>Feature sequence01 110 185 gene locus_tag LOCUS_t00010 110 185 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 217 318 gene locus_tag LOCUS_r00010 217 318 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 657 2075 gene locus_tag LOCUS_00010 gene ccoG 657 2075 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707874.1 protein_id gnl|my_center|LOCUS_00010 2127 3095 gene locus_tag LOCUS_00020 2127 3095 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707873.1 protein_id gnl|my_center|LOCUS_00020 3136 3738 gene locus_tag LOCUS_00030 3136 3738 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707872.1 protein_id gnl|my_center|LOCUS_00030 4100 3783 gene locus_tag LOCUS_00040 4100 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071883.1 protein_id gnl|my_center|LOCUS_00040 5678 4167 gene locus_tag LOCUS_00050 5678 4167 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707862.1 protein_id gnl|my_center|LOCUS_00050 6062 7705 gene locus_tag LOCUS_00060 gene ilvG 6062 7705 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707860.1 protein_id gnl|my_center|LOCUS_00060 7708 7968 gene locus_tag LOCUS_00070 gene ilvM 7708 7968 CDS product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212016.1 protein_id gnl|my_center|LOCUS_00070 7980 8903 gene locus_tag LOCUS_00080 7980 8903 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 protein_id gnl|my_center|LOCUS_00080 8970 10820 gene locus_tag LOCUS_00090 gene ilvD 8970 10820 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703963.1 protein_id gnl|my_center|LOCUS_00090 10826 12379 gene locus_tag LOCUS_00100 gene ilvA 10826 12379 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707857.1 protein_id gnl|my_center|LOCUS_00100 12674 13513 gene locus_tag LOCUS_00110 12674 13513 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794809.1 protein_id gnl|my_center|LOCUS_00110 13510 14376 gene locus_tag LOCUS_00120 13510 14376 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 protein_id gnl|my_center|LOCUS_00120 15821 14652 gene locus_tag LOCUS_00130 15821 14652 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704439.1 protein_id gnl|my_center|LOCUS_00130 16938 15832 gene locus_tag LOCUS_00140 16938 15832 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704440.1 protein_id gnl|my_center|LOCUS_00140 17680 16925 gene locus_tag LOCUS_00150 17680 16925 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704441.1 protein_id gnl|my_center|LOCUS_00150 18606 17677 gene locus_tag LOCUS_00160 gene hemC 18606 17677 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 protein_id gnl|my_center|LOCUS_00160 18802 21318 gene locus_tag LOCUS_00170 18802 21318 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704443.1 protein_id gnl|my_center|LOCUS_00170 21626 21315 gene locus_tag LOCUS_00180 gene cyaY 21626 21315 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704445.1 protein_id gnl|my_center|LOCUS_00180 21699 21821 gene locus_tag LOCUS_00190 21699 21821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21833 23089 gene locus_tag LOCUS_00200 gene lysA 21833 23089 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704446.1 protein_id gnl|my_center|LOCUS_00200 23099 23926 gene locus_tag LOCUS_00210 gene dapF 23099 23926 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704447.1 protein_id gnl|my_center|LOCUS_00210 23923 24594 gene locus_tag LOCUS_00220 23923 24594 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349251.1 protein_id gnl|my_center|LOCUS_00220 24581 25534 gene locus_tag LOCUS_00230 gene xerC 24581 25534 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704449.1 protein_id gnl|my_center|LOCUS_00230 25609 26316 gene locus_tag LOCUS_00240 25609 26316 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704450.1 protein_id gnl|my_center|LOCUS_00240 26352 28520 gene locus_tag LOCUS_00250 gene uvrD 26352 28520 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704228.1 protein_id gnl|my_center|LOCUS_00250 28555 28827 gene locus_tag LOCUS_00260 28555 28827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 29794 28874 gene locus_tag LOCUS_00270 gene rarD 29794 28874 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704249.1 protein_id gnl|my_center|LOCUS_00270 30016 31842 gene locus_tag LOCUS_00280 gene recQ 30016 31842 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707789.1 protein_id gnl|my_center|LOCUS_00280 32196 31897 gene locus_tag LOCUS_00290 32196 31897 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707788.1 protein_id gnl|my_center|LOCUS_00290 32317 33750 gene locus_tag LOCUS_00300 32317 33750 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707787.1 protein_id gnl|my_center|LOCUS_00300 33753 34019 gene locus_tag LOCUS_00310 33753 34019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34201 34860 gene locus_tag LOCUS_00320 34201 34860 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707785.1 protein_id gnl|my_center|LOCUS_00320 35432 34857 gene locus_tag LOCUS_00330 35432 34857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36323 35676 gene locus_tag LOCUS_00340 gene elbB 36323 35676 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704213.1 protein_id gnl|my_center|LOCUS_00340 36555 39374 gene locus_tag LOCUS_00350 gene polA 36555 39374 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704214.1 protein_id gnl|my_center|LOCUS_00350 39863 40693 gene locus_tag LOCUS_00360 gene thiD 39863 40693 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263201.1 protein_id gnl|my_center|LOCUS_00360 40753 41070 gene locus_tag LOCUS_00370 40753 41070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 41114 42670 gene locus_tag LOCUS_00380 41114 42670 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204917.1 protein_id gnl|my_center|LOCUS_00380 42989 45286 gene locus_tag LOCUS_00390 42989 45286 CDS product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 protein_id gnl|my_center|LOCUS_00390 45283 45726 gene locus_tag LOCUS_00400 45283 45726 CDS product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 protein_id gnl|my_center|LOCUS_00400 45726 46073 gene locus_tag LOCUS_00410 45726 46073 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_00410 46070 47572 gene locus_tag LOCUS_00420 46070 47572 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404437.1 protein_id gnl|my_center|LOCUS_00420 47569 48042 gene locus_tag LOCUS_00430 47569 48042 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 protein_id gnl|my_center|LOCUS_00430 48047 48322 gene locus_tag LOCUS_00440 48047 48322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 48312 48692 gene locus_tag LOCUS_00450 gene mnhG 48312 48692 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958313.1 protein_id gnl|my_center|LOCUS_00450 49890 48736 gene locus_tag LOCUS_00460 49890 48736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 50681 49995 gene locus_tag LOCUS_00470 gene rsuA 50681 49995 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073606.1 protein_id gnl|my_center|LOCUS_00470 51331 50681 gene locus_tag LOCUS_00480 gene yihA 51331 50681 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703927.1 protein_id gnl|my_center|LOCUS_00480 51473 52090 gene locus_tag LOCUS_00490 51473 52090 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349084.1 protein_id gnl|my_center|LOCUS_00490 52140 52802 gene locus_tag LOCUS_00500 52140 52802 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 protein_id gnl|my_center|LOCUS_00500 52799 53353 gene locus_tag LOCUS_00510 gene yihI 52799 53353 CDS product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041217267.1 protein_id gnl|my_center|LOCUS_00510 53350 53808 gene locus_tag LOCUS_00520 53350 53808 CDS product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704279.1 protein_id gnl|my_center|LOCUS_00520 53824 55194 gene locus_tag LOCUS_00530 gene hemN 53824 55194 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704280.1 protein_id gnl|my_center|LOCUS_00530 55776 57647 gene locus_tag LOCUS_00540 55776 57647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 58036 58443 gene locus_tag LOCUS_00550 58036 58443 CDS product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290200.1 protein_id gnl|my_center|LOCUS_00550 58484 60040 gene locus_tag LOCUS_00560 58484 60040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 60122 61621 gene locus_tag LOCUS_00570 60122 61621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 61638 62369 gene locus_tag LOCUS_00580 61638 62369 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978021.1 protein_id gnl|my_center|LOCUS_00580 62586 63035 gene locus_tag LOCUS_00590 62586 63035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 63194 63370 gene locus_tag LOCUS_00600 63194 63370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 63704 65848 gene locus_tag LOCUS_00610 63704 65848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 65848 66117 gene locus_tag LOCUS_00620 65848 66117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 66261 68726 gene locus_tag LOCUS_00630 66261 68726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 68732 69349 gene locus_tag LOCUS_00640 68732 69349 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768051.1 protein_id gnl|my_center|LOCUS_00640 69414 70112 gene locus_tag LOCUS_00650 69414 70112 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768051.1 protein_id gnl|my_center|LOCUS_00650 71247 70243 gene locus_tag LOCUS_00660 gene add 71247 70243 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704281.1 protein_id gnl|my_center|LOCUS_00660 72747 71320 gene locus_tag LOCUS_00670 gene glnG 72747 71320 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635441.1 protein_id gnl|my_center|LOCUS_00670 73809 72757 gene locus_tag LOCUS_00680 gene glnL 73809 72757 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704282.1 protein_id gnl|my_center|LOCUS_00680 74068 74499 gene locus_tag LOCUS_00690 gene slyA 74068 74499 CDS product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078997.1 protein_id gnl|my_center|LOCUS_00690 74504 75472 gene locus_tag LOCUS_00700 74504 75472 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119629.1 protein_id gnl|my_center|LOCUS_00700 75481 76494 gene locus_tag LOCUS_00710 75481 76494 CDS product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122410.1 protein_id gnl|my_center|LOCUS_00710 77977 76568 gene locus_tag LOCUS_00720 gene glnA 77977 76568 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110151.1 protein_id gnl|my_center|LOCUS_00720 78312 80123 gene locus_tag LOCUS_00730 gene typA 78312 80123 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 protein_id gnl|my_center|LOCUS_00730 80256 81158 gene locus_tag LOCUS_00740 80256 81158 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704286.1 protein_id gnl|my_center|LOCUS_00740 81158 82117 gene locus_tag LOCUS_00750 gene pip 81158 82117 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414210.1 protein_id gnl|my_center|LOCUS_00750 82114 82551 gene locus_tag LOCUS_00760 gene dtd 82114 82551 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704287.1 protein_id gnl|my_center|LOCUS_00760 82620 83510 gene locus_tag LOCUS_00770 82620 83510 CDS product bifunctional GNAT family N-acetyltransferase/hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704289.1 protein_id gnl|my_center|LOCUS_00770 85585 83549 gene locus_tag LOCUS_00780 85585 83549 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704290.1 protein_id gnl|my_center|LOCUS_00780 87725 85653 gene locus_tag LOCUS_00790 gene recG 87725 85653 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819155.1 protein_id gnl|my_center|LOCUS_00790 89177 87828 gene locus_tag LOCUS_00800 gene pssA 89177 87828 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275564.1 protein_id gnl|my_center|LOCUS_00800 91114 89324 gene locus_tag LOCUS_00810 91114 89324 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704534.1 protein_id gnl|my_center|LOCUS_00810 92178 91270 gene locus_tag LOCUS_00820 92178 91270 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704312.1 protein_id gnl|my_center|LOCUS_00820 92472 92254 gene locus_tag LOCUS_00830 92472 92254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 93267 92566 gene locus_tag LOCUS_00840 93267 92566 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947958.1 protein_id gnl|my_center|LOCUS_00840 94440 93277 gene locus_tag LOCUS_00850 94440 93277 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 protein_id gnl|my_center|LOCUS_00850 95841 94450 gene locus_tag LOCUS_00860 95841 94450 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_00860 97228 95858 gene locus_tag LOCUS_00870 97228 95858 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_00870 98750 97314 gene locus_tag LOCUS_00880 gene eat 98750 97314 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114906.1 protein_id gnl|my_center|LOCUS_00880 99907 98939 gene locus_tag LOCUS_00890 99907 98939 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806971.1 protein_id gnl|my_center|LOCUS_00890 103102 100025 gene locus_tag LOCUS_00900 103102 100025 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704065.1 protein_id gnl|my_center|LOCUS_00900 104236 103115 gene locus_tag LOCUS_00910 gene vmeC 104236 103115 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455175.1 protein_id gnl|my_center|LOCUS_00910 104830 104264 gene locus_tag LOCUS_00920 104830 104264 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262873.1 protein_id gnl|my_center|LOCUS_00920 105053 105129 gene locus_tag LOCUS_t00020 105053 105129 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 105151 105226 gene locus_tag LOCUS_t00030 105151 105226 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 105260 105345 gene locus_tag LOCUS_t00040 105260 105345 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 105458 105534 gene locus_tag LOCUS_t00050 105458 105534 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 105901 105626 gene locus_tag LOCUS_00930 105901 105626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 106207 106875 gene locus_tag LOCUS_00940 gene ribB 106207 106875 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070545.1 protein_id gnl|my_center|LOCUS_00940 107699 106929 gene locus_tag LOCUS_00950 gene yafV 107699 106929 CDS product 2-oxoglutaramate amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118036.1 protein_id gnl|my_center|LOCUS_00950 108832 107687 gene locus_tag LOCUS_00960 108832 107687 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816945.1 protein_id gnl|my_center|LOCUS_00960 109026 109877 gene locus_tag LOCUS_00970 109026 109877 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392225.1 protein_id gnl|my_center|LOCUS_00970 >Feature sequence02 >Feature sequence03 1779 415 gene locus_tag LOCUS_00980 1779 415 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706777.1 protein_id gnl|my_center|LOCUS_00980 2946 1837 gene locus_tag LOCUS_00990 2946 1837 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749934.1 protein_id gnl|my_center|LOCUS_00990 3900 2962 gene locus_tag LOCUS_01000 3900 2962 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096549.1 protein_id gnl|my_center|LOCUS_01000 4256 6241 gene locus_tag LOCUS_01010 4256 6241 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105342.1 protein_id gnl|my_center|LOCUS_01010 8142 6328 gene locus_tag LOCUS_01020 8142 6328 CDS product Wzy polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818252.1 protein_id gnl|my_center|LOCUS_01020 12066 8380 gene locus_tag LOCUS_01030 12066 8380 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705451.1 protein_id gnl|my_center|LOCUS_01030 13778 12063 gene locus_tag LOCUS_01040 13778 12063 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819691.1 protein_id gnl|my_center|LOCUS_01040 13930 14475 gene locus_tag LOCUS_01050 13930 14475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 14995 14426 gene locus_tag LOCUS_01060 14995 14426 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705447.1 protein_id gnl|my_center|LOCUS_01060 15248 15373 gene locus_tag LOCUS_01070 15248 15373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 15646 15479 gene locus_tag LOCUS_01080 15646 15479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 15718 17451 gene locus_tag LOCUS_01090 15718 17451 CDS product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367939.1 protein_id gnl|my_center|LOCUS_01090 17441 19219 gene locus_tag LOCUS_01100 17441 19219 CDS product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095870.1 protein_id gnl|my_center|LOCUS_01100 19536 22595 gene locus_tag LOCUS_01110 19536 22595 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707626.1 protein_id gnl|my_center|LOCUS_01110 23034 22636 gene locus_tag LOCUS_01120 23034 22636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 23392 23051 gene locus_tag LOCUS_01130 23392 23051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 23531 24100 gene locus_tag LOCUS_01140 23531 24100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457970.1 protein_id gnl|my_center|LOCUS_01140 24419 24171 gene locus_tag LOCUS_01150 24419 24171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386920.1 protein_id gnl|my_center|LOCUS_01150 24693 34680 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgcgcctgcggggaacgg 35058 34765 gene locus_tag LOCUS_01160 gene cas2e 35058 34765 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063176.1 protein_id gnl|my_center|LOCUS_01160 35978 35061 gene locus_tag LOCUS_01170 gene cas1e 35978 35061 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220066.1 protein_id gnl|my_center|LOCUS_01170 36835 36008 gene locus_tag LOCUS_01180 gene cas6e 36835 36008 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281463.1 protein_id gnl|my_center|LOCUS_01180 37571 36837 gene locus_tag LOCUS_01190 gene cas5e 37571 36837 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085058.1 protein_id gnl|my_center|LOCUS_01190 38615 37581 gene locus_tag LOCUS_01200 gene cas7e 38615 37581 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044180303.1 protein_id gnl|my_center|LOCUS_01200 39242 38631 gene locus_tag LOCUS_01210 39242 38631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 40834 39239 gene locus_tag LOCUS_01220 gene casA 40834 39239 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083149.1 protein_id gnl|my_center|LOCUS_01220 43887 41167 gene locus_tag LOCUS_01230 43887 41167 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091704098.1 protein_id gnl|my_center|LOCUS_01230 44818 43982 gene locus_tag LOCUS_01240 44818 43982 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_01240 45839 44967 gene locus_tag LOCUS_01250 gene htpX 45839 44967 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705391.1 protein_id gnl|my_center|LOCUS_01250 46608 45925 gene locus_tag LOCUS_01260 gene bioD 46608 45925 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705390.1 protein_id gnl|my_center|LOCUS_01260 47359 46601 gene locus_tag LOCUS_01270 gene bioC 47359 46601 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705389.1 protein_id gnl|my_center|LOCUS_01270 48507 47356 gene locus_tag LOCUS_01280 gene bioF 48507 47356 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705388.1 protein_id gnl|my_center|LOCUS_01280 49815 48778 gene locus_tag LOCUS_01290 gene bioB 49815 48778 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_01290 49918 51183 gene locus_tag LOCUS_01300 gene bioA 49918 51183 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819662.1 protein_id gnl|my_center|LOCUS_01300 >Feature sequence04 790 434 gene locus_tag LOCUS_01310 790 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 1215 787 gene locus_tag LOCUS_01320 1215 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707401.1 protein_id gnl|my_center|LOCUS_01320 1596 1324 gene locus_tag LOCUS_01330 gene hupA 1596 1324 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305063.1 protein_id gnl|my_center|LOCUS_01330 2717 1854 gene locus_tag LOCUS_01340 2717 1854 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478191.1 protein_id gnl|my_center|LOCUS_01340 3694 2894 gene locus_tag LOCUS_01350 3694 2894 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070950.1 protein_id gnl|my_center|LOCUS_01350 4016 3729 gene locus_tag LOCUS_01360 4016 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 5508 4039 gene locus_tag LOCUS_01370 gene astD 5508 4039 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706955.1 protein_id gnl|my_center|LOCUS_01370 6529 5513 gene locus_tag LOCUS_01380 gene astA 6529 5513 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706956.1 protein_id gnl|my_center|LOCUS_01380 7823 6609 gene locus_tag LOCUS_01390 7823 6609 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706957.1 protein_id gnl|my_center|LOCUS_01390 8793 8212 gene locus_tag LOCUS_01400 8793 8212 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925686.1 protein_id gnl|my_center|LOCUS_01400 9081 9287 gene locus_tag LOCUS_01410 9081 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 10281 9391 gene locus_tag LOCUS_01420 10281 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 11263 11520 gene locus_tag LOCUS_01430 11263 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 11615 11944 gene locus_tag LOCUS_01440 11615 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 12020 12973 gene locus_tag LOCUS_01450 12020 12973 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_01450 13052 14035 gene locus_tag LOCUS_01460 13052 14035 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 protein_id gnl|my_center|LOCUS_01460 14032 14928 gene locus_tag LOCUS_01470 14032 14928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042012908.1 protein_id gnl|my_center|LOCUS_01470 15133 15630 gene locus_tag LOCUS_01480 gene radC 15133 15630 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050665004.1 protein_id gnl|my_center|LOCUS_01480 15645 16079 gene locus_tag LOCUS_01490 15645 16079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 16517 16741 gene locus_tag LOCUS_01500 16517 16741 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_01500 16748 17749 gene locus_tag LOCUS_01510 16748 17749 CDS product CBASS cGAMP-activated phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133548.1 protein_id gnl|my_center|LOCUS_01510 17743 18882 gene locus_tag LOCUS_01520 17743 18882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 18879 20510 gene locus_tag LOCUS_01530 18879 20510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 20564 20974 gene locus_tag LOCUS_01540 20564 20974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 21151 24033 gene locus_tag LOCUS_01550 21151 24033 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_01550 24044 24661 gene locus_tag LOCUS_01560 24044 24661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 24835 24668 gene locus_tag LOCUS_01570 24835 24668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 24986 28462 gene locus_tag LOCUS_01580 24986 28462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 28472 31891 gene locus_tag LOCUS_01590 28472 31891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 34256 33510 gene locus_tag LOCUS_01600 34256 33510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 35877 34237 gene locus_tag LOCUS_01610 35877 34237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 37301 36411 gene locus_tag LOCUS_01620 37301 36411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 37396 38838 gene locus_tag LOCUS_01630 37396 38838 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976014.1 protein_id gnl|my_center|LOCUS_01630 38852 39865 gene locus_tag LOCUS_01640 38852 39865 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 protein_id gnl|my_center|LOCUS_01640 39913 41475 gene locus_tag LOCUS_01650 39913 41475 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479897.1 protein_id gnl|my_center|LOCUS_01650 41571 41984 gene locus_tag LOCUS_01660 41571 41984 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529414.1 protein_id gnl|my_center|LOCUS_01660 42158 41979 gene locus_tag LOCUS_01670 42158 41979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01670 42616 44202 gene locus_tag LOCUS_01680 42616 44202 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 protein_id gnl|my_center|LOCUS_01680 44186 46195 gene locus_tag LOCUS_01690 44186 46195 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041602000.1 protein_id gnl|my_center|LOCUS_01690 46260 47171 gene locus_tag LOCUS_01700 46260 47171 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104205.1 protein_id gnl|my_center|LOCUS_01700 48106 47294 gene locus_tag LOCUS_01710 48106 47294 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_01710 48199 49098 gene locus_tag LOCUS_01720 48199 49098 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532815.1 protein_id gnl|my_center|LOCUS_01720 50460 49120 gene locus_tag LOCUS_01730 50460 49120 CDS product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113382.1 protein_id gnl|my_center|LOCUS_01730 51039 52553 gene locus_tag LOCUS_01740 51039 52553 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 protein_id gnl|my_center|LOCUS_01740 53347 52580 gene locus_tag LOCUS_01750 53347 52580 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312277.1 protein_id gnl|my_center|LOCUS_01750 53851 53399 gene locus_tag LOCUS_01760 53851 53399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 55923 53905 gene locus_tag LOCUS_01770 55923 53905 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791648.1 protein_id gnl|my_center|LOCUS_01770 56933 55920 gene locus_tag LOCUS_01780 56933 55920 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940088.1 protein_id gnl|my_center|LOCUS_01780 57275 58897 gene locus_tag LOCUS_01790 57275 58897 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085184.1 protein_id gnl|my_center|LOCUS_01790 60211 59024 gene locus_tag LOCUS_01800 60211 59024 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130487.1 protein_id gnl|my_center|LOCUS_01800 61015 61392 gene locus_tag LOCUS_01810 61015 61392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 61463 61951 gene locus_tag LOCUS_01820 61463 61951 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152114.1 protein_id gnl|my_center|LOCUS_01820 62177 63940 gene locus_tag LOCUS_01830 62177 63940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 64499 63921 gene locus_tag LOCUS_01840 64499 63921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 65634 64537 gene locus_tag LOCUS_01850 gene zapE 65634 64537 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111446.1 protein_id gnl|my_center|LOCUS_01850 66776 65703 gene locus_tag LOCUS_01860 66776 65703 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704959.1 protein_id gnl|my_center|LOCUS_01860 67266 66778 gene locus_tag LOCUS_01870 gene cheD 67266 66778 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403301.1 protein_id gnl|my_center|LOCUS_01870 68069 67263 gene locus_tag LOCUS_01880 68069 67263 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770000.1 protein_id gnl|my_center|LOCUS_01880 69778 68102 gene locus_tag LOCUS_01890 69778 68102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 70474 69938 gene locus_tag LOCUS_01900 70474 69938 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381223.1 protein_id gnl|my_center|LOCUS_01900 72186 70558 gene locus_tag LOCUS_01910 72186 70558 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266628.1 protein_id gnl|my_center|LOCUS_01910 74394 72235 gene locus_tag LOCUS_01920 74394 72235 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 protein_id gnl|my_center|LOCUS_01920 74750 74424 gene locus_tag LOCUS_01930 74750 74424 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704966.1 protein_id gnl|my_center|LOCUS_01930 75131 74763 gene locus_tag LOCUS_01940 75131 74763 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004880039.1 protein_id gnl|my_center|LOCUS_01940 76298 75144 gene locus_tag LOCUS_01950 76298 75144 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770011.1 protein_id gnl|my_center|LOCUS_01950 77136 77846 gene locus_tag LOCUS_01960 77136 77846 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531705.1 protein_id gnl|my_center|LOCUS_01960 77871 79457 gene locus_tag LOCUS_01970 77871 79457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 79588 80886 gene locus_tag LOCUS_01980 79588 80886 CDS product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705158.1 protein_id gnl|my_center|LOCUS_01980 80949 82553 gene locus_tag LOCUS_01990 80949 82553 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705160.1 protein_id gnl|my_center|LOCUS_01990 82532 83224 gene locus_tag LOCUS_02000 82532 83224 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705161.1 protein_id gnl|my_center|LOCUS_02000 83626 83285 gene locus_tag LOCUS_02010 83626 83285 CDS product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010674427.1 protein_id gnl|my_center|LOCUS_02010 83770 84420 gene locus_tag LOCUS_02020 83770 84420 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813004.1 protein_id gnl|my_center|LOCUS_02020 84413 85606 gene locus_tag LOCUS_02030 gene pncB 84413 85606 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035921.1 protein_id gnl|my_center|LOCUS_02030 85716 86513 gene locus_tag LOCUS_02040 gene phhA 85716 86513 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705758.1 protein_id gnl|my_center|LOCUS_02040 86524 86865 gene locus_tag LOCUS_02050 86524 86865 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071818.1 protein_id gnl|my_center|LOCUS_02050 87552 87118 gene locus_tag LOCUS_02060 87552 87118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 88044 87589 gene locus_tag LOCUS_02070 88044 87589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 89375 88101 gene locus_tag LOCUS_02080 89375 88101 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367265.1 protein_id gnl|my_center|LOCUS_02080 90874 89390 gene locus_tag LOCUS_02090 gene puuC 90874 89390 CDS product aldehyde dehydrogenase PuuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096836.1 protein_id gnl|my_center|LOCUS_02090 91458 90892 gene locus_tag LOCUS_02100 gene puuR 91458 90892 CDS product HTH-type transcriptional regulator PuuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096835.1 protein_id gnl|my_center|LOCUS_02100 92237 91455 gene locus_tag LOCUS_02110 gene puuD 92237 91455 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307158.1 protein_id gnl|my_center|LOCUS_02110 92409 93818 gene locus_tag LOCUS_02120 gene puuA 92409 93818 CDS product glutamate-putrescine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296746.1 protein_id gnl|my_center|LOCUS_02120 93964 95448 gene locus_tag LOCUS_02130 93964 95448 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477816.1 protein_id gnl|my_center|LOCUS_02130 95578 96504 gene locus_tag LOCUS_02140 95578 96504 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382910.1 protein_id gnl|my_center|LOCUS_02140 96555 97739 gene locus_tag LOCUS_02150 96555 97739 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382911.1 protein_id gnl|my_center|LOCUS_02150 98848 97853 gene locus_tag LOCUS_02160 gene cydB 98848 97853 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945961.1 protein_id gnl|my_center|LOCUS_02160 100256 98850 gene locus_tag