620) product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703989.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene pldB CDS complement(33862..34485) product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928828.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene rhtC CDS complement(34551..36377) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368858.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene recQ CDS complement(36445..37308) product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259700.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene pldA CDS 37486..37956 product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277142.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene yigI CDS 38006..38902 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339085.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene rarD CDS complement(39256..40206) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883400.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene corA CDS complement(40506..42671) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene uvrD CDS complement(42735..43451) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099256.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene yigB CDS complement(43451..44356) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099257.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene xerC CDS complement(44353..45057) product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099258.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(45054..45878) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703982.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene dapF CDS complement(45914..46120) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799903.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 46276..46596 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999925.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene cyaY CDS complement(46597..49155) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099262.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene cyaA CDS 49442..50383 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703979.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene hemC CDS 50380..51141 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883127.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene hemD CDS 51141..52319 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138976.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene hemX CDS 52322..53518 product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979262.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene hemY tRNA complement(54937..55013) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(55048..55134) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(55149..55224) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(55288..55364) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(55467..56852) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774741.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(57028..57771) product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064040.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene wecG CDS complement(57761..59137) product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099270.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene wzyE CDS complement(59134..60210) product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217177.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(60207..61457) product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene wzxE CDS complement(61457..62587) product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene rffA CDS complement(62592..63287) product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145170.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene rffC CDS complement(63278..64540) product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099275.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene wecC CDS complement(64537..65667) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306792.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene wecB CDS complement(65734..66780) product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193415.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene wzzE CDS complement(66801..67892) product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050960.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene wecA CDS complement(68130..69389) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883293.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene rho CDS complement(69721..70050) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883224.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene trxA CDS 70226..71488 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene rhlB CDS 71495..72982 product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene gppA CDS complement(73003..75024) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099281.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene rep CDS 75215..75499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 75463..75744 product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene ppiC CDS 76009..76674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 76679..77092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 77099..77959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(78072..79547) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024951.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene ilvC CDS 79699..80592 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099284.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene ilvY CDS complement(80589..82133) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368895.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene ilvA CDS complement(82136..83986) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127399.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene ilvD CDS complement(84123..85052) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208520.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene ilvE CDS complement(85075..85332) product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368897.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene ilvM CDS complement(85329..86975) product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099288.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene ilvG CDS 87532..89088 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058957.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(89120..89458) product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene maoP CDS 89578..90399 product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703960.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene hdfR tRNA complement(90489..90564) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(90573..90649) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 sequence036 source 1..1264 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 151..693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 703..1089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 sequence037 source 1..1240 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence038 source 1..1225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 sequence039 source 1..1198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 67..333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 note possible pseudo, frameshifted CDS complement(552..782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 822..1166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 sequence040 source 1..1188 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4..720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 717..1019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 sequence041 source 1..1121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 109..1098 product IS630-like element ISEc33 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046092923.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 sequence042 source 1..1114 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(332..628) product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217738.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 sequence043 source 1..1033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1032 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015368828.1:elongation factor Tu locus_tag LOCUS_05490 sequence044 source 1..1008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence045 source 1..978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..639 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097113.1:PTS glucose transporter subunit IIBC locus_tag LOCUS_05500 sequence046 source 1..90478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(161..733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 1619..2908 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144384.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene avtA CDS complement(2994..4838) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094939.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene selB CDS complement(4835..6220) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206275.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene selA CDS complement(6291..6899) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094937.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 7354..9258 product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene mtlA CDS 9460..10608 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703789.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene mtlD CDS 10669..11190 product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094931.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene mtlR CDS 11260..11622 product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665677.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(11625..13001) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985735.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(13086..13757) product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703947.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene yiiM CDS complement(13987..14607) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297064.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene sodA CDS 14891..15925 product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene rhaT CDS complement(16018..16860) product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368942.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene rhaR CDS complement(16931..17767) product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene rhaS CDS 18097..19566 product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099337.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene rhaB CDS 19563..20822 product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene rhaA CDS 21059..21883 product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703941.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene rhaD CDS 21945..23093 product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009255.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene fucO CDS 23090..23404 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368949.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene rhaM CDS 23579..24136 product DUF2726 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693640.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(24146..24853) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753617.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene fdhD CDS 25128..28178 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086527976.1 transl_table 11 codon_start 1 transl_except (pos:25713..25715,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_05730 gene fdnG CDS 28191..29093 product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331359.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene fdxH CDS 29090..29725 product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368962.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene fdoI CDS 30034..30963 product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099358.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene fdhE tRNA 31289..31383 product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 31545..32723 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209587.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 32743..34602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 34599..35021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(35395..35970) product phage polarity suppression protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(35988..36230) product ogr/Delta-like zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(36227..37030) product capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167686221.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 37579..37845 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556587.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(37859..38047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 38244..38441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 38434..38733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 38726..39175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 39248..39508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216603.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 39505..39825 product DUF5375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795388.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 39837..42170 product primase-like DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017694613.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 42718..43155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(43473..44258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 44374..44625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(44960..45604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(45601..45960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(46054..46839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(47052..47489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(47740..48279) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(48352..50892) product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123830139.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(51074..51778) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045365459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 53143..53358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 note possible pseudo, internal stop codon, frameshifted CDS complement(54578..54889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 55057..55800 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706192.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 55793..56272 product FidL-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089600890.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(56454..57188) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200832809.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(57189..57440) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095136.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(57452..58219) product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095135.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(58216..59478) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(59465..60865) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200832808.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(60862..62814) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095132.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(62820..63980) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095131.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(63977..66118) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095130.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(66128..67078) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120159871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(67075..67785) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120159870.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(67836..68030) product DUF4762 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095127.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(68045..68254) product DUF4762 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095127.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(68339..69022) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095126.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(69049..69594) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(69618..70679) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095124.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(70588..70782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(70884..71618) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095123.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(71660..74131) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120159885.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(74817..75353) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095121.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(75448..75657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(76519..78654) product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(78681..79940) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(79958..81289) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(81294..81956) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094834.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(82033..82218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 82415..86044 product autotransporter adhesin EhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001491890.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene ehaA CDS 86319..86486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 86742..87365 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094832.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(87470..88369) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(88413..88937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 89669..90313 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529671.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 sequence047 source 1..976 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(91..510) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005760706.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(523..975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 sequence048 source 1..972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 426..893 product DUF6392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098592.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 sequence049 source 1..927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence050 source 1..925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(57..242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(293..559) product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 sequence051 source 1..920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 444..842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 sequence052 source 1..879 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 448..813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 sequence053 source 1..875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(160..507) product immunity 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218298.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 sequence054 source 1..850 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence055 source 1..837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..775 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393010.1:site-specific tyrosine recombinase XerD locus_tag LOCUS_06440 sequence056 source 1..831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 168..443 product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143987.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 440..769 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529821.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 sequence057 source 1..85897 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(74..535) product OapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069611.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 864..1484 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002886687.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene fklB CDS 2207..3619 product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095311.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene cycA CDS complement(3683..4345) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene ytfE CDS complement(4406..4810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 note possible pseudo, frameshifted CDS complement(4830..5381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 note possible pseudo, frameshifted CDS complement(5520..7466) product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene cpdB CDS 7684..8430 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886919.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene cysQ CDS complement(8420..8974) product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704190.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 9311..9517 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501430.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(9896..11230) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935036.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(11480..12118) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305659.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene msrA CDS 12332..14068 product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095333.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene tamA CDS 14065..17838 product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095334.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene tamB CDS 17841..18185 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704194.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(18501..19031) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene ppa CDS complement(19255..19593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209687.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(20386..21384) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853753.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene fbp CDS 21557..22930 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219816.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene mpl CDS complement(23198..24070) product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083151.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(24088..24690) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944226.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(24851..25396) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704200.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene yjgA CDS 25502..26842 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162171.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene pmbA CDS 27222..27890 product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 28161..28490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 28752..30407 product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099050.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene mdcA CDS 30407..31261 product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099049.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 31291..31590 product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008805033.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene mdcC CDS 31583..32416 product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 32413..33216 product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099046.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene mdcE CDS 33320..33838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 note possible pseudo, frameshifted CDS 33832..34281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 note possible pseudo, frameshifted CDS 34282..34902 product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099044.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 34899..35807 product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420731.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene mdcH CDS complement(35964..36893) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099042.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 37172..37513 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368577.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 37530..37889 product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006179053.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 37886..38182 product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810338.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 38209..38985 product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 38997..39638 product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368573.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 39682..40815 product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095351.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 40799..41914 product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095352.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 41911..42651 product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095353.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 42988..44142 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095354.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 44166..46076 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704203.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(46085..47098) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130415.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 47301..47549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(48058..48939) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(48948..49943) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098907.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 50157..50687 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098906.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 50681..51184 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703593.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(51171..51458) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928379.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 51560..52018 product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369539.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 52056..52706 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086288.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 52900..53262 product YfaZ family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095440.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(53362..53643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(55045..55590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 55628..55747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(55814..56389) product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098899.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene dolP CDS complement(56404..56991) product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861754.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene diaA CDS complement(57019..57414) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098898.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(57372..59375) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703588.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 59436..60311 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703587.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene rsmI CDS complement(60913..62484) product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273719.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene garD CDS 63022..63798 product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098883.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene garL CDS 63828..64721 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350452.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene garR CDS complement(65533..67017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(67051..69159) product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301445.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(69542..70243) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098873.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 70349..71245 product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041010.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene yhaJ CDS complement(71232..71624) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384145.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(71686..72705) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098870.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(72773..73165) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(73868..75370) product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 75598..77262 product glycerone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098955.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(77693..78712) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098954.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 tRNA 79176..79260 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 79480..80736 product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209313.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(80811..81065) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114194633.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(81584..82663) product helicase RepA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210707.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(82656..82880) product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209920.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(82880..83758) product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 84763..85122 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263506.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 85106..85429 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274842.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 85502..85867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 sequence058 source 1..804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..518 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034461534.1:DUF4942 domain-containing protein locus_tag LOCUS_07310 tRNA complement(650..726) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 sequence059 source 1..790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(91..399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(396..671) product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975041.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 sequence060 source 1..778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence061 source 1..775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(70..375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(372..656) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 sequence062 source 1..754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 345..722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 sequence063 source 1..739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence064 source 1..732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(91..393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 sequence065 source 1..724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence066 source 1..711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 336..641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 sequence067 source 1..710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(467..709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 sequence068 source 1..80679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(114..896) product DUF4123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878141.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(899..3271) product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705822.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(3614..3799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 3845..4768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868990.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 4866..5537 product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367146.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene phoP CDS 5606..6997 product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene phoQ CDS 7071..8192 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367148.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(8297..9529) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359416.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene pepT CDS 9892..11016 product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705060.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene potA CDS 11000..11857 product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097090.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene potB CDS 11854..12636 product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580316.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene potC CDS 12702..13748 product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705058.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene potD CDS complement(13933..14643) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952746.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene cobB CDS complement(14913..16160) product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097096.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene lolE CDS complement(16160..16852) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033714.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene lolD CDS complement(16857..18056) product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097098.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene lolC CDS 18926..22372 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene mfd CDS 22487..23473 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097101.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(23569..23832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(24274..24813) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043459.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(25015..26316) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097105.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(26544..27086) product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097106.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene ycfP CDS complement(27110..28150) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097107.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene nagZ CDS complement(28147..28965) product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257320.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene thiK CDS complement(28949..29593) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097109.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene lpoB CDS complement(29604..29978) product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225295.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(29981..30340) product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097111.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene hinT CDS complement(30908..32299) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097840.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(32650..33498) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754712.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 33917..34816 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131756.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene hisG CDS 34821..36125 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009596.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene hisD CDS 36122..37186 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706029.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene hisC CDS 37183..38250 product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene hisB CDS 38250..38840 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365820.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene hisH CDS 38841..39578 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706031.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene hisA CDS 39560..40336 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706032.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene hisF CDS 40330..40950 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954876.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene hisIE CDS complement(41405..42394) product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215243.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene wzzB CDS complement(42553..43455) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815331.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene rfbA CDS complement(43455..44522) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848110.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene rffG CDS complement(44670..46079) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043484.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene gndA CDS complement(46204..47370) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene ugd CDS complement(47409..48326) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875987.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(48328..49164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(49172..50125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(50238..51350) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272486.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene glf CDS complement(51366..52598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(52595..53995) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208049.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(54045..55172) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340422.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene wecB CDS complement(55563..56516) product GalU regulator GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097865.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene galF CDS complement(56849..57229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 note possible pseudo, internal stop codon, frameshifted CDS complement(57573..57758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(57727..57903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 58511..60094 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706061.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(60787..62649) product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252331.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene asmA CDS complement(62671..63252) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097886.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene dcd CDS complement(63359..64000) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132082.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene udk CDS complement(64107..64949) product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288389.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene alkA CDS 65084..66439 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469706.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene yegD CDS complement(66618..68405) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208868.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 68685..69947 product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678984.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene mdtA CDS 69947..73069 product multidrug efflux RND transporter permease subunit MdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197863.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene mdtB CDS 73070..76153 product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667528.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene mdtC CDS 76157..77572 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134351.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 77569..78963 product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675178.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene baeS CDS 78960..79682 product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137862.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene baeR CDS 80391..80627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 sequence069 source 1..697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 136..555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 sequence070 source 1..695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 sequence071 source 1..665 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence072 source 1..638 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(100..294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 sequence073 source 1..635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 150..575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 sequence074 source 1..626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence075 source 1..605 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence076 source 1..565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence077 source 1..561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(76..324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(321..560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 sequence078 source 1..537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 11..527 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgcgagcggggataaaccg sequence079 source 1..78793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(133..528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 1167..2561 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817163.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 2783..3757 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817165.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(4064..4846) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010422.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(5680..7032) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene gorA CDS complement(7110..7952) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954235.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 8135..10177 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099196.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene prlC CDS 10198..10947 product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369267.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene rsmJ CDS 11223..11843 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368521.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 11840..13069 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368522.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(13380..13814) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004145166.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene uspA CDS complement(14298..14564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(14730..16229) product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099193.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene pitA CDS 16456..17658 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703742.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 19011..21548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 21946..22128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 22431..24983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 25042..26694 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704568.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 26710..27078 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704569.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene acpS CDS 27100..27855 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704570.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 27859..28407 product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049967.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 28429..28713 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095701.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 28744..29904 product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095702.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 30049..32610 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 32615..33835 product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367826.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 33846..34820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095705.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 34843..35550 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095706.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 35534..36169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095707.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 36182..37483 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095708.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 37494..38276 product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055491.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 38282..39634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095710.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 39645..40583 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115801845.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 40580..41575 product protein YcdU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611858.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene ycdU CDS 41847..42272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(42463..43512) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064355.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(43829..44386) product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245277.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(44451..45116) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 45310..45555 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833603.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene tusA CDS complement(45574..47763) product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106499.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene zntA CDS complement(47839..48465) product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964735.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 48603..48968 product DUF2500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042855.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(48965..49228) product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369314.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(49218..49817) product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703709.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene rsmD CDS 50038..51636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 51639..52307 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099140.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene ftsE CDS 52300..53361 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081708.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene ftsX CDS 53622..54479 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500093.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene rpoH CDS 54809..55906 product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021986.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene livJ CDS complement(56093..56479) product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778769.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene panM CDS 56890..57996 product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099132.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene livK CDS 58013..58939 product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099131.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene livH CDS 58936..60213 product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803784.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene livM CDS 60210..60977 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369325.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene livG CDS 60978..61691 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene livF CDS complement(61970..62890) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207886.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(62877..63848) product guanitoxin biosynthesis L-arginine gamma (S) hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267186.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene gntB CDS complement(63850..64068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(64814..65605) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816552.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 65926..66729 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103983.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 66729..67652 product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 67663..68460 product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729199.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 68550..69482 product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367786.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 69531..70160 product DUF2291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704700.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 70160..71704 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704699.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 71720..72787 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 72780..74285 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704701.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 74331..75128 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704698.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 75558..76001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 note possible pseudo, frameshifted CDS 75973..76323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 note possible pseudo, frameshifted CDS 77081..78754 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210212.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 sequence080 source 1..535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence081 source 1..519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence082 source 1..508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(31..378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 sequence083 source 1..477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence084 source 1..455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence085 source 1..439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence086 source 1..439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 224..418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 sequence087 source 1..432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence088 source 1..427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence089 source 1..421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence090 source 1..78729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(90..347) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434222.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene rpmA CDS complement(363..695) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025032.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene rplU CDS 936..1907 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047336.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene ispB CDS 2100..2366 product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445406.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene sfsB CDS complement(3330..4589) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369505.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene murA CDS complement(4642..4896) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369504.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene ibaG CDS complement(5021..5320) product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098932.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene mlaB CDS complement(5320..5949) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369502.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene mlaC CDS complement(5966..6520) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005018829.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene mlaD CDS complement(6525..7382) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925792.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene mlaE CDS complement(7315..8232) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098935.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene mlaF CDS 8356..9330 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369498.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 9344..10330 product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098937.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene kdsD CDS 10349..10915 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030006.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene kdsC CDS 10912..11475 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369495.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene lptC CDS 11456..11998 product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene lptA CDS 12005..12730 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206203.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene lptB CDS 12832..14265 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703606.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene rpoN CDS 14290..14577 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098943.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene hpf CDS 14637..15122 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098944.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene ptsN CDS 15169..16023 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098945.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene rapZ CDS 16020..16292 product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918431.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene npr CDS complement(16797..17546) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047098.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene mtgA CDS complement(17539..18198) product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302019.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene elbB CDS complement(18438..20783) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene arcB CDS complement(21061..21984) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299745.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 22658..27115 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703611.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene gltB CDS 27125..28543 product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369485.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene gltD CDS complement(28776..29264) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098964.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene sspB CDS complement(29270..29911) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257300.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene sspA CDS complement(30206..30598) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene rpsI CDS complement(30614..31042) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene rplM CDS complement(31394..32518) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192347.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene zapE CDS 32702..33103 product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene zapG CDS 33189..34553 product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298588.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene degQ CDS 34639..35703 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098970.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene degS CDS complement(35968..36906) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369475.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene mdh CDS 37423..37863 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257847.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene argR CDS 38178..38441 product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695690.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene yhcN CDS 38559..38825 product DUF1471 family stress response protein YhcN-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369472.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene yhcN-B CDS complement(38885..39211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103887.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(39198..40652) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098976.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(40735..42702) product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098977.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene aaeB CDS complement(42708..43652) product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene aaeA CDS complement(43645..43848) product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051840.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene aaeX CDS 44048..44968 product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098979.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene aaeR CDS complement(44999..46447) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055936.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene tldD CDS complement(46559..50353) product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253574.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene yhdP CDS complement(50386..51855) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123188.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene rng CDS complement(51845..52438) product nucleoside triphosphate pyrophosphatase YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203096.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene yhdE CDS complement(52446..52934) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098985.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene mreD CDS complement(52934..53977) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098986.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene mreC CDS complement(54038..55081) product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene mreB CDS complement(55398..57203) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098987.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene csrD CDS 57470..58552 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098988.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 58614..59615 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000740078.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene msrP CDS 59616..60215 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098990.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene msrQ CDS 60446..60898 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene aroQ CDS 60920..61387 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354626.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene accB CDS 61399..62745 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene accC CDS 62836..63078 product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098993.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 63068..64522 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175728.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene panF CDS 64534..65415 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene prmA CDS 65562..66302 product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094853.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(66320..66538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 66652..67617 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369451.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene dusB CDS 67643..67939 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene fis CDS complement(68430..68654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(68823..70646) product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096330.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(70658..70861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(71336..73447) product DUF927 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786266.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(73450..73818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(73815..74123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(74116..74304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 74679..74864 product YlcI/YnfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(75097..75321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(75434..76306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(76303..77526) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085257.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(78007..78228) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825645.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 sequence091 source 1..417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence092 source 1..415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence093 source 1..415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence094 source 1..415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence095 source 1..408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence096 source 1..406 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence097 source 1..396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 2..>396 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctcgcgcggggaacac sequence098 source 1..389 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence099 source 1..378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence100 source 1..376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence101 source 1..78008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(189..1283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 1354..1623 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099387.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 1698..2684 product stress response kinase SrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene srkA CDS 2710..3333 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368980.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene dsbA CDS complement(3363..4112) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099384.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(4168..4434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 4704..7490 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249994.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene polA CDS complement(7798..8436) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183344.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene yihA CDS 9005..9508 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301646.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene yihI CDS 9703..11076 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703930.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene hemN CDS complement(11331..12743) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368973.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene glnG CDS complement(12728..13801) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190577.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene glnL CDS complement(14134..15543) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099376.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene glnA CDS 15919..17739 product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217380.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene typA CDS 18088..18300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(18255..19127) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013540.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 19291..21003 product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087177.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 21003..22502 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828483.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 22548..22895 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 22885..23238 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 23981..24229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(24176..24379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(24963..28727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(28794..29285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 30586..31866 product virulence-associated effector SrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene srfA CDS 31870..34794 product virulence factor SrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096481.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 34791..36953 product virulence factor SrfC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419532.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(37517..39163) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367342.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(39305..40000) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096018.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(40194..41453) product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704962.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 41859..43316 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097789.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene fliD CDS 43374..43760 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene fliS CDS 43774..44133 product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816593.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene fliT CDS 44889..45137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(46035..47141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(47134..48054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(48530..48931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(49664..49933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(49930..50214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(50782..51705) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097773.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene flgL CDS complement(51758..53404) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097774.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene flgK CDS complement(53505..54458) product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene flgJ CDS complement(54458..55579) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097776.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(55590..56342) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene flgH CDS complement(56391..57173) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367325.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene flgG CDS complement(57197..57952) product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097779.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(57965..59188) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097780.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene flgE CDS complement(59226..59951) product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097781.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(59976..60380) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene flgC CDS complement(60388..60804) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160463.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene flgB CDS 61022..61690 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849222.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene flgA CDS 61804..62097 product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704933.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene flgM CDS 62119..62562 product flagellar export chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097786.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene flgN CDS 63215..63565 product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097770.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene flhD CDS 63567..64169 product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367347.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene flhC CDS 64256..65131 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene motA CDS 65138..66049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 66076..68076 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096053.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene cheA CDS 68104..68616 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367343.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene cheW CDS 68774..69016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209438141.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 69095..69667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 note possible pseudo, frameshifted CDS 69558..70139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 note possible pseudo, frameshifted CDS complement(70435..71361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(71372..72118) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051542.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(72122..73045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(73085..73849) product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298460.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(73846..75096) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815625.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(75119..75349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(75363..76013) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109873.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 76571..77851 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene fabF sequence102 source 1..373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence103 source 1..372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence104 source 1..369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence105 source 1..369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence106 source 1..364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence107 source 1..346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 2..336 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgcgagcggggataaaccg sequence108 source 1..342 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence109 source 1..340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence110 source 1..338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence111 source 1..330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence112 source 1..172978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 11..833 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgcgagcggggataaaccg CDS 1191..1676 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368294.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene folA CDS complement(2124..2975) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257195.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene apaH CDS complement(2982..3359) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095539.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene apaG CDS complement(3362..4183) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene rsmA CDS complement(4180..5169) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241277.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene pdxA CDS complement(5162..6454) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800457.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene surA CDS complement(6507..8879) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095543.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene lptD CDS 9138..9959 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704375.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene djlA CDS complement(10424..11080) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525176.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene rluA CDS complement(11092..13998) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704377.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene rapA CDS complement(14199..16559) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035641.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene polB CDS complement(16645..17514) product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252363.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene cho CDS 17732..18499 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(18731..19432) product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095553.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene thiQ CDS complement(19416..21026) product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235706.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene thiP CDS complement(21002..21985) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene thiB CDS complement(22314..23972) product HTH-type transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095556.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene sgrR CDS complement(24357..24962) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704393.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene leuD CDS complement(24973..26373) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140662.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene leuC CDS complement(26376..27467) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042365.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene leuB CDS complement(27469..29037) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368261.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene leuA CDS 29779..30723 product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095563.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene leuO CDS 31082..32806 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425632.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene ilvI CDS 32779..33300 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252744.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene ilvN CDS 33599..34645 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762406.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene cra CDS 35192..35650 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368255.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene mraZ CDS 35650..36597 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095568.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene rsmH CDS 36594..36959 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625651.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene ftsL CDS 36992..38761 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095569.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 38748..40235 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095570.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene murE CDS 40232..41590 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626670.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene murF CDS 41584..42666 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501985.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene mraY CDS 42669..43985 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796468.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene murD CDS 43985..45226 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239803.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene ftsW CDS 45223..46251 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095574.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene murG CDS 46445..47827 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095575.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene murC CDS 47820..48731 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095576.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 48733..49554 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368242.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene ftsQ CDS 49557..50813 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006173845.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene ftsA CDS 50875..52029 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462798.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene ftsZ CDS 52131..53048 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595474.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene lpxC CDS 53279..53815 product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014320.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene secM CDS 53883..56588 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905763.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene secA CDS 56800..57195 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368238.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene mutT CDS complement(57351..57551) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856332.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene yacG CDS complement(57561..58304) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557441.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene zapD CDS complement(58304..58924) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704406.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene coaE CDS complement(58932..59114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 59182..60225 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217357.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(60433..61641) product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095586.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene hofC CDS complement(61631..63007) product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene gspE CDS complement(63012..63449) product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704409.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene ppdD CDS complement(63638..64534) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135134.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene nadC CDS 64618..65181 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923703.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene ampD CDS 65178..66032 product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171985.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene ampE CDS complement(66500..67858) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633582.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 68387..69151 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095596.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene pdhR CDS 69299..71962 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095597.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene aceE CDS 71977..73860 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095598.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene aceF CDS 74108..75532 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368220.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene lpdA CDS 76023..76565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 76634..77155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 77143..79725 product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878139.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 80173..82770 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095602.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene acnB CDS complement(83145..86981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 87273..87635 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368214.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene yacL CDS 87812..88762 product 2-keto-3-deoxygluconate permease 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022089.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 88774..90042 product D-threonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 90032..91015 product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448742.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 91025..91792 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678254.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(91824..92618) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene speD CDS complement(92660..93517) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095610.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene speE CDS complement(93597..93926) product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704423.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 94090..95721 product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946058.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene cueO CDS complement(96368..98758) product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704425.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 99501..100037 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683335.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene hpt CDS complement(100334..100996) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651604.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene can CDS 101253..102179 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 102176..102946 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983419.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 103110..103286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 note possible pseudo, internal stop codon CDS complement(103485..103865) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621515.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene panD CDS complement(103958..104812) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368199.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene panC CDS complement(104826..105620) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805497.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene panB CDS complement(105794..106273) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095629.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene folK CDS complement(106270..107631) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204100700.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene pcnB CDS complement(107726..108607) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937424.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene gluQRS CDS complement(108664..109119) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155227.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene dksA CDS complement(109294..109998) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396051.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene sfsA CDS complement(110012..110548) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095634.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene thpR CDS 110640..113117 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938639.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene hrpB CDS 113212..115713 product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095636.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene mrcB CDS 116393..118651 product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene fhuA CDS 118707..119504 product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704433.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene fhuC CDS 119513..120400 product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095639.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene fhuD CDS 120397..122376 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095640.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene fhuB CDS complement(122983..124239) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045277.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene hemL CDS 124412..125854 product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845433.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene clcA CDS 125936..126283 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295564.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene erpA CDS complement(126485..127105) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(127120..127923) product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704438.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene btuF CDS complement(127916..128614) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689844.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene mtnN CDS 128695..130209 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095647.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene dgt CDS 130351..131772 product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene degP CDS 132143..132409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 132683..133840 product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929458.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene cdaR CDS complement(133917..134384) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272188.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 134572..135390 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097701.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(135656..136480) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene dapD CDS complement(136524..139199) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095651.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene glnD CDS complement(139396..140190) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018194.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene map CDS 140484..141209 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246882.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene rpsB CDS 141491..142342 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501911.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene tsf CDS 142851..143576 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856194.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene pyrH CDS 143806..144363 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501909.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene frr CDS 144481..145686 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704446.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene ispC CDS 145872..146630 product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028110.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene ispU CDS 146643..147500 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095657.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene cdsA CDS 147510..148862 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949016.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene rseP CDS 148893..151298 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095659.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene bamA CDS 151414..151908 product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095660.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene skp CDS 151912..152949 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139282.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene lpxD CDS 153059..153514 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210739.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene fabZ CDS 153518..154306 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565966.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene lpxA CDS 154307..155455 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741216.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene lpxB CDS 155452..156048 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569430.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene rnhB CDS 156070..159552 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095665.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene dnaE CDS 159643..160602 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095666.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene accA CDS 160739..161128 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095668.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 161194..162501 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418721.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene tilS CDS 162501..162821 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212150.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(163148..163408) product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830722.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene rof CDS complement(163395..163595) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518678.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 163847..164389 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185283.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 164374..164799 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene arfB CDS 164833..165504 product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene nlpE CDS complement(165536..166321) product YaeF family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336393.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(166382..168100) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260716.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene proS CDS 168116..168334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(168291..168998) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095676.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene tsaA CDS complement(168995..169399) product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202315.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene rcsF CDS complement(169514..170329) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368138.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene metQ CDS complement(170425..171078) product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294600.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(171071..172102) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene metN CDS 172216..172845 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704459.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene gmhB sequence113 source 1..76704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(75..386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 note possible pseudo, internal stop codon, frameshifted CDS complement(485..1825) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705448.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(1850..2266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(2277..3272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096186.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(3285..3569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(3627..4220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(4361..4495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 note possible pseudo, internal stop codon CDS complement(4631..5068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096174.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(5824..7191) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937912.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene xseA CDS 7360..8826 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370334.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene guaB CDS 8903..10480 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138293.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene guaA CDS complement(10966..11160) product YfgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076001.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(11207..11407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 11508..13721 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098245.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(13749..15293) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123330.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene ppx CDS complement(15296..17356) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098243.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene ppk1 CDS complement(17487..18125) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370398.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene purN CDS complement(18125..19162) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098241.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene purM CDS 19374..20000 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706208.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene upp CDS 20067..21350 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098238.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene uraA CDS 21426..22151 product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100388.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(22364..22720) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166449.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene arsC CDS complement(22735..24198) product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene bepA CDS complement(24479..26023) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187329.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 26263..27336 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892056.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(27533..28006) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098229.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene bcp CDS complement(28022..28588) product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098228.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 28736..29614 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295469.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene dapA CDS 29631..30659 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene bamC CDS 30893..31606 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501631.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 31799..32671 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098225.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 32675..34705 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703147.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(34788..34979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(35007..36134) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277830.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene dapE CDS complement(36137..36493) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(37002..40118) product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273151.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene acrD CDS complement(40267..40911) product nitrate/nitrite response regulator protein NarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115500.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene narP CDS complement(40908..42650) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296285.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene narQ CDS complement(42882..43061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 43259..43741 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208536.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene napF CDS 43741..44004 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557378.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene napD CDS 44001..46487 product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778047.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene napA CDS 46491..47186 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene napG CDS 47173..48036 product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013513.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene napH CDS 48072..48479 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835177.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene napB CDS 48488..49084 product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528376.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene napC CDS 49185..49757 product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138361092.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene nudK CDS 49893..50912 product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(50901..52895) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098214.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene tkt CDS complement(52914..53864) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703140.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene tal CDS 54134..56413 product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098212.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene maeB CDS complement(56541..57065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(57312..58205) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309639.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene hemF CDS complement(58211..59083) product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102910.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene amiA CDS 59399..59824 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406000.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(59891..60277) product OB fold stress tolerance protein YgiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene ygiW CDS 60376..60810 product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 60871..61434 product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838944.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 61539..62438 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098206.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 62603..63619 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365488.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 63619..64449 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458408.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene cysT CDS 64449..65321 product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene cysW CDS 65311..66396 product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098202.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene cysA CDS 66664..67590 product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365492.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene cysM CDS complement(68101..68604) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522253.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene crr CDS complement(68648..70375) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene ptsI CDS complement(70423..70680) product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene ptsH CDS complement(71059..72030) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034402.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene cysK CDS complement(72188..72949) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254835.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene cysZ CDS 73180..74181 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene zipA CDS 74248..76266 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878165.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene ligA CDS 76268..76483 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114688.