LOCUS_02170 100256 98850 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188183.1 protein_id gnl|my_center|LOCUS_02170 100543 102414 gene locus_tag LOCUS_02180 100543 102414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 102411 103751 gene locus_tag LOCUS_02190 102411 103751 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_02190 105205 103973 gene locus_tag LOCUS_02200 105205 103973 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_02200 106706 105315 gene locus_tag LOCUS_02210 106706 105315 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 protein_id gnl|my_center|LOCUS_02210 107976 106885 gene locus_tag LOCUS_02220 gene hppD 107976 106885 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454802.1 protein_id gnl|my_center|LOCUS_02220 108125 108604 gene locus_tag LOCUS_02230 108125 108604 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266690.1 protein_id gnl|my_center|LOCUS_02230 109694 108687 gene locus_tag LOCUS_02240 109694 108687 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065037.1 protein_id gnl|my_center|LOCUS_02240 110692 109694 gene locus_tag LOCUS_02250 110692 109694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311331.1 protein_id gnl|my_center|LOCUS_02250 111683 110703 gene locus_tag LOCUS_02260 111683 110703 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040761.1 protein_id gnl|my_center|LOCUS_02260 112669 111698 gene locus_tag LOCUS_02270 112669 111698 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065034.1 protein_id gnl|my_center|LOCUS_02270 114305 112716 gene locus_tag LOCUS_02280 114305 112716 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970061.1 protein_id gnl|my_center|LOCUS_02280 114574 115764 gene locus_tag LOCUS_02290 114574 115764 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970063.1 protein_id gnl|my_center|LOCUS_02290 115800 117269 gene locus_tag LOCUS_02300 115800 117269 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974081.1 protein_id gnl|my_center|LOCUS_02300 118669 117608 gene locus_tag LOCUS_02310 118669 117608 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480234.1 protein_id gnl|my_center|LOCUS_02310 119629 118931 gene locus_tag LOCUS_02320 119629 118931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 121722 119710 gene locus_tag LOCUS_02330 121722 119710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 122150 121725 gene locus_tag LOCUS_02340 122150 121725 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477070.1 protein_id gnl|my_center|LOCUS_02340 122291 123565 gene locus_tag LOCUS_02350 gene yjeH 122291 123565 CDS product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705120.1 protein_id gnl|my_center|LOCUS_02350 124970 123798 gene locus_tag LOCUS_02360 124970 123798 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995535.1 protein_id gnl|my_center|LOCUS_02360 126426 125044 gene locus_tag LOCUS_02370 126426 125044 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009934990.1 protein_id gnl|my_center|LOCUS_02370 127339 126443 gene locus_tag LOCUS_02380 gene rfbD 127339 126443 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_02380 127875 127336 gene locus_tag LOCUS_02390 gene rfbC 127875 127336 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261024.1 protein_id gnl|my_center|LOCUS_02390 128750 127872 gene locus_tag LOCUS_02400 gene rfbA 128750 127872 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103413.1 protein_id gnl|my_center|LOCUS_02400 129817 128747 gene locus_tag LOCUS_02410 gene rffG 129817 128747 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216798.1 protein_id gnl|my_center|LOCUS_02410 130854 129829 gene locus_tag LOCUS_02420 130854 129829 CDS product DUF1972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172642.1 protein_id gnl|my_center|LOCUS_02420 131680 130961 gene locus_tag LOCUS_02430 131680 130961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 132157 132330 gene locus_tag LOCUS_02440 132157 132330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 134887 133565 gene locus_tag LOCUS_02450 134887 133565 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768493.1 protein_id gnl|my_center|LOCUS_02450 135430 134918 gene locus_tag LOCUS_02460 135430 134918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 136782 136045 gene locus_tag LOCUS_02470 136782 136045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 138102 137266 gene locus_tag LOCUS_02480 gene fghA 138102 137266 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113869.1 protein_id gnl|my_center|LOCUS_02480 139418 138294 gene locus_tag LOCUS_02490 139418 138294 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162256.1 protein_id gnl|my_center|LOCUS_02490 139702 140571 gene locus_tag LOCUS_02500 139702 140571 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307641.1 protein_id gnl|my_center|LOCUS_02500 140842 141612 gene locus_tag LOCUS_02510 140842 141612 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741188.1 protein_id gnl|my_center|LOCUS_02510 141798 143294 gene locus_tag LOCUS_02520 gene putP 141798 143294 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_02520 146009 143370 gene locus_tag LOCUS_02530 146009 143370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 146049 147563 gene locus_tag LOCUS_02540 146049 147563 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706587.1 protein_id gnl|my_center|LOCUS_02540 148003 147560 gene locus_tag LOCUS_02550 148003 147560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 148626 148156 gene locus_tag LOCUS_02560 gene bfr 148626 148156 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 protein_id gnl|my_center|LOCUS_02560 149103 148639 gene locus_tag LOCUS_02570 gene bfr 149103 148639 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071355.1 protein_id gnl|my_center|LOCUS_02570 149966 149304 gene locus_tag LOCUS_02580 gene hxpB 149966 149304 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 protein_id gnl|my_center|LOCUS_02580 150998 149988 gene locus_tag LOCUS_02590 150998 149988 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098564.1 protein_id gnl|my_center|LOCUS_02590 152466 151042 gene locus_tag LOCUS_02600 152466 151042 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705235.1 protein_id gnl|my_center|LOCUS_02600 153684 152692 gene locus_tag LOCUS_02610 153684 152692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099948.1 protein_id gnl|my_center|LOCUS_02610 154842 153850 gene locus_tag LOCUS_02620 154842 153850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 155312 154872 gene locus_tag LOCUS_02630 155312 154872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 155403 156011 gene locus_tag LOCUS_02640 155403 156011 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704488.1 protein_id gnl|my_center|LOCUS_02640 156008 156916 gene locus_tag LOCUS_02650 156008 156916 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929674.1 protein_id gnl|my_center|LOCUS_02650 158754 156955 gene locus_tag LOCUS_02660 158754 156955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_02660 159419 158814 gene locus_tag LOCUS_02670 159419 158814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 160755 159547 gene locus_tag LOCUS_02680 160755 159547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 161282 160890 gene locus_tag LOCUS_02690 161282 160890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 161450 162007 gene locus_tag LOCUS_02700 161450 162007 CDS product DUF2939 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087044236.1 protein_id gnl|my_center|LOCUS_02700 162863 162009 gene locus_tag LOCUS_02710 162863 162009 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141082.1 protein_id gnl|my_center|LOCUS_02710 163407 162913 gene locus_tag LOCUS_02720 163407 162913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 166103 163404 gene locus_tag LOCUS_02730 166103 163404 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207762468.1 protein_id gnl|my_center|LOCUS_02730 166788 166225 gene locus_tag LOCUS_02740 166788 166225 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 protein_id gnl|my_center|LOCUS_02740 168523 166985 gene locus_tag LOCUS_02750 168523 166985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 169022 168573 gene locus_tag LOCUS_02760 169022 168573 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243242.1 protein_id gnl|my_center|LOCUS_02760 169219 170352 gene locus_tag LOCUS_02770 169219 170352 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549756.1 protein_id gnl|my_center|LOCUS_02770 170776 171762 gene locus_tag LOCUS_02780 170776 171762 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706476.1 protein_id gnl|my_center|LOCUS_02780 171749 172378 gene locus_tag LOCUS_02790 gene maiA 171749 172378 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_02790 172379 174343 gene locus_tag LOCUS_02800 172379 174343 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704166.1 protein_id gnl|my_center|LOCUS_02800 174435 175259 gene locus_tag LOCUS_02810 174435 175259 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819278.1 protein_id gnl|my_center|LOCUS_02810 175574 176044 gene locus_tag LOCUS_02820 175574 176044 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763215.1 protein_id gnl|my_center|LOCUS_02820 176342 178717 gene locus_tag LOCUS_02830 176342 178717 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236179.1 protein_id gnl|my_center|LOCUS_02830 178832 179581 gene locus_tag LOCUS_02840 178832 179581 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032699777.1 protein_id gnl|my_center|LOCUS_02840 179941 179591 gene locus_tag LOCUS_02850 179941 179591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 180730 179945 gene locus_tag LOCUS_02860 180730 179945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 181656 180910 gene locus_tag LOCUS_02870 181656 180910 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763178.1 protein_id gnl|my_center|LOCUS_02870 182674 181799 gene locus_tag LOCUS_02880 182674 181799 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244655.1 protein_id gnl|my_center|LOCUS_02880 183973 182723 gene locus_tag LOCUS_02890 183973 182723 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763182.1 protein_id gnl|my_center|LOCUS_02890 185139 183970 gene locus_tag LOCUS_02900 185139 183970 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399727.1 protein_id gnl|my_center|LOCUS_02900 186398 185151 gene locus_tag LOCUS_02910 186398 185151 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269002.1 protein_id gnl|my_center|LOCUS_02910 187385 186414 gene locus_tag LOCUS_02920 gene cpaB 187385 186414 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105205.1 protein_id gnl|my_center|LOCUS_02920 187751 187972 gene locus_tag LOCUS_02930 187751 187972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 189780 188062 gene locus_tag LOCUS_02940 189780 188062 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550550.1 protein_id gnl|my_center|LOCUS_02940 191474 189996 gene locus_tag LOCUS_02950 191474 189996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 191837 192325 gene locus_tag LOCUS_02960 191837 192325 CDS product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763217.1 protein_id gnl|my_center|LOCUS_02960 192349 194262 gene locus_tag LOCUS_02970 gene tadG 192349 194262 CDS product type 4b pilus Flp biogenesis protein TadG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114984.1 protein_id gnl|my_center|LOCUS_02970 194277 194822 gene locus_tag LOCUS_02980 194277 194822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 195322 194888 gene locus_tag LOCUS_02990 195322 194888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 195699 195487 gene locus_tag LOCUS_03000 195699 195487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706959.1 protein_id gnl|my_center|LOCUS_03000 196773 195760 gene locus_tag LOCUS_03010 gene trpS 196773 195760 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706960.1 protein_id gnl|my_center|LOCUS_03010 197455 196784 gene locus_tag LOCUS_03020 197455 196784 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706961.1 protein_id gnl|my_center|LOCUS_03020 198122 197448 gene locus_tag LOCUS_03030 gene rpe 198122 197448 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351625.1 protein_id gnl|my_center|LOCUS_03030 198227 198403 gene locus_tag LOCUS_03040 198227 198403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 199280 198453 gene locus_tag LOCUS_03050 199280 198453 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706963.1 protein_id gnl|my_center|LOCUS_03050 200770 199343 gene locus_tag LOCUS_03060 200770 199343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 201849 200767 gene locus_tag LOCUS_03070 gene aroB 201849 200767 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706965.1 protein_id gnl|my_center|LOCUS_03070 202346 201864 gene locus_tag LOCUS_03080 gene aroK 202346 201864 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298388.1 protein_id gnl|my_center|LOCUS_03080 204651 202630 gene locus_tag LOCUS_03090 204651 202630 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706966.1 protein_id gnl|my_center|LOCUS_03090 205188 204673 gene locus_tag LOCUS_03100 205188 204673 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_03100 205769 205185 gene locus_tag LOCUS_03110 gene tapO 205769 205185 CDS product PilO family type IV pilus biogenesis protein TapO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706968.1 protein_id gnl|my_center|LOCUS_03110 206326 205766 gene locus_tag LOCUS_03120 gene tapN 206326 205766 CDS product PilN family type IV pilus biogenesis protein TapN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706969.1 protein_id gnl|my_center|LOCUS_03120 207369 206314 gene locus_tag LOCUS_03130 gene tapM 207369 206314 CDS product PilM family type IVa pilus assembly protein TapM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706970.1 protein_id gnl|my_center|LOCUS_03130 207534 209912 gene locus_tag LOCUS_03140 207534 209912 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668733.1 protein_id gnl|my_center|LOCUS_03140 210869 209976 gene locus_tag LOCUS_03150 gene oxyR 210869 209976 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409206.1 protein_id gnl|my_center|LOCUS_03150 211725 210997 gene locus_tag LOCUS_03160 211725 210997 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 protein_id gnl|my_center|LOCUS_03160 212115 211876 gene locus_tag LOCUS_03170 212115 211876 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104887.1 protein_id gnl|my_center|LOCUS_03170 213097 212147 gene locus_tag LOCUS_03180 gene dusA 213097 212147 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707399.1 protein_id gnl|my_center|LOCUS_03180 213275 214348 gene locus_tag LOCUS_03190 213275 214348 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975769.1 protein_id gnl|my_center|LOCUS_03190 214609 214851 gene locus_tag LOCUS_03200 214609 214851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 215485 215045 gene locus_tag LOCUS_03210 215485 215045 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074368.1 protein_id gnl|my_center|LOCUS_03210 215712 215530 gene locus_tag LOCUS_03220 215712 215530 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103638.1 protein_id gnl|my_center|LOCUS_03220 216310 216507 gene locus_tag LOCUS_03230 216310 216507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 216504 216719 gene locus_tag LOCUS_03240 216504 216719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 216782 217357 gene locus_tag LOCUS_03250 216782 217357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 217599 218288 gene locus_tag LOCUS_03260 217599 218288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 218759 218929 gene locus_tag LOCUS_03270 218759 218929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 218926 219207 gene locus_tag LOCUS_03280 218926 219207 CDS product pyocin activator PrtN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267327.1 protein_id gnl|my_center|LOCUS_03280 219204 219455 gene locus_tag LOCUS_03290 219204 219455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 219445 221643 gene locus_tag LOCUS_03300 219445 221643 CDS product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150388894.1 protein_id gnl|my_center|LOCUS_03300 221640 222677 gene locus_tag LOCUS_03310 221640 222677 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027757.1 protein_id gnl|my_center|LOCUS_03310 223089 223400 gene locus_tag LOCUS_03320 223089 223400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 224447 223647 gene locus_tag LOCUS_03330 224447 223647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 225701 224619 gene locus_tag LOCUS_03340 225701 224619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 228165 226672 gene locus_tag LOCUS_03350 228165 226672 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537520.1 protein_id gnl|my_center|LOCUS_03350 229261 228146 gene locus_tag LOCUS_03360 229261 228146 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383637.1 protein_id gnl|my_center|LOCUS_03360 229354 229803 gene locus_tag LOCUS_03370 gene zur 229354 229803 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707398.1 protein_id gnl|my_center|LOCUS_03370 229842 230048 gene locus_tag LOCUS_03380 229842 230048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 230116 230994 gene locus_tag LOCUS_03390 230116 230994 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031361.1 protein_id gnl|my_center|LOCUS_03390 232172 231084 gene locus_tag LOCUS_03400 gene alr 232172 231084 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704949.1 protein_id gnl|my_center|LOCUS_03400 233576 232182 gene locus_tag LOCUS_03410 gene dnaB 233576 232182 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704946.1 protein_id gnl|my_center|LOCUS_03410 233864 234718 gene locus_tag LOCUS_03420 233864 234718 CDS product Tim44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704944.1 protein_id gnl|my_center|LOCUS_03420 234862 237819 gene locus_tag LOCUS_03430 234862 237819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 238999 237869 gene locus_tag LOCUS_03440 238999 237869 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_03440 240799 239009 gene locus_tag LOCUS_03450 gene oadA 240799 239009 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_03450 241095 240853 gene locus_tag LOCUS_03460 241095 240853 CDS product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148780.1 protein_id gnl|my_center|LOCUS_03460 241452 241376 gene locus_tag LOCUS_t00060 241452 241376 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 241553 241477 gene locus_tag LOCUS_t00070 241553 241477 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 241659 241583 gene locus_tag LOCUS_t00080 241659 241583 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 241757 241665 gene locus_tag LOCUS_t00090 241757 241665 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 242083 241892 gene locus_tag LOCUS_03470 gene csrA 242083 241892 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417777.1 protein_id gnl|my_center|LOCUS_03470 244889 242265 gene locus_tag LOCUS_03480 gene alaS 244889 242265 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707429.1 protein_id gnl|my_center|LOCUS_03480 245453 244995 gene locus_tag LOCUS_03490 gene recX 245453 244995 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098485.1 protein_id gnl|my_center|LOCUS_03490 246568 245498 gene locus_tag LOCUS_03500 gene recA 246568 245498 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707431.1 protein_id gnl|my_center|LOCUS_03500 247153 246641 gene locus_tag LOCUS_03510 gene pncC 247153 246641 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 protein_id gnl|my_center|LOCUS_03510 247269 249854 gene locus_tag LOCUS_03520 gene mutS 247269 249854 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707433.1 protein_id gnl|my_center|LOCUS_03520 250889 249918 gene locus_tag LOCUS_03530 gene rpoS 250889 249918 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704778.1 protein_id gnl|my_center|LOCUS_03530 251957 250932 gene locus_tag LOCUS_03540 251957 250932 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819395.1 protein_id gnl|my_center|LOCUS_03540 252502 251957 gene locus_tag LOCUS_03550 252502 251957 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_03550 253161 252535 gene locus_tag LOCUS_03560 253161 252535 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704775.1 protein_id gnl|my_center|LOCUS_03560 253911 253165 gene locus_tag LOCUS_03570 gene surE 253911 253165 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704774.1 protein_id gnl|my_center|LOCUS_03570 254935 253892 gene locus_tag LOCUS_03580 gene truD 254935 253892 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704773.1 protein_id gnl|my_center|LOCUS_03580 255408 254932 gene locus_tag LOCUS_03590 gene ispF 255408 254932 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704772.1 protein_id gnl|my_center|LOCUS_03590 256100 255405 gene locus_tag LOCUS_03600 gene ispD 256100 255405 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704771.1 protein_id gnl|my_center|LOCUS_03600 256387 256097 gene locus_tag LOCUS_03610 gene ftsB 256387 256097 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704770.1 protein_id gnl|my_center|LOCUS_03610 257792 256491 gene locus_tag LOCUS_03620 gene eno 257792 256491 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648049.1 protein_id gnl|my_center|LOCUS_03620 259473 257881 gene locus_tag LOCUS_03630 gene pyrG 259473 257881 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704768.1 protein_id gnl|my_center|LOCUS_03630 259460 259624 gene locus_tag LOCUS_03640 259460 259624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 260867 259929 gene locus_tag LOCUS_03650 260867 259929 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_03650 261616 260867 gene locus_tag LOCUS_03660 261616 260867 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267372.1 protein_id gnl|my_center|LOCUS_03660 261746 263395 gene locus_tag LOCUS_03670 261746 263395 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406170.1 protein_id gnl|my_center|LOCUS_03670 264338 263577 gene locus_tag LOCUS_03680 264338 263577 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705951.1 protein_id gnl|my_center|LOCUS_03680 265237 264341 gene locus_tag LOCUS_03690 gene mmsB 265237 264341 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477273.1 protein_id gnl|my_center|LOCUS_03690 266385 265252 gene locus_tag LOCUS_03700 266385 265252 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 protein_id gnl|my_center|LOCUS_03700 267171 266395 gene locus_tag LOCUS_03710 267171 266395 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483360.1 protein_id gnl|my_center|LOCUS_03710 268593 267439 gene locus_tag LOCUS_03720 268593 267439 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071829.1 protein_id gnl|my_center|LOCUS_03720 <269394 268725 gene locus_tag LOCUS_03730 <269394 268725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114170.1:CoA-acylating methylmalonate-semialdehyde dehydrogenase >Feature sequence05 622 2046 gene locus_tag LOCUS_03740 622 2046 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408020.1 protein_id gnl|my_center|LOCUS_03740 2171 3514 gene locus_tag LOCUS_03750 2171 3514 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112635.1 protein_id gnl|my_center|LOCUS_03750 3615 4319 gene locus_tag LOCUS_03760 3615 4319 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171423.1 protein_id gnl|my_center|LOCUS_03760 5501 4323 gene locus_tag LOCUS_03770 5501 4323 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704460.1 protein_id gnl|my_center|LOCUS_03770 5645 6598 gene locus_tag LOCUS_03780 gene metA 5645 6598 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704462.1 protein_id gnl|my_center|LOCUS_03780 7909 6620 gene locus_tag LOCUS_03790 7909 6620 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704405.1 protein_id gnl|my_center|LOCUS_03790 8155 11835 gene locus_tag LOCUS_03800 gene metH 8155 11835 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 protein_id gnl|my_center|LOCUS_03800 12049 13284 gene locus_tag LOCUS_03810 12049 13284 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626309.1 protein_id gnl|my_center|LOCUS_03810 14294 13827 gene locus_tag LOCUS_03820 14294 13827 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464913.1 protein_id gnl|my_center|LOCUS_03820 14743 14432 gene locus_tag LOCUS_03830 14743 14432 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_03830 15330 14764 gene locus_tag LOCUS_03840 15330 14764 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043122718.1 protein_id gnl|my_center|LOCUS_03840 15463 16572 gene locus_tag LOCUS_03850 15463 16572 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114824.1 protein_id gnl|my_center|LOCUS_03850 16569 17345 gene locus_tag LOCUS_03860 16569 17345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114823.1 protein_id gnl|my_center|LOCUS_03860 17348 18262 gene locus_tag LOCUS_03870 17348 18262 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114822.1 protein_id gnl|my_center|LOCUS_03870 18259 18852 gene locus_tag LOCUS_03880 18259 18852 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109195.1 protein_id gnl|my_center|LOCUS_03880 19798 18860 gene locus_tag LOCUS_03890 19798 18860 CDS product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_03890 20193 19798 gene locus_tag LOCUS_03900 20193 19798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 20577 21158 gene locus_tag LOCUS_03910 20577 21158 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382896.1 protein_id gnl|my_center|LOCUS_03910 21145 21948 gene locus_tag LOCUS_03920 gene fetB 21145 21948 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_03920 21957 22772 gene locus_tag LOCUS_03930 21957 22772 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211996.1 protein_id gnl|my_center|LOCUS_03930 25622 22785 gene locus_tag LOCUS_03940 gene uvrA 25622 22785 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707637.1 protein_id gnl|my_center|LOCUS_03940 25759 27132 gene locus_tag LOCUS_03950 25759 27132 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073745.1 protein_id gnl|my_center|LOCUS_03950 27147 27713 gene locus_tag LOCUS_03960 gene ssb1 27147 27713 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209100.1 protein_id gnl|my_center|LOCUS_03960 27934 29847 gene locus_tag LOCUS_03970 27934 29847 CDS product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039212856.1 protein_id gnl|my_center|LOCUS_03970 30753 29842 gene locus_tag LOCUS_03980 30753 29842 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819958.1 protein_id gnl|my_center|LOCUS_03980 30926 31969 gene locus_tag LOCUS_03990 30926 31969 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308111.1 protein_id gnl|my_center|LOCUS_03990 32006 32878 gene locus_tag LOCUS_04000 gene mreC 32006 32878 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704376.1 protein_id gnl|my_center|LOCUS_04000 32875 33363 gene locus_tag LOCUS_04010 gene mreD 32875 33363 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308115.1 protein_id gnl|my_center|LOCUS_04010 33360 33947 gene locus_tag LOCUS_04020 33360 33947 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703625.1 protein_id gnl|my_center|LOCUS_04020 34040 35485 gene locus_tag LOCUS_04030 gene rng 34040 35485 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704378.1 protein_id gnl|my_center|LOCUS_04030 35485 39246 gene locus_tag LOCUS_04040 35485 39246 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819191.1 protein_id gnl|my_center|LOCUS_04040 39250 40077 gene locus_tag LOCUS_04050 39250 40077 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704381.1 protein_id gnl|my_center|LOCUS_04050 40074 41519 gene locus_tag LOCUS_04060 gene tldD 40074 41519 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819195.1 protein_id gnl|my_center|LOCUS_04060 42401 41880 gene locus_tag LOCUS_04070 gene yjgA 42401 41880 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707625.1 protein_id gnl|my_center|LOCUS_04070 42471 43844 gene locus_tag LOCUS_04080 gene pmbA 42471 43844 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707624.1 protein_id gnl|my_center|LOCUS_04080 45318 43957 gene locus_tag LOCUS_04090 gene mgtE 45318 43957 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073704.1 protein_id gnl|my_center|LOCUS_04090 45628 45353 gene locus_tag LOCUS_04100 45628 45353 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073703.1 protein_id gnl|my_center|LOCUS_04100 46481 45615 gene locus_tag LOCUS_04110 gene rapZ 46481 45615 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707611.1 protein_id gnl|my_center|LOCUS_04110 46938 46492 gene locus_tag LOCUS_04120 gene ptsN 46938 46492 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305951.1 protein_id gnl|my_center|LOCUS_04120 47228 46941 gene locus_tag LOCUS_04130 gene hpf 47228 46941 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_04130 48643 47252 gene locus_tag LOCUS_04140 48643 47252 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707612.1 protein_id gnl|my_center|LOCUS_04140 49464 48739 gene locus_tag LOCUS_04150 gene lptB 49464 48739 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707613.1 protein_id gnl|my_center|LOCUS_04150 49998 49468 gene locus_tag LOCUS_04160 gene lptA 49998 49468 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352198.1 protein_id gnl|my_center|LOCUS_04160 50515 49967 gene locus_tag LOCUS_04170 gene lptC 50515 49967 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707615.1 protein_id gnl|my_center|LOCUS_04170 51063 50512 gene locus_tag LOCUS_04180 gene kdsC 51063 50512 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707616.1 protein_id gnl|my_center|LOCUS_04180 52037 51063 gene locus_tag LOCUS_04190 52037 51063 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_04190 52187 53041 gene locus_tag LOCUS_04200 gene mlaF 52187 53041 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707618.1 protein_id gnl|my_center|LOCUS_04200 53031 53810 gene locus_tag LOCUS_04210 gene mlaE 53031 53810 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 protein_id gnl|my_center|LOCUS_04210 53817 54290 gene locus_tag LOCUS_04220 gene mlaD 53817 54290 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707620.1 protein_id gnl|my_center|LOCUS_04220 54318 54956 gene locus_tag LOCUS_04230 gene mlaC 54318 54956 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707621.1 protein_id gnl|my_center|LOCUS_04230 54953 55237 gene locus_tag LOCUS_04240 54953 55237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 55224 55484 gene locus_tag LOCUS_04250 gene ibaG 55224 55484 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417509.1 protein_id gnl|my_center|LOCUS_04250 55497 56756 gene locus_tag LOCUS_04260 gene murA 55497 56756 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707623.1 protein_id gnl|my_center|LOCUS_04260 58001 56919 gene locus_tag LOCUS_04270 gene degS 58001 56919 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707601.1 protein_id gnl|my_center|LOCUS_04270 59470 58112 gene locus_tag LOCUS_04280 59470 58112 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707600.1 protein_id gnl|my_center|LOCUS_04280 