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 sequence114 source 1..324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence115 source 1..323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence116 source 1..322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence117 source 1..322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence118 source 1..322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence119 source 1..321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence120 source 1..317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 sequence121 source 1..308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence122 source 1..307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence123 source 1..302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence124 source 1..72352 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(318..545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(1325..1555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 1966..3951 product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446029.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene pqqU CDS complement(4582..5106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(5124..6356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(6359..6943) product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301577.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(6934..7173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 7755..9146 product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096516.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 9233..12973 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040363.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 12970..14514 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702603.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene narH CDS 14514..15209 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166367.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene narW CDS 15206..15886 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367083.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene narI CDS 16184..17905 product alpha,alpha-trehalase TreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934251.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene treF CDS complement(18308..18481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 18733..18954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(18996..19829) product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367002.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(19834..21153) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367003.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(21501..22157) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096488.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(22616..23647) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682108.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(23681..23842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 24041..24559 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(24823..25068) product DUF2526 family protein YdcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018633.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene ydcY CDS complement(25473..28775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(29060..29308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 29430..30968 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096554.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(31207..33174) product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303492.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene rlhA CDS 33366..33938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(33967..34488) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705566.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 34523..35752 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238501.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(35760..37253) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(37876..38472) product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218282.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene tehB CDS 38502..38666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(39450..40004) product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350184.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene cas6f CDS complement(40016..41017) product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029749.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene csy3 CDS complement(41029..41973) product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene csy2 CDS complement(41970..43289) product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene csy1 CDS complement(43579..46575) product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101563.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene cas3f CDS complement(47377..48891) product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366380.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(48932..50275) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013811.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 50581..51501 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366376.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 51676..51981 product DUF1471 family virulence protein SrfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745961.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene srfN CDS 52809..53147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(53256..54377) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(54697..56139) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115947.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene aldA CDS complement(56355..57152) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098505.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(57286..61185) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420907.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene hrpA CDS 61389..61994 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048950.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene azoR CDS complement(62155..62691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(63649..63855) product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688201.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(63855..66485) product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 66692..67681 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096773.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 67796..68230 product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366322.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene hslJ CDS complement(68224..68490) product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705621.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 68773..72318 product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705622.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene nifJ sequence125 source 1..300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence126 source 1..223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence127 source 1..68977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 27..857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(812..1603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1600..2730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(2742..3587) product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene hisJ CDS complement(3584..4612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 4899..8837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 8837..11257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 11254..12399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 12400..14256 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895630.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 14265..14846 product 4Fe-4S single cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230227.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(15088..15708) product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860996.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(15901..17316) product YfjI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035339735.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(17440..17676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(18191..18937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 19452..19610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210363.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(19607..20221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(20226..21542) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480579.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(22036..25902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(25962..27212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(27273..27959) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(27961..28908) product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(28905..29147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(29505..30812) product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194628.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene phnY CDS complement(31083..31685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(31807..32289) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310415.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(32294..32755) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070733.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 32860..33774 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(33844..34617) product NADPH-dependent ferric chelate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066496.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene nfeF CDS 34916..35503 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(35625..35987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 35904..37853 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121479.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene fadH CDS complement(38026..39156) product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703562.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene rlmG CDS 39611..40696 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118793072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 40957..41736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 note possible pseudo, internal stop codon, frameshifted CDS 41993..42961 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703564.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 43433..44683 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene sstT CDS 45596..46258 product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422141.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene yqjA CDS 46267..46638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 47071..47370 product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 47374..47772 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785626.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 47765..48058 product YqjK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703570.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(48155..49237) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098949.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene lptG CDS complement(49237..50343) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene lptF CDS 50620..52131 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098951.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene pepA CDS 52472..52921 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368546.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene holC CDS 52934..55789 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368547.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(56127..57287) product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209177.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 57472..57936 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519079.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(58111..58869) product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene miaE CDS complement(58926..59345) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002940.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene rraB CDS 59504..60511 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095378.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene argF CDS complement(60547..60999) product toxin-antitoxin biofilm protein TabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583469.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene tabA CDS 61198..61362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 61355..62290 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013042.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene pyrB CDS 62303..62764 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095364.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene pyrI CDS 62830..63225 product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162498.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene ridA CDS complement(63812..66220) product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704211.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 66808..68943 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368566.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene nrdD sequence128 source 1..66818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 547..2418 product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703497.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene gss CDS 2863..3237 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462158.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 3750..3908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(4249..4416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(4423..6714) product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704310.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene opgB CDS complement(7376..7861) product DUF2501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704311.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(7996..8736) product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368406.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene dnaC CDS complement(8739..9278) product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298056.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene dnaT CDS 10218..10901 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704315.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(11682..12140) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368396.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(12273..13052) product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155106701.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene fhuF CDS 13245..13490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 note possible pseudo, internal stop codon tRNA complement(13543..13630) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(13673..13759) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(13793..13879) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(14002..15030) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272341.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene rsmC CDS 15204..15608 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204030.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene holD CDS 15586..16029 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095481.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene rimI CDS 16050..16727 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095482.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene yjjG CDS 16837..18426 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175968.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene prfC CDS 18798..19412 product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095484.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene osmY CDS 19542..19703 product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176651.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 19997..21142 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531551.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 21139..21915 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000563040.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 22066..23343 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209214.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 23607..24386 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368381.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene deoC CDS 24412..25734 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095490.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene deoA CDS 25967..27190 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816471.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene deoB CDS 27249..27971 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene deoD CDS complement(28466..29347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 29977..30309 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214300.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(30454..31980) product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463563.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(32167..32847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(34409..35059) product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090067.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 35164..36135 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095495.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene serB CDS 36140..37522 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029687.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene radA CDS 37596..38840 product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532645.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene nadR CDS complement(39352..41019) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046754.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene ettA CDS 41527..43464 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095501.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene sltY CDS 43533..43868 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095502.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene trpR CDS complement(43862..44377) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882672.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene yjjX CDS 44560..45207 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942359.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene gpmB CDS complement(45204..46073) product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371679.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene robA CDS 46171..46752 product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095506.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene creA CDS complement(47123..47839) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856501.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene arcA CDS 48482..49168 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223164.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 49528..51993 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264731.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene thrA CDS 51995..52924 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241685.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene thrB CDS 52928..54208 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781063.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene thrC CDS complement(54540..55313) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906171.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene yaaA CDS complement(55375..56787) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112565.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 57037..57990 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130185.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene tal CDS 58100..58687 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368355.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene mog CDS 58864..60180 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704337.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(60362..60928) product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095518.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene satP CDS 61228..63138 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516126.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene dnaK CDS 63226..64371 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368350.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene dnaJ CDS 64634..65815 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681841.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene nhaA CDS 65850..66743 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene nhaR sequence129 source 1..65705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(89..379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 note possible pseudo, internal stop codon, frameshifted CDS complement(376..675) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149473.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(837..2054) product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704303.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(2051..3535) product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704305.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(3571..3963) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(3977..5416) product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704304.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(5413..6054) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198701.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene dgoA CDS complement(6051..7088) product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267365.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 7339..8109 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(8193..8789) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121044.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 8910..10403 product methyl viologen efflux MFS transporter SmvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489748.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene smvA CDS complement(10604..10870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(11749..12258) product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136192.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(12926..13144) product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291435.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(13172..13546) product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499288.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene tomB CDS complement(14249..17398) product multidrug efflux RND transporter permease subunit AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095890.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene acrB CDS complement(17421..18614) product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095891.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene acrA CDS 18758..19399 product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101755.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene acrR CDS 19515..22889 product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177732.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene mscK CDS complement(22881..23036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(23051..23578) product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704614.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene priC CDS 23645..24022 product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704615.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 24170..24721 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127348.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene apt CDS 24810..26798 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121969.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene dnaX CDS 26888..27217 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 27217..27822 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095898.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene recR CDS 27969..29843 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682145.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene htpG CDS 30282..30926 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367904.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene adk CDS 31114..32079 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250103.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene hemH CDS complement(32490..34169) product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546202.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene ybaL CDS complement(34410..35627) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251598.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 35833..37485 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704618.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene ushA CDS complement(37487..37966) product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186620.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene ybaK CDS complement(38160..38960) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367896.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 39638..40015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 40005..40292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(40794..43295) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083904.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene copA CDS 43523..44410 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107361.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(44477..44737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(44773..44988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 45297..45701 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026762.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene cueR CDS complement(46168..46560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 46636..46911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 note possible pseudo, internal stop codon CDS 47017..47643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 note possible pseudo, internal stop codon CDS complement(47791..48240) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561177.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(48237..49154) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906145.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(49257..50111) product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295322.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene cnoX CDS complement(50178..50948) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(50977..51633) product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704624.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene tesA CDS 51571..52254 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367886.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 52254..54668 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561872.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(55109..56314) product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095917.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene mnmH CDS complement(56495..57562) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095918.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene purK CDS complement(57562..58068) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367880.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene purE CDS complement(58266..58511) product DUF1158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682518.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(58656..59381) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212291.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene lpxH CDS complement(59385..59879) product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256006.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene ppiB CDS 60055..61440 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704630.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene cysS CDS 61935..62678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(63015..63227) product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310620.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene ybcJ CDS complement(63229..64092) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095929.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene folD tRNA 64333..64409 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 sequence130 source 1..62990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..807 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704285.1:hemagglutinin repeat-containing protein locus_tag LOCUS_14800 CDS 804..1277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 1407..1646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(1683..2507) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098513.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 2673..4229 product maltose/glucose-specific PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098512.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 4229..4936 product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098511.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 4991..5662 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098510.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene queE CDS 5738..7063 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(7582..7941) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165931770.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene queD CDS 7897..8163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(8227..8496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(9123..10859) product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989494.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 11290..13083 product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene cysJ CDS 13083..14798 product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene cysI CDS 14811..15545 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080392.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene cysH CDS complement(15908..16945) product alkaline phosphatase isozyme conversion aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490435.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene iap CDS 17220..18128 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499613.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene cysD CDS 18140..19576 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090361.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene cysN CDS 19576..20181 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369981.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene cysC CDS 20235..20558 product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098502.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 20725..21036 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369983.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene ftsB CDS 21052..21768 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098500.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene ispD CDS 21768..22247 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene ispF CDS 22244..23290 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098498.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene truD CDS 23271..24032 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883175.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene surE CDS 24026..24652 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253542.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 25093..26058 product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272624.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene nlpD CDS 26239..27231 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene rpoS CDS complement(27483..30041) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272888.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene mutS CDS 30790..31701 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476820.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene mltB CDS 31822..32319 product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene pncC CDS 32412..33476 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963150.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene recA CDS 33547..34041 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098437.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene recX CDS 34179..36806 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047160.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene alaS CDS 37041..37226 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene csrA tRNA 37585..37677 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 37681..37757 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 37906..37982 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 38156..38232 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 38562..39128 product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703238.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene yqaB CDS 39125..39553 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152081995.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 39633..41186 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098433.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene gshA CDS 41338..41853 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098432.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene luxS CDS complement(41929..42099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(42131..43684) product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703236.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene emrB CDS complement(43686..44852) product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098428.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene emrA CDS complement(44994..45524) product multidrug efflux transporter EmrAB transcriptional repressor EmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378442.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene emrR CDS complement(45981..46529) product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133998.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene idi CDS complement(46634..47845) product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830774.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene ampH CDS 48399..49616 product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095803.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene sbmA CDS 49684..50775 product DUF1615 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704539.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(50782..51093) product DUF2755 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095805.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 51660..52358 product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095808.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 52470..53663 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368028.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 53890..54150 product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095810.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene iraP CDS complement(54781..55590) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412190.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene proC CDS 55882..56334 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158137.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 56600..56764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 57292..57831 product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene aroL CDS 58055..58729 product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095818.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 58806..59087 product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095819.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene ppnP CDS complement(59469..59825) product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370080.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 60005..60346 product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370081.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(60599..60778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370085.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 61405..62157 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211655.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(62141..62785) product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215903.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 sequence131 source 1..62169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 409..1047 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096285.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene ompW CDS complement(1445..1762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(2541..3350) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096355.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene trpA CDS complement(3350..4543) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096356.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene trpB CDS complement(4554..5918) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983893.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene trpCF CDS complement(5926..6924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 note possible pseudo, frameshifted CDS complement(6942..7520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 note possible pseudo, frameshifted CDS complement(7520..9106) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883574.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 9356..10234 product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096361.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene rnm CDS 10231..10851 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295575.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 11213..11422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 12058..12936 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291217.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene rluB CDS 12997..13209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(13297..13887) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366219.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene cobO CDS complement(13884..14645) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 14834..15931 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422053.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene sohB CDS complement(16235..16486) product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031530.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 16890..19487 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513593.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene topA CDS 19668..20642 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene cysB CDS 21424..24099 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705737.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene acnA CDS complement(24313..24903) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096372.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene ribA CDS 25103..25861 product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420925.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene pgpB CDS 26004..26324 product lipopolysaccharide assembly protein LapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876284.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene lapA CDS 26331..27500 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096375.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene lapB CDS 27671..28405 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881808.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene pyrF CDS 28405..28731 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295580.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene yciH CDS complement(28821..29036) product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501216.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene osmB CDS 30410..30922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 31020..31250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 31268..32515 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095134.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 32508..33275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 33277..34020 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051542.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 34073..34960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 35002..36579 product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113330.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(36764..38695) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485012.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene rnb CDS complement(38975..39763) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506485.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene fabI CDS complement(40088..40894) product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366242.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene sapF CDS complement(40894..41886) product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096394.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene sapD CDS complement(41886..42776) product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146170.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene sapC CDS complement(42763..43728) product peptide ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583298.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene sapB CDS complement(43725..45365) product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241626.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene sapA CDS complement(45460..47772) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705665.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 47947..49113 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366269.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 49169..50560 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705664.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(50710..51696) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298101.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene pspF CDS 51867..52535 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366272.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene pspA CDS 52585..52812 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene pspB CDS 52812..53165 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907387.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene pspC CDS 53195..53431 product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295585.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene pspD CDS 53541..54938 product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825801.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 54935..55999 product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138717.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 56139..57677 product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295587.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene tyrR CDS complement(57925..58431) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366280.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene tpx CDS 58562..59536 product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261211.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene ycjG CDS 60479..62098 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096426.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 sequence132 source 1..61785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(196..690) product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426135.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(776..1231) product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106616.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene yfbV CDS 1567..2769 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095689.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene ackA CDS 2851..4989 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098116.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene pta CDS 5178..5888 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083620.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 5885..6349 product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073203.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 6360..7475 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097629.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 7897..8661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 note possible pseudo, internal stop codon, frameshifted CDS 8672..8875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(8802..9107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(10138..10806) product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230215.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene yfcD CDS complement(10902..11456) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706165.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene yfcE CDS complement(11502..11810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 note possible pseudo, internal stop codon, frameshifted CDS 12235..12852 product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566559.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene yfcG CDS 12915..13280 product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098127.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene folX CDS 13302..14198 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706167.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(14817..15401) product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098133.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(15535..17049) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334220.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene purF CDS complement(17086..17571) product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098135.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene cvpA CDS complement(17748..18374) product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146992.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene dedD CDS complement(18391..19656) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098137.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene folC CDS complement(19717..20637) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118383.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene accD CDS complement(21185..21850) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098139.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(21874..22683) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283581.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene truA CDS complement(22683..23696) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365551.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(23753..24889) product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706175.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene pdxB CDS 25126..26136 product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553395.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene flk CDS complement(26307..27482) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098144.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(27703..28923) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706178.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene fabB CDS 29082..31079 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098146.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene mnmC CDS complement(31117..31479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(31780..32058) product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098147.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(32085..32624) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365544.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(32630..33427) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098149.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(33440..34264) product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706180.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene mepA CDS complement(34269..35354) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706181.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene aroC CDS complement(35421..36353) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001542329.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene prmB CDS 36528..37079 product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730817.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene smrB CDS complement(37307..37795) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832802.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene sixA CDS complement(38009..40159) product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214156.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene fadJ CDS complement(40159..41469) product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706184.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene fadI CDS 41957..42757 product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989071.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 42873..43100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(43185..43469) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296261.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 43843..45168 product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078223.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene fadL CDS complement(45308..46069) product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776774.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene mlaA CDS complement(46169..47371) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815901.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene ccmI CDS complement(47368..47835) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703210.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(47832..48389) product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824439.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene dsbE CDS complement(48389..50338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(50338..50814) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158631.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene ccmE CDS complement(50815..51033) product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815899.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene ccmD CDS complement(51033..51770) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006798169.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(51876..52535) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971730.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene ccmB CDS complement(52532..53152) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370110.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene ccmA CDS 53344..54210 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365532.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 tRNA 54305..54379 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 54557..55747 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706186.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 56358..57581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036781.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 57578..58066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 58063..60024 product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036780.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(60314..61096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(61089..61706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 sequence133 source 1..59072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 279..1514 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 1517..4075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 4099..6195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 6215..12046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 12177..12554 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537487.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 tRNA 13391..13466 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(13903..14196) product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062282.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene cas2e CDS complement(14193..15116) product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220066.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene cas1e CDS complement(15116..15778) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281411.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene cas6e CDS complement(15778..16515) product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene cas5e CDS complement(16527..17615) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044180303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene cas7e CDS complement(17649..18242) product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935107.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene casB CDS complement(18235..19800) product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene casA CDS complement(20310..23048) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233978.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 23471..24928 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428186.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 tRNA 25060..25135 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(25512..26939) product multidrug efflux MATE transporter EmmdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120727113.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene emmdR tRNA 27127..27202 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 27383..28657 product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032666220.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(28704..30092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(30539..33811) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385732.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(33808..35115) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(35118..37121) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385729.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(37553..39271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(39583..39906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(39990..40505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(40532..40846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 41767..41961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 42468..43979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(44055..44747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 45493..45792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(45889..46284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(46397..46690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(46781..47068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(47085..47471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(47486..47797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(47827..48042) product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071599.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(48228..49091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 49718..49933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 note possible pseudo, frameshifted CDS 50291..50665 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143718.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 50662..51354 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095078.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(51968..52756) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105226.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(53013..53207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 53372..54091 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705999.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(54489..54809) product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432067.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(54979..56037) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706020.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 56313..57077 product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827390.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 57083..58843 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531857.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 58840..59052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 sequence134 source 1..58568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(70..519) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196065.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene rplI CDS complement(561..788) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene rpsR CDS complement(793..1107) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001768658.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene priB CDS complement(1114..1512) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216677.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene rpsF CDS 2045..2353 product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368621.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene bsmA CDS 2484..2759 product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441025.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene yjfN CDS complement(2750..4396) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095296.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(4526..5260) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704174.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene rlmB CDS complement(5323..7764) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076357.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene rnr CDS complement(7804..8229) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177639.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene nsrR CDS complement(8396..9694) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002885665.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(9798..9995) product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089295.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(10151..11155) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232412.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene hflC CDS complement(11158..12390) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095289.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene hflK CDS complement(12577..13857) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095288.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene hflX CDS complement(13935..14249) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368633.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene hfq CDS complement(14357..15307) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280339.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene miaA CDS complement(15300..17207) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704168.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene mutL CDS complement(17229..18548) product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619489.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene amiB CDS complement(18563..19024) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704166.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene tsaE CDS complement(19031..20542) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418520.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene nnr CDS 20541..21680 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294246.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene queG tRNA complement(22104..22179) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(22241..22316) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(22379..22454) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(22634..23197) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209143.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene orn CDS 23295..24347 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041948.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene rsgA CDS 24437..25669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 25696..29022 product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236803.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene mscM CDS complement(29227..30204) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095276.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene epmA CDS 30692..32482 product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095275.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene frdA CDS 32475..33209 product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704156.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene frdB CDS 33221..33616 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208763.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene frdC CDS 33626..33985 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299198.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene frdD CDS 34196..34738 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238395.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(34725..35042) product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704154.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene sugE CDS complement(35212..35358) product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239598.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene ecnB CDS complement(35590..36156) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene efp CDS 36244..37227 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940500.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene epmB CDS 37707..39446 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405043.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 39474..40793 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 40795..42165 product alkaline protease secretion protein AprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110827.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene aprF CDS 42240..44009 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 45450..45728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 45862..47337 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(47390..47743) product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605289.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(49540..51186) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368665.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene groL CDS complement(51234..51527) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209127.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(51665..52177) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095258.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene fxsA CDS 52480..53916 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855923.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene aspA CDS 54032..55333 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368669.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 55759..56082 product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704145.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene cutA CDS 56058..57815 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068881.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 57847..58440 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188506.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 sequence135 source 1..139748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 596..2428 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098111.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(2531..3130) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098110.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene yfbR CDS complement(3253..4467) product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074540.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene alaA CDS 5414..6349 product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881734.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene lrhA CDS 6982..7425 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062993.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene nuoA CDS 7441..8115 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913178.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene nuoB CDS 8218..10017 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098106.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene nuoC CDS 10020..10520 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene nuoE CDS 10517..11854 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789500.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene nuoF CDS 12068..14797 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene nuoG CDS 14801..15778 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365589.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene nuoH CDS 15793..16335 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172749.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene nuoI CDS 16346..16900 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393511.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene nuoJ CDS 16897..17199 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004865088.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene nuoK CDS 17196..19037 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832758.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene nuoL CDS 19157..20686 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365593.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene nuoM CDS 20694..22151 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156669.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene nuoN CDS 22493..22975 product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705072.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 23080..23619 product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168624.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(24170..25102) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098099.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene rnz CDS 25225..25410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 25514..25957 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 26028..26336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 26450..27754 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191428.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene menF CDS 27838..29508 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098095.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene menD CDS 29505..30275 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210246.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene menH CDS 30278..31135 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640013.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene menB CDS 31135..32100 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098092.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene menC CDS 32097..33536 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577547.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene menE CDS complement(33731..34651) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 34950..36281 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 36333..37082 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098400.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 37097..37945 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098399.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 37942..38943 product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098398.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 39746..40945 product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935685.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 41239..42588 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365615.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene glpT CDS complement(42666..44204) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527971.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(44205..46034) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533440.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(46045..46887) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527973.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(46889..47914) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527972.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 48204..49004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 49046..50107 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919053.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(50802..51794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(52244..52504) product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533921.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene yfaE CDS complement(52507..53637) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene nrdB CDS complement(53854..56139) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098011.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene nrdA CDS 56601..56780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(56874..57629) product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098010.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene ubiG CDS 57787..60420 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098009.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene gyrA CDS 60826..63687 product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098008.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene rcsC CDS complement(64084..64734) product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061917.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene rcsB CDS complement(64750..67332) product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619743.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene rcsD CDS 68213..69316 product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865526.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 70169..71215 product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784304.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene apbE CDS 71288..72343 product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786374.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene ada CDS 72346..72987 product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365631.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene alkB CDS 73053..74720 product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098002.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 tRNA complement(75041..75117) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(75194..76957) product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256152.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene yejM CDS complement(76977..77204) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208836.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 77439..78449 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097995.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene yejK CDS complement(78523..78807) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365674.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene rplY CDS complement(79011..79280) product protein YnfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720962.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene ynfN CDS complement(79507..79719) product cold shock-like protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066484.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene cspB CDS 79745..79921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(80399..82258) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706128.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 82310..83017 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097990.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene rsuA CDS 82998..84224 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 84781..85149 product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097988.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(85155..85307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(85644..87242) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097983.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(87419..87808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(88389..89102) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178088.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(89151..90128) product zinc-binding GTPase YeiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198816.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene yeiR CDS complement(90435..91007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 note possible pseudo, internal stop codon CDS 91171..91425 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365691.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(91398..92603) product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene setB CDS 92969..94108 product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706118.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene fruB CDS 94105..95040 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365695.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene fruK CDS 95061..96743 product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097965.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene fruA CDS 96840..97730 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703472.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(97983..98840) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706116.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene nfo CDS 99171..100043 product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548316.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene yieE CDS 100225..101694 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365702.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 102136..104124 product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489254.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene cirA CDS 104706..105647 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535960.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(105644..106480) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097959.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene fghA CDS 106735..107403 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097957.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene folE CDS 107425..108558 product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097956.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene yeiB CDS complement(109006..109752) product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920079.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene sanA CDS complement(109875..110759) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553529.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene cdd CDS complement(110887..111582) product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365717.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(111575..111979) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045719.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 112251..113186 product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706102.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene dusC CDS 113183..113353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(113400..113987) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097943.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 114168..114755 product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097942.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 114925..115842 product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319943.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene pbpG CDS 116008..117150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(117782..119512) product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097938.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene dld CDS 119777..122074 product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706093.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene bglX CDS 122582..123490 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097936.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 123495..124655 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278105.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 124648..125586 product glycine betaine ABC transporter ATP binding protein YehX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene yehX CDS 125583..126314 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706090.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(127085..129109) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706086.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene metG CDS 129260..130369 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097927.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene apbC CDS complement(131274..131642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 132132..132590 product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519640.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 132817..133605 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195634.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene thiM CDS 133602..134402 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822268.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene thiD CDS 134579..135631 product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500869.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene fbaB CDS complement(135800..136705) product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273393.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene yegS CDS complement(136942..138303) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001517981.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene yegQ CDS complement(138546..139688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 sequence136 source 1..57458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 405..953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(1215..1433) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098270.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(1941..2366) product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210416.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 2914..3546 product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366381.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene ycaC CDS complement(3740..3988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(4339..5817) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370328.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene der CDS complement(5935..7116) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177033.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene bamB CDS complement(7127..7747) product ancillary SecYEG translocon subunit YfgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409205.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene yfgM CDS complement(7783..9057) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene hisS CDS complement(9173..10291) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551807.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene ispG CDS complement(10326..11333) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098278.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene rodZ CDS complement(11734..12900) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003317.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(13069..13500) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963837.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene ndk CDS 13775..14623 product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098288.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene sseA CDS complement(14985..15950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(15961..18291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(18492..19271) product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098290.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene sseB CDS complement(19422..20708) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370317.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene pepB CDS complement(20933..21133) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860650.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene iscX CDS complement(21145..21480) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124471.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene fdx CDS complement(21482..23332) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene hscA CDS complement(23347..23862) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540869.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene hscB CDS complement(23942..24265) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540868.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene iscA CDS complement(24282..24668) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860661.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene iscU CDS complement(24697..25911) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775265.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene iscS CDS complement(26014..26505) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098294.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene iscR CDS complement(26645..27373) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370313.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene trmJ CDS 27493..28296 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553451.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene suhB CDS complement(28830..29951) product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173729.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(30016..30753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(31156..32184) product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172959.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(32231..33211) product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212233.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene yut CDS complement(33229..34152) product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815718.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(34173..34808) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212232.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene ureG CDS complement(34831..35517) product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212231.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(35514..36110) product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172973.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene ureE CDS complement(36121..37836) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815716.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(37839..38285) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212228.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene ureB CDS complement(38349..38651) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215288.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(40524..41780) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919165.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene glyA CDS 42073..43254 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883143.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene hmpA CDS 43654..45210 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919571.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene tsr CDS complement(45394..45732) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717694.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene glnB CDS complement(45846..47186) product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098304.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene glrR CDS complement(47183..47986) product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215898.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene qseG CDS complement(47919..49319) product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420402.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene qseE CDS complement(50065..53952) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970142.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene purL CDS 54223..55773 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098308.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene mltF CDS complement(55664..56161) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene tadA CDS 56512..57354 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370295.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 sequence137 source 1..55919 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(493..1497) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369391.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene trpS CDS complement(1502..2212) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703653.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene gph CDS complement(2205..2882) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816285.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene rpe CDS complement(2927..3739) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742132.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene dam CDS complement(3806..5023) product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099070.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene damX CDS complement(5111..6199) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420740.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene aroB CDS complement(6256..6777) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861630.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene aroK CDS complement(7148..8398) product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815963.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene hofQ CDS complement(8307..8705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(8702..9166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(9150..9686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(9683..10471) product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene pilM CDS 10590..13139 product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001367029.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene mrcA CDS complement(14180..14764) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519362.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene nudE CDS 15145..17280 product intracellular growth attenuator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099081.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 17397..18068 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520508.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene yrfG CDS 18065..18466 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660485.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene hslR CDS 18490..19368 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001753131.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene hslO CDS 19670..21289 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099086.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene pckA CDS 21566..21910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(22032..22829) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(22823..23287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(23266..24027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(24029..24478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(24475..25605) product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097344.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene gspL CDS complement(25602..26507) product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776550.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene gspK CDS complement(26519..27109) product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070569.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene gspJ CDS complement(27106..27477) product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173839.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene gspI CDS complement(27464..27919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(27930..28319) product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231211.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene gspG CDS complement(28383..29585) product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173152.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene gspF CDS complement(29587..31029) product GspE family T2SS ATPase variant ExeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704541.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene exeE CDS complement(31026..32978) product GspD family T2SS secretin variant ExeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704540.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene exeD CDS complement(32975..33763) product GspC family type II secretion system variant ExeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704539.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene exeC CDS 34158..36200 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(36693..38027) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882169.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene envZ CDS complement(38033..38752) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006177890.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene ompR CDS complement(39002..39499) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458979.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene greB CDS 39655..41982 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980764.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(42420..42698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(42996..43133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 43178..43402 product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160955.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene feoA CDS 43444..45753 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703678.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene feoB CDS 45763..46005 product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene feoC CDS 46572..48023 product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706057.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(48020..48811) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703680.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene bioH CDS 48847..49530 product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420751.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene gntX CDS 49590..50165 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099096.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene nfuA CDS complement(50457..52556) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099098.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene malQ CDS complement(52569..54977) product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082255.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene malP sequence138 source 1..54652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 346..714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(900..1973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(2102..3370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(3371..4588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(4606..5688) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528318.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(5678..6166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 6399..7307 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529929.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(7688..9232) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095457.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene tsr CDS complement(9924..10844) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene speB CDS complement(11097..12995) product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295380.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene speA CDS 13867..15021 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004149807.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene metK CDS 15954..17270 product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098659.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene galP CDS complement(17577..17777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 17847..18719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096689.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 19533..19994 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369738.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 20094..20792 product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286121.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene endA CDS 21103..21834 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098662.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene rsmE CDS 21846..22793 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593260.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene gshB CDS 22947..23510 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053178.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 23510..23929 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811925.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene ruvX CDS complement(24139..25134) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703454.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(25226..25831) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162012.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 26273..27079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(27173..27952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(27952..28458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(28525..28992) product DUF6392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098592.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(28992..30674) product S-type pyocin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096824.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(30689..31387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(31546..32214) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119916272.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(32973..34415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(34518..36167) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080500353.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 36419..37132 product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997795.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene yggS CDS 37148..37702 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157142.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 37699..37992 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173614.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene yggU CDS 38044..38637 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369727.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 38630..39766 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239943.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene hemW CDS complement(40279..42171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(42865..43581) product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984827.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(43620..43868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 note possible pseudo, frameshifted CDS complement(43945..44664) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098672.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene trmB CDS 44814..45893 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703459.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene mutY CDS 45896..46168 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098674.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 46300..47379 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098675.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene mltC tRNA 47617..47692 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(47923..48540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(48915..50267) product TraI domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640265.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(50375..52711) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095179.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(52854..53840) product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163274.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(53922..54260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(54272..54577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 sequence139 source 1..54551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(123..1310) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098187.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 1666..2895 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878155.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(2923..3240) product DUF2502 domain-containing protein YpeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490091.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene ypeC CDS 3653..4618 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098181.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene glk CDS 5406..6641 product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878147.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene alaC CDS complement(7676..7867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(7879..8730) product DUF4942 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034461534.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(8809..9012) product DUF957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839282.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(9042..9536) product DUF5983 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761698.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(9533..9910) product TA system toxin CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854823.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(9961..10320) product type IV toxin-antitoxin system YeeU family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390338.