59684 60778 gene locus_tag LOCUS_04290 gene zapE 59684 60778 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707598.1 protein_id gnl|my_center|LOCUS_04290 61033 61461 gene locus_tag LOCUS_04300 gene rplM 61033 61461 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396465.1 protein_id gnl|my_center|LOCUS_04300 61477 61869 gene locus_tag LOCUS_04310 gene rpsI 61477 61869 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005336286.1 protein_id gnl|my_center|LOCUS_04310 62339 62746 gene locus_tag LOCUS_04320 62339 62746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 62750 63967 gene locus_tag LOCUS_04330 62750 63967 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707596.1 protein_id gnl|my_center|LOCUS_04330 63964 64698 gene locus_tag LOCUS_04340 63964 64698 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707595.1 protein_id gnl|my_center|LOCUS_04340 64787 65416 gene locus_tag LOCUS_04350 gene sspA 64787 65416 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_04350 65419 65862 gene locus_tag LOCUS_04360 65419 65862 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409380.1 protein_id gnl|my_center|LOCUS_04360 66493 65912 gene locus_tag LOCUS_04370 gene dolP 66493 65912 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818900.1 protein_id gnl|my_center|LOCUS_04370 67083 66493 gene locus_tag LOCUS_04380 67083 66493 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707591.1 protein_id gnl|my_center|LOCUS_04380 67457 67092 gene locus_tag LOCUS_04390 67457 67092 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 protein_id gnl|my_center|LOCUS_04390 69249 67429 gene locus_tag LOCUS_04400 69249 67429 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818899.1 protein_id gnl|my_center|LOCUS_04400 69328 70167 gene locus_tag LOCUS_04410 gene rsmI 69328 70167 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707588.1 protein_id gnl|my_center|LOCUS_04410 70865 71323 gene locus_tag LOCUS_04420 gene mraZ 70865 71323 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305730.1 protein_id gnl|my_center|LOCUS_04420 71325 72269 gene locus_tag LOCUS_04430 gene rsmH 71325 72269 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707587.1 protein_id gnl|my_center|LOCUS_04430 72266 72580 gene locus_tag LOCUS_04440 gene ftsL 72266 72580 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305726.1 protein_id gnl|my_center|LOCUS_04440 72577 74322 gene locus_tag LOCUS_04450 72577 74322 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707586.1 protein_id gnl|my_center|LOCUS_04450 74306 75778 gene locus_tag LOCUS_04460 gene murE 74306 75778 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707585.1 protein_id gnl|my_center|LOCUS_04460 75775 77115 gene locus_tag LOCUS_04470 gene murF 75775 77115 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707584.1 protein_id gnl|my_center|LOCUS_04470 77109 78191 gene locus_tag LOCUS_04480 gene mraY 77109 78191 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707583.1 protein_id gnl|my_center|LOCUS_04480 78195 79493 gene locus_tag LOCUS_04490 gene murD 78195 79493 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707582.1 protein_id gnl|my_center|LOCUS_04490 79490 80665 gene locus_tag LOCUS_04500 gene ftsW 79490 80665 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352178.1 protein_id gnl|my_center|LOCUS_04500 80662 81735 gene locus_tag LOCUS_04510 gene murG 80662 81735 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_04510 81751 83214 gene locus_tag LOCUS_04520 gene murC 81751 83214 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635950.1 protein_id gnl|my_center|LOCUS_04520 83211 84128 gene locus_tag LOCUS_04530 83211 84128 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210432.1 protein_id gnl|my_center|LOCUS_04530 84130 84897 gene locus_tag LOCUS_04540 84130 84897 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707579.1 protein_id gnl|my_center|LOCUS_04540 84857 86113 gene locus_tag LOCUS_04550 gene ftsA 84857 86113 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305690.1 protein_id gnl|my_center|LOCUS_04550 86155 87294 gene locus_tag LOCUS_04560 gene ftsZ 86155 87294 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305686.1 protein_id gnl|my_center|LOCUS_04560 87391 88314 gene locus_tag LOCUS_04570 gene lpxC 87391 88314 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707578.1 protein_id gnl|my_center|LOCUS_04570 88385 89239 gene locus_tag LOCUS_04580 88385 89239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 89295 92027 gene locus_tag LOCUS_04590 gene secA 89295 92027 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707576.1 protein_id gnl|my_center|LOCUS_04590 92286 93962 gene locus_tag LOCUS_04600 92286 93962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 94083 94802 gene locus_tag LOCUS_04610 94083 94802 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707454.1 protein_id gnl|my_center|LOCUS_04610 94842 95186 gene locus_tag LOCUS_04620 gene rraB 94842 95186 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076360509.1 protein_id gnl|my_center|LOCUS_04620 95434 95189 gene locus_tag LOCUS_04630 95434 95189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 95550 97814 gene locus_tag LOCUS_04640 95550 97814 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_04640 97845 98252 gene locus_tag LOCUS_04650 97845 98252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 99066 98254 gene locus_tag LOCUS_04660 99066 98254 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113730.1 protein_id gnl|my_center|LOCUS_04660 99414 100811 gene locus_tag LOCUS_04670 gene aspA 99414 100811 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739655.1 protein_id gnl|my_center|LOCUS_04670 100813 101823 gene locus_tag LOCUS_04680 gene ansA 100813 101823 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072398.1 protein_id gnl|my_center|LOCUS_04680 101944 102177 gene locus_tag LOCUS_04690 101944 102177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 102323 103405 gene locus_tag LOCUS_04700 gene ada 102323 103405 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 protein_id gnl|my_center|LOCUS_04700 103970 103410 gene locus_tag LOCUS_04710 103970 103410 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546171.1 protein_id gnl|my_center|LOCUS_04710 106918 104066 gene locus_tag LOCUS_04720 106918 104066 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478852.1 protein_id gnl|my_center|LOCUS_04720 107369 106923 gene locus_tag LOCUS_04730 107369 106923 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693964.1 protein_id gnl|my_center|LOCUS_04730 108883 107372 gene locus_tag LOCUS_04740 gene pepA 108883 107372 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_04740 109046 110155 gene locus_tag LOCUS_04750 gene lptF 109046 110155 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305138.1 protein_id gnl|my_center|LOCUS_04750 110155 111225 gene locus_tag LOCUS_04760 gene lptG 110155 111225 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707420.1 protein_id gnl|my_center|LOCUS_04760 111775 111281 gene locus_tag LOCUS_04770 111775 111281 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045788985.1 protein_id gnl|my_center|LOCUS_04770 111950 112034 gene locus_tag LOCUS_t00100 111950 112034 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 112110 113459 gene locus_tag LOCUS_04780 gene rlmD 112110 113459 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707417.1 protein_id gnl|my_center|LOCUS_04780 113517 113717 gene locus_tag LOCUS_04790 113517 113717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 114583 113750 gene locus_tag LOCUS_04800 114583 113750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 115317 114757 gene locus_tag LOCUS_04810 115317 114757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 115717 115376 gene locus_tag LOCUS_04820 115717 115376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 115961 115876 gene locus_tag LOCUS_t00110 115961 115876 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 116120 116035 gene locus_tag LOCUS_t00120 116120 116035 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 116271 116186 gene locus_tag LOCUS_t00130 116271 116186 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 117417 116398 gene locus_tag LOCUS_04830 gene rsmC 117417 116398 CDS product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707512.1 protein_id gnl|my_center|LOCUS_04830 117711 118583 gene locus_tag LOCUS_04840 gene dapA 117711 118583 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707511.1 protein_id gnl|my_center|LOCUS_04840 118626 119207 gene locus_tag LOCUS_04850 118626 119207 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818863.1 protein_id gnl|my_center|LOCUS_04850 119630 119232 gene locus_tag LOCUS_04860 119630 119232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 119733 120905 gene locus_tag LOCUS_04870 119733 120905 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458342.1 protein_id gnl|my_center|LOCUS_04870 122098 120902 gene locus_tag LOCUS_04880 122098 120902 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260921.1 protein_id gnl|my_center|LOCUS_04880 122434 122225 gene locus_tag LOCUS_04890 122434 122225 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_04890 122746 123054 gene locus_tag LOCUS_04900 122746 123054 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261433.1 protein_id gnl|my_center|LOCUS_04900 123919 123056 gene locus_tag LOCUS_04910 123919 123056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 124319 124244 gene locus_tag LOCUS_t00140 124319 124244 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 124486 124411 gene locus_tag LOCUS_t00150 124486 124411 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 124592 124517 gene locus_tag LOCUS_t00160 124592 124517 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 124700 124625 gene locus_tag LOCUS_t00170 124700 124625 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 125070 124795 gene locus_tag LOCUS_04920 125070 124795 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305420.1 protein_id gnl|my_center|LOCUS_04920 126125 125070 gene locus_tag LOCUS_04930 gene mutY 126125 125070 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707498.1 protein_id gnl|my_center|LOCUS_04930 126444 127622 gene locus_tag LOCUS_04940 126444 127622 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707233.1 protein_id gnl|my_center|LOCUS_04940 127776 128492 gene locus_tag LOCUS_04950 gene trmB 127776 128492 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 protein_id gnl|my_center|LOCUS_04950 129105 128500 gene locus_tag LOCUS_04960 gene coaE 129105 128500 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707572.1 protein_id gnl|my_center|LOCUS_04960 129956 129102 gene locus_tag LOCUS_04970 129956 129102 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_04970 131253 130027 gene locus_tag LOCUS_04980 131253 130027 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707570.1 protein_id gnl|my_center|LOCUS_04980 133033 131318 gene locus_tag LOCUS_04990 gene tapB 133033 131318 CDS product PilB family type IVa pilus assembly ATPase TapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707569.1 protein_id gnl|my_center|LOCUS_04990 133519 133037 gene locus_tag LOCUS_05000 gene tapA 133519 133037 CDS product type IVa pilus major pilin TapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707568.1 protein_id gnl|my_center|LOCUS_05000 134696 133842 gene locus_tag LOCUS_05010 gene nadC 134696 133842 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707567.1 protein_id gnl|my_center|LOCUS_05010 135253 134741 gene locus_tag LOCUS_05020 135253 134741 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 protein_id gnl|my_center|LOCUS_05020 135337 135891 gene locus_tag LOCUS_05030 gene ampD 135337 135891 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707565.1 protein_id gnl|my_center|LOCUS_05030 136229 136990 gene locus_tag LOCUS_05040 gene pdhR 136229 136990 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707564.1 protein_id gnl|my_center|LOCUS_05040 137049 139709 gene locus_tag LOCUS_05050 gene aceE 137049 139709 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707563.1 protein_id gnl|my_center|LOCUS_05050 139720 141606 gene locus_tag LOCUS_05060 gene aceF 139720 141606 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707562.1 protein_id gnl|my_center|LOCUS_05060 141759 143186 gene locus_tag LOCUS_05070 gene lpdA 141759 143186 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102485.1 protein_id gnl|my_center|LOCUS_05070 143480 145354 gene locus_tag LOCUS_05080 143480 145354 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105343.1 protein_id gnl|my_center|LOCUS_05080 145586 145407 gene locus_tag LOCUS_05090 145586 145407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707560.1 protein_id gnl|my_center|LOCUS_05090 145833 148034 gene locus_tag LOCUS_05100 145833 148034 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707557.1 protein_id gnl|my_center|LOCUS_05100 >Feature sequence06 237 1436 gene locus_tag LOCUS_05110 237 1436 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707628.1 protein_id gnl|my_center|LOCUS_05110 4075 1502 gene locus_tag LOCUS_05120 gene clpB 4075 1502 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707734.1 protein_id gnl|my_center|LOCUS_05120 4911 4186 gene locus_tag LOCUS_05130 gene yfiH 4911 4186 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040130.1 protein_id gnl|my_center|LOCUS_05130 5882 4902 gene locus_tag LOCUS_05140 gene rluD 5882 4902 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707736.1 protein_id gnl|my_center|LOCUS_05140 5996 6742 gene locus_tag LOCUS_05150 5996 6742 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409782.1 protein_id gnl|my_center|LOCUS_05150 8407 6815 gene locus_tag LOCUS_05160 gene gshA 8407 6815 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704677.1 protein_id gnl|my_center|LOCUS_05160 11272 8468 gene locus_tag LOCUS_05170 11272 8468 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704676.1 protein_id gnl|my_center|LOCUS_05170 12235 11303 gene locus_tag LOCUS_05180 12235 11303 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051773499.1 protein_id gnl|my_center|LOCUS_05180 12403 12570 gene locus_tag LOCUS_05190 12403 12570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308905.1 protein_id gnl|my_center|LOCUS_05190 13376 12639 gene locus_tag LOCUS_05200 13376 12639 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704670.1 protein_id gnl|my_center|LOCUS_05200 13921 13472 gene locus_tag LOCUS_05210 gene rplI 13921 13472 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196054.1 protein_id gnl|my_center|LOCUS_05210 14186 13959 gene locus_tag LOCUS_05220 gene rpsR 14186 13959 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308890.1 protein_id gnl|my_center|LOCUS_05220 14582 14214 gene locus_tag LOCUS_05230 gene rpsF 14582 14214 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308887.1 protein_id gnl|my_center|LOCUS_05230 15721 14858 gene locus_tag LOCUS_05240 15721 14858 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819329.1 protein_id gnl|my_center|LOCUS_05240 16167 15709 gene locus_tag LOCUS_05250 16167 15709 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038584.1 protein_id gnl|my_center|LOCUS_05250 17089 16301 gene locus_tag LOCUS_05260 gene rlmB 17089 16301 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 protein_id gnl|my_center|LOCUS_05260 19443 17122 gene locus_tag LOCUS_05270 gene rnr 19443 17122 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704662.1 protein_id gnl|my_center|LOCUS_05270 20080 19571 gene locus_tag LOCUS_05280 gene luxS 20080 19571 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130214.1 protein_id gnl|my_center|LOCUS_05280 20549 20211 gene locus_tag LOCUS_05290 gene glnB 20549 20211 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231018.1 protein_id gnl|my_center|LOCUS_05290 22179 20560 gene locus_tag LOCUS_05300 22179 20560 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211555.1 protein_id gnl|my_center|LOCUS_05300 23875 22253 gene locus_tag LOCUS_05310 23875 22253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 25033 23879 gene locus_tag LOCUS_05320 25033 23879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704656.1 protein_id gnl|my_center|LOCUS_05320 25700 25035 gene locus_tag LOCUS_05330 25700 25035 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704655.1 protein_id gnl|my_center|LOCUS_05330 26179 25694 gene locus_tag LOCUS_05340 26179 25694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 26273 26665 gene locus_tag LOCUS_05350 26273 26665 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483031.1 protein_id gnl|my_center|LOCUS_05350 26812 27876 gene locus_tag LOCUS_05360 26812 27876 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259351.1 protein_id gnl|my_center|LOCUS_05360 27962 28612 gene locus_tag LOCUS_05370 27962 28612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 29576 28632 gene locus_tag LOCUS_05380 gene ispH 29576 28632 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704646.1 protein_id gnl|my_center|LOCUS_05380 30024 29578 gene locus_tag LOCUS_05390 gene fkpB 30024 29578 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704645.1 protein_id gnl|my_center|LOCUS_05390 30509 30021 gene locus_tag LOCUS_05400 gene lspA 30509 30021 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704644.1 protein_id gnl|my_center|LOCUS_05400 33334 30509 gene locus_tag LOCUS_05410 gene ileS 33334 30509 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704643.1 protein_id gnl|my_center|LOCUS_05410 34287 33340 gene locus_tag LOCUS_05420 gene ribF 34287 33340 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704642.1 protein_id gnl|my_center|LOCUS_05420 35896 34355 gene locus_tag LOCUS_05430 gene murJ 35896 34355 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704641.1 protein_id gnl|my_center|LOCUS_05430 36109 36369 gene locus_tag LOCUS_05440 gene rpsT 36109 36369 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308808.1 protein_id gnl|my_center|LOCUS_05440 36846 36529 gene locus_tag LOCUS_05450 36846 36529 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349423.1 protein_id gnl|my_center|LOCUS_05450 37822 36857 gene locus_tag LOCUS_05460 gene nhaR 37822 36857 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704639.1 protein_id gnl|my_center|LOCUS_05460 39085 37889 gene locus_tag LOCUS_05470 gene nhaA 39085 37889 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704638.1 protein_id gnl|my_center|LOCUS_05470 40724 39534 gene locus_tag LOCUS_05480 gene nhaA 40724 39534 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704638.1 protein_id gnl|my_center|LOCUS_05480 41700 40906 gene locus_tag LOCUS_05490 gene thyA 41700 40906 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704637.1 protein_id gnl|my_center|LOCUS_05490 42515 41697 gene locus_tag LOCUS_05500 gene lgt 42515 41697 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704636.1 protein_id gnl|my_center|LOCUS_05500 44871 42613 gene locus_tag LOCUS_05510 gene ptsP 44871 42613 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704635.1 protein_id gnl|my_center|LOCUS_05510 45410 44898 gene locus_tag LOCUS_05520 gene rppH 45410 44898 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704634.1 protein_id gnl|my_center|LOCUS_05520 46088 46765 gene locus_tag LOCUS_05530 gene mutH 46088 46765 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704633.1 protein_id gnl|my_center|LOCUS_05530 47334 46972 gene locus_tag LOCUS_05540 gene rplS 47334 46972 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417803.1 protein_id gnl|my_center|LOCUS_05540 48113 47367 gene locus_tag LOCUS_05550 gene trmD 48113 47367 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704631.1 protein_id gnl|my_center|LOCUS_05550 48662 48141 gene locus_tag LOCUS_05560 gene rimM 48662 48141 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704630.1 protein_id gnl|my_center|LOCUS_05560 48937 48686 gene locus_tag LOCUS_05570 gene rpsP 48937 48686 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005341383.1 protein_id gnl|my_center|LOCUS_05570 50484 49102 gene locus_tag LOCUS_05580 gene ffh 50484 49102 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704629.1 protein_id gnl|my_center|LOCUS_05580 50654 51418 gene locus_tag LOCUS_05590 gene ccsA 50654 51418 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704628.1 protein_id gnl|my_center|LOCUS_05590 51487 52755 gene locus_tag LOCUS_05600 51487 52755 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_05600 53201 52752 gene locus_tag LOCUS_05610 53201 52752 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704626.1 protein_id gnl|my_center|LOCUS_05610 53962 53309 gene locus_tag LOCUS_05620 53962 53309 CDS product SEL1-like repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349413.1 protein_id gnl|my_center|LOCUS_05620 54193 55632 gene locus_tag LOCUS_05630 gene ptsG 54193 55632 CDS product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157966.1 protein_id gnl|my_center|LOCUS_05630 56507 55704 gene locus_tag LOCUS_05640 gene mazG 56507 55704 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704767.1 protein_id gnl|my_center|LOCUS_05640 58733 56520 gene locus_tag LOCUS_05650 gene relA 58733 56520 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704766.1 protein_id gnl|my_center|LOCUS_05650 60056 58743 gene locus_tag LOCUS_05660 gene rlmD 60056 58743 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704765.1 protein_id gnl|my_center|LOCUS_05660 60137 62833 gene locus_tag LOCUS_05670 gene barA 60137 62833 CDS product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704764.1 protein_id gnl|my_center|LOCUS_05670 63730 62993 gene locus_tag LOCUS_05680 gene pdxJ 63730 62993 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704752.1 protein_id gnl|my_center|LOCUS_05680 64430 63723 gene locus_tag LOCUS_05690 gene recO 64430 63723 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704751.1 protein_id gnl|my_center|LOCUS_05690 65337 64432 gene locus_tag LOCUS_05700 gene era 65337 64432 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704750.1 protein_id gnl|my_center|LOCUS_05700 66002 65334 gene locus_tag LOCUS_05710 gene rnc 66002 65334 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704749.1 protein_id gnl|my_center|LOCUS_05710 66916 66002 gene locus_tag LOCUS_05720 gene lepB 66916 66002 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704748.1 protein_id gnl|my_center|LOCUS_05720 68715 66919 gene locus_tag LOCUS_05730 gene lepA 68715 66919 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704747.1 protein_id gnl|my_center|LOCUS_05730 69244 68795 gene locus_tag LOCUS_05740 69244 68795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 70218 69241 gene locus_tag LOCUS_05750 70218 69241 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349517.1 protein_id gnl|my_center|LOCUS_05750 70782 70231 gene locus_tag LOCUS_05760 70782 70231 CDS product RseA family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704744.1 protein_id gnl|my_center|LOCUS_05760 71377 70799 gene locus_tag LOCUS_05770 gene rpoE 71377 70799 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_05770 71559 73175 gene locus_tag LOCUS_05780 gene nadB 71559 73175 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704743.1 protein_id gnl|my_center|LOCUS_05780 73480 73172 gene locus_tag LOCUS_05790 73480 73172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 73787 73524 gene locus_tag LOCUS_05800 73787 73524 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704741.1 protein_id gnl|my_center|LOCUS_05800 73907 74809 gene locus_tag LOCUS_05810 gene ygfZ 73907 74809 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704740.1 protein_id gnl|my_center|LOCUS_05810 75681 74791 gene locus_tag LOCUS_05820 75681 74791 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967943.1 protein_id gnl|my_center|LOCUS_05820 75771 76208 gene locus_tag LOCUS_05830 75771 76208 CDS product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971767.1 protein_id gnl|my_center|LOCUS_05830 77519 76242 gene locus_tag LOCUS_05840 77519 76242 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482999.1 protein_id gnl|my_center|LOCUS_05840 79205 77877 gene locus_tag LOCUS_05850 gene abgA 79205 77877 CDS product p-aminobenzoyl-glutamate hydrolase subunit AbgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444925.1 protein_id gnl|my_center|LOCUS_05850 80641 79208 gene locus_tag LOCUS_05860 80641 79208 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976259.1 protein_id gnl|my_center|LOCUS_05860 81746 80694 gene locus_tag LOCUS_05870 81746 80694 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939164.1 protein_id gnl|my_center|LOCUS_05870 82969 81788 gene locus_tag LOCUS_05880 gene doeA 82969 81788 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252806.1 protein_id gnl|my_center|LOCUS_05880 84356 83064 gene locus_tag LOCUS_05890 84356 83064 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461221.1 protein_id gnl|my_center|LOCUS_05890 84931 84368 gene locus_tag LOCUS_05900 84931 84368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 86013 84994 gene locus_tag LOCUS_05910 86013 84994 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930890.1 protein_id gnl|my_center|LOCUS_05910 87583 86219 gene locus_tag LOCUS_05920 87583 86219 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050564339.1 protein_id gnl|my_center|LOCUS_05920 88030 89217 gene locus_tag LOCUS_05930 gene doeA 88030 89217 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969329.1 protein_id gnl|my_center|LOCUS_05930 89225 90226 gene locus_tag LOCUS_05940 gene doeB 89225 90226 CDS product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401275.1 protein_id gnl|my_center|LOCUS_05940 90333 90812 gene locus_tag LOCUS_05950 90333 90812 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530324.1 protein_id gnl|my_center|LOCUS_05950 91282 92799 gene locus_tag LOCUS_05960 91282 92799 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969339.1 protein_id gnl|my_center|LOCUS_05960 92853 94259 gene locus_tag LOCUS_05970 92853 94259 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253525.1 protein_id gnl|my_center|LOCUS_05970 94383 95375 gene locus_tag LOCUS_05980 gene eutB 94383 95375 CDS product hydroxyectoine utilization dehydratase EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992461.1 protein_id gnl|my_center|LOCUS_05980 94670 94576 gene locus_tag LOCUS_t00180 94670 94576 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 95413 96357 gene locus_tag LOCUS_05990 gene eutC 95413 96357 CDS product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969330.1 protein_id gnl|my_center|LOCUS_05990 96456 97250 gene locus_tag LOCUS_06000 96456 97250 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064245.1 protein_id gnl|my_center|LOCUS_06000 97247 98140 gene locus_tag LOCUS_06010 97247 98140 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969107.1 protein_id gnl|my_center|LOCUS_06010 99933 98449 gene locus_tag LOCUS_06020 gene lysS 99933 98449 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261233.1 protein_id gnl|my_center|LOCUS_06020 101093 100191 gene locus_tag LOCUS_06030 gene prfB 101093 100191 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707133.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06030 101489 103369 gene locus_tag LOCUS_06040 101489 103369 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707132.1 protein_id gnl|my_center|LOCUS_06040 105174 103441 gene locus_tag LOCUS_06050 gene recJ 105174 103441 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707042.1 protein_id gnl|my_center|LOCUS_06050 106205 105318 gene locus_tag LOCUS_06060 gene xerD 106205 105318 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707046.1 protein_id gnl|my_center|LOCUS_06060 106281 106796 gene locus_tag LOCUS_06070 gene fldB 106281 106796 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707047.1 protein_id gnl|my_center|LOCUS_06070 107253 106879 gene locus_tag LOCUS_06080 107253 106879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 108714 107440 gene locus_tag LOCUS_06090 gene brnQ 108714 107440 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707394.1 protein_id gnl|my_center|LOCUS_06090 109617 108910 gene locus_tag LOCUS_06100 109617 108910 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707393.1 protein_id gnl|my_center|LOCUS_06100 109688 110983 gene locus_tag LOCUS_06110 gene srmB 109688 110983 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707392.1 protein_id gnl|my_center|LOCUS_06110 112078 111305 gene locus_tag LOCUS_06120 gene yaaA 112078 111305 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487639.1 protein_id gnl|my_center|LOCUS_06120 113197 112088 gene locus_tag LOCUS_06130 gene tapU 113197 112088 CDS product type IVa pilus ATPase TapU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707390.1 protein_id gnl|my_center|LOCUS_06130 114293 113259 gene locus_tag LOCUS_06140 gene tapT 114293 113259 CDS product type IVa pilus ATPase TapT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707389.1 protein_id gnl|my_center|LOCUS_06140 114328 115020 gene locus_tag LOCUS_06150 114328 115020 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073222.1 protein_id gnl|my_center|LOCUS_06150 115031 115855 gene locus_tag LOCUS_06160 gene proC 115031 115855 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707387.1 protein_id gnl|my_center|LOCUS_06160 115865 116416 gene locus_tag LOCUS_06170 115865 116416 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707386.1 protein_id gnl|my_center|LOCUS_06170 116413 116715 gene locus_tag LOCUS_06180 gene yggU 116413 116715 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173614.1 protein_id gnl|my_center|LOCUS_06180 116753 117166 gene locus_tag LOCUS_06190 116753 117166 CDS product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 protein_id gnl|my_center|LOCUS_06190 117263 117862 gene locus_tag LOCUS_06200 117263 117862 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704791.1 protein_id gnl|my_center|LOCUS_06200 117862 119007 gene locus_tag LOCUS_06210 gene hemW 117862 119007 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704790.1 protein_id gnl|my_center|LOCUS_06210 119059 119793 gene locus_tag LOCUS_06220 gene zapD 119059 119793 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818895.1 protein_id gnl|my_center|LOCUS_06220 119790 119981 gene locus_tag LOCUS_06230 gene yacG 119790 119981 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305661.1 protein_id gnl|my_center|LOCUS_06230 119971 120390 gene locus_tag LOCUS_06240 gene mutT 119971 120390 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352173.