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(10344..10565) product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703392.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(10580..11059) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703393.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene radC CDS complement(11070..11537) product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042894353.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(11662..11877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(11877..12695) product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704096.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(12785..13324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(13371..13838) product protein YfjT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702495.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene yfjT CDS complement(13896..14207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(14220..14507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(14541..15044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(15041..15769) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703837.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(16217..17101) product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878129.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(17247..18209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(19840..21666) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040060.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 21876..22481 product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220727.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 22635..22862 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112216314.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 23153..23575 product putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703405.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 23563..23979 product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221617.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 24058..24606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704107.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 24713..25315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 25766..26263 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096428.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene tssB CDS 26303..27844 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023324775.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene tssC CDS 27863..29200 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211664.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene tssK CDS 29197..29850 product type VI secretion system protein TssL, short form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210015.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene tssL CDS 29854..31578 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120158270.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 31583..32074 product type VI secretion system effector Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366299.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene hcp CDS complement(32038..32247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 32246..34894 product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705646.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene tssH CDS 34896..35501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 35498..35725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 35805..38345 product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061709398.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 38346..40283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 40276..41043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 41204..41470 product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001443095.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 41474..42634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 42621..46025 product type VI secretion system membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211936.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 46025..47617 product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096439.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene tssA CDS 47638..49401 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155110255.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene tssF CDS 49356..50459 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373315.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene tssG CDS 50440..50976 product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074160625.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene tssJ CDS 50969..51421 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096444.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene tssE CDS 51436..51906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 52505..53749 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897032.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 53797..54519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 sequence140 source 1..51894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 203..1267 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550638.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(1307..2020) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105278.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 2285..3529 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266439.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 3537..4310 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 4307..5116 product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105455.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(5639..6541) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366366.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(7123..8577) product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684770.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene ansP CDS complement(8928..9572) product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480118.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 10152..10376 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296778.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 10628..11017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 11131..12030 product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096510.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene nhoA CDS 12094..12522 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094729.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(12648..13277) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216917.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 13303..13455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 13439..13906 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522988.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(13908..14192) product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522986.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(14189..14935) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530159.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(15305..15544) product DUF2164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704280.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(15577..16869) product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210262.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 17055..18749 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096532.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 19147..20349 product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391470.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 20351..21586 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803854.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 21586..22758 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803855.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 22748..24544 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 24541..26826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 26823..28139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 28081..28299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(28291..28563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 28742..28978 product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206240.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(29454..29729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(30217..30432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 31130..31996 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324138.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 32385..32849 product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799375.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene marR CDS 32869..33276 product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366733.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene marA CDS complement(33484..35124) product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene ubiB CDS complement(35241..35423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366470.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 35576..35788 product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161573.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(35823..37328) product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095119.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene proP CDS complement(37621..37845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(38424..38570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 38893..39276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(40023..42071) product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306080.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene dcp CDS 42211..42957 product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636564.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene ydfG CDS 43047..43730 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366754.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(43876..45345) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705299.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(45438..46835) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047042816.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(46902..47915) product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705297.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(48459..49673) product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295394.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene rspA CDS 49933..50277 product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366763.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 50491..51051 product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366764.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene speG CDS 51224..51529 product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059218804.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 sequence141 source 1..41421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(164..1087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 note possible pseudo, frameshifted CDS complement(1090..3015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 note possible pseudo, frameshifted CDS complement(3078..3911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(4364..4780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 5554..6342 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094866.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 6345..6809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 7121..7354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 7906..8187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 tRNA complement(8253..8340) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 8650..9309 product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374046.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene yccA CDS 9759..10088 product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904439.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene tusE CDS complement(10085..10363) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097246.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene yccX CDS 10463..11653 product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116317.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene rlmI CDS 11684..12079 product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561983.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene hspQ CDS complement(12104..12517) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665217.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 12658..13116 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424187.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene mgsA CDS complement(13117..15171) product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419044.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene helD CDS 15311..15760 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261235.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 15778..17901 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097254.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene yccS CDS complement(17898..18524) product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097255.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 18742..19239 product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288732.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene sulA CDS 19604..20677 product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378625.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene ompA CDS complement(20789..21241) product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877161.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene matP CDS 21656..23179 product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097259.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 23247..23765 product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097260.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene fabA CDS complement(24244..24804) product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367436.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene pqiC CDS complement(24801..26441) product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097263.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene pqiB CDS complement(26431..27519) product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333164.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene pqiA CDS complement(27714..29630) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053090.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(29634..31751) product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086472.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene rlmKL CDS 31849..32958 product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704902.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(32955..33494) product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220671.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene zapC CDS complement(33652..34662) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704900.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene pyrD CDS complement(35065..37677) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704896.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene pepN CDS 37941..39143 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305916.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene pncB CDS 39371..40771 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367451.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene asnS sequence142 source 1..40741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 145..714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(833..2773) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083142.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 tRNA complement(2863..2936) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(3020..3784) product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518939.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene actS CDS complement(4059..5576) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369798.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene lysS CDS complement(5586..6485) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095908218.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene prfB note possible pseudo, frameshifted CDS complement(6816..8435) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369796.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene recJ CDS complement(8550..9269) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098611.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene dsbC CDS complement(9296..10192) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806652.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene xerD CDS 10474..10995 product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055874.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene fldB CDS complement(11007..11375) product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244777.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(11383..11649) product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354046.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene sdhE CDS 11907..12893 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886087.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene ygfZ CDS complement(12935..13588) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008806429.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 14153..14761 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817027.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 14816..15559 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098618.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 15910..17331 product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369787.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene bglA CDS 17619..19010 product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784821.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene ccp CDS complement(19962..22835) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195039.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene gcvP CDS complement(22904..23293) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene gcvH CDS complement(23346..24440) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068738.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene gcvT CDS complement(24855..26048) product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703429.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene ubiI CDS complement(26074..27252) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098625.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene ubiH CDS complement(27249..28562) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193684.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene pepP CDS complement(28803..29363) product UPF0149 family protein YgfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640201.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene ygfB CDS 29549..29878 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811891.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene zapA CDS 30121..30717 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703433.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(30820..32058) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703434.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene serA CDS complement(32339..32998) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189741.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene rpiA CDS 33169..34062 product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499727.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene argP CDS complement(34201..34962) product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369771.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(35132..35725) product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098632.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene argO CDS complement(35914..36783) product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389833.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(36971..38047) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034386.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene fbaA CDS complement(38139..39302) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369762.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene pgk CDS complement(39352..40371) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369761.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene epd sequence143 source 1..40119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(64..151) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 435..1373 product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402555.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene ghrA CDS 1424..2161 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161298.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 2182..2742 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001883.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 3013..3546 product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857411.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene ymdB CDS 3488..4972 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976323.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(4969..6153) product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097165.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene mdoC CDS 6396..7961 product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367217.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene mdoG CDS 7966..10470 product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044602.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene mdoH CDS 10646..11017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(11026..11388) product MysB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180050.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(11514..12434) product kdo(2)-lipid IV(A) lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602388.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene lpxL CDS complement(12721..13293) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097156.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(13293..13862) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419093.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(14656..14910) product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414437.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene bssS CDS complement(15169..15411) product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217754.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene dinI CDS complement(15495..16541) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126556.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene pyrC CDS complement(16664..17332) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713057.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(17486..18133) product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780893.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene grxB CDS 18337..18921 product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097146.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene rimJ CDS 18931..19578 product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873047.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 19582..20505 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736158.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 20646..22181 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050683.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene murJ CDS complement(22685..25966) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705034.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene rne CDS 26597..27550 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846343.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene rluC CDS complement(27562..28143) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028074.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 28284..28805 product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705036.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene yceD CDS 28822..28992 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210931.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene rpmF CDS 29005..30039 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518286.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene plsX CDS 30046..30999 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288132.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene fabH CDS 31017..31946 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191346.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene fabD CDS 31960..32694 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097120.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene fabG CDS 32849..33085 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857954.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene acpP CDS 33175..34416 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419106.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene fabF CDS 34668..35468 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705038.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene pabC CDS 35477..36502 product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756827.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene yceG CDS 36492..37130 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535399.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene tmk CDS 37130..38137 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830395.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene holB CDS 38148..38942 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097114.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 39242..40084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 sequence144 source 1..38103 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(70..237) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094893.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene rpmG CDS complement(251..487) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091955.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene rpmB CDS complement(699..1364) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380129.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene radC CDS 1533..2744 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703809.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene coaBC CDS 2722..3180 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015570042.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene dut CDS 3297..3893 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094890.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene slmA CDS complement(4266..4907) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806177.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene pyrE CDS complement(5006..5722) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369149.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene rph CDS 5835..6710 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621352.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 6899..8155 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525821.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 8262..9176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 9348..9545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 9565..10401 product antA/AntB antirepressor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776709.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(10498..10683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 10775..11077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 11070..11390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 11383..11694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 11691..12731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 12715..13197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 note possible pseudo, frameshifted CDS 13136..14563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 note possible pseudo, frameshifted CDS 15366..15809 product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233778.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 15806..16117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 17175..18086 product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368935.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene fieF CDS 18265..19227 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099327.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene pfkA CDS 19370..20359 product sulfate/thiosulfate ABC transporter substrate-binding protein Sbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045689.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene sbp CDS 20520..21278 product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298413.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene cdh CDS 21618..23360 product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192092.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 23662..23889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(24035..24931) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007509.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene metF CDS complement(25147..27579) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110772.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene metL CDS complement(27582..28742) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309892.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene metB CDS 28995..29312 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004107547.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene metJ CDS complement(29357..29569) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368925.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene rpmE CDS 29803..31998 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301674.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene priA CDS 32280..33293 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099311.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene cytR CDS 33469..34347 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068837.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene ftsN CDS 34438..34968 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208242.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene hslV CDS 34978..36309 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099313.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene hslU CDS 36391..37320 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001308187.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene menA CDS 37413..37898 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872918.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene rraA sequence145 source 1..36362 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(222..2795) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703191.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene clpB CDS complement(2926..3657) product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703192.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene yfiH CDS complement(3654..4634) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079097.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene rluD CDS 4767..5504 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098339.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene bamD CDS 5928..6263 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914111.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene raiA CDS 6640..7797 product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098340.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene pheA CDS complement(7900..8778) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703193.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(8848..9969) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098342.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene tyrA CDS complement(9985..11055) product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370264.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene aroF CDS 11417..12712 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799876.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(12845..13195) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914145.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene rplS CDS complement(13255..14010) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene trmD CDS complement(14042..14590) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene rimM CDS complement(14609..14857) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256453.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene rpsP CDS complement(15241..16602) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460035.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene ffh CDS 16772..17551 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189257.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 17576..18862 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723175.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 18942..19187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(19184..19768) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518875.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene grpE CDS 19893..20771 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098356.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene nadK CDS 20855..22516 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880931.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene recN CDS 22728..23063 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203437.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene bamE CDS complement(23143..23433) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117834.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(23423..23860) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242603.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 23986..24498 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518569.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene smpB tmRNA 24690..25054 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 25239..26438 product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210713.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(26435..27286) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770800.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(27288..28934) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107988645.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(29222..29785) product phage polarity suppression protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095388.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(29814..30032) product ogr/Delta-like zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095389.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(30035..30778) product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095390.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 31316..31582 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556587.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 31801..32130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 32127..32354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216603.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 32351..32671 product DUF5375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095395.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 32686..35019 product primase-like DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783716.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 35128..35691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 sequence146 source 1..111344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 57..1817 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211940.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene tssF CDS 1826..2911 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211941.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene tssG CDS 2892..3425 product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705809.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene tssJ CDS complement(4954..5460) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109977.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(5531..6007) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(6823..8193) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423729.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene purB CDS complement(8211..8840) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297479.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene hflD CDS complement(8950..10104) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097080.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene mnmA CDS complement(10116..10574) product phosphatase NudJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476093.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene nudJ CDS complement(10586..10915) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825956.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(10912..11547) product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097078.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene rluE CDS 11694..12944 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444506.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene icd CDS complement(13194..13865) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334592.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 14459..14653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 14845..15099 product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673491.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(15287..15637) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097067.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(15963..17162) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366138.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 17261..18073 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366139.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(18255..18701) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460707.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(19072..20355) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366144.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(20463..22397) product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097060.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene yeaG CDS 22795..23541 product scaffolding protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163771.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene mipA CDS complement(23851..24729) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097054.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(24828..25832) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153502.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene gapA CDS 26169..26579 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519539.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene msrB CDS 26621..26899 product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046864.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(27046..27696) product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097049.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene pncA CDS complement(27707..28723) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170162.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene ansA CDS complement(28968..30839) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097047.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene sppA CDS 30994..31545 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097046.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 31665..32705 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297659.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene selD CDS 32710..34617 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235841.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene topB CDS complement(34842..36185) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097043.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene gdhA CDS 36412..36687 product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097042.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 36764..36919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 37073..37642 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097040.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 37635..38255 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097039.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(38247..39554) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097038.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(39639..40259) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097037.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(40259..41794) product thiamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097036.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(41758..42936) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097035.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(42949..43629) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097034.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(43636..44442) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673924.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene xthA CDS 45061..46095 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097031.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene astA CDS 46520..47002 product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705764.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene spy CDS complement(47231..48055) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174989.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene nadE CDS 48295..48645 product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857836.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene osmE CDS complement(49161..51413) product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077868.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene katE CDS 51621..51854 product cell division activator CedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977510.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene cedA CDS complement(52179..53570) product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010714.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene tcyP CDS complement(53711..54295) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097014.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(54395..55156) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene kduD CDS complement(55308..55976) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106859.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene hxpB CDS 56145..56681 product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097011.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(56764..57642) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267670.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(57729..58016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 58382..60310 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367045.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene thrS CDS 60389..60856 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001700733.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene infC CDS 60952..61149 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene rpmI CDS 61197..61553 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211833.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene rplT CDS 61878..62861 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367044.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene pheS CDS 62877..65264 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097002.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene pheT CDS 65269..65568 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097001.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene ihfA CDS 65935..66912 product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954986.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene btuC CDS 66944..67492 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705119.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 67496..68245 product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080607.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene btuD CDS 68326..68790 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209795.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 68759..68962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(69261..70313) product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419178.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene aroH CDS complement(70472..71305) product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370992.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene ppsR CDS 71636..74014 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069371.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene ppsA CDS complement(74463..75566) product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248612.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene ydiK CDS 75781..78837 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419180.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 78834..79250 product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637930.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene menI CDS 79279..80469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 80822..81196 product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367169.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene sufA CDS 81200..82681 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705129.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene sufB CDS 82704..83450 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948895.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene sufC CDS 83425..84711 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096954.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene sufD CDS 84708..85928 product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144556.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene sufS CDS 85942..86367 product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279738.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene sufE CDS 86508..87542 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705133.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(87600..87836) product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002908860.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(88147..89559) product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705134.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene pykF CDS complement(90068..90283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 90460..90957 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211662.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene tssB CDS 90987..92537 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023324775.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene tssC CDS 92548..93885 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686687.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene tssK CDS 93882..94538 product type VI secretion system protein TssL, short form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710992.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene tssL CDS 94539..96248 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243153.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 96249..96740 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210014.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 96905..99535 product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147357.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene tssH CDS 99605..101206 product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211937.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene tssA CDS 101225..101665 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096444.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene tssE CDS 101665..103074 product type VI secretion system ImpA and VasL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211944.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 tRNA complement(103298..103374) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(103379..103455) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(103657..104379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 note possible pseudo, internal stop codon CDS complement(104398..105030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24070 note possible pseudo, internal stop codon CDS 105244..105906 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493949.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene ribE CDS complement(106167..107315) product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098879.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene cfa CDS complement(107638..108798) product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182326.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene punC CDS 108904..109815 product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096930.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene punR CDS complement(109826..110851) product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190982.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene purR sequence147 source 1..34670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1626..2273) product type VI secretion system protein TssL, short form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710992.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene tssL CDS complement(2748..3317) product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046807.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene smrA CDS complement(3398..3718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 4040..4555 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096864.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene ogt CDS complement(4689..4838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 4809..5480 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611911.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene fnr CDS 5616..6566 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096866.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene uspE CDS complement(6620..7903) product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540054.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene arsB CDS complement(8263..9651) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705257.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene pntB CDS complement(9664..11202) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096869.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene pntA CDS 11982..12929 product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769298.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene ydgH CDS 13117..14499 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412385.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 14533..14868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 note possible pseudo, frameshifted CDS 14766..15242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 note possible pseudo, frameshifted CDS complement(15286..15477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 15451..16383 product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705252.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene tus CDS complement(16431..17825) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259129.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene fumC CDS complement(17945..19591) product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096879.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene fumA CDS 19801..20976 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096880.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene manA CDS 21150..22655 product DUF945 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043344.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(22892..23923) product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705245.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 24103..25695 product maltose/glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705244.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene malX CDS 25741..26928 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705243.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 27646..28680 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366845.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene add CDS complement(28695..29684) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169841.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(29773..30813) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096894.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 31041..31256 product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366849.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene ydgT CDS 31348..31788 product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302052.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 31866..32447 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366851.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene rsxA CDS 32447..33025 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991809.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene rsxB sequence148 source 1..33727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 90..590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 592..849 product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168435353.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 1017..1190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 1195..1329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 1474..1605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 1830..2624 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111965864.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(2697..3938) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419062.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(4533..6632) product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703267.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene flhA CDS complement(6761..7771) product hydrogenase maturation carbamoyl dehydratase HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059931.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene hypE CDS complement(7768..8886) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212968.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene hypD CDS complement(8886..9164) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703264.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(9155..10015) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337657.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene hypB CDS complement(10025..10414) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544461.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene hypA CDS 10584..11051 product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703262.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene hycA CDS 11131..11739 product formate hydrogenlyase subunit HycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079164.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene hycB CDS 11736..13559 product formate hydrogenlyase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274382.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene hycC CDS 13561..14493 product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703260.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 14513..16222 product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288122.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene hycE CDS 16425..16967 product formate hydrogenlyase complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370029.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 16967..17734 product formate hydrogenlyase subunit HycG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067401.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene hycG CDS 17731..18138 product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370031.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 18131..18586 product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132980.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene hycI CDS 18880..19425 product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078791.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene hydN CDS 19794..21980 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963417.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene hypF CDS 21977..23002 product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098454.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 23113..25335 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300547.1 transl_table 11 codon_start 1 transl_except (pos:23605..23607,aa:Sec) note codon on position 165 is selenocysteine opal codon. locus_tag LOCUS_24680 gene fdhF tRNA complement(25909..25985) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(26086..26820) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670675.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene dnaQ CDS 26873..27343 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368126.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene rnhA CDS complement(27297..27989) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095688.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 28076..28831 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704465.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene gloB CDS 28918..30306 product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644706.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene mltD CDS complement(30559..31416) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230964.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 31578..32462 product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648572.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene yafC CDS 33003..33305 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001406079.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 sequence149 source 1..33658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 2..762 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctcgcgcggggaacac assembly_gap 763..928 estimated_length known gap_type within scaffold linkage_evidence paired-ends repeat_region 929..2058 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctcgcgcggggaacac CDS complement(2230..2616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(2896..3126) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095533.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(3243..4187) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729503.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(4206..4994) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063963580.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(5025..6281) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556566.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 6438..7382 product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083599.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(7432..10656) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126321.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene carB CDS complement(10675..11823) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001558523.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene carA CDS complement(12291..13112) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704365.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene dapB CDS complement(13245..14252) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819931.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 14442..16190 product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 16193..16621 product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706184.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 16631..17125 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706183.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 17136..17933 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706182.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 17933..18751 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706181.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(19165..19935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(20800..21525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 repeat_region 21822..26623 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctcgcgcggggaacac CDS complement(27259..28209) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166426.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene ispH CDS complement(28190..28660) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368326.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene fkpB CDS complement(28660..29166) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368327.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene lspA CDS complement(29166..31982) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286823.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene ileS CDS complement(32067..33002) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767311.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene ribF CDS 33318..33581 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274021.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene rpsT sequence150 source 1..29051 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 714..1313 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966111.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 1751..2227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 2801..3889 product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(3962..4318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(4373..4582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 5526..7676 product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379928.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene btsT CDS complement(7896..8723) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007372648.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(8742..10220) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095207.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 10856..11632 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705454.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 11659..12615 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094852.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(12857..13576) product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598641.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene btsR CDS complement(13570..15258) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097931.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(15396..15974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(16050..17762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(17767..19059) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095714.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(19094..21292) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095715.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(21619..22524) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095694.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(22633..24198) product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877763.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(24256..28992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 sequence151 source 1..28095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1038 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369509.1:DMT family transporter locus_tag LOCUS_25190 CDS 1054..2229 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369510.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene cgtA CDS complement(2485..3918) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420697.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene dacB CDS 4331..4807 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148001.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene greA CDS complement(4957..5250) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196654.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene yhbY CDS 5358..5999 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene rlmE CDS 6100..8043 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107481.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene ftsH CDS 8306..9154 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703603.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene folP CDS 9147..10484 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071169.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene glmM CDS 10847..11176 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272680.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene secG tRNA 11227..11313 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 11372..11448 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 11642..12094 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024135124.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene rimP CDS 12121..13608 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369524.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene nusA CDS 13634..16315 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098916.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene infB CDS 16379..16783 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene rbfA CDS 16783..17733 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089698.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene truB CDS complement(17810..18646) product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367870.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene kduI CDS 18988..19974 product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704632.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene kdgT CDS 20125..20394 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098914.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene rpsO CDS 20640..22772 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369529.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene pnp CDS 22885..23772 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098912.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene nlpI CDS 23951..25807 product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602538.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene deaD CDS 25960..27204 product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098910.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene mtr CDS complement(27587..28051) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106222.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene nrdG sequence152 source 1..27971 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(195..512) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104350.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(746..1195) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705917.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(1715..2149) product antiterminator Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170273.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 2308..3075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 3189..3449 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370294.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(3579..3959) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986023.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene acpS CDS complement(3959..4690) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370292.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene pdxJ CDS complement(4766..5500) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370291.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene recO CDS complement(5512..6417) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102231.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene era CDS complement(6414..7094) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860711.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene rnc CDS complement(7263..8231) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703182.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene lepB CDS complement(8247..10046) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098320.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene lepA CDS complement(10684..11160) product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589049.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene rseC CDS complement(11157..12113) product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098322.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene rseB CDS complement(12113..12769) product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168379.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene rseA CDS complement(12801..13376) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914074.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene rpoE CDS 13786..15405 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094490.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene nadB CDS complement(15384..16049) product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298974.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene trmN CDS 16258..17586 product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219193.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene srmB CDS complement(17861..18244) product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627807.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene grcA CDS 18558..19247 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262723.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene ung CDS complement(19332..20366) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703188.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 20595..21014 product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098726.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene trxC CDS 21029..21781 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703189.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene tapT CDS 21817..24480 product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082966.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene pat CDS 24588..25946 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882218.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene pssA CDS 26144..26473 product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300818.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(26470..27768) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370272.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 sequence153 source 1..26555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(659..3130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(3380..4138) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099103.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(4154..5008) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928705.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene glpG CDS complement(5056..5385) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369349.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene glpE CDS 5598..7136 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069543.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene glpD CDS complement(7509..9956) product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099108.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene glgP CDS complement(9977..11410) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099109.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene glgA CDS complement(11496..12779) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099110.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene glgC CDS complement(12792..14771) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703689.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene glgX CDS complement(14762..16957) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283726.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene glgB CDS complement(17594..18697) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099113.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene asd CDS 18855..19448 product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002544.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene yhgN CDS complement(19576..20916) product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105950.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene gntU CDS complement(20931..21455) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108320.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene gntK CDS complement(21623..22621) product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730239.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene gntR CDS complement(22762..23457) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639796.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(24274..25986) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene ggt CDS 26097..26495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 sequence154 source 1..26317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 255..1307 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099225.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene murB CDS 1304..2266 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099224.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene birA CDS complement(2527..2814) product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455790.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 3152..3865 product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094974.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(4118..5095) product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369217.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene ghrB CDS 5370..5666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 5710..5859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(5939..6868) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703773.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(6879..7634) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094978.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(7739..8758) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094979.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 8962..11289 product biotin sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013914.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene bisC CDS complement(11258..11695) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619903.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(11692..12255) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438953.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene tag CDS complement(12509..13093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 13522..15066 product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269197.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene eptB tRNA 15155..15231 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(15767..16468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 note possible pseudo, frameshifted CDS complement(16461..16778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 note possible pseudo, frameshifted CDS complement(16866..17405) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098375.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(17398..18750) product aconitase/3-isopropylmalate dehydratase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098376.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(18857..19957) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098377.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(20083..20685) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098378.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(20699..21925) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098379.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(21936..22409) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098380.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 22638..23414 product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098381.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 23567..24043 product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098382.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(24027..24941) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098383.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 25647..25934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(25931..26095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 sequence155 source 1..26302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1564 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098386.1:Ig-like domain-containing protein locus_tag LOCUS_26160 CDS 1450..3834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 note possible pseudo, frameshifted CDS 4095..5534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 5555..7813 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095715.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 7823..9088 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095714.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(9362..10477) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365665.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 10760..11215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367842.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(11671..12075) product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098481.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 12308..13555 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367814.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 13822..13953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 13959..14243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 14243..15376 product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044290.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene agp CDS complement(15490..15717) product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367252.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(15735..16331) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170081.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene wrbA CDS 17317..17490 product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097201.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 17894..18529 product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097192.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene rutR CDS complement(18526..18921) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821059.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(18979..22941) product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367239.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene putA CDS 23353..24861 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018479.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene putP CDS 25423..26211 product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097183.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene phoH sequence156 source 1..25332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(409..1464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211935.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(1640..2122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(2124..3119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(3141..5633) product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211928.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 6520..7827 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097432.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene rimO CDS complement(7824..8273) product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985648.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(8282..9193) product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704838.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene gsiD CDS complement(9198..10118) product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367554.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene gsiC CDS complement(10164..11705) product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097435.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene gsiB CDS complement(11771..13678) product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097436.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene gsiA CDS complement(13693..14628) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513763.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene iaaA CDS 14840..16072 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397322.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene moeA CDS 16074..16838 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829211.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene moeB CDS complement(16899..18467) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367567.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 18718..19632 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367569.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene ldtB CDS complement(19936..20403) product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097457.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene mntR CDS complement(21925..22440) product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716763.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene ompX CDS 22793..23683 product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119538.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene rhtA CDS 23959..24462 product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704821.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene dps misc_feature complement(24830..>25332) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097467.1:23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF locus_tag LOCUS_26550 sequence157 source 1..106325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 209..907 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131160.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 918..2306 product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene mdtD CDS complement(2303..3295) product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099392.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene rbsR CDS complement(3300..4229) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361791.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene rbsK CDS complement(4294..5181) product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368990.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene rbsB CDS complement(5200..6171) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211858.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene rbsC CDS complement(6168..7682) product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099396.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene rbsA CDS complement(7690..8109) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099397.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene rbsD CDS complement(8477..10345) product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099398.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene kup CDS 10565..12061 product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099399.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene ravA CDS 12055..13506 product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956591.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene viaA CDS complement(13909..14901) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845128.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene asnA CDS 15055..15513 product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500198.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene asnC CDS 15606..16049 product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene mioC CDS 16428..18317 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499788.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene mnmG CDS 18378..19001 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932839.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene rsmG CDS 19618..19998 product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116695.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene atpI CDS 20007..20825 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135618.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene atpB CDS 20872..21111 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene atpE CDS 21185..21655 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393038.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene atpF CDS 21670..22203 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288587.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene atpH CDS 22216..23757 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176751.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene atpA CDS 23808..24671 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369007.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene atpG CDS 24697..26079 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190506.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene atpD CDS 26100..26519 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251971.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 26836..28206 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099408.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene glmU CDS 28585..30414 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099409.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene glmS CDS 31344..32384 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867146.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene pstS CDS 32437..33396 product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741620.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene pstC CDS 33396..34286 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251991.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene pstA CDS 34334..35107 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063125.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene pstB CDS 35153..35878 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004145007.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene phoU CDS 36702..38423 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095797.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 38716..39483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 39476..40396 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528656.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 40380..41522 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(41718..42383) product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703909.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene yieH CDS 42541..43872 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369021.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(44126..44896) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190678.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(46070..47434) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282357.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene mnmE CDS complement(47735..49375) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099419.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene yidC CDS complement(49599..49925) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703902.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene rnpA CDS 50714..52111 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014068246.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene dnaA CDS 52116..53216 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500170.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene dnaN CDS 53546..54619 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059373.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene recF CDS 54647..57061 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072047.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene gyrB CDS 57190..57597 product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052034.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 57769..58581 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369035.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene yidA CDS 58795..60465 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 60483..61319 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene folD CDS 61740..62363 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046966.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene gmk CDS 62419..62694 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene rpoZ CDS 62716..64836 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280498.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene spoT CDS 65220..67301 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678401.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene recG CDS 67710..69101 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094877.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 69369..71210 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766661.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(71211..72152) product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368966.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene fabY CDS complement(72193..72630) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099363.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene dtd CDS complement(72875..73480) product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309880.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene yihX CDS complement(74204..74632) product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094790.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene ibpB CDS complement(74746..75159) product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532742.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene ibpA CDS 75576..75827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(75828..77093) product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094788.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(77477..77971) product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223800.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene cpxP CDS 78122..78820 product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368937.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene cpxR CDS 78817..80190 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580417.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene cpxA CDS 80225..80752 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703791.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene trmL CDS complement(80992..81810) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106845.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene cysE CDS complement(81885..82898) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene gpsA CDS complement(82898..83371) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860835.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene secB CDS complement(83506..83757) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426371.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene grxC CDS complement(83775..84206) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156179.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 84454..86001 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116577.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene gpmM CDS 86062..87279 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094918.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene envC CDS 87281..88225 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032713082.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(88249..89268) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798185.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(89548..90573) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094910.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene tdh CDS complement(90583..91779) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213794.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene kbl CDS 92005..92943 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094908.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene rfaD CDS 92959..94029 product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094907.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene rfaF CDS 94016..94978 product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264610.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene rfaC CDS 95069..96289 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602581.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 96282..97295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 97297..98358 product lipopolysaccharide core heptosyltransferase RfaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360402.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene rfaQ CDS 98351..99289 product lipopolysaccharide 1,2-glucosyltransferase RfaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376841.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene rfaJ CDS complement(99319..100329) product UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364806.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(100358..101374) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006502.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(101405..102202) product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001357918.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene rfaP CDS complement(102195..103259) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634259.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 103670..104947 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891584.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene waaA CDS 104957..105436 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171879.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene coaD CDS complement(105437..106246) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114533.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene mutM sequence158 source 1..24104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(79..321) product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392238.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene zapB CDS 760..1608 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369132.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 1628..3142 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369131.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene glpK CDS 3248..4258 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703815.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene glpX CDS 4327..5073 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796307.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene fpr CDS complement(5051..5494) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155256.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 5607..6200 product DUF1454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369137.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 6321..7070 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002922909.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene tpiA CDS complement(7182..9794) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368915.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene ppc CDS complement(10054..11205) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309894.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene argE CDS 11387..12391 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935379.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene argC CDS 12407..13180 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077696320.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene argB CDS 13206..14423 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049171.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 14505..15878 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230038.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene argH CDS 16229..17146 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025939.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene oxyR CDS complement(17129..18529) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368908.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene sthA CDS 18726..19379 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300495.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene fabR CDS 19379..19732 product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703957.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(19918..21021) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187022.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene trmA CDS 21377..23218 product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703958.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene btuB CDS 23163..24014 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201827.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene murI sequence159 source 1..22781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(411..710) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149473.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 928..1287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(1521..1862) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097810.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene fliE CDS 2152..3867 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704955.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene fliF CDS 3867..4853 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097807.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene fliG CDS 4846..5559 product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097806.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 5556..6932 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704953.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene fliI CDS 6948..7397 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097733.