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence07 2865 595 gene locus_tag LOCUS_06250 2865 595 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691589.1 protein_id gnl|my_center|LOCUS_06250 3535 2858 gene locus_tag LOCUS_06260 gene ytfE 3535 2858 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210159.1 protein_id gnl|my_center|LOCUS_06260 3690 5231 gene locus_tag LOCUS_06270 gene norR 3690 5231 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 protein_id gnl|my_center|LOCUS_06270 5834 5256 gene locus_tag LOCUS_06280 5834 5256 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103689.1 protein_id gnl|my_center|LOCUS_06280 6267 5890 gene locus_tag LOCUS_06290 6267 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 7563 6427 gene locus_tag LOCUS_06300 7563 6427 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029699.1 protein_id gnl|my_center|LOCUS_06300 8800 7874 gene locus_tag LOCUS_06310 8800 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 9494 8883 gene locus_tag LOCUS_06320 9494 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 10496 9522 gene locus_tag LOCUS_06330 10496 9522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_06330 10711 10487 gene locus_tag LOCUS_06340 10711 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 10944 10729 gene locus_tag LOCUS_06350 10944 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 11262 12428 gene locus_tag LOCUS_06360 gene ltrA 11262 12428 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_06360 13447 12497 gene locus_tag LOCUS_06370 13447 12497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040388.1 protein_id gnl|my_center|LOCUS_06370 14482 14024 gene locus_tag LOCUS_06380 14482 14024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 15048 14722 gene locus_tag LOCUS_06390 15048 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 16418 15066 gene locus_tag LOCUS_06400 16418 15066 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071311.1 protein_id gnl|my_center|LOCUS_06400 17090 19054 gene locus_tag LOCUS_06410 17090 19054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 19065 20036 gene locus_tag LOCUS_06420 19065 20036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 20046 21830 gene locus_tag LOCUS_06430 20046 21830 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970775.1 protein_id gnl|my_center|LOCUS_06430 22285 21923 gene locus_tag LOCUS_06440 22285 21923 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706471.1 protein_id gnl|my_center|LOCUS_06440 23810 22389 gene locus_tag LOCUS_06450 23810 22389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 24776 23946 gene locus_tag LOCUS_06460 24776 23946 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943998.1 protein_id gnl|my_center|LOCUS_06460 25092 26015 gene locus_tag LOCUS_06470 25092 26015 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943999.1 protein_id gnl|my_center|LOCUS_06470 26188 27144 gene locus_tag LOCUS_06480 26188 27144 CDS product amonabactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705834.1 protein_id gnl|my_center|LOCUS_06480 27149 28159 gene locus_tag LOCUS_06490 27149 28159 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_06490 28173 29255 gene locus_tag LOCUS_06500 28173 29255 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112992.1 protein_id gnl|my_center|LOCUS_06500 29255 30085 gene locus_tag LOCUS_06510 29255 30085 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_06510 30991 30176 gene locus_tag LOCUS_06520 30991 30176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 32286 30988 gene locus_tag LOCUS_06530 32286 30988 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_06530 32519 34240 gene locus_tag LOCUS_06540 32519 34240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 34895 34269 gene locus_tag LOCUS_06550 gene ycaC 34895 34269 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165876.1 protein_id gnl|my_center|LOCUS_06550 35822 34965 gene locus_tag LOCUS_06560 35822 34965 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211685.1 protein_id gnl|my_center|LOCUS_06560 35948 36853 gene locus_tag LOCUS_06570 35948 36853 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811380.1 protein_id gnl|my_center|LOCUS_06570 39154 36923 gene locus_tag LOCUS_06580 39154 36923 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113369.1 protein_id gnl|my_center|LOCUS_06580 40790 39399 gene locus_tag LOCUS_06590 40790 39399 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925621.1 protein_id gnl|my_center|LOCUS_06590 41082 42383 gene locus_tag LOCUS_06600 41082 42383 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048293.1 protein_id gnl|my_center|LOCUS_06600 43419 42487 gene locus_tag LOCUS_06610 43419 42487 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112455.1 protein_id gnl|my_center|LOCUS_06610 44439 43519 gene locus_tag LOCUS_06620 44439 43519 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389757.1 protein_id gnl|my_center|LOCUS_06620 44531 45706 gene locus_tag LOCUS_06630 44531 45706 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_06630 45728 46936 gene locus_tag LOCUS_06640 45728 46936 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389759.1 protein_id gnl|my_center|LOCUS_06640 46997 47746 gene locus_tag LOCUS_06650 46997 47746 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267372.1 protein_id gnl|my_center|LOCUS_06650 47746 48675 gene locus_tag LOCUS_06660 47746 48675 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091099.1 protein_id gnl|my_center|LOCUS_06660 48699 50348 gene locus_tag LOCUS_06670 48699 50348 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102932.1 protein_id gnl|my_center|LOCUS_06670 50529 51191 gene locus_tag LOCUS_06680 50529 51191 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806896.1 protein_id gnl|my_center|LOCUS_06680 51286 51783 gene locus_tag LOCUS_06690 51286 51783 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315770.1 protein_id gnl|my_center|LOCUS_06690 51784 54012 gene locus_tag LOCUS_06700 51784 54012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 54070 55257 gene locus_tag LOCUS_06710 54070 55257 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391241.1 protein_id gnl|my_center|LOCUS_06710 55325 56947 gene locus_tag LOCUS_06720 55325 56947 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103804.1 protein_id gnl|my_center|LOCUS_06720 58342 57002 gene locus_tag LOCUS_06730 58342 57002 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_06730 60081 58672 gene locus_tag LOCUS_06740 60081 58672 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943381.1 protein_id gnl|my_center|LOCUS_06740 61816 60068 gene locus_tag LOCUS_06750 61816 60068 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943382.1 protein_id gnl|my_center|LOCUS_06750 63223 61859 gene locus_tag LOCUS_06760 63223 61859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261856.1 protein_id gnl|my_center|LOCUS_06760 64371 63358 gene locus_tag LOCUS_06770 64371 63358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 65563 64565 gene locus_tag LOCUS_06780 65563 64565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 66187 65570 gene locus_tag LOCUS_06790 66187 65570 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946869.1 protein_id gnl|my_center|LOCUS_06790 66803 66216 gene locus_tag LOCUS_06800 66803 66216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 67636 66803 gene locus_tag LOCUS_06810 gene phnE 67636 66803 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808584.1 protein_id gnl|my_center|LOCUS_06810 68415 67633 gene locus_tag LOCUS_06820 gene phnE 68415 67633 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808587.1 protein_id gnl|my_center|LOCUS_06820 69164 68403 gene locus_tag LOCUS_06830 gene phnC 69164 68403 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808589.1 protein_id gnl|my_center|LOCUS_06830 70308 69271 gene locus_tag LOCUS_06840 gene phnD 70308 69271 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939223.1 protein_id gnl|my_center|LOCUS_06840 70744 70409 gene locus_tag LOCUS_06850 70744 70409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 71858 70788 gene locus_tag LOCUS_06860 gene glpQ 71858 70788 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482305.1 protein_id gnl|my_center|LOCUS_06860 73368 72031 gene locus_tag LOCUS_06870 73368 72031 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268780.1 protein_id gnl|my_center|LOCUS_06870 75229 73370 gene locus_tag LOCUS_06880 75229 73370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 76401 75400 gene locus_tag LOCUS_06890 76401 75400 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256666.1 protein_id gnl|my_center|LOCUS_06890 76912 76463 gene locus_tag LOCUS_06900 76912 76463 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_06900 79130 76923 gene locus_tag LOCUS_06910 79130 76923 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256665.1 protein_id gnl|my_center|LOCUS_06910 80985 79618 gene locus_tag LOCUS_06920 80985 79618 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073030.1 protein_id gnl|my_center|LOCUS_06920 82949 80982 gene locus_tag LOCUS_06930 82949 80982 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204799.1 protein_id gnl|my_center|LOCUS_06930 83033 83305 gene locus_tag LOCUS_06940 83033 83305 CDS product DUF2960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707214.1 protein_id gnl|my_center|LOCUS_06940 83460 85295 gene locus_tag LOCUS_06950 83460 85295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 85573 86151 gene locus_tag LOCUS_06960 85573 86151 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096513.1 protein_id gnl|my_center|LOCUS_06960 87073 86174 gene locus_tag LOCUS_06970 87073 86174 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817235.1 protein_id gnl|my_center|LOCUS_06970 87180 88571 gene locus_tag LOCUS_06980 87180 88571 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208000.1 protein_id gnl|my_center|LOCUS_06980 88779 89381 gene locus_tag LOCUS_06990 88779 89381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170077.1 protein_id gnl|my_center|LOCUS_06990 90518 89439 gene locus_tag LOCUS_07000 90518 89439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07000 92316 90934 gene locus_tag LOCUS_07010 92316 90934 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 protein_id gnl|my_center|LOCUS_07010 93089 92340 gene locus_tag LOCUS_07020 93089 92340 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112938.1 protein_id gnl|my_center|LOCUS_07020 93365 94738 gene locus_tag LOCUS_07030 93365 94738 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382104.1 protein_id gnl|my_center|LOCUS_07030 94856 96802 gene locus_tag LOCUS_07040 94856 96802 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838696.1 protein_id gnl|my_center|LOCUS_07040 97458 97042 gene locus_tag LOCUS_07050 97458 97042 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097249.1 protein_id gnl|my_center|LOCUS_07050 98616 97618 gene locus_tag LOCUS_07060 98616 97618 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817247.1 protein_id gnl|my_center|LOCUS_07060 99205 98774 gene locus_tag LOCUS_07070 gene trxC 99205 98774 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_07070 99485 99577 gene locus_tag LOCUS_t00190 99485 99577 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 100626 99637 gene locus_tag LOCUS_07080 100626 99637 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707803.1 protein_id gnl|my_center|LOCUS_07080 101545 100688 gene locus_tag LOCUS_07090 101545 100688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707800.1 protein_id gnl|my_center|LOCUS_07090 101674 102363 gene locus_tag LOCUS_07100 101674 102363 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707792.1 protein_id gnl|my_center|LOCUS_07100 102426 102502 gene locus_tag LOCUS_t00200 102426 102502 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 102759 102544 gene locus_tag LOCUS_07110 gene ybcJ 102759 102544 CDS product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010674882.1 protein_id gnl|my_center|LOCUS_07110 102918 104051 gene locus_tag LOCUS_07120 102918 104051 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_07120 104196 104735 gene locus_tag LOCUS_07130 gene yeiP 104196 104735 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815996.1 protein_id gnl|my_center|LOCUS_07130 104797 105207 gene locus_tag LOCUS_07140 104797 105207 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 protein_id gnl|my_center|LOCUS_07140 105319 106158 gene locus_tag LOCUS_07150 105319 106158 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704257.1 protein_id gnl|my_center|LOCUS_07150 106217 106453 gene locus_tag LOCUS_07160 106217 106453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349071.1 protein_id gnl|my_center|LOCUS_07160 106453 107805 gene locus_tag LOCUS_07170 gene rmuC 106453 107805 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704261.1 protein_id gnl|my_center|LOCUS_07170 109178 107802 gene locus_tag LOCUS_07180 gene trkA 109178 107802 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704263.1 protein_id gnl|my_center|LOCUS_07180 110470 109175 gene locus_tag LOCUS_07190 gene rsmB 110470 109175 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704264.1 protein_id gnl|my_center|LOCUS_07190 111440 110496 gene locus_tag LOCUS_07200 gene fmt 111440 110496 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704265.1 protein_id gnl|my_center|LOCUS_07200 111968 111459 gene locus_tag LOCUS_07210 gene def 111968 111459 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704266.1 protein_id gnl|my_center|LOCUS_07210 112063 113166 gene locus_tag LOCUS_07220 112063 113166 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704267.1 protein_id gnl|my_center|LOCUS_07220 113147 114244 gene locus_tag LOCUS_07230 gene dprA 113147 114244 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704268.1 protein_id gnl|my_center|LOCUS_07230 114247 114720 gene locus_tag LOCUS_07240 114247 114720 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704269.1 protein_id gnl|my_center|LOCUS_07240 114768 115316 gene locus_tag LOCUS_07250 114768 115316 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704270.1 protein_id gnl|my_center|LOCUS_07250 115348 115911 gene locus_tag LOCUS_07260 115348 115911 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704272.1 protein_id gnl|my_center|LOCUS_07260 115937 116845 gene locus_tag LOCUS_07270 gene hemF 115937 116845 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704273.1 protein_id gnl|my_center|LOCUS_07270 117699 116842 gene locus_tag LOCUS_07280 gene hdfR 117699 116842 CDS product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 protein_id gnl|my_center|LOCUS_07280 118050 118874 gene locus_tag LOCUS_07290 gene aroE 118050 118874 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704274.1 protein_id gnl|my_center|LOCUS_07290 118871 119131 gene locus_tag LOCUS_07300 118871 119131 CDS product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704275.1 protein_id gnl|my_center|LOCUS_07300 119701 119165 gene locus_tag LOCUS_07310 119701 119165 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070458.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence08 >Feature sequence09 >Feature sequence10 <1 898 gene locus_tag LOCUS_07320 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_174557857.1:IS4-like element ISEc13 family transposase 1063 914 gene locus_tag LOCUS_07330 gene rsmS 1063 914 CDS product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299504.1 protein_id gnl|my_center|LOCUS_07330 1304 1933 gene locus_tag LOCUS_07340 1304 1933 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705252.1 protein_id gnl|my_center|LOCUS_07340 1965 4229 gene locus_tag LOCUS_07350 1965 4229 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705253.1 protein_id gnl|my_center|LOCUS_07350 5742 4303 gene locus_tag LOCUS_07360 gene pyk 5742 4303 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705256.1 protein_id gnl|my_center|LOCUS_07360 6810 6028 gene locus_tag LOCUS_07370 6810 6028 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298732.1 protein_id gnl|my_center|LOCUS_07370 8450 7137 gene locus_tag LOCUS_07380 gene rimO 8450 7137 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705268.1 protein_id gnl|my_center|LOCUS_07380 9166 8585 gene locus_tag LOCUS_07390 gene sodB 9166 8585 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705306.1 protein_id gnl|my_center|LOCUS_07390 9462 9800 gene locus_tag LOCUS_07400 9462 9800 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010673955.1 protein_id gnl|my_center|LOCUS_07400 11583 9883 gene locus_tag LOCUS_07410 gene narX 11583 9883 CDS product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918083.1 protein_id gnl|my_center|LOCUS_07410 11980 11651 gene locus_tag LOCUS_07420 gene tusE 11980 11651 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079836.1 protein_id gnl|my_center|LOCUS_07420 14154 12007 gene locus_tag LOCUS_07430 gene yccS 14154 12007 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706489.1 protein_id gnl|my_center|LOCUS_07430 14934 14275 gene locus_tag LOCUS_07440 14934 14275 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262111.1 protein_id gnl|my_center|LOCUS_07440 15153 15243 gene locus_tag LOCUS_t00210 15153 15243 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15309 15971 gene locus_tag LOCUS_07450 15309 15971 CDS product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706480.1 protein_id gnl|my_center|LOCUS_07450 17069 16092 gene locus_tag LOCUS_07460 gene cra 17069 16092 CDS product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300974.1 protein_id gnl|my_center|LOCUS_07460 17243 20407 gene locus_tag LOCUS_07470 17243 20407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 20404 21348 gene locus_tag LOCUS_07480 gene pfkB 20404 21348 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406610.1 protein_id gnl|my_center|LOCUS_07480 21352 23094 gene locus_tag LOCUS_07490 gene fruA 21352 23094 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706188.1 protein_id gnl|my_center|LOCUS_07490 23409 23179 gene locus_tag LOCUS_07500 23409 23179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 23443 23586 gene locus_tag LOCUS_07510 23443 23586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07510 23583 23756 gene locus_tag LOCUS_07520 23583 23756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07520 23851 26661 gene locus_tag LOCUS_07530 gene hypF 23851 26661 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338264.1 protein_id gnl|my_center|LOCUS_07530 26711 26968 gene locus_tag LOCUS_07540 gene hypC 26711 26968 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816727.1 protein_id gnl|my_center|LOCUS_07540 26958 28097 gene locus_tag LOCUS_07550 gene hypD 26958 28097 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338278.1 protein_id gnl|my_center|LOCUS_07550 28090 29124 gene locus_tag LOCUS_07560 gene hypE 28090 29124 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077175158.1 protein_id gnl|my_center|LOCUS_07560 29127 29453 gene locus_tag LOCUS_07570 29127 29453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 29453 30205 gene locus_tag LOCUS_07580 gene hypB 29453 30205 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728544.1 protein_id gnl|my_center|LOCUS_07580 30202 31314 gene locus_tag LOCUS_07590 30202 31314 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027268647.1 protein_id gnl|my_center|LOCUS_07590 31307 32125 gene locus_tag LOCUS_07600 31307 32125 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_07600 32122 32919 gene locus_tag LOCUS_07610 32122 32919 CDS product sulfhydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948170.1 protein_id gnl|my_center|LOCUS_07610 32916 34220 gene locus_tag LOCUS_07620 32916 34220 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948169.1 protein_id gnl|my_center|LOCUS_07620 34320 36104 gene locus_tag LOCUS_07630 gene acsA 34320 36104 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 protein_id gnl|my_center|LOCUS_07630 36082 37080 gene locus_tag LOCUS_07640 gene pdhA 36082 37080 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142838.1 protein_id gnl|my_center|LOCUS_07640 37077 38060 gene locus_tag LOCUS_07650 37077 38060 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943073.1 protein_id gnl|my_center|LOCUS_07650 38057 39196 gene locus_tag LOCUS_07660 38057 39196 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730028.1 protein_id gnl|my_center|LOCUS_07660 39193 39477 gene locus_tag LOCUS_07670 39193 39477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 40102 39503 gene locus_tag LOCUS_07680 gene ribA 40102 39503 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634253.1 protein_id gnl|my_center|LOCUS_07680 40295 40975 gene locus_tag LOCUS_07690 gene cmk 40295 40975 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705689.1 protein_id gnl|my_center|LOCUS_07690 41085 42755 gene locus_tag LOCUS_07700 gene rpsA 41085 42755 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705690.1 protein_id gnl|my_center|LOCUS_07700 42823 43104 gene locus_tag LOCUS_07710 gene ihfB 42823 43104 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705691.1 protein_id gnl|my_center|LOCUS_07710 43212 43499 gene locus_tag LOCUS_07720 43212 43499 CDS product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705692.1 protein_id gnl|my_center|LOCUS_07720 43508 44677 gene locus_tag LOCUS_07730 gene lapB 43508 44677 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705693.1 protein_id gnl|my_center|LOCUS_07730 44777 45496 gene locus_tag LOCUS_07740 gene pyrF 44777 45496 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705694.1 protein_id gnl|my_center|LOCUS_07740 45599 45820 gene locus_tag LOCUS_07750 45599 45820 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 protein_id gnl|my_center|LOCUS_07750 46391 45984 gene locus_tag LOCUS_07760 gene hns 46391 45984 CDS product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210661.1 protein_id gnl|my_center|LOCUS_07760 47031 48584 gene locus_tag LOCUS_07770 47031 48584 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705702.1 protein_id gnl|my_center|LOCUS_07770 48590 49171 gene locus_tag LOCUS_07780 48590 49171 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705703.1 protein_id gnl|my_center|LOCUS_07780 50406 49180 gene locus_tag LOCUS_07790 50406 49180 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706002.1 protein_id gnl|my_center|LOCUS_07790 51851 50526 gene locus_tag LOCUS_07800 51851 50526 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706004.1 protein_id gnl|my_center|LOCUS_07800 53485 52022 gene locus_tag LOCUS_07810 gene putP 53485 52022 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440098.1 protein_id gnl|my_center|LOCUS_07810 54344 53616 gene locus_tag LOCUS_07820 54344 53616 CDS product DUF3379 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706005.1 protein_id gnl|my_center|LOCUS_07820 54906 54337 gene locus_tag LOCUS_07830 54906 54337 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706006.1 protein_id gnl|my_center|LOCUS_07830 55086 56399 gene locus_tag LOCUS_07840 gene fadI 55086 56399 CDS product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706012.1 protein_id gnl|my_center|LOCUS_07840 56396 58516 gene locus_tag LOCUS_07850 gene fadJ 56396 58516 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706013.1 protein_id gnl|my_center|LOCUS_07850 58731 60641 gene locus_tag LOCUS_07860 gene htpG 58731 60641 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706320.1 protein_id gnl|my_center|LOCUS_07860 62547 60784 gene locus_tag LOCUS_07870 62547 60784 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230124.1 protein_id gnl|my_center|LOCUS_07870 63397 62732 gene locus_tag LOCUS_07880 63397 62732 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810854.1 protein_id gnl|my_center|LOCUS_07880 63636 64280 gene locus_tag LOCUS_07890 gene adk 63636 64280 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706319.1 protein_id gnl|my_center|LOCUS_07890 64344 65312 gene locus_tag LOCUS_07900 gene hemH 64344 65312 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927663.1 protein_id gnl|my_center|LOCUS_07900 65824 65360 gene locus_tag LOCUS_07910 65824 65360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 65978 66175 gene locus_tag LOCUS_07920 65978 66175 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300391.1 protein_id gnl|my_center|LOCUS_07920 66231 66884 gene locus_tag LOCUS_07930 66231 66884 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705866.1 protein_id gnl|my_center|LOCUS_07930 67249 68616 gene locus_tag LOCUS_07940 67249 68616 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704871.1 protein_id gnl|my_center|LOCUS_07940 68671 69207 gene locus_tag LOCUS_07950 68671 69207 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_07950 70088 69456 gene locus_tag LOCUS_07960 70088 69456 CDS product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706592.1 protein_id gnl|my_center|LOCUS_07960 70963 70196 gene locus_tag LOCUS_07970 70963 70196 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005492537.1 protein_id gnl|my_center|LOCUS_07970 73020 70960 gene locus_tag LOCUS_07980 gene dinG 73020 70960 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818171.1 protein_id gnl|my_center|LOCUS_07980 73277 74233 gene locus_tag LOCUS_07990 73277 74233 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706590.1 protein_id gnl|my_center|LOCUS_07990 74950 74387 gene locus_tag LOCUS_08000 74950 74387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08000 75593 75222 gene locus_tag LOCUS_08010 75593 75222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 76594 75665 gene locus_tag LOCUS_08020 gene dusC 76594 75665 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706065.1 protein_id gnl|my_center|LOCUS_08020 77185 76703 gene locus_tag LOCUS_08030 77185 76703 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707301.1 protein_id gnl|my_center|LOCUS_08030 78429 77182 gene locus_tag LOCUS_08040 78429 77182 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707300.1 protein_id gnl|my_center|LOCUS_08040 79109 78423 gene locus_tag LOCUS_08050 79109 78423 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707299.1 protein_id gnl|my_center|LOCUS_08050 79769 79113 gene locus_tag LOCUS_08060 79769 79113 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707298.1 protein_id gnl|my_center|LOCUS_08060 80754 79870 gene locus_tag LOCUS_08070 80754 79870 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705688.1 protein_id gnl|my_center|LOCUS_08070 80843 82033 gene locus_tag LOCUS_08080 80843 82033 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705687.1 protein_id gnl|my_center|LOCUS_08080 82553 82023 gene locus_tag LOCUS_08090 82553 82023 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517116.1 protein_id gnl|my_center|LOCUS_08090 83323 82559 gene locus_tag LOCUS_08100 83323 82559 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705685.1 protein_id gnl|my_center|LOCUS_08100 83525 84499 gene locus_tag LOCUS_08110 gene cysB 83525 84499 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634254.1 protein_id gnl|my_center|LOCUS_08110 84994 84587 gene locus_tag LOCUS_08120 gene gloA 84994 84587 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706456.1 protein_id gnl|my_center|LOCUS_08120 85431 85045 gene locus_tag LOCUS_08130 85431 85045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 85888 85523 gene locus_tag LOCUS_08140 85888 85523 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_08140 87369 85885 gene locus_tag LOCUS_08150 87369 85885 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_08150 88083 87442 gene locus_tag LOCUS_08160 gene nth 88083 87442 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706455.1 protein_id gnl|my_center|LOCUS_08160 88775 88080 gene locus_tag LOCUS_08170 88775 88080 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261584.1 protein_id gnl|my_center|LOCUS_08170 89404 88772 gene locus_tag LOCUS_08180 gene rsxG 89404 88772 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706453.1 protein_id gnl|my_center|LOCUS_08180 90453 89404 gene locus_tag LOCUS_08190 gene rsxD 90453 89404 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706452.1 protein_id gnl|my_center|LOCUS_08190 92744 90453 gene locus_tag LOCUS_08200 92744 90453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 93300 92746 gene locus_tag LOCUS_08210 gene rsxB 93300 92746 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706450.1 protein_id gnl|my_center|LOCUS_08210 93883 93302 gene locus_tag LOCUS_08220 gene rsxA 93883 93302 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 protein_id gnl|my_center|LOCUS_08220 94697 93963 gene locus_tag LOCUS_08230 94697 93963 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454206.1 protein_id gnl|my_center|LOCUS_08230 95072 94932 gene locus_tag LOCUS_08240 95072 94932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 96145 95183 gene locus_tag LOCUS_08250 gene pfkA 96145 95183 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706225.1 protein_id gnl|my_center|LOCUS_08250 96977 96225 gene locus_tag LOCUS_08260 gene tpiA 96977 96225 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706224.1 protein_id gnl|my_center|LOCUS_08260 97855 97070 gene locus_tag LOCUS_08270 gene elyC 97855 97070 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457224.1 protein_id gnl|my_center|LOCUS_08270 97936 98724 gene locus_tag LOCUS_08280 gene cmoM 97936 98724 CDS product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706222.1 protein_id gnl|my_center|LOCUS_08280 98843 100168 gene locus_tag LOCUS_08290 gene mukF 98843 100168 CDS product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706221.1 protein_id gnl|my_center|LOCUS_08290 100149 100823 gene locus_tag LOCUS_08300 gene mukE 100149 100823 CDS product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706220.1 protein_id gnl|my_center|LOCUS_08300 100820 105250 gene locus_tag LOCUS_08310 gene mukB 100820 105250 CDS product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706219.1 protein_id gnl|my_center|LOCUS_08310 105518 108934 gene locus_tag LOCUS_08320 gene recC 105518 108934 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793829.1 protein_id gnl|my_center|LOCUS_08320 108931 112566 gene locus_tag LOCUS_08330 gene recB 108931 112566 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266564.1 protein_id gnl|my_center|LOCUS_08330 112563 114593 gene locus_tag LOCUS_08340 gene recD 112563 114593 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103277.1 protein_id gnl|my_center|LOCUS_08340 114775 116439 gene locus_tag LOCUS_08350 gene fan1 114775 116439 CDS product nuclease Fan1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113615.1 protein_id gnl|my_center|LOCUS_08350 116488 117030 gene locus_tag LOCUS_08360 116488 117030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 117146 117676 gene locus_tag LOCUS_08370 117146 117676 CDS product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266352.1 protein_id gnl|my_center|LOCUS_08370 117772 118338 gene locus_tag LOCUS_08380 117772 118338 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266351.1 protein_id gnl|my_center|LOCUS_08380 118335 119039 gene locus_tag LOCUS_08390 118335 119039 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266350.1 protein_id gnl|my_center|LOCUS_08390 121618 119036 gene locus_tag LOCUS_08400 121618 119036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 125608 121769 gene locus_tag LOCUS_08410 125608 121769 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982246.1 protein_id gnl|my_center|LOCUS_08410 127269 125620 gene locus_tag LOCUS_08420 127269 125620 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332063.1 protein_id gnl|my_center|LOCUS_08420 128277 127363 gene locus_tag LOCUS_08430 128277 127363 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189368.1 protein_id gnl|my_center|LOCUS_08430 128381 129214 gene locus_tag LOCUS_08440 128381 129214 CDS product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668695.1 protein_id gnl|my_center|LOCUS_08440 129988 129230 gene locus_tag LOCUS_08450 129988 129230 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918240.1 protein_id gnl|my_center|LOCUS_08450 132516 130033 gene locus_tag LOCUS_08460 132516 130033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 132699 133169 gene locus_tag LOCUS_08470 132699 133169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 134468 133185 gene locus_tag LOCUS_08480 134468 133185 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024649113.1 protein_id gnl|my_center|LOCUS_08480 136361 134697 gene locus_tag LOCUS_08490 gene asnB 136361 134697 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706472.1 protein_id gnl|my_center|LOCUS_08490 136690 137709 gene locus_tag LOCUS_08500 136690 137709 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966094.1 protein_id gnl|my_center|LOCUS_08500 138383 137745 gene locus_tag LOCUS_08510 138383 137745 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819905.1 protein_id gnl|my_center|LOCUS_08510 138551 139651 gene locus_tag LOCUS_08520 138551 139651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088336.1 protein_id gnl|my_center|LOCUS_08520 139783 139696 gene locus_tag LOCUS_t00220 139783 139696 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 140355 139930 gene locus_tag LOCUS_08530 140355 139930 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301206.1 protein_id gnl|my_center|LOCUS_08530 140580 141440 gene locus_tag LOCUS_08540 140580 141440 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093974.1 protein_id gnl|my_center|LOCUS_08540 142295 141489 gene locus_tag LOCUS_08550 gene cysQ 142295 141489 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818748.1 protein_id gnl|my_center|LOCUS_08550 142373 143362 gene locus_tag LOCUS_08560 142373 143362 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707119.1 protein_id gnl|my_center|LOCUS_08560 143355 143726 gene locus_tag LOCUS_08570 143355 143726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 143878 144141 gene locus_tag LOCUS_08580 143878 144141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 144254 144700 gene locus_tag LOCUS_08590 144254 144700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 144800 146392 gene locus_tag LOCUS_08600 144800 146392 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_08600 147714 146551 gene locus_tag LOCUS_08610 gene cfa 147714 146551 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444610.1 protein_id gnl|my_center|LOCUS_08610 148792 147938 gene locus_tag LOCUS_08620 148792 147938 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813546.1 protein_id gnl|my_center|LOCUS_08620 149753 148893 gene locus_tag LOCUS_08630 149753 148893 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813546.1 protein_id gnl|my_center|LOCUS_08630 151245 149761 gene locus_tag LOCUS_08640 151245 149761 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_08640 151658 152059 gene locus_tag LOCUS_08650 151658 152059 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072739.1 protein_id gnl|my_center|LOCUS_08650 153676 152105 gene locus_tag LOCUS_08660 153676 152105 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_08660 153834 154184 gene locus_tag LOCUS_08670 153834 154184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 156192 154192 gene locus_tag LOCUS_08680 156192 154192 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522854.1 protein_id gnl|my_center|LOCUS_08680 157026 156274 gene locus_tag LOCUS_08690 157026 156274 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706469.1 protein_id gnl|my_center|LOCUS_08690 157789 157112 gene locus_tag LOCUS_08700 gene mtgA 157789 157112 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387788.1 protein_id gnl|my_center|LOCUS_08700 157919 158941 gene locus_tag LOCUS_08710 157919 158941 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706468.1 protein_id gnl|my_center|LOCUS_08710 159003 159872 gene locus_tag LOCUS_08720 159003 159872 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817979.1 protein_id gnl|my_center|LOCUS_08720 159957 160748 gene locus_tag LOCUS_08730 159957 160748 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 protein_id gnl|my_center|LOCUS_08730 160933 160814 gene locus_tag LOCUS_08740 160933 160814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 161901 160933 gene locus_tag LOCUS_08750 161901 160933 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060389247.1 protein_id gnl|my_center|LOCUS_08750 162729 161956 gene locus_tag LOCUS_08760 162729 161956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 162890 163402 gene locus_tag LOCUS_08770 162890 163402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 165117 163639 gene locus_tag LOCUS_08780 165117 163639 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420103.1 protein_id gnl|my_center|LOCUS_08780 165560 165769 gene locus_tag LOCUS_08790 165560 165769 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706670.1 protein_id gnl|my_center|LOCUS_08790 167205 165838 gene locus_tag LOCUS_08800 167205 165838 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462594.1 protein_id gnl|my_center|LOCUS_08800 167275 169983 gene locus_tag LOCUS_08810 167275 169983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 170239 171492 gene locus_tag LOCUS_08820 170239 171492 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972918.1 protein_id gnl|my_center|LOCUS_08820 171604 172485 gene locus_tag LOCUS_08830 171604 172485 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 protein_id gnl|my_center|LOCUS_08830 172633 172899 gene locus_tag LOCUS_08840 172633 172899 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_08840 172910 174613 gene locus_tag LOCUS_08850 172910 174613 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354544.1 protein_id gnl|my_center|LOCUS_08850 174741 175607 gene locus_tag LOCUS_08860 gene mshI 174741 175607 CDS product MSHA fimbrial biogenesis protein MshI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704361.1 protein_id gnl|my_center|LOCUS_08860 175604 176182 gene locus_tag LOCUS_08870 175604 176182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 176179 176817 gene locus_tag LOCUS_08880 176179 176817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 176810 177127 gene locus_tag LOCUS_08890 176810 177127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 177124 178722 gene locus_tag LOCUS_08900 gene mshL 177124 178722 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704365.1 protein_id gnl|my_center|LOCUS_08900 178722 179468 gene locus_tag LOCUS_08910 178722 179468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 179446 181143 gene locus_tag LOCUS_08920 gene mshE 179446 181143 CDS product MSHA fimbrial ATPase MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_08920 181143 182363 gene locus_tag LOCUS_08930 gene mshG 181143 182363 CDS product MSHA fimbrial biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_08930 182519 183034 gene locus_tag LOCUS_08940 182519 183034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 183078 183629 gene locus_tag LOCUS_08950 183078 183629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 183619 184179 gene locus_tag LOCUS_08960 183619 184179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 184176 184928 gene locus_tag LOCUS_08970 184176 184928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 184942 185280 gene locus_tag LOCUS_08980 184942 185280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 186021 187949 gene locus_tag LOCUS_08990 186021 187949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 188132 189892 gene locus_tag LOCUS_09000 188132 189892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 191427 189910 gene locus_tag LOCUS_09010 gene glpD 191427 189910 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099107.1 protein_id gnl|my_center|LOCUS_09010 191696 192868 gene locus_tag LOCUS_09020 191696 192868 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_09020 193037 193798 gene locus_tag LOCUS_09030 193037 193798 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705542.1 protein_id gnl|my_center|LOCUS_09030 195361 193856 gene locus_tag LOCUS_09040 gene glpK 195361 193856 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705539.1 protein_id gnl|my_center|LOCUS_09040 196240 195389 gene locus_tag LOCUS_09050 196240 195389 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705540.1 protein_id gnl|my_center|LOCUS_09050 196653 198644 gene locus_tag LOCUS_09060 196653 198644 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463903.1 protein_id gnl|my_center|LOCUS_09060 199395 198634 gene locus_tag LOCUS_09070 gene mepA 199395 198634 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819795.1 protein_id gnl|my_center|LOCUS_09070 199489 200106 gene locus_tag LOCUS_09080 199489 200106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705673.1 protein_id gnl|my_center|LOCUS_09080 200163 201056 gene locus_tag LOCUS_09090 200163 201056 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170320146.1 protein_id gnl|my_center|LOCUS_09090 201829 201197 gene locus_tag LOCUS_09100 201829 201197 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706079.1 protein_id gnl|my_center|LOCUS_09100 203223 202030 gene locus_tag LOCUS_09110 203223 202030 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927646.1 protein_id gnl|my_center|LOCUS_09110 203299 203571 gene locus_tag LOCUS_09120 gene yccX 203299 203571 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704915.1 protein_id gnl|my_center|LOCUS_09120 205253 203733 gene locus_tag LOCUS_09130 205253 203733 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944465.1 protein_id gnl|my_center|LOCUS_09130 205381 206757 gene locus_tag LOCUS_09140 gene pabB 205381 206757 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819891.1 protein_id gnl|my_center|LOCUS_09140 206754 207317 gene locus_tag LOCUS_09150 206754 207317 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706269.1 protein_id gnl|my_center|LOCUS_09150 207457 208839 gene locus_tag LOCUS_09160 207457 208839 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705997.1 protein_id gnl|my_center|LOCUS_09160 211035 208996 gene locus_tag LOCUS_09170 gene metG 211035 208996 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706089.1 protein_id gnl|my_center|LOCUS_09170 211144 211311 gene locus_tag LOCUS_09180 211144 211311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 211308 212024 gene locus_tag LOCUS_09190 211308 212024 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348992.1 protein_id gnl|my_center|LOCUS_09190 212021 213472 gene locus_tag LOCUS_09200 212021 213472 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348991.1 protein_id gnl|my_center|LOCUS_09200 213628 214881 gene locus_tag LOCUS_09210 213628 214881 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 protein_id gnl|my_center|LOCUS_09210 214941 215882 gene locus_tag LOCUS_09220 214941 215882 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091471.1 protein_id gnl|my_center|LOCUS_09220 215875 216738 gene locus_tag LOCUS_09230 215875 216738 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185577.1 protein_id gnl|my_center|LOCUS_09230 217027 218142 gene locus_tag LOCUS_09240 gene ugpC 217027 218142 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527557.1 protein_id gnl|my_center|LOCUS_09240 218243 219316 gene locus_tag LOCUS_09250 gene apbC 218243 219316 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706090.1 protein_id gnl|my_center|LOCUS_09250 219342 219983 gene locus_tag LOCUS_09260 gene udk 219342 219983 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706091.1 protein_id gnl|my_center|LOCUS_09260 220005 220586 gene locus_tag LOCUS_09270 gene dcd 220005 220586 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706092.1 protein_id gnl|my_center|LOCUS_09270 220609 222525 gene locus_tag LOCUS_09280 220609 222525 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072519.1 protein_id gnl|my_center|LOCUS_09280 222859 222656 gene locus_tag LOCUS_09290 222859 222656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 223102 223578 gene locus_tag LOCUS_09300 223102 223578 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001961184.1 protein_id gnl|my_center|LOCUS_09300 226739 223626 gene locus_tag LOCUS_09310 gene rne 226739 223626 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706095.1 protein_id gnl|my_center|LOCUS_09310 227073 228023 gene locus_tag LOCUS_09320 gene rluC 227073 228023 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201356046.1 protein_id gnl|my_center|LOCUS_09320 228020 228661 gene locus_tag LOCUS_09330 228020 228661 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706097.1 protein_id gnl|my_center|LOCUS_09330 229360 228782 gene locus_tag LOCUS_09340 229360 228782 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817289.1 protein_id gnl|my_center|LOCUS_09340 229700 230041 gene locus_tag LOCUS_09350 229700 230041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 230063 230233 gene locus_tag LOCUS_09360 gene rpmF 230063 230233 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300935.1 protein_id gnl|my_center|LOCUS_09360 230244 231254 gene locus_tag LOCUS_09370 gene plsX 230244 231254 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706103.1 protein_id gnl|my_center|LOCUS_09370 231260 232219 gene locus_tag LOCUS_09380 231260 232219 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706104.1 protein_id gnl|my_center|LOCUS_09380 232233 233168 gene locus_tag LOCUS_09390 gene fabD 232233 233168 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706105.1 protein_id gnl|my_center|LOCUS_09390 233277 234011 gene locus_tag LOCUS_09400 gene fabG 233277 234011 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210935.1 protein_id gnl|my_center|LOCUS_09400 234170 234406 gene locus_tag LOCUS_09410 gene acpP 234170 234406 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300909.1 protein_id gnl|my_center|LOCUS_09410 234479 235720 gene locus_tag LOCUS_09420 gene fabF 234479 235720 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706107.1 protein_id gnl|my_center|LOCUS_09420 235778 236575 gene locus_tag LOCUS_09430 gene pabC 235778 236575 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706108.1 protein_id gnl|my_center|LOCUS_09430 236559 237566 gene locus_tag LOCUS_09440 gene mltG 236559 237566 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350715.1 protein_id gnl|my_center|LOCUS_09440 237570 238193 gene locus_tag LOCUS_09450 gene tmk 237570 238193 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706110.1 protein_id gnl|my_center|LOCUS_09450 238178 239161 gene locus_tag LOCUS_09460 gene holB 238178 239161 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163136678.1 protein_id gnl|my_center|LOCUS_09460 239183 239962 gene locus_tag LOCUS_09470 239183 239962 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706112.1 protein_id gnl|my_center|LOCUS_09470 240064 240477 gene locus_tag LOCUS_09480 240064 240477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 240491 241444 gene locus_tag LOCUS_09490 240491 241444 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147080.1 protein_id gnl|my_center|LOCUS_09490 241901 242125 gene locus_tag LOCUS_09500 241901 242125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 243921 242134 gene locus_tag LOCUS_09510 243921 242134 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625975.1 protein_id gnl|my_center|LOCUS_09510 243997 244455 gene locus_tag LOCUS_09520 243997 244455 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706144.1 protein_id gnl|my_center|LOCUS_09520 244543 245088 gene locus_tag LOCUS_09530 gene proQ 244543 245088 CDS product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706143.1 protein_id gnl|my_center|LOCUS_09530 245099 247105 gene locus_tag LOCUS_09540 gene prc 245099 247105 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706142.1 protein_id gnl|my_center|LOCUS_09540 247184 249790 gene locus_tag LOCUS_09550 gene pepN 247184 249790 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706141.1 protein_id gnl|my_center|LOCUS_09550 249790 250011 gene locus_tag LOCUS_09560 249790 250011 CDS product DUF2835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119779.1 protein_id gnl|my_center|LOCUS_09560 250360 255165 gene locus_tag LOCUS_09570 250360 255165 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706140.1 protein_id gnl|my_center|LOCUS_09570 255223 256230 gene locus_tag LOCUS_09580 gene pyrD 255223 256230 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706139.1 protein_id gnl|my_center|LOCUS_09580 256481 257017 gene locus_tag LOCUS_09590 256481 257017 CDS product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706138.1 protein_id gnl|my_center|LOCUS_09590 257159 257083 gene locus_tag LOCUS_t00230 257159 257083 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 257273 257197 gene locus_tag LOCUS_t00240 257273 257197 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 257387 257311 gene locus_tag LOCUS_t00250 257387 257311 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 257501 257425 gene locus_tag LOCUS_t00260 257501 257425 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 257625 257549 gene locus_tag LOCUS_t00270 257625 257549 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 257807 259912 gene locus_tag LOCUS_09600 gene rlmKL 257807 259912 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819954.1 protein_id gnl|my_center|LOCUS_09600 259909 260139 gene locus_tag LOCUS_09610 259909 260139 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706136.1 protein_id gnl|my_center|LOCUS_09610 260136 262040 gene locus_tag LOCUS_09620 260136 262040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706135.1 protein_id gnl|my_center|LOCUS_09620 262334 262510 gene locus_tag LOCUS_09630 gene rmf 262334 262510 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010674759.1 protein_id gnl|my_center|LOCUS_09630 263104 262574 gene locus_tag LOCUS_09640 gene fabA 263104 262574 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706133.1 protein_id gnl|my_center|LOCUS_09640 265155 263197 gene locus_tag LOCUS_09650 265155 263197 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706132.1 protein_id gnl|my_center|LOCUS_09650 265324 265833 gene locus_tag LOCUS_09660 265324 265833 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704824.1 protein_id gnl|my_center|LOCUS_09660 265846 266898 gene locus_tag LOCUS_09670 265846 266898 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704825.1 protein_id gnl|my_center|LOCUS_09670 267620 266895 gene locus_tag LOCUS_09680 267620 266895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 267840 268958 gene locus_tag LOCUS_09690 267840 268958 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984007.1 protein_id gnl|my_center|LOCUS_09690 269316 269014 gene locus_tag LOCUS_09700 269316 269014 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 protein_id gnl|my_center|LOCUS_09700 269485 269982 gene locus_tag LOCUS_09710 269485 269982 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921917.1 protein_id gnl|my_center|LOCUS_09710 270775 270419 gene locus_tag LOCUS_09720 270775 270419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 272509 271463 gene locus_tag LOCUS_09730 gene fabF 272509 271463 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895556.1 protein_id gnl|my_center|LOCUS_09730 273387 272848 gene locus_tag LOCUS_09740 273387 272848 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084025.1 protein_id gnl|my_center|LOCUS_09740 274274 273468 gene locus_tag LOCUS_09750 274274 273468 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035676.1 protein_id gnl|my_center|LOCUS_09750 277384 274319 gene locus_tag LOCUS_09760 277384 274319 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103298.1 protein_id gnl|my_center|LOCUS_09760 278496 277381 gene locus_tag LOCUS_09770 278496 277381 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103299.1 protein_id gnl|my_center|LOCUS_09770 279199 278582 gene locus_tag LOCUS_09780 279199 278582 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993970.1 protein_id gnl|my_center|LOCUS_09780 279301 280749 gene locus_tag LOCUS_09790 279301 280749 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035672.1 protein_id gnl|my_center|LOCUS_09790 281271 280777 gene locus_tag LOCUS_09800 281271 280777 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028617.1 protein_id gnl|my_center|LOCUS_09800 282693 281401 gene locus_tag LOCUS_09810 282693 281401 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706131.1 protein_id gnl|my_center|LOCUS_09810 282866 285727 gene locus_tag LOCUS_09820 282866 285727 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_09820 285956 285765 gene locus_tag LOCUS_09830 285956 285765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479653.1 protein_id gnl|my_center|LOCUS_09830 286070 286846 gene locus_tag LOCUS_09840 286070 286846 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_09840 287726 287130 gene locus_tag LOCUS_09850 287726 287130 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527976.1 protein_id gnl|my_center|LOCUS_09850 289330 287756 gene locus_tag LOCUS_09860 289330 287756 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 protein_id gnl|my_center|LOCUS_09860 289955 289371 gene locus_tag LOCUS_09870 289955 289371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090222.1 protein_id gnl|my_center|LOCUS_09870 290679 289939 gene locus_tag LOCUS_09880 290679 289939 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103216.1 protein_id gnl|my_center|LOCUS_09880 291367 290660 gene locus_tag LOCUS_09890 291367 290660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 291606 291364 gene locus_tag LOCUS_09900 291606 291364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 292631 291603 gene locus_tag LOCUS_09910 292631 291603 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_09910 293643 292657 gene locus_tag LOCUS_09920 gene acoA 293643 292657 CDS product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921304.1 protein_id gnl|my_center|LOCUS_09920 293866 295758 gene locus_tag LOCUS_09930 gene eatR 293866 295758 CDS product sigma-54-dependent transcriptional regulator EatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114083.1 protein_id gnl|my_center|LOCUS_09930 296232 295762 gene locus_tag LOCUS_09940 296232 295762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 296542 297966 gene locus_tag LOCUS_09950 gene ccoN 296542 297966 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350679.1 protein_id gnl|my_center|LOCUS_09950 297979 298587 gene locus_tag LOCUS_09960 gene ccoO 297979 298587 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300783.1 protein_id gnl|my_center|LOCUS_09960 298600 298818 gene locus_tag LOCUS_09970 298600 298818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 298815 299783 gene locus_tag LOCUS_09980 gene ccoP 298815 299783 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706147.1 protein_id gnl|my_center|LOCUS_09980 299870 300355 gene locus_tag LOCUS_09990 299870 300355 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 protein_id gnl|my_center|LOCUS_09990 300357 302732 gene locus_tag LOCUS_10000 300357 302732 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706149.1 protein_id gnl|my_center|LOCUS_10000 302729 302929 gene locus_tag LOCUS_10010 gene ccoS 302729 302929 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300771.1 protein_id gnl|my_center|LOCUS_10010 302913 303596 gene locus_tag LOCUS_10020 302913 303596 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706150.1 protein_id gnl|my_center|LOCUS_10020 303661 304407 gene locus_tag LOCUS_10030 303661 304407 CDS product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477663.1 protein_id gnl|my_center|LOCUS_10030 304437 305357 gene locus_tag LOCUS_10040 gene uspE 304437 305357 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300766.1 protein_id gnl|my_center|LOCUS_10040 305430 306353 gene locus_tag LOCUS_10050 gene ttcA 305430 306353 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706151.1 protein_id gnl|my_center|LOCUS_10050 306979 306380 gene locus_tag LOCUS_10060 306979 306380 CDS product DUF2987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706152.1 protein_id gnl|my_center|LOCUS_10060 307749 306976 gene locus_tag LOCUS_10070 307749 306976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029303065.1 protein_id gnl|my_center|LOCUS_10070 307975 309084 gene locus_tag LOCUS_10080 gene potA 307975 309084 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097089.1 protein_id gnl|my_center|LOCUS_10080 309071 309946 gene locus_tag LOCUS_10090 gene potB 309071 309946 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911544.1 protein_id gnl|my_center|LOCUS_10090 309939 310706 gene locus_tag LOCUS_10100 gene potC 309939 310706 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097091.1 protein_id gnl|my_center|LOCUS_10100 310708 311757 gene locus_tag LOCUS_10110 310708 311757 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666442.1 protein_id gnl|my_center|LOCUS_10110 312521 311811 gene locus_tag LOCUS_10120 gene cobB 312521 311811 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706162.1 protein_id gnl|my_center|LOCUS_10120 312943 312638 gene locus_tag LOCUS_10130 gene ihfA 312943 312638 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300715.1 protein_id gnl|my_center|LOCUS_10130 315335 312948 gene locus_tag LOCUS_10140 gene pheT 315335 312948 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706166.1 protein_id gnl|my_center|LOCUS_10140 316334 315351 gene locus_tag LOCUS_10150 gene pheS 316334 315351 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706167.1 protein_id gnl|my_center|LOCUS_10150 316847 316491 gene locus_tag LOCUS_10160 gene rplT 316847 316491 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300683.1 protein_id gnl|my_center|LOCUS_10160 317059 316862 gene locus_tag LOCUS_10170 gene rpmI 317059 316862 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072303.1 protein_id gnl|my_center|LOCUS_10170 317566 317135 gene locus_tag LOCUS_10180 gene infC 317566 317135 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072302.1 protein_id gnl|my_center|LOCUS_10180 319608 317674 gene locus_tag LOCUS_10190 gene thrS 319608 317674 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706169.1 protein_id gnl|my_center|LOCUS_10190 320243 319803 gene locus_tag LOCUS_10200 320243 319803 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481270.1 protein_id gnl|my_center|LOCUS_10200 320329 321192 gene locus_tag LOCUS_10210 320329 321192 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455078.1 protein_id gnl|my_center|LOCUS_10210 321201 321947 gene locus_tag LOCUS_10220 321201 321947 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_10220 321975 322178 gene locus_tag LOCUS_10230 321975 322178 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301298.1 protein_id gnl|my_center|LOCUS_10230 322825 322220 gene locus_tag LOCUS_10240 322825 322220 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210939.1 protein_id gnl|my_center|LOCUS_10240 322994 324382 gene locus_tag LOCUS_10250 322994 324382 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705975.1 protein_id gnl|my_center|LOCUS_10250 324327 325361 gene locus_tag LOCUS_10260 324327 325361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 325453 325529 gene locus_tag LOCUS_t00280 325453 325529 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 325565 325641 gene locus_tag LOCUS_t00290 325565 325641 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 325657 325733 gene locus_tag LOCUS_t00300 325657 325733 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 325904 327226 gene locus_tag LOCUS_10270 325904 327226 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920685.1 protein_id gnl|my_center|LOCUS_10270 327870 327283 gene locus_tag LOCUS_10280 327870 327283 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483453.1 protein_id gnl|my_center|LOCUS_10280 328554 330491 gene locus_tag LOCUS_10290 328554 330491 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706273.1 protein_id gnl|my_center|LOCUS_10290 330514 331782 gene locus_tag LOCUS_10300 330514 331782 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706274.1 protein_id gnl|my_center|LOCUS_10300 331790 333313 gene locus_tag LOCUS_10310 331790 333313 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706275.1 protein_id gnl|my_center|LOCUS_10310 334055 333342 gene locus_tag LOCUS_10320 gene fadR 334055 333342 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706276.1 protein_id gnl|my_center|LOCUS_10320 334186 334701 gene locus_tag LOCUS_10330 gene dsbB 334186 334701 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706278.1 protein_id gnl|my_center|LOCUS_10330 335161 334727 gene locus_tag LOCUS_10340 335161 334727 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300228.1 protein_id gnl|my_center|LOCUS_10340 335829 335167 gene locus_tag LOCUS_10350 335829 335167 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096147.1 protein_id gnl|my_center|LOCUS_10350 336153 335872 gene locus_tag LOCUS_10360 336153 335872 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250286.1 protein_id gnl|my_center|LOCUS_10360 336259 336930 gene locus_tag LOCUS_10370 gene minC 336259 336930 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705993.1 protein_id gnl|my_center|LOCUS_10370 336956 337768 gene locus_tag LOCUS_10380 gene minD 336956 337768 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705992.1 protein_id gnl|my_center|LOCUS_10380 337772 338071 gene locus_tag LOCUS_10390 gene minE 337772 338071 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705991.1 protein_id gnl|my_center|LOCUS_10390 339210 338113 gene locus_tag LOCUS_10400 gene rnd 339210 338113 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171280573.1 protein_id gnl|my_center|LOCUS_10400 340992 339283 gene locus_tag LOCUS_10410 gene fadD 340992 339283 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706061.1 protein_id gnl|my_center|LOCUS_10410 341959 341279 gene locus_tag LOCUS_10420 gene tsaB 341959 341279 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816515.1 protein_id gnl|my_center|LOCUS_10420 343893 341968 gene locus_tag LOCUS_10430 343893 341968 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706056.1 protein_id gnl|my_center|LOCUS_10430 344957 343983 gene locus_tag LOCUS_10440 344957 343983 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160805.1 protein_id gnl|my_center|LOCUS_10440 345110 346429 gene locus_tag LOCUS_10450 345110 346429 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 protein_id gnl|my_center|LOCUS_10450 346466 346882 gene locus_tag LOCUS_10460 346466 346882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943077.1 protein_id gnl|my_center|LOCUS_10460 347740 346904 