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene fliJ CDS 7394..8587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 8743..9231 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367297.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene fliL CDS 9237..10253 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367298.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene fliM CDS 10246..10650 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367299.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene fliN CDS 10650..11060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 11057..11833 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704950.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene fliP CDS 11846..12115 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367302.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene fliQ CDS 12117..12896 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168816.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene fliR CDS 13333..14358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267900.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(14989..15390) product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211101.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(15390..17492) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816614.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene flhA CDS complement(17492..18637) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211099.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene flhB CDS complement(18853..19497) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983587.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene cheZ CDS complement(19504..19893) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367338.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene cheY CDS complement(19948..20994) product protein-glutamate methylesterase/protein glutamine deamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036372.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene cheB CDS complement(20994..21857) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367340.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene cheR sequence160 source 1..22612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..667) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099037.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene slyD CDS complement(762..962) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106389.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(977..1105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 1478..3397 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703646.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 3705..4658 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099052.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 4660..4878 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907085.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 4956..5825 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274680.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(6293..6697) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027906.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 6979..7611 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242758.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene crp CDS 7634..9757 product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012135464.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(9754..10974) product bifunctional acetylornithine/succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190012.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene argD CDS complement(11063..11626) product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601848.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene pabA CDS complement(11657..12259) product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280679.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(12249..12419) product YhfG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736858.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(12522..13094) product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920482.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene ppiA CDS complement(13735..14007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 13900..16407 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369394.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene nirB CDS 16404..16730 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099065.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene nirD CDS 16895..17701 product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493556.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene nirC CDS 17718..19091 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349855.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene cysG CDS 19621..21219 product cholesterol oxidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113002.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(21270..21545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 sequence161 source 1..21804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 649..996 product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108172.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene grxD CDS complement(1304..1951) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282267.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene rnt CDS complement(2161..2568) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237787.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene gloA CDS complement(2664..3761) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816376.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(4171..4398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 4596..4835 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001538148.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 4890..5786 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366872.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 5868..6392 product superoxide dismutase [Cu-Zn] SodC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826818.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene sodC2 CDS complement(6379..8412) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705224.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(8420..9277) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096915.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(9281..9517) product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096914.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 9701..10135 product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445639.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene slyA CDS complement(10316..10783) product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597196.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene slyB CDS 11082..12206 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366864.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene anmK CDS 12320..12649 product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061975.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene mliC CDS 12714..13370 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096909.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene pdxH CDS 13512..14783 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831636.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene tyrS CDS 14839..15708 product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096907.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene pdxY CDS complement(15775..16377) product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765749.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene gstA CDS complement(16641..18140) product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366858.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene dtpA CDS complement(18734..19369) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030339.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene nth CDS complement(19366..20055) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096903.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(20052..20681) product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920784.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene rsxG CDS complement(20692..21744) product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705232.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene rsxD sequence162 source 1..20599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 53..652 product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996130.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene bcsQ CDS 649..3267 product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275344.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene bcsA CDS 3278..5638 product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823808.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene bcsB CDS 5644..6747 product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099216.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene bcsZ CDS 6729..10196 product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099215.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene bcsC CDS 10338..11492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 11762..13048 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369244.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 13240..14730 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703757.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 15106..17151 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158664.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(17362..18684) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099207.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(18944..19987) product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191257.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene yhjD CDS 20251..20544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 sequence163 source 1..20512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3399 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002214945.1:contact-dependent inhibition toxin CdiA locus_tag LOCUS_28510 CDS 3396..3614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 3790..4092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 4230..4709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 4848..5408 product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 5619..5750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(6179..6772) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112218.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(6829..7605) product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544919.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(7598..8224) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211603.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene dmsB CDS complement(8238..10670) product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211602.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 11485..12255 product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene lipA CDS complement(13065..14135) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705361.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene uxuA CDS 14610..16025 product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096788.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene uxaC CDS 16040..17587 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096787.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 17651..19114 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096786.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 sequence164 source 1..18610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(312..623) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036696.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 1578..1901 product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098654.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 1898..2212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004144765.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 2223..3245 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369746.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 3245..3994 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703448.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 4011..4799 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703447.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 4888..5814 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703446.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 5811..7007 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703445.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 7036..8292 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703444.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 8303..8836 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152888.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 8846..9619 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703443.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 9603..10397 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703442.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 10407..11189 product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098643.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 11199..12668 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703440.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 12681..14324 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098641.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 14645..14782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(15226..16167) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703437.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 16363..18354 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098658.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene tkt sequence165 source 1..17562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 426..893 product DUF6392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098592.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 1211..1531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 1918..3279 product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368823.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene dcuB CDS complement(3526..4653) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095007.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene thiH CDS complement(4650..5420) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704009.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene thiG CDS complement(5422..5622) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166228.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene thiS CDS complement(5606..6361) product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001600813.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene thiF CDS complement(6354..6995) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368816.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene thiE CDS complement(6992..8920) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108425.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene thiC CDS complement(9172..9666) product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095013.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 9766..10539 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373941.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene nudC CDS 10580..11644 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137636.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene hemE CDS 11654..12325 product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362359.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene nfi CDS 12368..12973 product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940092.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 13145..13417 product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044509.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene hupA CDS 13426..14127 product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621286.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(14366..15658) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866836.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene purD CDS complement(15673..17316) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095020.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene purH sequence166 source 1..17159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(118..2376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 2439..3134 product global regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098333.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(3131..4441) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267368.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 5084..5500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096671.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 5511..5957 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096670.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 5970..6488 product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420909.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(6646..7491) product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229237.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(7491..8018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(8678..9460) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094866.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(9699..9863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 10064..10597 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097473.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 10668..11333 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096968.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 11330..13915 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096967.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 13979..14935 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123654.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 15046..15375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 15467..15649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 15783..16184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 note possible pseudo, frameshifted CDS 16177..16788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 sequence167 source 1..16856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(441..719) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015547.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(907..1221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(2678..3070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 3453..3764 product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300427.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene atl CDS complement(4025..4600) product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779802.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 4786..5652 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095873.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene tesB CDS complement(5946..7232) product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685029.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene amtB CDS complement(7260..7598) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780338.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene glnK CDS complement(7820..9598) product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256185.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(9591..11363) product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367939.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(11416..11892) product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884593.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene decR CDS 12007..13053 product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704598.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(13094..13912) product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095866.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene cof CDS 14015..15712 product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704597.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 15777..16472 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817229.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene queC sequence168 source 1..105771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(33..800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(961..3150) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136402.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(3147..4679) product anti-bacteriophage protein AbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445380.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene abpA CDS complement(5372..8443) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202280.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(8454..10520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(10596..13298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(13295..13996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(13993..17271) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(17271..18176) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS 18606..19469 product GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065553.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 19559..20380 product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197389.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 20597..21298 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189409.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 21481..22176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 22198..22671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 22749..22988 product DUF905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007869725.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 23086..23544 product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211841.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(23578..23778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 23710..24036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 24045..24266 product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691994.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 24284..24601 product type IV toxin-antitoxin system YeeU family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007869729.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 24622..24963 product type IV toxin-antitoxin system toxin YkfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854672.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene ykfI CDS 25079..25912 product DUF4942 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034461534.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 tRNA complement(26015..26090) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 26215..26772 product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703525.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene mug CDS complement(27136..28974) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437371.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene rpoD CDS complement(29124..30869) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098776.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene dnaG CDS complement(30984..31199) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene rpsU CDS 31454..32467 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264365.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene tsaD CDS complement(32487..33116) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703522.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene plsY CDS 33326..33700 product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295541.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene folB CDS 33792..34610 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305111.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene bacA CDS complement(34626..35867) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708457.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(35976..36590) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125344.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 36845..38143 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098760.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 38165..41011 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703518.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene glnE CDS 41060..42487 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098758.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene hldE CDS complement(42591..42899) product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098757.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene ubiK CDS 43343..43996 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703517.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene ribB CDS complement(44425..45192) product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098748.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene zupT CDS complement(45637..46797) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442833.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(46801..47472) product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831528.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(47620..49104) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098744.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene tolC CDS 49314..49946 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369649.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene nudF CDS 49946..50371 product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862516.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS 50397..51224 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098742.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene cpdA CDS 51224..51799 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098741.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene yqiA CDS 51840..53732 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195318.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene parE CDS complement(54083..54397) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369654.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(54487..55068) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098727.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 55268..57538 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281888.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene parC CDS 57750..58505 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369660.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene plsC CDS 58558..59973 product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010658.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene ftsP CDS 60153..62309 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095186.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 62327..62719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(63142..63309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(64258..65085) product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098717.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene dkgA CDS complement(65450..66769) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113742.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(66785..68560) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110747.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(68563..69285) product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110746.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(69611..70990) product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene xylE CDS complement(70987..71502) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210027.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene rbsD CDS complement(71576..72958) product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 gene araE CDS complement(72973..73938) product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029553.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(73935..75278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(75302..76699) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 76868..77719 product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389099.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 77734..78696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(79536..80195) product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268419.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene yghB CDS complement(80336..81523) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098713.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene metC CDS 81777..82499 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527844.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene exbB CDS 82506..82931 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369671.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene exbD CDS 83753..84454 product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642330.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene fucR CDS 84610..84798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 note possible pseudo, internal stop codon, frameshifted CDS 84867..85064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30070 note possible pseudo, internal stop codon, frameshifted CDS complement(85142..86017) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295515.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene yghU CDS complement(86091..86885) product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705118.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(87707..88573) product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(88589..89485) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420843.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(89541..90437) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327311.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(90439..91842) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291196.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(91858..93288) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078438.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(93387..94394) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357967.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(94452..95345) product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718901.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene yihU CDS 95570..96352 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059689.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(96449..96679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 note possible pseudo, frameshifted CDS complement(96711..97658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 note possible pseudo, frameshifted CDS complement(97639..99816) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098388.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(99813..101174) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533850.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 misc_feature complement(101547..>105771) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098386.1:Ig-like domain-containing protein locus_tag LOCUS_30220 sequence169 source 1..15773 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(128..718) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095419.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 900..1094 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099030.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene bfd CDS 1235..1714 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675528.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene bfr CDS 2048..2359 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene rpsJ CDS 2392..3021 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863274.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene rplC CDS 3032..3637 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424395.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene rplD CDS 3634..3936 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617544.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene rplW CDS 3954..4778 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301859.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene rplB CDS 4795..5073 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138117.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene rpsS CDS 5088..5420 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447529.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 gene rplV CDS 5438..6139 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene rpsC CDS 6152..6562 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919759.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene rplP CDS 6562..6753 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218942.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene rpmC CDS 6753..7007 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene rpsQ CDS 7174..7545 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613955.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene rplN CDS 7555..7869 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene rplX CDS 7884..8423 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096200.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene rplE CDS 8439..8744 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118930.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene rpsN CDS 8778..9170 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807048.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene rpsH CDS 9184..9717 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807049.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene rplF CDS 9727..10080 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358960.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene rplR CDS 10095..10595 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene rpsE CDS 10602..10781 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140434.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene rpmD CDS 10785..11219 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369426.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene rplO CDS 11227..12549 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863305.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene secY CDS complement(12571..12786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 12850..13206 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090775.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene rpsM CDS 13223..13612 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388621.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene rpsK CDS 13644..14264 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene rpsD CDS 14290..15279 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438685.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene rpoA CDS 15320..15703 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216372.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene rplQ sequence170 source 1..13927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 10..7239 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgcgagcggggataaaccg CDS complement(7303..8730) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706025.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene sbcB CDS complement(9091..9285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(9357..10358) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001729.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(11175..11453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 12183..12671 product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706021.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene sbmC CDS complement(12870..13820) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531858.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 sequence171 source 1..13434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 262..510 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367020.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 618..887 product C4-type zinc finger protein YbiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146357.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene ybiI CDS 1095..2078 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096452.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene zntB CDS 2357..2494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(2536..3462) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156215.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene ttcA CDS complement(4119..5153) product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192349.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene fbpC CDS complement(5168..7240) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095788.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(7295..8326) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095789.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(8337..9665) product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543352.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene uhpC CDS complement(9767..11284) product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095791.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(11284..11913) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621918.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 12201..13229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 sequence172 source 1..12746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 270..653 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094999.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene secE CDS 655..1200 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287521.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene nusG CDS 1358..1786 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene rplK CDS 1791..2495 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095000.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene rplA CDS 2853..3350 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004097644.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene rplJ CDS 3418..3786 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095002.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene rplL CDS 4107..8135 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503453.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene rpoB CDS 8212..12435 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095003.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 gene rpoC sequence173 source 1..11528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 152..487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(902..2380) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948686.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 2901..3686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 3797..4516 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102119.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 4528..5955 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023919.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 5948..6643 product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069255.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 7837..8979 product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816380.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene cfa CDS 9050..9655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(9812..10504) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098280.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS complement(10687..11490) product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098281.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 sequence174 source 1..11383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(84..158) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(252..328) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(334..408) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(486..560) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(582..666) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(673..749) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(1203..2867) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704746.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene asnB CDS complement(3346..3615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 note possible pseudo, frameshifted CDS complement(3612..3827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(3922..5151) product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097570.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(5158..6306) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367708.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene nagA CDS complement(6334..7134) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097568.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene nagB CDS 7455..9473 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816827.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene nagE CDS 9638..11305 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287188.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene glnS sequence175 source 1..10905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(252..1205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(1286..3799) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(3810..4313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(4537..5097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 6450..6605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 6633..6752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 6815..7024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(7279..8151) product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096664.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(9636..10628) product UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364806.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 sequence176 source 1..10678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 231..800 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285635.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(761..1015) product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070563.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(1012..1830) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420960.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene aroE CDS complement(1835..2407) product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069531.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene tsaC CDS complement(2397..2954) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369441.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(2991..3464) product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460663.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene smg CDS complement(3436..4560) product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703635.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene dprA CDS 4689..5204 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114984.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene def CDS 5220..6167 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703637.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene fmt CDS 6238..7527 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703638.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene rsmB CDS 7571..8947 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691382.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene trkA CDS 9106..9510 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099017.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene mscL CDS complement(9511..9726) product alternative ribosome-rescue factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703639.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS complement(9782..10189) product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369432.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene zntR CDS complement(10193..10561) product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266513.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 sequence177 source 1..10491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1191..1886) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366772.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 gene bioD CDS complement(2012..3229) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096827.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(3507..3671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 3992..4831 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096841.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(4880..5209) product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366783.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene mdtI CDS complement(5196..5552) product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705282.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene mdtJ CDS complement(6111..6923) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367562.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(7081..7311) product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096502.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene pptA CDS complement(7523..8563) product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373315.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 gene tssG CDS complement(8560..10350) product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705811.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene tssF sequence178 source 1..9720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(6490..8157) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098821.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 8439..8708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 8830..9006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 9275..9625 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165178.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 sequence179 source 1..102026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 537..1976 product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097565.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 gene chiP CDS 2035..2361 product ChiQ/YbfN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733594.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene chiQ CDS 2379..5030 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816825.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 5345..5662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(5778..6227) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131699.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene fur CDS complement(6523..7053) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018622.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene fldA CDS complement(7203..7484) product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367696.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene ybfE CDS complement(7609..8385) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097562.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene ybfF CDS 8571..9128 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367694.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene seqA CDS 9153..10796 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097560.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene pgm CDS 11423..11629 product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097552.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 12014..12970 product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367132.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 12982..14415 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207142.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene phrB CDS 14412..15155 product radiation resistance protein YbgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798844.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene ybgI CDS 15190..15825 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188343.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene pxpB CDS 15819..16754 product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912729.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene pxpC CDS 16775..17566 product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113965.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene nei CDS complement(17886..19172) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785832.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene gltA CDS 19810..20199 product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684965.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene sdhC CDS 20193..20540 product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501088.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene sdhD CDS 20597..22306 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775540.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene sdhA CDS 22323..23039 product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501090.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene sdhB CDS 23926..26733 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622290.