gene locus_tag LOCUS_10470 347740 346904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 348265 349167 gene locus_tag LOCUS_10480 gene hisG 348265 349167 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706053.1 protein_id gnl|my_center|LOCUS_10480 349171 350463 gene locus_tag LOCUS_10490 gene hisD 349171 350463 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706052.1 protein_id gnl|my_center|LOCUS_10490 350460 351518 gene locus_tag LOCUS_10500 gene hisC 350460 351518 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706051.1 protein_id gnl|my_center|LOCUS_10500 351519 352589 gene locus_tag LOCUS_10510 gene hisB 351519 352589 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460048.1 protein_id gnl|my_center|LOCUS_10510 352586 353176 gene locus_tag LOCUS_10520 gene hisH 352586 353176 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261649.1 protein_id gnl|my_center|LOCUS_10520 353180 353917 gene locus_tag LOCUS_10530 gene hisA 353180 353917 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706048.1 protein_id gnl|my_center|LOCUS_10530 353899 354672 gene locus_tag LOCUS_10540 gene hisF 353899 354672 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880146.1 protein_id gnl|my_center|LOCUS_10540 354665 355270 gene locus_tag LOCUS_10550 gene hisIE 354665 355270 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706043.1 protein_id gnl|my_center|LOCUS_10550 355540 355352 gene locus_tag LOCUS_10560 355540 355352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 355479 356366 gene locus_tag LOCUS_10570 355479 356366 CDS product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706671.1 protein_id gnl|my_center|LOCUS_10570 356439 357629 gene locus_tag LOCUS_10580 356439 357629 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 protein_id gnl|my_center|LOCUS_10580 357738 358928 gene locus_tag LOCUS_10590 357738 358928 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706588.1 protein_id gnl|my_center|LOCUS_10590 361163 359004 gene locus_tag LOCUS_10600 361163 359004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 363583 361184 gene locus_tag LOCUS_10610 363583 361184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 365501 363675 gene locus_tag LOCUS_10620 365501 363675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 366136 365513 gene locus_tag LOCUS_10630 366136 365513 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523925.1 protein_id gnl|my_center|LOCUS_10630 366504 366133 gene locus_tag LOCUS_10640 366504 366133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 368476 366644 gene locus_tag LOCUS_10650 368476 366644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 368858 370147 gene locus_tag LOCUS_10660 368858 370147 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457979.1 protein_id gnl|my_center|LOCUS_10660 370140 371777 gene locus_tag LOCUS_10670 gene pqiB 370140 371777 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707505.1 protein_id gnl|my_center|LOCUS_10670 371774 372364 gene locus_tag LOCUS_10680 371774 372364 CDS product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805968.1 protein_id gnl|my_center|LOCUS_10680 372486 374162 gene locus_tag LOCUS_10690 372486 374162 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971995.1 protein_id gnl|my_center|LOCUS_10690 374679 374203 gene locus_tag LOCUS_10700 374679 374203 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617103.1 protein_id gnl|my_center|LOCUS_10700 375732 374866 gene locus_tag LOCUS_10710 375732 374866 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298308.1 protein_id gnl|my_center|LOCUS_10710 375907 376842 gene locus_tag LOCUS_10720 375907 376842 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170570.1 protein_id gnl|my_center|LOCUS_10720 377323 376850 gene locus_tag LOCUS_10730 377323 376850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 377872 377582 gene locus_tag LOCUS_10740 377872 377582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 378414 377941 gene locus_tag LOCUS_10750 378414 377941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 380399 378624 gene locus_tag LOCUS_10760 380399 378624 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104008.1 protein_id gnl|my_center|LOCUS_10760 381104 380499 gene locus_tag LOCUS_10770 381104 380499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 381903 381121 gene locus_tag LOCUS_10780 381903 381121 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104022.1 protein_id gnl|my_center|LOCUS_10780 383444 382077 gene locus_tag LOCUS_10790 383444 382077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 384213 383446 gene locus_tag LOCUS_10800 384213 383446 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125677.1 protein_id gnl|my_center|LOCUS_10800 384838 384278 gene locus_tag LOCUS_10810 384838 384278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021703980.1 protein_id gnl|my_center|LOCUS_10810 385271 384873 gene locus_tag LOCUS_10820 385271 384873 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 protein_id gnl|my_center|LOCUS_10820 386921 385365 gene locus_tag LOCUS_10830 386921 385365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 387520 387185 gene locus_tag LOCUS_10840 387520 387185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 388484 387921 gene locus_tag LOCUS_10850 388484 387921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 389204 388830 gene locus_tag LOCUS_10860 389204 388830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240938.1 protein_id gnl|my_center|LOCUS_10860 392510 389409 gene locus_tag LOCUS_10870 392510 389409 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 protein_id gnl|my_center|LOCUS_10870 393648 392521 gene locus_tag LOCUS_10880 393648 392521 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_10880 394584 393781 gene locus_tag LOCUS_10890 394584 393781 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942221.1 protein_id gnl|my_center|LOCUS_10890 395632 394646 gene locus_tag LOCUS_10900 395632 394646 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485753.1 protein_id gnl|my_center|LOCUS_10900 396227 395715 gene locus_tag LOCUS_10910 396227 395715 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229593.1 protein_id gnl|my_center|LOCUS_10910 396680 396306 gene locus_tag LOCUS_10920 396680 396306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 397345 396749 gene locus_tag LOCUS_10930 397345 396749 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037388.1 protein_id gnl|my_center|LOCUS_10930 397883 397395 gene locus_tag LOCUS_10940 397883 397395 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267607.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10940 398531 398136 gene locus_tag LOCUS_10950 398531 398136 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530889.1 protein_id gnl|my_center|LOCUS_10950 398845 398534 gene locus_tag LOCUS_10960 398845 398534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 399351 398842 gene locus_tag LOCUS_10970 399351 398842 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089838.1 protein_id gnl|my_center|LOCUS_10970 399384 399644 gene locus_tag LOCUS_10980 399384 399644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 400207 399821 gene locus_tag LOCUS_10990 400207 399821 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919370.1 protein_id gnl|my_center|LOCUS_10990 400548 400321 gene locus_tag LOCUS_11000 400548 400321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 401551 400682 gene locus_tag LOCUS_11010 401551 400682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 402861 401551 gene locus_tag LOCUS_11020 402861 401551 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924694.1 protein_id gnl|my_center|LOCUS_11020 403738 402974 gene locus_tag LOCUS_11030 403738 402974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence11 357 1112 gene locus_tag LOCUS_11040 gene ubiE 357 1112 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704116.1 protein_id gnl|my_center|LOCUS_11040 1112 1732 gene locus_tag LOCUS_11050 1112 1732 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478696.1 protein_id gnl|my_center|LOCUS_11050 1729 3366 gene locus_tag LOCUS_11060 gene ubiB 1729 3366 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704118.1 protein_id gnl|my_center|LOCUS_11060 3450 3704 gene locus_tag LOCUS_11070 gene tatA 3450 3704 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456852.1 protein_id gnl|my_center|LOCUS_11070 3707 4066 gene locus_tag LOCUS_11080 gene tatB 3707 4066 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459768.1 protein_id gnl|my_center|LOCUS_11080 4067 4819 gene locus_tag LOCUS_11090 gene tatC 4067 4819 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704121.1 protein_id gnl|my_center|LOCUS_11090 4816 5607 gene locus_tag LOCUS_11100 4816 5607 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704122.1 protein_id gnl|my_center|LOCUS_11100 5604 6617 gene locus_tag LOCUS_11110 gene hemB 5604 6617 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 protein_id gnl|my_center|LOCUS_11110 8122 6644 gene locus_tag LOCUS_11120 gene gppA 8122 6644 CDS product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704128.1 protein_id gnl|my_center|LOCUS_11120 9445 8129 gene locus_tag LOCUS_11130 gene rhlB 9445 8129 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704129.1 protein_id gnl|my_center|LOCUS_11130 9561 9887 gene locus_tag LOCUS_11140 gene trxA 9561 9887 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307306.1 protein_id gnl|my_center|LOCUS_11140 10070 11335 gene locus_tag LOCUS_11150 gene rho 10070 11335 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307308.1 protein_id gnl|my_center|LOCUS_11150 11448 12947 gene locus_tag LOCUS_11160 gene ubiD 11448 12947 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704131.1 protein_id gnl|my_center|LOCUS_11160 12950 13648 gene locus_tag LOCUS_11170 gene fre 12950 13648 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704132.1 protein_id gnl|my_center|LOCUS_11170 13983 13717 gene locus_tag LOCUS_11180 13983 13717 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307315.1 protein_id gnl|my_center|LOCUS_11180 14962 14075 gene locus_tag LOCUS_11190 gene ilvY 14962 14075 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_11190 15101 16585 gene locus_tag LOCUS_11200 gene ilvC 15101 16585 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024919.1 protein_id gnl|my_center|LOCUS_11200 16746 17549 gene locus_tag LOCUS_11210 gene tcdA 16746 17549 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707894.1 protein_id gnl|my_center|LOCUS_11210 18252 17827 gene locus_tag LOCUS_11220 18252 17827 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182976181.1 protein_id gnl|my_center|LOCUS_11220 19463 18249 gene locus_tag LOCUS_11230 19463 18249 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707892.1 protein_id gnl|my_center|LOCUS_11230 19591 21603 gene locus_tag LOCUS_11240 gene rep 19591 21603 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707891.1 protein_id gnl|my_center|LOCUS_11240 22262 21831 gene locus_tag LOCUS_11250 22262 21831 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945508.1 protein_id gnl|my_center|LOCUS_11250 22500 23033 gene locus_tag LOCUS_11260 22500 23033 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968485.1 protein_id gnl|my_center|LOCUS_11260 23220 23840 gene locus_tag LOCUS_11270 gene gstA 23220 23840 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083981.1 protein_id gnl|my_center|LOCUS_11270 24736 23837 gene locus_tag LOCUS_11280 24736 23837 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482188.1 protein_id gnl|my_center|LOCUS_11280 24860 26077 gene locus_tag LOCUS_11290 gene sbcD 24860 26077 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208687.1 protein_id gnl|my_center|LOCUS_11290 26074 29463 gene locus_tag LOCUS_11300 26074 29463 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208688.1 protein_id gnl|my_center|LOCUS_11300 29940 29473 gene locus_tag LOCUS_11310 29940 29473 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467599.1 protein_id gnl|my_center|LOCUS_11310 31239 29971 gene locus_tag LOCUS_11320 31239 29971 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810872.1 protein_id gnl|my_center|LOCUS_11320 32005 31253 gene locus_tag LOCUS_11330 32005 31253 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_11330 33416 32097 gene locus_tag LOCUS_11340 33416 32097 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870182.1 protein_id gnl|my_center|LOCUS_11340 33991 33416 gene locus_tag LOCUS_11350 33991 33416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 35153 34137 gene locus_tag LOCUS_11360 gene dctP 35153 34137 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870184.1 protein_id gnl|my_center|LOCUS_11360 35555 36355 gene locus_tag LOCUS_11370 35555 36355 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113730.1 protein_id gnl|my_center|LOCUS_11370 37891 36428 gene locus_tag LOCUS_11380 37891 36428 CDS product DUF3360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457552.1 protein_id gnl|my_center|LOCUS_11380 38943 38041 gene locus_tag LOCUS_11390 38943 38041 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142979.1 protein_id gnl|my_center|LOCUS_11390 39103 39309 gene locus_tag LOCUS_11400 39103 39309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 39302 40759 gene locus_tag LOCUS_11410 39302 40759 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404732.1 protein_id gnl|my_center|LOCUS_11410 40769 42040 gene locus_tag LOCUS_11420 40769 42040 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029435.1 protein_id gnl|my_center|LOCUS_11420 43477 42122 gene locus_tag LOCUS_11430 43477 42122 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_11430 45196 43577 gene locus_tag LOCUS_11440 45196 43577 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_11440 45346 47655 gene locus_tag LOCUS_11450 gene bfiS 45346 47655 CDS product two-component system sensor histidine kinase BfiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114718.1 protein_id gnl|my_center|LOCUS_11450 47655 48302 gene locus_tag LOCUS_11460 gene bfiR 47655 48302 CDS product two-component system response regulator BfiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114717.1 protein_id gnl|my_center|LOCUS_11460 48523 48314 gene locus_tag LOCUS_11470 48523 48314 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212949.1 protein_id gnl|my_center|LOCUS_11470 49707 48454 gene locus_tag LOCUS_11480 49707 48454 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359221.1 protein_id gnl|my_center|LOCUS_11480 49817 50689 gene locus_tag LOCUS_11490 49817 50689 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228551.1 protein_id gnl|my_center|LOCUS_11490 52640 50679 gene locus_tag LOCUS_11500 52640 50679 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267518.1 protein_id gnl|my_center|LOCUS_11500 53375 54058 gene locus_tag LOCUS_11510 53375 54058 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 protein_id gnl|my_center|LOCUS_11510 54489 55340 gene locus_tag LOCUS_11520 54489 55340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 55401 55697 gene locus_tag LOCUS_11530 55401 55697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 55700 56362 gene locus_tag LOCUS_11540 55700 56362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 56371 56829 gene locus_tag LOCUS_11550 56371 56829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 58589 57576 gene locus_tag LOCUS_11560 58589 57576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 60252 61490 gene locus_tag LOCUS_11570 60252 61490 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401360.1 protein_id gnl|my_center|LOCUS_11570 62356 61718 gene locus_tag LOCUS_11580 62356 61718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11580 62319 62459 gene locus_tag LOCUS_11590 62319 62459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 63933 62560 gene locus_tag LOCUS_11600 63933 62560 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528221.1 protein_id gnl|my_center|LOCUS_11600 65488 64049 gene locus_tag LOCUS_11610 65488 64049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 66113 65499 gene locus_tag LOCUS_11620 66113 65499 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530025.1 protein_id gnl|my_center|LOCUS_11620 66427 67083 gene locus_tag LOCUS_11630 66427 67083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 67062 68384 gene locus_tag LOCUS_11640 gene ktrB 67062 68384 CDS product Ktr system potassium transporter KtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243582.1 protein_id gnl|my_center|LOCUS_11640 68371 69678 gene locus_tag LOCUS_11650 68371 69678 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258678.1 protein_id gnl|my_center|LOCUS_11650 69675 70361 gene locus_tag LOCUS_11660 gene kdpE 69675 70361 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_11660 72265 70538 gene locus_tag LOCUS_11670 72265 70538 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_11670 73765 72299 gene locus_tag LOCUS_11680 73765 72299 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_11680 74524 74003 gene locus_tag LOCUS_11690 74524 74003 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705787.1 protein_id gnl|my_center|LOCUS_11690 75512 74574 gene locus_tag LOCUS_11700 75512 74574 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550739.1 protein_id gnl|my_center|LOCUS_11700 75561 76997 gene locus_tag LOCUS_11710 75561 76997 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965040.1 protein_id gnl|my_center|LOCUS_11710 77836 76979 gene locus_tag LOCUS_11720 77836 76979 CDS product ferric iron reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162180344.1 protein_id gnl|my_center|LOCUS_11720 78632 78162 gene locus_tag LOCUS_11730 gene bfr 78632 78162 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 protein_id gnl|my_center|LOCUS_11730 79109 78645 gene locus_tag LOCUS_11740 gene bfr 79109 78645 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071355.1 protein_id gnl|my_center|LOCUS_11740 79676 81808 gene locus_tag LOCUS_11750 79676 81808 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086926.1 protein_id gnl|my_center|LOCUS_11750 81802 82701 gene locus_tag LOCUS_11760 81802 82701 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015613.1 protein_id gnl|my_center|LOCUS_11760 82682 83677 gene locus_tag LOCUS_11770 82682 83677 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259661.1 protein_id gnl|my_center|LOCUS_11770 83674 84645 gene locus_tag LOCUS_11780 83674 84645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11780 84649 85440 gene locus_tag LOCUS_11790 84649 85440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886609.1 protein_id gnl|my_center|LOCUS_11790 86824 85457 gene locus_tag LOCUS_11800 gene ompQ 86824 85457 CDS product pyoverdine export/recycling transporter outer membrane subunit OmpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895610.1 protein_id gnl|my_center|LOCUS_11800 88755 86827 gene locus_tag LOCUS_11810 88755 86827 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969681.1 protein_id gnl|my_center|LOCUS_11810 89906 88755 gene locus_tag LOCUS_11820 gene macA 89906 88755 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526928.1 protein_id gnl|my_center|LOCUS_11820 91205 90321 gene locus_tag LOCUS_11830 91205 90321 CDS product putative metalloprotease CJM1_0395 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704306.1 protein_id gnl|my_center|LOCUS_11830 91495 91208 gene locus_tag LOCUS_11840 91495 91208 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704305.1 protein_id gnl|my_center|LOCUS_11840 93851 91614 gene locus_tag LOCUS_11850 93851 91614 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815626.1 protein_id gnl|my_center|LOCUS_11850 94233 94853 gene locus_tag LOCUS_11860 94233 94853 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810476.1 protein_id gnl|my_center|LOCUS_11860 94868 95356 gene locus_tag LOCUS_11870 94868 95356 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479631.1 protein_id gnl|my_center|LOCUS_11870 95358 96167 gene locus_tag LOCUS_11880 95358 96167 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 protein_id gnl|my_center|LOCUS_11880 96178 96477 gene locus_tag LOCUS_11890 96178 96477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479615.1 protein_id gnl|my_center|LOCUS_11890 96464 96961 gene locus_tag LOCUS_11900 96464 96961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 96958 97839 gene locus_tag LOCUS_11910 96958 97839 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459333.1 protein_id gnl|my_center|LOCUS_11910 97839 98534 gene locus_tag LOCUS_11920 97839 98534 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390142.1 protein_id gnl|my_center|LOCUS_11920 98534 99412 gene locus_tag LOCUS_11930 98534 99412 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479618.1 protein_id gnl|my_center|LOCUS_11930 99409 100182 gene locus_tag LOCUS_11940 99409 100182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 100432 101376 gene locus_tag LOCUS_11950 100432 101376 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153529.1 protein_id gnl|my_center|LOCUS_11950 101729 101373 gene locus_tag LOCUS_11960 101729 101373 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089312.1 protein_id gnl|my_center|LOCUS_11960 102136 101723 gene locus_tag LOCUS_11970 102136 101723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 102335 103639 gene locus_tag LOCUS_11980 102335 103639 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072104.1 protein_id gnl|my_center|LOCUS_11980 103752 104486 gene locus_tag LOCUS_11990 103752 104486 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401743.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence12 31 107 gene locus_tag LOCUS_t00310 31 107 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 503 1513 gene locus_tag LOCUS_12000 503 1513 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042143812.1 protein_id gnl|my_center|LOCUS_12000 1510 2067 gene locus_tag LOCUS_12010 1510 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2064 3344 gene locus_tag LOCUS_12020 2064 3344 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384579.1 protein_id gnl|my_center|LOCUS_12020 3377 4108 gene locus_tag LOCUS_12030 3377 4108 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086078.1 protein_id gnl|my_center|LOCUS_12030 4273 4968 gene locus_tag LOCUS_12040 4273 4968 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212344658.1 protein_id gnl|my_center|LOCUS_12040 5745 7166 gene locus_tag LOCUS_12050 gene hydA 5745 7166 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086079.1 protein_id gnl|my_center|LOCUS_12050 7246 8412 gene locus_tag LOCUS_12060 7246 8412 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815469.1 protein_id gnl|my_center|LOCUS_12060 8487 9521 gene locus_tag LOCUS_12070 8487 9521 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383445.1 protein_id gnl|my_center|LOCUS_12070 9577 10185 gene locus_tag LOCUS_12080 9577 10185 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064555.1 protein_id gnl|my_center|LOCUS_12080 10182 11471 gene locus_tag LOCUS_12090 10182 11471 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808102.1 protein_id gnl|my_center|LOCUS_12090 11450 12874 gene locus_tag LOCUS_12100 11450 12874 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086065.1 protein_id gnl|my_center|LOCUS_12100 12880 13647 gene locus_tag LOCUS_12110 12880 13647 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223448.1 protein_id gnl|my_center|LOCUS_12110 13796 14638 gene locus_tag LOCUS_12120 13796 14638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 14892 16526 gene locus_tag LOCUS_12130 14892 16526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 17220 16576 gene locus_tag LOCUS_12140 17220 16576 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477517.1 protein_id gnl|my_center|LOCUS_12140 18144 17230 gene locus_tag LOCUS_12150 18144 17230 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104189.1 protein_id gnl|my_center|LOCUS_12150 19672 18179 gene locus_tag LOCUS_12160 19672 18179 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704305.1 protein_id gnl|my_center|LOCUS_12160 20162 19773 gene locus_tag LOCUS_12170 20162 19773 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368415.1 protein_id gnl|my_center|LOCUS_12170 21613 20159 gene locus_tag LOCUS_12180 21613 20159 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550877.1 protein_id gnl|my_center|LOCUS_12180 22502 21639 gene locus_tag LOCUS_12190 22502 21639 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704308.1 protein_id gnl|my_center|LOCUS_12190 22688 23914 gene locus_tag LOCUS_12200 22688 23914 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704303.1 protein_id gnl|my_center|LOCUS_12200 25867 23957 gene locus_tag LOCUS_12210 25867 23957 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706272.1 protein_id gnl|my_center|LOCUS_12210 27195 26011 gene locus_tag LOCUS_12220 gene pobA 27195 26011 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103764.1 protein_id gnl|my_center|LOCUS_12220 27325 28236 gene locus_tag LOCUS_12230 27325 28236 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084097.1 protein_id gnl|my_center|LOCUS_12230 29544 28258 gene locus_tag LOCUS_12240 29544 28258 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_12240 30077 29541 gene locus_tag LOCUS_12250 30077 29541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 31093 30098 gene locus_tag LOCUS_12260 31093 30098 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538040.1 protein_id gnl|my_center|LOCUS_12260 33065 31308 gene locus_tag LOCUS_12270 33065 31308 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086450.1 protein_id gnl|my_center|LOCUS_12270 34117 33227 gene locus_tag LOCUS_12280 34117 33227 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084097.1 protein_id gnl|my_center|LOCUS_12280 34396 35211 gene locus_tag LOCUS_12290 34396 35211 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643078.1 protein_id gnl|my_center|LOCUS_12290 35236 35571 gene locus_tag LOCUS_12300 35236 35571 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086452.1 protein_id gnl|my_center|LOCUS_12300 35686 36468 gene locus_tag LOCUS_12310 35686 36468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 36637 37488 gene locus_tag LOCUS_12320 36637 37488 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528527.1 protein_id gnl|my_center|LOCUS_12320 37485 38510 gene locus_tag LOCUS_12330 37485 38510 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809842.1 protein_id gnl|my_center|LOCUS_12330 38497 39216 gene locus_tag LOCUS_12340 38497 39216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338847.1 protein_id gnl|my_center|LOCUS_12340 39213 39911 gene locus_tag LOCUS_12350 39213 39911 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809848.1 protein_id gnl|my_center|LOCUS_12350 40000 41187 gene locus_tag LOCUS_12360 40000 41187 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814767.1 protein_id gnl|my_center|LOCUS_12360 41445 42605 gene locus_tag LOCUS_12370 41445 42605 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042595882.1 protein_id gnl|my_center|LOCUS_12370 43643 42708 gene locus_tag LOCUS_12380 43643 42708 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207577.1 protein_id gnl|my_center|LOCUS_12380 44990 43653 gene locus_tag LOCUS_12390 44990 43653 CDS product lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538212.1 protein_id gnl|my_center|LOCUS_12390 45637 45038 gene locus_tag LOCUS_12400 gene pcaG 45637 45038 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524240.1 protein_id gnl|my_center|LOCUS_12400 46339 45641 gene locus_tag LOCUS_12410 gene pcaH 46339 45641 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524239.1 protein_id gnl|my_center|LOCUS_12410 47440 46448 gene locus_tag LOCUS_12420 47440 46448 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113326.1 protein_id gnl|my_center|LOCUS_12420 48460 47507 gene locus_tag LOCUS_12430 48460 47507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 49404 48478 gene locus_tag LOCUS_12440 49404 48478 CDS product DUF1932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494215.1 protein_id gnl|my_center|LOCUS_12440 50740 49517 gene locus_tag LOCUS_12450 50740 49517 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057204.1 protein_id gnl|my_center|LOCUS_12450 50956 51969 gene locus_tag LOCUS_12460 50956 51969 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 protein_id gnl|my_center|LOCUS_12460 51987 52664 gene locus_tag LOCUS_12470 51987 52664 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039101.1 protein_id gnl|my_center|LOCUS_12470 52657 53721 gene locus_tag LOCUS_12480 52657 53721 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 protein_id gnl|my_center|LOCUS_12480 53739 54614 gene locus_tag LOCUS_12490 53739 54614 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_12490 54632 54997 gene locus_tag LOCUS_12500 54632 54997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 54990 55829 gene locus_tag LOCUS_12510 54990 55829 CDS product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_12510 57057 55879 gene locus_tag LOCUS_12520 gene pcaD 57057 55879 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920269.1 protein_id gnl|my_center|LOCUS_12520 58103 57168 gene locus_tag LOCUS_12530 gene pcaQ 58103 57168 CDS product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037467939.1 protein_id gnl|my_center|LOCUS_12530 58614 59438 gene locus_tag LOCUS_12540 58614 59438 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382871.1 protein_id gnl|my_center|LOCUS_12540 60024 61046 gene locus_tag LOCUS_12550 60024 61046 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253036.1 protein_id gnl|my_center|LOCUS_12550 61114 61668 gene locus_tag LOCUS_12560 61114 61668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 61672 62940 gene locus_tag LOCUS_12570 61672 62940 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538085.1 protein_id gnl|my_center|LOCUS_12570 62950 63774 gene locus_tag LOCUS_12580 62950 63774 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382871.1 protein_id gnl|my_center|LOCUS_12580 63767 64210 gene locus_tag LOCUS_12590 gene aroQ 63767 64210 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224605.1 protein_id gnl|my_center|LOCUS_12590 64207 66057 gene locus_tag LOCUS_12600 64207 66057 CDS product sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395800.1 protein_id gnl|my_center|LOCUS_12600 66222 67220 gene locus_tag LOCUS_12610 66222 67220 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063714.1 protein_id gnl|my_center|LOCUS_12610 67272 67739 gene locus_tag LOCUS_12620 67272 67739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 67752 69263 gene locus_tag LOCUS_12630 67752 69263 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_12630 70202 69333 gene locus_tag LOCUS_12640 gene yghU 70202 69333 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530630.1 protein_id gnl|my_center|LOCUS_12640 71121 70306 gene locus_tag LOCUS_12650 71121 70306 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086441.1 protein_id gnl|my_center|LOCUS_12650 71307 73055 gene locus_tag LOCUS_12660 71307 73055 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086439.1 protein_id gnl|my_center|LOCUS_12660 73141 73941 gene locus_tag LOCUS_12670 73141 73941 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086453.1 protein_id gnl|my_center|LOCUS_12670 74834 74013 gene locus_tag LOCUS_12680 74834 74013 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086437.1 protein_id gnl|my_center|LOCUS_12680 75040 76758 gene locus_tag LOCUS_12690 75040 76758 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966193.1 protein_id gnl|my_center|LOCUS_12690 76796 77410 gene locus_tag LOCUS_12700 76796 77410 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086438.1 protein_id gnl|my_center|LOCUS_12700 77461 78513 gene locus_tag LOCUS_12710 77461 78513 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089125.1 protein_id gnl|my_center|LOCUS_12710 78707 79711 gene locus_tag LOCUS_12720 78707 79711 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064788.1 protein_id gnl|my_center|LOCUS_12720 79756 80223 gene locus_tag LOCUS_12730 79756 80223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 80237 81748 gene locus_tag LOCUS_12740 80237 81748 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 protein_id gnl|my_center|LOCUS_12740 81887 82696 gene locus_tag LOCUS_12750 81887 82696 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101874.1 protein_id gnl|my_center|LOCUS_12750 82891 83337 gene locus_tag LOCUS_12760 82891 83337 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094294.1 protein_id gnl|my_center|LOCUS_12760 83347 84036 gene locus_tag LOCUS_12770 83347 84036 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482811.1 protein_id gnl|my_center|LOCUS_12770 85117 84188 gene locus_tag LOCUS_12780 85117 84188 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919349.1 protein_id gnl|my_center|LOCUS_12780 85519 86202 gene locus_tag LOCUS_12790 85519 86202 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090561.1 protein_id gnl|my_center|LOCUS_12790 86289 86576 gene locus_tag LOCUS_12800 86289 86576 CDS product DUF1427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114379.1 protein_id gnl|my_center|LOCUS_12800 86573 88471 gene locus_tag LOCUS_12810 86573 88471 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209600098.1 protein_id gnl|my_center|LOCUS_12810 88553 90154 gene locus_tag LOCUS_12820 88553 90154 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969601.1 protein_id gnl|my_center|LOCUS_12820 90634 90422 gene locus_tag LOCUS_12830 90634 90422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 92038 90722 gene locus_tag LOCUS_12840 92038 90722 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267047.1 protein_id gnl|my_center|LOCUS_12840 92733 92266 gene locus_tag LOCUS_12850 gene pyrI 92733 92266 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707750.1 protein_id gnl|my_center|LOCUS_12850 93653 92730 gene locus_tag LOCUS_12860 gene pyrB 93653 92730 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352301.1 protein_id gnl|my_center|LOCUS_12860 93969 94045 gene locus_tag LOCUS_t00320 93969 94045 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 94100 94477 gene locus_tag LOCUS_12870 94100 94477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 94453 94896 gene locus_tag LOCUS_12880 gene rimI 94453 94896 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704681.1 protein_id gnl|my_center|LOCUS_12880 94940 95941 gene locus_tag LOCUS_12890 94940 95941 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096656.1 protein_id gnl|my_center|LOCUS_12890 96179 97474 gene locus_tag LOCUS_12900 96179 97474 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 protein_id gnl|my_center|LOCUS_12900 97527 98354 gene locus_tag LOCUS_12910 97527 98354 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705936.1 protein_id gnl|my_center|LOCUS_12910 98903 100426 gene locus_tag LOCUS_12920 gene pntA 98903 100426 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705256.1 protein_id gnl|my_center|LOCUS_12920 100431 101807 gene locus_tag LOCUS_12930 gene pntB 100431 101807 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073523.1 protein_id gnl|my_center|LOCUS_12930 102185 102045 gene locus_tag LOCUS_12940 102185 102045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 103288 102365 gene locus_tag LOCUS_12950 103288 102365 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973349.1 protein_id gnl|my_center|LOCUS_12950 104403 103420 gene locus_tag LOCUS_12960 104403 103420 CDS product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457949.1 protein_id gnl|my_center|LOCUS_12960 105684 104800 gene locus_tag LOCUS_12970 105684 104800 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_12970 107426 105975 gene locus_tag LOCUS_12980 107426 105975 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078607651.1 protein_id gnl|my_center|LOCUS_12980 107614 108288 gene locus_tag LOCUS_12990 107614 108288 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 protein_id gnl|my_center|LOCUS_12990 108281 108610 gene locus_tag LOCUS_13000 108281 108610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 109414 108662 gene locus_tag LOCUS_13010 109414 108662 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477266.1 protein_id gnl|my_center|LOCUS_13010 110573 109569 gene locus_tag LOCUS_13020 gene galM 110573 109569 CDS product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042050097.1 protein_id gnl|my_center|LOCUS_13020 111715 110567 gene locus_tag LOCUS_13030 gene galK 111715 110567 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707767.1 protein_id gnl|my_center|LOCUS_13030 112755 111715 gene locus_tag LOCUS_13040 112755 111715 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707766.1 protein_id gnl|my_center|LOCUS_13040 113771 112758 gene locus_tag LOCUS_13050 gene galE 113771 112758 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707765.1 protein_id gnl|my_center|LOCUS_13050 113969 114985 gene locus_tag LOCUS_13060 113969 114985 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707764.1 protein_id gnl|my_center|LOCUS_13060 116044 115037 gene locus_tag LOCUS_13070 116044 115037 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707769.1 protein_id gnl|my_center|LOCUS_13070 116243 117568 gene locus_tag LOCUS_13080 116243 117568 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969771.1 protein_id gnl|my_center|LOCUS_13080 118502 117651 gene locus_tag LOCUS_13090 gene melR 118502 117651 CDS product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090750.1 protein_id gnl|my_center|LOCUS_13090 120126 118507 gene locus_tag LOCUS_13100 120126 118507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969770.1 protein_id gnl|my_center|LOCUS_13100 121275 120139 gene locus_tag LOCUS_13110 121275 120139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530192.1 protein_id gnl|my_center|LOCUS_13110 122293 121295 gene locus_tag LOCUS_13120 122293 121295 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974056.1 protein_id gnl|my_center|LOCUS_13120 124459 122399 gene locus_tag LOCUS_13130 124459 122399 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974055.1 protein_id gnl|my_center|LOCUS_13130 126636 124522 gene locus_tag LOCUS_13140 126636 124522 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213113.1 protein_id gnl|my_center|LOCUS_13140 127684 126863 gene locus_tag LOCUS_13150 127684 126863 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168756122.1 protein_id gnl|my_center|LOCUS_13150 127955 129307 gene locus_tag LOCUS_13160 127955 129307 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460902.1 protein_id gnl|my_center|LOCUS_13160 129586 130842 gene locus_tag LOCUS_13170 129586 130842 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974524.1 protein_id gnl|my_center|LOCUS_13170 130895 132013 gene locus_tag LOCUS_13180 130895 132013 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315886.1 protein_id gnl|my_center|LOCUS_13180 132016 132918 gene locus_tag LOCUS_13190 132016 132918 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974523.1 protein_id gnl|my_center|LOCUS_13190 132930 134384 gene locus_tag LOCUS_13200 132930 134384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 134401 135531 gene locus_tag LOCUS_13210 gene ugpC 134401 135531 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532490.1 protein_id gnl|my_center|LOCUS_13210 137579 135993 gene locus_tag LOCUS_13220 gene prfC 137579 135993 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108381.1 protein_id gnl|my_center|LOCUS_13220 138040 137729 gene locus_tag LOCUS_13230 138040 137729 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970224.1 protein_id gnl|my_center|LOCUS_13230 139323 138094 gene locus_tag LOCUS_13240 139323 138094 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970225.1 protein_id gnl|my_center|LOCUS_13240 139515 140090 gene locus_tag LOCUS_13250 139515 140090 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766709.1 protein_id gnl|my_center|LOCUS_13250 140567 141817 gene locus_tag LOCUS_13260 140567 141817 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550272.1 protein_id gnl|my_center|LOCUS_13260 141923 142690 gene locus_tag LOCUS_13270 141923 142690 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119010.1 protein_id gnl|my_center|LOCUS_13270 142861 144141 gene locus_tag LOCUS_13280 142861 144141 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707414.1 protein_id gnl|my_center|LOCUS_13280 144439 145212 gene locus_tag LOCUS_13290 gene deoC 144439 145212 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071446.1 protein_id gnl|my_center|LOCUS_13290 145212 146543 gene locus_tag LOCUS_13300 gene deoA 145212 146543 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071447.1 protein_id gnl|my_center|LOCUS_13300 146540 147766 gene locus_tag LOCUS_13310 gene deoB 146540 147766 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368379.1 protein_id gnl|my_center|LOCUS_13310 148103 148822 gene locus_tag LOCUS_13320 gene deoD 148103 148822 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166923.1 protein_id gnl|my_center|LOCUS_13320 149359 148814 gene locus_tag LOCUS_13330 149359 148814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 149472 150455 gene locus_tag LOCUS_13340 gene serB 149472 150455 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707408.1 protein_id gnl|my_center|LOCUS_13340 152682 150406 gene locus_tag LOCUS_13350 152682 150406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 152754 154121 gene locus_tag LOCUS_13360 gene radA 152754 154121 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707405.1 protein_id gnl|my_center|LOCUS_13360 154483 154118 gene locus_tag LOCUS_13370 gene mapZ 154483 154118 CDS product cyclic di-GMP-binding protein MapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094864.1 protein_id gnl|my_center|LOCUS_13370 154960 154496 gene locus_tag LOCUS_13380 154960 154496 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707403.1 protein_id gnl|my_center|LOCUS_13380 155172 156239 gene locus_tag LOCUS_13390 gene hemE 155172 156239 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635049.1 protein_id gnl|my_center|LOCUS_13390 157612 156311 gene locus_tag LOCUS_13400 gene mepM 157612 156311 CDS product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707439.1 protein_id gnl|my_center|LOCUS_13400 158840 157851 gene locus_tag LOCUS_13410 gene znuA 158840 157851 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705954.1 protein_id gnl|my_center|LOCUS_13410 158928 159665 gene locus_tag LOCUS_13420 gene znuC 158928 159665 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707444.1 protein_id gnl|my_center|LOCUS_13420 159655 160443 gene locus_tag LOCUS_13430 gene znuB 159655 160443 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707445.1 protein_id gnl|my_center|LOCUS_13430 161015 160440 gene locus_tag LOCUS_13440 161015 160440 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_13440 161962 161018 gene locus_tag LOCUS_13450 161962 161018 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707438.1 protein_id gnl|my_center|LOCUS_13450 162052 162699 gene locus_tag LOCUS_13460 162052 162699 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707437.1 protein_id gnl|my_center|LOCUS_13460 163178 162696 gene locus_tag LOCUS_13470 gene cosR 163178 162696 CDS product MarR family transcriptional regulator CosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 protein_id gnl|my_center|LOCUS_13470 163335 164045 gene locus_tag LOCUS_13480 gene hutC 163335 164045 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483583.1 protein_id gnl|my_center|LOCUS_13480 164690 164154 gene locus_tag LOCUS_13490 164690 164154 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173162.1 protein_id gnl|my_center|LOCUS_13490 166094 164784 gene locus_tag LOCUS_13500 166094 164784 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289416.1 protein_id gnl|my_center|LOCUS_13500 166274 167482 gene locus_tag LOCUS_13510 gene hutI 166274 167482 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927515.1 protein_id gnl|my_center|LOCUS_13510 167491 168408 gene locus_tag LOCUS_13520 gene hutG 167491 168408 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704354.1 protein_id gnl|my_center|LOCUS_13520 168423 170105 gene locus_tag LOCUS_13530 gene hutU 168423 170105 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207979.1 protein_id gnl|my_center|LOCUS_13530 170109 171641 gene locus_tag LOCUS_13540 gene hutH 170109 171641 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421598.1 protein_id gnl|my_center|LOCUS_13540 171752 172426 gene locus_tag LOCUS_13550 171752 172426 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 protein_id gnl|my_center|LOCUS_13550 172532 173635 gene locus_tag LOCUS_13560 172532 173635 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462603.1 protein_id gnl|my_center|LOCUS_13560 174367 173729 gene locus_tag LOCUS_13570 gene crp 174367 173729 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704916.1 protein_id gnl|my_center|LOCUS_13570 174550 174954 gene locus_tag LOCUS_13580 174550 174954 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349708.1 protein_id gnl|my_center|LOCUS_13580 175121 176119 gene locus_tag LOCUS_13590 175121 176119 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 protein_id gnl|my_center|LOCUS_13590 177040 176171 gene locus_tag LOCUS_13600 177040 176171 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704920.1 protein_id gnl|my_center|LOCUS_13600 177323 177099 gene locus_tag LOCUS_13610 177323 177099 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704929.1 protein_id gnl|my_center|LOCUS_13610 178300 177320 gene locus_tag LOCUS_13620 178300 177320 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162498650.1 protein_id gnl|my_center|LOCUS_13620 178445 179038 gene locus_tag LOCUS_13630 178445 179038 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707333.1 protein_id gnl|my_center|LOCUS_13630 179124 180230 gene locus_tag LOCUS_13640 179124 180230 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707330.1 protein_id gnl|my_center|LOCUS_13640 180249 181148 gene locus_tag LOCUS_13650 180249 181148 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_13650 182031 181189 gene locus_tag LOCUS_13660 gene rlmJ 182031 181189 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707316.1 protein_id gnl|my_center|LOCUS_13660 182477 182046 gene locus_tag LOCUS_13670 182477 182046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 184372 182474 gene locus_tag LOCUS_13680 184372 182474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707314.1 protein_id gnl|my_center|LOCUS_13680 185092 184403 gene locus_tag LOCUS_13690 185092 184403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819462.1 protein_id gnl|my_center|LOCUS_13690 185152 185352 gene locus_tag LOCUS_13700 185152 185352 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704934.1 protein_id gnl|my_center|LOCUS_13700 185591 186109 gene locus_tag LOCUS_13710 185591 186109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 186397 186182 gene locus_tag LOCUS_13720 186397 186182 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704936.1 protein_id gnl|my_center|LOCUS_13720 187383 186394 gene locus_tag LOCUS_13730 187383 186394 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704937.1 protein_id gnl|my_center|LOCUS_13730 187491 188273 gene locus_tag LOCUS_13740 gene fkpA 187491 188273 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 protein_id gnl|my_center|LOCUS_13740 188603 188304 gene locus_tag LOCUS_13750 188603 188304 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429067.1 protein_id gnl|my_center|LOCUS_13750 188655 189365 gene locus_tag LOCUS_13760 188655 189365 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 protein_id gnl|my_center|LOCUS_13760 189822 189367 gene locus_tag LOCUS_13770 189822 189367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 190063 190548 gene locus_tag LOCUS_13780 gene fxsA 190063 190548 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460455.1 protein_id gnl|my_center|LOCUS_13780 191895 190609 gene locus_tag LOCUS_13790 191895 190609 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_13790 192159 192449 gene locus_tag LOCUS_13800 192159 192449 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309514.1 protein_id gnl|my_center|LOCUS_13800 192485 194122 gene locus_tag LOCUS_13810 gene groL 192485 194122 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729136.1 protein_id gnl|my_center|LOCUS_13810 195173 196849 gene locus_tag LOCUS_13820 gene ltrA 195173 196849 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235893157.1 protein_id gnl|my_center|LOCUS_13820 198140 199675 gene locus_tag LOCUS_13830 gene ltrA 198140 199675 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235893157.1 protein_id gnl|my_center|LOCUS_13830 200018 200515 gene locus_tag LOCUS_13840 200018 200515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349563.1 protein_id gnl|my_center|LOCUS_13840 200512 202443 gene locus_tag LOCUS_13850 200512 202443 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704806.1 protein_id gnl|my_center|LOCUS_13850 202775 202467 gene locus_tag LOCUS_13860 202775 202467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 203804 202785 gene locus_tag LOCUS_13870 gene epmB 203804 202785 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482201.1 protein_id gnl|my_center|LOCUS_13870 203847 204413 gene locus_tag LOCUS_13880 gene efp 203847 204413 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246893.1 protein_id gnl|my_center|LOCUS_13880 205508 204465 gene locus_tag LOCUS_13890 205508 204465 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707000.1 protein_id gnl|my_center|LOCUS_13890 205827 207332 gene locus_tag LOCUS_13900 205827 207332 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075232.1 protein_id gnl|my_center|LOCUS_13900 207425 207823 gene locus_tag LOCUS_13910 207425 207823 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 protein_id gnl|my_center|LOCUS_13910 207852 208850 gene locus_tag LOCUS_13920 gene epmA 207852 208850 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065622721.1 protein_id gnl|my_center|LOCUS_13920 209343 208852 gene locus_tag LOCUS_13930 209343 208852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 210325 209438 gene locus_tag LOCUS_13940 210325 209438 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005498809.1 protein_id gnl|my_center|LOCUS_13940 211722 210322 gene locus_tag LOCUS_13950 211722 210322 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560515.1 protein_id gnl|my_center|LOCUS_13950 215044 211706 gene locus_tag LOCUS_13960 gene mscM 215044 211706 CDS product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706981.1 protein_id gnl|my_center|LOCUS_13960 215945 215085 gene locus_tag LOCUS_13970 gene asd 215945 215085 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818735.1 protein_id gnl|my_center|LOCUS_13970 217049 215976 gene locus_tag LOCUS_13980 gene rsgA 217049 215976 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039215125.1 protein_id gnl|my_center|LOCUS_13980 217098 217643 gene locus_tag LOCUS_13990 gene orn 217098 217643 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707210.1 protein_id gnl|my_center|LOCUS_13990 217874 217949 gene locus_tag LOCUS_t00330 217874 217949 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 218001 218076 gene locus_tag LOCUS_t00340 218001 218076 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 218128 218203 gene locus_tag LOCUS_t00350 218128 218203 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 219396 218269 gene locus_tag LOCUS_14000 gene queG 219396 218269 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819425.1 protein_id gnl|my_center|LOCUS_14000 219395 220903 gene locus_tag LOCUS_14010 219395 220903 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704859.1 protein_id gnl|my_center|LOCUS_14010 220890 221357 gene locus_tag LOCUS_14020 gene tsaE 220890 221357 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457080.1 protein_id gnl|my_center|LOCUS_14020 221354 222670 gene locus_tag LOCUS_14030 221354 222670 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704861.1 protein_id gnl|my_center|LOCUS_14030 222672 224462 gene locus_tag LOCUS_14040 gene mutL 222672 224462 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704862.1 protein_id gnl|my_center|LOCUS_14040 224482 225396 gene locus_tag LOCUS_14050 gene miaA 224482 225396 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704169.1 protein_id gnl|my_center|LOCUS_14050 225433 225699 gene locus_tag LOCUS_14060 gene hfq 225433 225699 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704864.1 protein_id gnl|my_center|LOCUS_14060 225772 227058 gene locus_tag LOCUS_14070 gene hflX 225772 227058 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704865.1 protein_id gnl|my_center|LOCUS_14070 227195 228274 gene locus_tag LOCUS_14080 gene hflK 227195 228274 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704866.1 protein_id gnl|my_center|LOCUS_14080 228278 229165 gene locus_tag LOCUS_14090 gene hflC 228278 229165 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704867.1 protein_id gnl|my_center|LOCUS_14090 229294 230592 gene locus_tag LOCUS_14100 229294 230592 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527932.1 protein_id gnl|my_center|LOCUS_14100 231662 230688 gene locus_tag LOCUS_14110 gene ispB 231662 230688 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_14110 231897 232208 gene locus_tag LOCUS_14120 gene rplU 231897 232208 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271393.1 protein_id gnl|my_center|LOCUS_14120 232226 232483 gene locus_tag LOCUS_14130 gene rpmA 232226 232483 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004385076.1 protein_id gnl|my_center|LOCUS_14130 232602 233768 gene locus_tag LOCUS_14140 gene cgtA 232602 233768 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704870.1 protein_id gnl|my_center|LOCUS_14140 233772 234272 gene locus_tag LOCUS_14150 gene folA 233772 234272 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973535.1 protein_id gnl|my_center|LOCUS_14150 235078 234260 gene locus_tag LOCUS_14160 235078 234260 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704877.1 protein_id gnl|my_center|LOCUS_14160 235452 235078 gene locus_tag LOCUS_14170 gene apaG 235452 235078 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383338.1 protein_id gnl|my_center|LOCUS_14170 236261 235452 gene locus_tag LOCUS_14180 gene rsmA 236261 235452 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349619.1 protein_id gnl|my_center|LOCUS_14180 237243 236254 gene locus_tag LOCUS_14190 gene pdxA 237243 236254 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704880.1 protein_id gnl|my_center|LOCUS_14190 238556 237240 gene locus_tag LOCUS_14200 gene surA 238556 237240 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704881.1 protein_id gnl|my_center|LOCUS_14200 240920 238581 gene locus_tag LOCUS_14210 gene lptD 240920 238581 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704882.1 protein_id gnl|my_center|LOCUS_14210 241189 241995 gene locus_tag LOCUS_14220 gene djlA 241189 241995 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704885.1 protein_id gnl|my_center|LOCUS_14220 242987 242037 gene locus_tag LOCUS_14230 242987 242037 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707005.1 protein_id gnl|my_center|LOCUS_14230 243732 242941 gene locus_tag LOCUS_14240 243732 242941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 244400 243729 gene locus_tag LOCUS_14250 gene rluA 244400 243729 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704807.1 protein_id gnl|my_center|LOCUS_14250 247288 244415 gene locus_tag LOCUS_14260 gene rapA 247288 244415 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704808.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence13 648 238 gene locus_tag LOCUS_14270 648 238 CDS product LPP20 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073139.1 protein_id gnl|my_center|LOCUS_14270 1363 638 gene locus_tag LOCUS_14280 1363 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1547 2686 gene locus_tag LOCUS_14290 1547 2686 CDS product flagellar assembly protein FlgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705016.1 protein_id gnl|my_center|LOCUS_14290 2767 2842 gene locus_tag LOCUS_t00360 2767 2842 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2924 3754 gene locus_tag LOCUS_14300 2924 3754 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704980.1 protein_id gnl|my_center|LOCUS_14300 4096 3758 gene locus_tag LOCUS_14310 4096 3758 CDS product DUF1904 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483015.1 protein_id gnl|my_center|LOCUS_14310 4173 5030 gene locus_tag LOCUS_14320 4173 5030 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704979.1 protein_id gnl|my_center|LOCUS_14320 5100 5240 gene locus_tag LOCUS_14330 5100 5240 CDS product DUF3149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064773827.1 protein_id gnl|my_center|LOCUS_14330 5476 6951 gene locus_tag LOCUS_14340 5476 6951 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819484.1 protein_id gnl|my_center|LOCUS_14340 7017 7394 gene locus_tag LOCUS_14350 7017 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 7499 8581 gene locus_tag LOCUS_14360 7499 8581 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704969.1 protein_id gnl|my_center|LOCUS_14360 9118 8642 gene locus_tag LOCUS_14370 9118 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 9242 9326 gene locus_tag LOCUS_t00370 9242 9326 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 9382 9466 gene locus_tag LOCUS_t00380 9382 9466 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 12752 9660 gene locus_tag LOCUS_14380 gene vmeF 12752 9660 CDS product multidrug efflux RND transporter permease subunit VmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481813.1 protein_id gnl|my_center|LOCUS_14380 13761 12739 gene locus_tag LOCUS_14390 13761 12739 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017408534.1 protein_id gnl|my_center|LOCUS_14390 13950 14711 gene locus_tag LOCUS_14400 13950 14711 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103539.1 protein_id gnl|my_center|LOCUS_14400 14760 15569 gene locus_tag LOCUS_14410 gene xthA 14760 15569 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706756.1 protein_id gnl|my_center|LOCUS_14410 16497 15805 gene locus_tag LOCUS_14420 16497 15805 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705577.1 protein_id gnl|my_center|LOCUS_14420 17241 16501 gene locus_tag LOCUS_14430 17241 16501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705576.1 protein_id gnl|my_center|LOCUS_14430 18066 17290 gene locus_tag LOCUS_14440 18066 17290 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419848.1 protein_id gnl|my_center|LOCUS_14440 18878 18111 gene locus_tag LOCUS_14450 18878 18111 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705574.1 protein_id gnl|my_center|LOCUS_14450 19341 20249 gene locus_tag LOCUS_14460 19341 20249 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705573.1 protein_id gnl|my_center|LOCUS_14460 20681 22588 gene locus_tag LOCUS_14470 20681 22588 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480508.1 protein_id gnl|my_center|LOCUS_14470 22864 24015 gene locus_tag LOCUS_14480 22864 24015 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480503.1 protein_id gnl|my_center|LOCUS_14480 24055 24594 gene locus_tag LOCUS_14490 24055 24594 CDS product MltR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468084.1 protein_id gnl|my_center|LOCUS_14490 24707 25810 gene locus_tag LOCUS_14500 gene asd 24707 25810 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705815.1 protein_id gnl|my_center|LOCUS_14500 26075 26623 gene locus_tag LOCUS_14510 gene cetB 26075 26623 CDS product bipartate energy taxis response protein CetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002777340.1 protein_id gnl|my_center|LOCUS_14510 26613 28064 gene locus_tag LOCUS_14520 26613 28064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 28114 29895 gene locus_tag LOCUS_14530 28114 29895 CDS product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705813.1 protein_id gnl|my_center|LOCUS_14530 30901 30173 gene locus_tag LOCUS_14540 30901 30173 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390181.1 protein_id gnl|my_center|LOCUS_14540 31596 30970 gene locus_tag LOCUS_14550 31596 30970 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705578.1 protein_id gnl|my_center|LOCUS_14550 31873 32820 gene locus_tag LOCUS_14560 31873 32820 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 protein_id gnl|my_center|LOCUS_14560 32955 34967 gene locus_tag LOCUS_14570 32955 34967 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070809.1 protein_id gnl|my_center|LOCUS_14570 34967 35341 gene locus_tag LOCUS_14580 34967 35341 CDS product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528643.1 protein_id gnl|my_center|LOCUS_14580 35476 37107 gene locus_tag LOCUS_14590 35476 37107 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204799.