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene sucA CDS 26750..27970 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099834.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene odhB CDS 28064..29230 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809579.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene sucC CDS 29230..30099 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367669.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene sucD CDS complement(30387..30677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(31335..31532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 31553..33115 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979005.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene cydA CDS 33131..34270 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene cydB CDS 34383..34709 product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097534.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene ybgE CDS 34815..35210 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859689.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene ybgC CDS 35216..35899 product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097532.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 gene tolQ CDS 35903..36331 product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858589.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene tolR CDS 36362..37474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 37702..38994 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295307.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 gene tolB CDS 39027..39554 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859700.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 gene pal CDS 39564..40352 product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097580.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene cpoB tRNA 40517..40592 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 40614..40689 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA 40694..40769 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA 40797..40872 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 41661..42722 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704773.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene nadA CDS 42740..43459 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345378.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene pnuC CDS complement(43456..44388) product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951257.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene zitB CDS complement(44935..45306) product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367654.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 45639..46691 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097523.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene aroG CDS complement(47263..48015) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301554.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene gpmA CDS complement(48419..49459) product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097522.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene galM CDS complement(49453..50601) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097521.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene galK CDS complement(50604..51650) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191505.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene galT CDS complement(51661..52677) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622345.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene galE CDS complement(53140..54612) product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097518.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene modF CDS complement(54689..55480) product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097517.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 gene modE CDS 55598..55747 product AcrZ family multidrug efflux pump-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045380498.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 55887..56666 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951413.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 gene modA CDS 56663..57352 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604026.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene modB CDS 57356..58414 product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891721.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 gene modC CDS complement(58809..59627) product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097512.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 60174..61190 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815470.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene pgl CDS complement(61442..62731) product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097510.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 62947..64173 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163359289.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 gene hutI CDS 64170..65126 product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704790.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 gene hutG CDS 65229..65966 product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704791.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 66372..68057 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367623.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene hutU CDS 68057..69589 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367622.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene hutH CDS 69688..71076 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367620.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(71197..71673) product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704792.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(71685..72353) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(72393..73721) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205503.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene bioA CDS 73805..74836 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704794.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene bioB CDS 74833..75984 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097501.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene bioF CDS 75968..76723 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704796.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene bioC CDS 76861..77547 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044843.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene bioD CDS 78253..80274 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097496.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene uvrB CDS complement(80403..81317) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097495.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene yvcK CDS 81662..82651 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704804.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene moaA CDS 82666..83178 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084632.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene moaB CDS 83181..83666 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097492.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene moaC CDS 83659..83904 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611264.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene moaD CDS 83906..84355 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545202.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene moaE CDS 84544..85251 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367602.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(85361..86326) product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097488.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(86326..87567) product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097487.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene clsB CDS complement(87564..88325) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097486.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 88468..88881 product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871981.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(88843..89949) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469048.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(89961..91097) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045765.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(91087..92832) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704811.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(92819..93820) product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097481.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene hlyD CDS complement(93807..94505) product transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704813.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene cecR CDS 95133..96527 product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007147.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene rhlE CDS 96855..99011 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309370.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene dinG CDS 99076..100053 product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386565.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene ybiB CDS complement(100137..100397) product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849302.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene ybiJ CDS complement(100904..101164) product DUF1471 family periplasmic protein McbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710621.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene mcbA CDS 101515..101721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32280 note possible pseudo, frameshifted CDS 101760..102017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 note possible pseudo, frameshifted sequence180 source 1..8831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..778 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000998102.1:IS66-like element ISEc8 family transposase locus_tag LOCUS_32300 CDS complement(1117..1677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(1681..2409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(3141..4328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(4321..4494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(4847..5122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(5124..5978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(6024..6155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(6497..7048) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235713.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 7211..7579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 note possible pseudo, internal stop codon CDS 7640..8050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 note possible pseudo, internal stop codon CDS complement(7990..8151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(8234..8806) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095238.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 sequence181 source 1..8808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(422..511) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 603..1379 product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001325918.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene mtfA tRNA 1480..1555 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS 1717..2979 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059623.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(3834..4721) product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511773.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(5230..5532) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(5537..5890) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024360564.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(6389..6610) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(6607..7068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246267.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(7718..8728) product DUF4917 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119745.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 sequence182 source 1..8744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(6228..6758) product cyclolysin-activating lysine-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929994.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene cyaC CDS complement(6758..8392) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704284.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 sequence183 source 1..7969 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(232..307) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(314..388) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(665..749) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(766..841) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS 1254..2204 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023085.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene coaA CDS complement(2592..4661) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094970.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene glyS CDS complement(4671..5588) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene glyQ CDS 6217..7212 product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182641.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene wecH misc_feature complement(7377..>7969) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001322902.1:inner membrane protein YiaA locus_tag LOCUS_32570 sequence184 source 1..7151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(147..2255) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124693.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene fusA CDS complement(2349..2819) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138043.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene rpsG CDS complement(2916..3290) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene rpsL CDS complement(3416..3703) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369415.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene tusB CDS complement(3711..4070) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212321.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene tusC CDS complement(4070..4456) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099035.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene tusD CDS complement(4456..5181) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091472.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(5697..6518) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174645.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene fkpA CDS 6735..6953 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153615.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 sequence185 source 1..6165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 611..1174 product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 1615..2004 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301470.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(2516..2713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 2750..3379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32700 note possible pseudo, frameshifted CDS 3364..4662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 note possible pseudo, internal stop codon, frameshifted sequence186 source 1..5709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(78..153) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA complement(197..272) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 CDS 574..1986 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878160.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene gltX CDS complement(2024..2413) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878158.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(2410..2772) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098189.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 tRNA 2996..3071 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA 3114..3189 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 CDS 3422..5611 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420302.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 sequence187 source 1..5447 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence188 source 1..5433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(19..585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(575..808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(811..1848) product DUF6396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269338.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(1862..3700) product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269337.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 misc_feature complement(3713..>5433) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001529381.1:type VI secretion system Vgr family protein locus_tag LOCUS_32800 sequence189 source 1..4687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 168..305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 891..2633 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525720.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(3475..3702) product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(3919..4158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(4094..4414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 sequence190 source 1..98056 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(288..683) product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194531.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene fadM CDS complement(825..1145) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095861.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(1297..3168) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704592.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene ppiD CDS complement(3371..3643) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043544.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene hupB CDS complement(3867..6215) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295325.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene lon CDS complement(6411..7685) product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130305.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene clpX CDS complement(7832..8455) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095857.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene clpP CDS complement(8749..10047) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367952.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene tig CDS complement(10379..10765) product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367954.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene bolA CDS 10956..11534 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095854.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 11745..13229 product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367956.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene ampG CDS 13649..14608 product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239436.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene cyoA CDS 14614..16605 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704587.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene cyoB CDS 16595..17212 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061708214.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 17212..17538 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176899.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 17550..18437 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095848.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene cyoE CDS 18836..20203 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000935.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(20242..20733) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503327.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 20942..21856 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705865.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 gene panE CDS 22458..22787 product DUF1971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706013.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 22800..23132 product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706012.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(23178..24494) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087885.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(24843..26291) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367986.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene thiI CDS 26552..26860 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124935.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene xseB CDS 26860..27759 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348078.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene ispA CDS 27781..29643 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006791.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene dxs CDS complement(30328..30846) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154063.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene pgpA CDS complement(30824..31798) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742109.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene thiL CDS complement(31858..32277) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367993.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene nusB CDS complement(32297..32767) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021161.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene ribE CDS complement(32878..33987) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150440.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 gene ribD CDS complement(33993..34442) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene nrdR CDS 34585..35163 product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198480.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(35647..36597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(36628..36834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(36831..37004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS 37223..37495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS 37749..38276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 38278..38892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 38894..39487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 40045..40593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 note possible pseudo, frameshifted CDS complement(41025..41996) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046629.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene secF CDS complement(42007..43821) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934811.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene secD CDS complement(43882..44220) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007630.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene yajC CDS complement(44236..45363) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095832.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene tgt CDS complement(45497..46567) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704557.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene queA CDS 46666..47247 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095830.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene acpH CDS complement(47504..48868) product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602179.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene proY CDS complement(48931..50244) product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095826.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 gene brnQ CDS complement(50639..51943) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704551.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 gene phoR CDS complement(51959..52648) product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113921.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 gene phoB CDS 52849..54051 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221246.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 gene sbcD CDS 54048..57197 product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001526312.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene sbcC CDS complement(57219..58142) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704548.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene mak CDS 58265..59176 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964305.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene rdgC CDS 59894..60211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 60305..60703 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275180.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS 61035..62012 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704537.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene hemB CDS complement(62192..64357) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706054.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(64375..64821) product protein-tyrosine-phosphatase Etp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057871.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene etp CDS complement(64809..66065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(66210..67262) product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211988.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene wecA CDS 68216..68395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS 68490..68672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 tRNA complement(68687..68762) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 CDS complement(68873..70126) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095746.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 gene proA CDS complement(70137..71240) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095745.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 gene proB CDS complement(71675..72073) product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368042.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene crl CDS complement(72180..73427) product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095741.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 gene frsA CDS complement(73535..73993) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292018.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene gpt CDS 74254..75708 product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095740.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene pepD CDS complement(75686..75841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(75899..76957) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095738.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene dinB CDS 77133..77489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(77613..77828) product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368113.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene nqrM CDS complement(77840..79063) product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368114.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 gene nqrF CDS complement(79076..79672) product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368115.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene nqrE CDS complement(79676..80314) product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002889716.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(80307..81101) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095732.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(81094..82332) product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704471.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(82336..83721) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704470.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS 84095..84826 product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095729.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 gene dpaA CDS complement(84797..85564) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333380.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(85612..86193) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167499.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene lpcA CDS 86413..88869 product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368121.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene fadE CDS 89594..90517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 90583..91086 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163272.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS 91118..91687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 91953..92867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 note possible pseudo, frameshifted CDS 93004..94263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 note possible pseudo, frameshifted CDS 94309..95064 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018304.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS 95290..95778 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208091882.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS 95829..96335 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167315.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS 96418..96906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS 96955..97824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33790 sequence191 source 1..4620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 491..2887 product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878139.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 2901..3158 product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366096.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 3158..4273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445872.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 sequence192 source 1..4542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 273..566 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110456.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 632..1051 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622308.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 sequence193 source 1..4441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(25..423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(466..1122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS complement(1014..4097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33870 note possible pseudo, frameshifted sequence194 source 1..4002 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(132..584) product Ivy family C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705431.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene ivy CDS 897..1163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS 1164..2726 product S-type pyocin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096824.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 2731..3126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 3175..3459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS 3467..3724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS 3734..3985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33940 sequence195 source 1..3949 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(100..582) product toxin-activating lysine-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291472.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS complement(601..1368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(2651..2857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33970 sequence196 source 1..3779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(316..1449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(1453..1713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(1729..2136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(2375..3247) product DUF6396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269338.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(3446..3703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34020 sequence197 source 1..3550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(79..1961) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 58 percent of the 23S ribosomal RNA locus_tag LOCUS_r00020 sequence198 source 1..3176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3152 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211936.1:type VI secretion system membrane subunit locus_tag LOCUS_34030 sequence199 source 1..3159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS 210..962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS 988..3111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106189.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 sequence200 source 1..3094 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 5..217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 214..1008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS 1014..2972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106189.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 sequence201 source 1..97260 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..1263) product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097573.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene ubiF CDS 1405..2829 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162740.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene miaB CDS 3014..4069 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493272.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS 4066..4533 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858677.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene ybeY CDS 4637..5512 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278615.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene corC CDS 5517..7052 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853021.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 gene lnt CDS complement(7230..8228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526761.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(8238..10847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(10837..11115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS 11734..12642 product glutamate/aspartate ABC transporter substrate-binding protein GltI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309342.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene gltI CDS 12825..13565 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097579.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 13565..14242 product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272799.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene gltK CDS 14239..14964 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367722.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(15122..15601) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831082.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS 15839..18421 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301620.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene leuS CDS 18436..19044 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704738.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene lptE CDS 19044..20075 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620533.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene holA CDS 20068..20721 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420893.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene nadD CDS 20872..21288 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161664.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene rsfS CDS 21292..21762 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858701.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene rlmH CDS 21790..23691 product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097589.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene mrdA CDS 23693..24805 product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131719.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene mrdB CDS 24816..25910 product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231421.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene rlpA CDS 26030..27259 product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858714.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene dacA CDS 27360..27623 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158389.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene ybeD CDS 27709..28380 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284040.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene lipB CDS 28545..29510 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042632.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene lipA CDS complement(29595..29798) product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503931.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene tatE CDS complement(30337..30669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 note possible pseudo, internal stop codon, frameshifted CDS 30757..31140 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939738.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene crcB CDS complement(31429..31638) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439184.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 gene cspE CDS complement(31825..32394) product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170942738.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene pagP CDS 33032..33844 product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099620.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene rna CDS 34184..34339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 34696..36072 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478622.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 36350..36778 product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278509.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene uspG CDS complement(36893..38458) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887645.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene ahpF CDS complement(38648..39211) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501015.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene ahpC CDS complement(39458..39793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 note possible pseudo, internal stop codon, frameshifted CDS complement(40231..41295) product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094852.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene yjiA CDS complement(41330..41527) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460431.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS complement(41723..41881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 note possible pseudo, internal stop codon, frameshifted CDS complement(42243..42515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 note possible pseudo, frameshifted CDS complement(42529..42723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 note possible pseudo, frameshifted CDS complement(42869..43282) product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097630.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene entH CDS complement(43284..44036) product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367767.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 gene entA CDS complement(44033..44887) product enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367768.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 gene entB CDS complement(44902..46518) product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222445.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 gene entE CDS complement(46528..47706) product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602222.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene entC CDS 47893..48855 product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234336.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene fepB CDS complement(48883..50139) product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041793.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene entS CDS 50253..51260 product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704708.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene fepD CDS 51257..52249 product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640969.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene fepG CDS 52246..53037 product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140620.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene fepC CDS complement(53088..53663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS complement(53711..54271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(54522..54704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(54855..55340) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533908.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(55328..55606) product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965889.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(56149..60081) product enterobactin non-ribosomal peptide synthetase EntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077782.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 gene entF CDS complement(60090..60305) product enterobactin biosynthesis protein YbdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885783.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene ybdZ CDS complement(60354..61553) product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704705.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 gene fes CDS 61851..64112 product siderophore enterobactin receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704704.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene fepA CDS 64698..65831 product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130654.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS complement(65873..66397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS 67460..70507 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830252.1 transl_table 11 codon_start 1 transl_except (pos:68045..68047,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_34750 gene fdnG CDS 70520..71407 product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240581.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene fdnH CDS 71400..72065 product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045646.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene fdnI CDS complement(72289..72645) product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248993.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene yeaR CDS complement(72967..75144) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420653.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(75260..75688) product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098815.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(76188..76622) product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098815.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(76830..80378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(80375..81028) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098817.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(82548..83471) product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484431.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene lpxP CDS 84790..85674 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096673.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS 86250..86477 product biofilm-dependent modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096534.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 gene bdm CDS complement(87080..87511) product peroxiredoxin OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152305.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene osmC CDS 88519..88920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34880 note possible pseudo, frameshifted CDS 89043..89861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34890 note possible pseudo, frameshifted CDS 89858..90169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 90435..90767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 90777..91241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(91375..92226) product DUF4942 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034461534.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS complement(92359..92724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS complement(92721..93074) product type IV toxin-antitoxin system toxin YpjF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094400.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 gene ypjF CDS complement(93208..93504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34960 note possible pseudo, frameshifted CDS complement(93552..93773) product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703392.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS complement(93757..94266) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703393.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene radC CDS complement(94278..94742) product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214398.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(94844..95071) product DUF905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006024.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS complement(95182..96045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35010 sequence202 source 1..3000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(225..788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS 1077..2057 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 tRNA complement(2473..2560) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 sequence203 source 1..2950 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..934 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224144836.1:hemagglutinin repeat-containing protein locus_tag LOCUS_35040 CDS 931..1254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817057.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(1303..1542) product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807562.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS complement(1627..1998) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083575.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 sequence204 source 1..2823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(376..552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(1026..2675) product S-type pyocin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096824.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 sequence205 source 1..2720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(182..511) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529821.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(508..783) product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143987.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(824..1819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(1972..2493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35130 sequence206 source 1..2713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence207 source 1..2703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1460..1816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 1816..1968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS complement(2011..2355) product immunity 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967957.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 sequence208 source 1..2602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..687 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224144836.1:hemagglutinin repeat-containing protein locus_tag LOCUS_35170 CDS 684..1022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817057.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(1065..1301) product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807562.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(1359..1727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35200 sequence209 source 1..2570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS 207..413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 453..2519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106189.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 sequence210 source 1..2298 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 60..296 product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807562.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(338..592) product MafI family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244315.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(607..1308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35260 misc_feature complement(1636..>2298) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002214945.1:contact-dependent inhibition toxin CdiA locus_tag LOCUS_35270 sequence211 source 1..2292 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 464..544 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 638..1156 product DUF3304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047064446.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS 1248..1766 product DUF3304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047064446.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290