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14590 37088 38413 gene locus_tag LOCUS_14600 37088 38413 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060859.1 protein_id gnl|my_center|LOCUS_14600 38934 38389 gene locus_tag LOCUS_14610 gene nsrR 38934 38389 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_14610 39074 40585 gene locus_tag LOCUS_14620 39074 40585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 41307 40564 gene locus_tag LOCUS_14630 41307 40564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 41666 42304 gene locus_tag LOCUS_14640 41666 42304 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705131.1 protein_id gnl|my_center|LOCUS_14640 45807 42349 gene locus_tag LOCUS_14650 45807 42349 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704911.1 protein_id gnl|my_center|LOCUS_14650 46952 45807 gene locus_tag LOCUS_14660 46952 45807 CDS product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704908.1 protein_id gnl|my_center|LOCUS_14660 47039 47938 gene locus_tag LOCUS_14670 47039 47938 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711605.1 protein_id gnl|my_center|LOCUS_14670 50114 47970 gene locus_tag LOCUS_14680 50114 47970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 51034 50111 gene locus_tag LOCUS_14690 51034 50111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 52220 51027 gene locus_tag LOCUS_14700 52220 51027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 52596 53327 gene locus_tag LOCUS_14710 52596 53327 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139219.1 protein_id gnl|my_center|LOCUS_14710 54266 53370 gene locus_tag LOCUS_14720 54266 53370 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243788.1 protein_id gnl|my_center|LOCUS_14720 54376 55434 gene locus_tag LOCUS_14730 54376 55434 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723651.1 protein_id gnl|my_center|LOCUS_14730 55484 56563 gene locus_tag LOCUS_14740 55484 56563 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928297.1 protein_id gnl|my_center|LOCUS_14740 56597 58552 gene locus_tag LOCUS_14750 56597 58552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence14 975 196 gene locus_tag LOCUS_14760 975 196 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706235.1 protein_id gnl|my_center|LOCUS_14760 1164 1778 gene locus_tag LOCUS_14770 gene msrA 1164 1778 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_14770 1781 2251 gene locus_tag LOCUS_14780 gene msrB 1781 2251 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038734.1 protein_id gnl|my_center|LOCUS_14780 2261 4369 gene locus_tag LOCUS_14790 2261 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 5936 4470 gene locus_tag LOCUS_14800 5936 4470 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_14800 6076 7182 gene locus_tag LOCUS_14810 6076 7182 CDS product GNAT family N-acetyltransferase/peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 protein_id gnl|my_center|LOCUS_14810 7383 7811 gene locus_tag LOCUS_14820 7383 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 8284 7988 gene locus_tag LOCUS_14830 8284 7988 CDS product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705767.1 protein_id gnl|my_center|LOCUS_14830 9409 8285 gene locus_tag LOCUS_14840 9409 8285 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_14840 9949 9425 gene locus_tag LOCUS_14850 9949 9425 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365544.1 protein_id gnl|my_center|LOCUS_14850 11170 10088 gene locus_tag LOCUS_14860 gene aroC 11170 10088 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706197.1 protein_id gnl|my_center|LOCUS_14860 12113 11193 gene locus_tag LOCUS_14870 gene prmB 12113 11193 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706198.1 protein_id gnl|my_center|LOCUS_14870 12164 12688 gene locus_tag LOCUS_14880 gene smrB 12164 12688 CDS product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171938.1 protein_id gnl|my_center|LOCUS_14880 12989 12780 gene locus_tag LOCUS_14890 12989 12780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 13433 13020 gene locus_tag LOCUS_14900 gene sixA 13433 13020 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072979.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14900 14373 14173 gene locus_tag LOCUS_14910 14373 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 14559 15551 gene locus_tag LOCUS_14920 14559 15551 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114439.1 protein_id gnl|my_center|LOCUS_14920 15593 16036 gene locus_tag LOCUS_14930 gene uspA 15593 16036 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121736.1 protein_id gnl|my_center|LOCUS_14930 16758 16033 gene locus_tag LOCUS_14940 gene nfsA 16758 16033 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705684.1 protein_id gnl|my_center|LOCUS_14940 16816 17493 gene locus_tag LOCUS_14950 16816 17493 CDS product DUF2982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705682.1 protein_id gnl|my_center|LOCUS_14950 17697 18626 gene locus_tag LOCUS_14960 17697 18626 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705681.1 protein_id gnl|my_center|LOCUS_14960 20454 18784 gene locus_tag LOCUS_14970 20454 18784 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705768.1 protein_id gnl|my_center|LOCUS_14970 22271 20634 gene locus_tag LOCUS_14980 22271 20634 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104682.1 protein_id gnl|my_center|LOCUS_14980 22632 22545 gene locus_tag LOCUS_t00390 22632 22545 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23025 23699 gene locus_tag LOCUS_14990 gene rnt 23025 23699 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300258.1 protein_id gnl|my_center|LOCUS_14990 25782 23734 gene locus_tag LOCUS_15000 25782 23734 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817980.1 protein_id gnl|my_center|LOCUS_15000 26695 26030 gene locus_tag LOCUS_15010 26695 26030 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_15010 28228 26753 gene locus_tag LOCUS_15020 gene modF 28228 26753 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097518.1 protein_id gnl|my_center|LOCUS_15020 28402 28647 gene locus_tag LOCUS_15030 28402 28647 CDS product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096418.1 protein_id gnl|my_center|LOCUS_15030 29352 28747 gene locus_tag LOCUS_15040 29352 28747 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705411.1 protein_id gnl|my_center|LOCUS_15040 29650 30972 gene locus_tag LOCUS_15050 29650 30972 CDS product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706460.1 protein_id gnl|my_center|LOCUS_15050 31098 32033 gene locus_tag LOCUS_15060 gene focA 31098 32033 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211331.1 protein_id gnl|my_center|LOCUS_15060 32856 31915 gene locus_tag LOCUS_15070 32856 31915 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819969.1 protein_id gnl|my_center|LOCUS_15070 33160 34050 gene locus_tag LOCUS_15080 gene aguB 33160 34050 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209979.1 protein_id gnl|my_center|LOCUS_15080 34050 35120 gene locus_tag LOCUS_15090 gene aguA 34050 35120 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704695.1 protein_id gnl|my_center|LOCUS_15090 35440 35252 gene locus_tag LOCUS_15100 35440 35252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 35605 35453 gene locus_tag LOCUS_15110 35605 35453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 35702 37612 gene locus_tag LOCUS_15120 35702 37612 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265858.1 protein_id gnl|my_center|LOCUS_15120 37968 37714 gene locus_tag LOCUS_15130 37968 37714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 37873 38568 gene locus_tag LOCUS_15140 gene rsbQ 37873 38568 CDS product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 protein_id gnl|my_center|LOCUS_15140 38854 38531 gene locus_tag LOCUS_15150 38854 38531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 38831 39529 gene locus_tag LOCUS_15160 38831 39529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 40125 39535 gene locus_tag LOCUS_15170 40125 39535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 40302 41351 gene locus_tag LOCUS_15180 40302 41351 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930118.1 protein_id gnl|my_center|LOCUS_15180 42937 41696 gene locus_tag LOCUS_15190 gene codA 42937 41696 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195011.1 protein_id gnl|my_center|LOCUS_15190 43496 43017 gene locus_tag LOCUS_15200 43496 43017 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391513.1 protein_id gnl|my_center|LOCUS_15200 44118 43504 gene locus_tag LOCUS_15210 44118 43504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 44523 44122 gene locus_tag LOCUS_15220 44523 44122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941821.1 protein_id gnl|my_center|LOCUS_15220 45549 44602 gene locus_tag LOCUS_15230 45549 44602 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 protein_id gnl|my_center|LOCUS_15230 46191 45847 gene locus_tag LOCUS_15240 46191 45847 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090818.1 protein_id gnl|my_center|LOCUS_15240 47115 46249 gene locus_tag LOCUS_15250 gene purU 47115 46249 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763680.1 protein_id gnl|my_center|LOCUS_15250 47133 47384 gene locus_tag LOCUS_15260 47133 47384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 48003 47374 gene locus_tag LOCUS_15270 gene soxG 48003 47374 CDS product sarcosine oxidase subunit gamma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103144.1 protein_id gnl|my_center|LOCUS_15270 51025 47996 gene locus_tag LOCUS_15280 51025 47996 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142077.1 protein_id gnl|my_center|LOCUS_15280 51300 51022 gene locus_tag LOCUS_15290 51300 51022 CDS product sarcosine oxidase subunit delta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096781.1 protein_id gnl|my_center|LOCUS_15290 52565 51312 gene locus_tag LOCUS_15300 52565 51312 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148382.1 protein_id gnl|my_center|LOCUS_15300 54007 52754 gene locus_tag LOCUS_15310 54007 52754 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269187.1 protein_id gnl|my_center|LOCUS_15310 54633 55679 gene locus_tag LOCUS_15320 54633 55679 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121890.1 protein_id gnl|my_center|LOCUS_15320 56118 55768 gene locus_tag LOCUS_15330 56118 55768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 57431 56115 gene locus_tag LOCUS_15340 57431 56115 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 protein_id gnl|my_center|LOCUS_15340 58815 57442 gene locus_tag LOCUS_15350 gene alkT 58815 57442 CDS product rubredoxin-NAD(+) reductase AlkT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114369.1 protein_id gnl|my_center|LOCUS_15350 60271 58844 gene locus_tag LOCUS_15360 60271 58844 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533461.1 protein_id gnl|my_center|LOCUS_15360 61461 60274 gene locus_tag LOCUS_15370 61461 60274 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_15370 61779 63467 gene locus_tag LOCUS_15380 61779 63467 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_15380 64823 63897 gene locus_tag LOCUS_15390 64823 63897 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267751.1 protein_id gnl|my_center|LOCUS_15390 65074 64928 gene locus_tag LOCUS_15400 65074 64928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 65284 65150 gene locus_tag LOCUS_15410 65284 65150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 66509 65361 gene locus_tag LOCUS_15420 66509 65361 CDS product cyanate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064385.1 protein_id gnl|my_center|LOCUS_15420 67270 66596 gene locus_tag LOCUS_15430 67270 66596 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311533.1 protein_id gnl|my_center|LOCUS_15430 67384 68262 gene locus_tag LOCUS_15440 67384 68262 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112482.1 protein_id gnl|my_center|LOCUS_15440 69685 68333 gene locus_tag LOCUS_15450 gene vcrM 69685 68333 CDS product sodium-coupled multidrug efflux MATE transporter VcrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981941.1 protein_id gnl|my_center|LOCUS_15450 70163 69690 gene locus_tag LOCUS_15460 70163 69690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 70406 71539 gene locus_tag LOCUS_15470 70406 71539 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527856.1 protein_id gnl|my_center|LOCUS_15470 71529 72590 gene locus_tag LOCUS_15480 71529 72590 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976079.1 protein_id gnl|my_center|LOCUS_15480 72584 73369 gene locus_tag LOCUS_15490 72584 73369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976078.1 protein_id gnl|my_center|LOCUS_15490 73601 74899 gene locus_tag LOCUS_15500 73601 74899 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404402.1 protein_id gnl|my_center|LOCUS_15500 74937 75080 gene locus_tag LOCUS_15510 74937 75080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 75486 76343 gene locus_tag LOCUS_15520 75486 76343 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 protein_id gnl|my_center|LOCUS_15520 76506 77861 gene locus_tag LOCUS_15530 76506 77861 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072757.1 protein_id gnl|my_center|LOCUS_15530 78268 78080 gene locus_tag LOCUS_15540 78268 78080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 79159 78371 gene locus_tag LOCUS_15550 79159 78371 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419848.1 protein_id gnl|my_center|LOCUS_15550 81143 79683 gene locus_tag LOCUS_15560 gene putP 81143 79683 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 protein_id gnl|my_center|LOCUS_15560 81298 81179 gene locus_tag LOCUS_15570 81298 81179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 82102 81812 gene locus_tag LOCUS_15580 82102 81812 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_15580 84388 82973 gene locus_tag LOCUS_15590 gene asnS 84388 82973 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705384.1 protein_id gnl|my_center|LOCUS_15590 85212 84448 gene locus_tag LOCUS_15600 85212 84448 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 protein_id gnl|my_center|LOCUS_15600 86824 85217 gene locus_tag LOCUS_15610 86824 85217 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_15610 88280 87069 gene locus_tag LOCUS_15620 88280 87069 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 protein_id gnl|my_center|LOCUS_15620 89254 91020 gene locus_tag LOCUS_15630 89254 91020 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249724.1 protein_id gnl|my_center|LOCUS_15630 91159 91437 gene locus_tag LOCUS_15640 91159 91437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 92049 93326 gene locus_tag LOCUS_15650 92049 93326 CDS product reverse transcriptase/maturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459234.1 protein_id gnl|my_center|LOCUS_15650 93424 94293 gene locus_tag LOCUS_15660 93424 94293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 95350 94568 gene locus_tag LOCUS_15670 95350 94568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114449.1 protein_id gnl|my_center|LOCUS_15670 96557 95340 gene locus_tag LOCUS_15680 96557 95340 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269226.1 protein_id gnl|my_center|LOCUS_15680 98496 96550 gene locus_tag LOCUS_15690 gene dgcB 98496 96550 CDS product dimethylglycine demethylation protein DgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114447.1 protein_id gnl|my_center|LOCUS_15690 100604 98541 gene locus_tag LOCUS_15700 gene dgcA 100604 98541 CDS product dimethylglycine demethylation protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114446.1 protein_id gnl|my_center|LOCUS_15700 101310 100780 gene locus_tag LOCUS_15710 101310 100780 CDS product DUF5943 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107282.1 protein_id gnl|my_center|LOCUS_15710 102324 101344 gene locus_tag LOCUS_15720 102324 101344 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114445.1 protein_id gnl|my_center|LOCUS_15720 103447 102968 gene locus_tag LOCUS_15730 103447 102968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 104857 103805 gene locus_tag LOCUS_15740 104857 103805 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096699.1 protein_id gnl|my_center|LOCUS_15740 106874 105339 gene locus_tag LOCUS_15750 106874 105339 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_15750 107247 107486 gene locus_tag LOCUS_15760 107247 107486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 107649 107861 gene locus_tag LOCUS_15770 107649 107861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 108027 108437 gene locus_tag LOCUS_15780 108027 108437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 109438 108422 gene locus_tag LOCUS_15790 109438 108422 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706775.1 protein_id gnl|my_center|LOCUS_15790 113192 109575 gene locus_tag LOCUS_15800 gene putA 113192 109575 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531234.1 protein_id gnl|my_center|LOCUS_15800 113450 113902 gene locus_tag LOCUS_15810 113450 113902 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531233.1 protein_id gnl|my_center|LOCUS_15810 115019 114072 gene locus_tag LOCUS_15820 115019 114072 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533150.1 protein_id gnl|my_center|LOCUS_15820 115279 118542 gene locus_tag LOCUS_15830 115279 118542 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224019328.1 protein_id gnl|my_center|LOCUS_15830 118560 119486 gene locus_tag LOCUS_15840 118560 119486 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930394.1 protein_id gnl|my_center|LOCUS_15840 119508 120854 gene locus_tag LOCUS_15850 119508 120854 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_15850 <122100 120935 gene locus_tag LOCUS_15860 <122100 120935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096552.1:sucrose-6-phosphate hydrolase >Feature sequence15 642 1319 gene locus_tag LOCUS_15870 642 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 3979 1649 gene locus_tag LOCUS_15880 3979 1649 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819165.1 protein_id gnl|my_center|LOCUS_15880 5146 4235 gene locus_tag LOCUS_15890 5146 4235 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_15890 5529 6731 gene locus_tag LOCUS_15900 5529 6731 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_15900 6812 7852 gene locus_tag LOCUS_15910 6812 7852 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402005.1 protein_id gnl|my_center|LOCUS_15910 7938 9365 gene locus_tag LOCUS_15920 7938 9365 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081157730.1 protein_id gnl|my_center|LOCUS_15920 9457 11091 gene locus_tag LOCUS_15930 9457 11091 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462305.1 protein_id gnl|my_center|LOCUS_15930 11692 11210 gene locus_tag LOCUS_15940 gene greB 11692 11210 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074226.1 protein_id gnl|my_center|LOCUS_15940 12483 12055 gene locus_tag LOCUS_15950 12483 12055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 14416 13217 gene locus_tag LOCUS_15960 gene zigA 14416 13217 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099674.1 protein_id gnl|my_center|LOCUS_15960 14514 15140 gene locus_tag LOCUS_15970 14514 15140 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269410.1 protein_id gnl|my_center|LOCUS_15970 15358 17523 gene locus_tag LOCUS_15980 15358 17523 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060825866.1 protein_id gnl|my_center|LOCUS_15980 17770 17525 gene locus_tag LOCUS_15990 17770 17525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 18272 17787 gene locus_tag LOCUS_16000 18272 17787 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_16000 22213 18626 gene locus_tag LOCUS_16010 22213 18626 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344102.1 protein_id gnl|my_center|LOCUS_16010 24078 22465 gene locus_tag LOCUS_16020 gene pckA 24078 22465 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265681.1 protein_id gnl|my_center|LOCUS_16020 25120 24251 gene locus_tag LOCUS_16030 gene hslO 25120 24251 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943636.1 protein_id gnl|my_center|LOCUS_16030 25533 25141 gene locus_tag LOCUS_16040 gene hslR 25533 25141 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819274.1 protein_id gnl|my_center|LOCUS_16040 25697 26254 gene locus_tag LOCUS_16050 gene nudE 25697 26254 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017765235.1 protein_id gnl|my_center|LOCUS_16050 26257 27078 gene locus_tag LOCUS_16060 gene cysQ 26257 27078 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704554.1 protein_id gnl|my_center|LOCUS_16060 27423 27094 gene locus_tag LOCUS_16070 gene metJ 27423 27094 CDS product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308521.1 protein_id gnl|my_center|LOCUS_16070 27604 28764 gene locus_tag LOCUS_16080 gene metB 27604 28764 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704557.1 protein_id gnl|my_center|LOCUS_16080 28765 31197 gene locus_tag LOCUS_16090 28765 31197 CDS product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704558.1 protein_id gnl|my_center|LOCUS_16090 32867 31383 gene locus_tag LOCUS_16100 32867 31383 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112672.1 protein_id gnl|my_center|LOCUS_16100 33981 33034 gene locus_tag LOCUS_16110 33981 33034 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530452.1 protein_id gnl|my_center|LOCUS_16110 35576 34182 gene locus_tag LOCUS_16120 35576 34182 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114627.1 protein_id gnl|my_center|LOCUS_16120 37380 35956 gene locus_tag LOCUS_16130 37380 35956 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084045.1 protein_id gnl|my_center|LOCUS_16130 38649 37474 gene locus_tag LOCUS_16140 gene argE 38649 37474 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106035.1 protein_id gnl|my_center|LOCUS_16140 39259 38783 gene locus_tag LOCUS_16150 39259 38783 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 protein_id gnl|my_center|LOCUS_16150 40556 39270 gene locus_tag LOCUS_16160 40556 39270 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461221.1 protein_id gnl|my_center|LOCUS_16160 41141 40584 gene locus_tag LOCUS_16170 41141 40584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 42232 41204 gene locus_tag LOCUS_16180 42232 41204 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391960.1 protein_id gnl|my_center|LOCUS_16180 43011 42340 gene locus_tag LOCUS_16190 43011 42340 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815682.1 protein_id gnl|my_center|LOCUS_16190 43441 43022 gene locus_tag LOCUS_16200 43441 43022 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369686.1 protein_id gnl|my_center|LOCUS_16200 44835 43519 gene locus_tag LOCUS_16210 44835 43519 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114443.1 protein_id gnl|my_center|LOCUS_16210 45267 46166 gene locus_tag LOCUS_16220 45267 46166 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847999.1 protein_id gnl|my_center|LOCUS_16220 46167 47432 gene locus_tag LOCUS_16230 46167 47432 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704988.1 protein_id gnl|my_center|LOCUS_16230 47425 48066 gene locus_tag LOCUS_16240 47425 48066 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170138703.1 protein_id gnl|my_center|LOCUS_16240 48077 48862 gene locus_tag LOCUS_16250 48077 48862 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704986.1 protein_id gnl|my_center|LOCUS_16250 48866 49630 gene locus_tag LOCUS_16260 48866 49630 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208861.1 protein_id gnl|my_center|LOCUS_16260 49707 50666 gene locus_tag LOCUS_16270 49707 50666 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704985.1 protein_id gnl|my_center|LOCUS_16270 50666 52057 gene locus_tag LOCUS_16280 50666 52057 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704984.1 protein_id gnl|my_center|LOCUS_16280 52637 52191 gene locus_tag LOCUS_16290 52637 52191 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171431.1 protein_id gnl|my_center|LOCUS_16290 53146 52742 gene locus_tag LOCUS_16300 53146 52742 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921211.1 protein_id gnl|my_center|LOCUS_16300 53478 53158 gene locus_tag LOCUS_16310 53478 53158 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512149.1 protein_id gnl|my_center|LOCUS_16310 53982 53521 gene locus_tag LOCUS_16320 gene ybaK 53982 53521 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707484.1 protein_id gnl|my_center|LOCUS_16320 56701 54080 gene locus_tag LOCUS_16330 gene ppc 56701 54080 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308531.1 protein_id gnl|my_center|LOCUS_16330 57965 56814 gene locus_tag LOCUS_16340 gene argE 57965 56814 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704559.1 protein_id gnl|my_center|LOCUS_16340 58217 59230 gene locus_tag LOCUS_16350 gene argC 58217 59230 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704560.1 protein_id gnl|my_center|LOCUS_16350 59237 60022 gene locus_tag LOCUS_16360 gene argB 59237 60022 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704561.1 protein_id gnl|my_center|LOCUS_16360 60032 60949 gene locus_tag LOCUS_16370 60032 60949 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819287.1 protein_id gnl|my_center|LOCUS_16370 60949 62160 gene locus_tag LOCUS_16380 60949 62160 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704563.1 protein_id gnl|my_center|LOCUS_16380 62530 64410 gene locus_tag LOCUS_16390 gene argH 62530 64410 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465154.1 protein_id gnl|my_center|LOCUS_16390 64626 64937 gene locus_tag LOCUS_16400 gene rpsJ 64626 64937 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 protein_id gnl|my_center|LOCUS_16400 64959 65597 gene locus_tag LOCUS_16410 gene rplC 64959 65597 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070617.1 protein_id gnl|my_center|LOCUS_16410 65615 66220 gene locus_tag LOCUS_16420 gene rplD 65615 66220 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005340616.1 protein_id gnl|my_center|LOCUS_16420 66217 66519 gene locus_tag LOCUS_16430 gene rplW 66217 66519 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307955.1 protein_id gnl|my_center|LOCUS_16430 66537 67361 gene locus_tag LOCUS_16440 gene rplB 66537 67361 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417230.1 protein_id gnl|my_center|LOCUS_16440 67383 67661 gene locus_tag LOCUS_16450 gene rpsS 67383 67661 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307960.1 protein_id gnl|my_center|LOCUS_16450 67672 68004 gene locus_tag LOCUS_16460 gene rplV 67672 68004 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704314.1 protein_id gnl|my_center|LOCUS_16460 68023 68718 gene locus_tag LOCUS_16470 gene rpsC 68023 68718 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331168.1 protein_id gnl|my_center|LOCUS_16470 68731 69144 gene locus_tag LOCUS_16480 gene rplP 68731 69144 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307963.1 protein_id gnl|my_center|LOCUS_16480 69144 69335 gene locus_tag LOCUS_16490 gene rpmC 69144 69335 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307965.1 protein_id gnl|my_center|LOCUS_16490 69337 69597 gene locus_tag LOCUS_16500 gene rpsQ 69337 69597 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 protein_id gnl|my_center|LOCUS_16500 69755 70123 gene locus_tag LOCUS_16510 gene rplN 69755 70123 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 protein_id gnl|my_center|LOCUS_16510 70134 70451 gene locus_tag LOCUS_16520 gene rplX 70134 70451 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307977.1 protein_id gnl|my_center|LOCUS_16520 70466 71005 gene locus_tag LOCUS_16530 gene rplE 70466 71005 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331162.1 protein_id gnl|my_center|LOCUS_16530 71017 71322 gene locus_tag LOCUS_16540 gene rpsN 71017 71322 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118930.1 protein_id gnl|my_center|LOCUS_16540 71345 71737 gene locus_tag LOCUS_16550 gene rpsH 71345 71737 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099025.1 protein_id gnl|my_center|LOCUS_16550 71748 72281 gene locus_tag LOCUS_16560 gene rplF 71748 72281 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307981.1 protein_id gnl|my_center|LOCUS_16560 72291 72644 gene locus_tag LOCUS_16570 gene rplR 72291 72644 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358092.1 protein_id gnl|my_center|LOCUS_16570 72659 73159 gene locus_tag LOCUS_16580 gene rpsE 72659 73159 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940115.1 protein_id gnl|my_center|LOCUS_16580 73166 73348 gene locus_tag LOCUS_16590 gene rpmD 73166 73348 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307985.1 protein_id gnl|my_center|LOCUS_16590 73353 73787 gene locus_tag LOCUS_16600 gene rplO 73353 73787 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417259.1 protein_id gnl|my_center|LOCUS_16600 73796 75127 gene locus_tag LOCUS_16610 gene secY 73796 75127 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010672567.1 protein_id gnl|my_center|LOCUS_16610 75408 75764 gene locus_tag LOCUS_16620 gene rpsM 75408 75764 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307991.1 protein_id gnl|my_center|LOCUS_16620 75779 76171 gene locus_tag LOCUS_16630 gene rpsK 75779 76171 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005319702.1 protein_id gnl|my_center|LOCUS_16630 76202 76822 gene locus_tag LOCUS_16640 gene rpsD 76202 76822 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704319.1 protein_id gnl|my_center|LOCUS_16640 76847 77836 gene locus_tag LOCUS_16650 gene rpoA 76847 77836 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307997.1 protein_id gnl|my_center|LOCUS_16650 77881 78273 gene locus_tag LOCUS_16660 gene rplQ 77881 78273 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644470.1 protein_id gnl|my_center|LOCUS_16660 78440 80605 gene locus_tag LOCUS_16670 78440 80605 CDS product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345196.1 protein_id gnl|my_center|LOCUS_16670 80592 82469 gene locus_tag LOCUS_16680 gene nosZ 80592 82469 CDS product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098686.1 protein_id gnl|my_center|LOCUS_16680 82499 83764 gene locus_tag LOCUS_16690 82499 83764 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113112.1 protein_id gnl|my_center|LOCUS_16690 83733 84659 gene locus_tag LOCUS_16700 83733 84659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113111.1 protein_id gnl|my_center|LOCUS_16700 84631 85467 gene locus_tag LOCUS_16710 84631 85467 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113110.1 protein_id gnl|my_center|LOCUS_16710 85471 85971 gene locus_tag LOCUS_16720 85471 85971 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113109.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence16 338 2062 gene locus_tag LOCUS_16730 338 2062 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940398.1 protein_id gnl|my_center|LOCUS_16730 2062 2859 gene locus_tag LOCUS_16740 2062 2859 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930466.1 protein_id gnl|my_center|LOCUS_16740 2856 3530 gene locus_tag LOCUS_16750 2856 3530 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590258.1 protein_id gnl|my_center|LOCUS_16750 3873 4955 gene locus_tag LOCUS_16760 3873 4955 CDS product capsule polysaccharide export inner-membrane protein KpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905920.1 protein_id gnl|my_center|LOCUS_16760 4969 5883 gene locus_tag LOCUS_16770 gene galU 4969 5883 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818749.1 protein_id gnl|my_center|LOCUS_16770 6024 8018 gene locus_tag LOCUS_16780 6024 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 8039 8347 gene locus_tag LOCUS_16790 8039 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 8364 9476 gene locus_tag LOCUS_16800 gene vpsA 8364 9476 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) VpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756756.1 protein_id gnl|my_center|LOCUS_16800 9653 10933 gene locus_tag LOCUS_16810 gene wecC 9653 10933 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211985.1 protein_id gnl|my_center|LOCUS_16810 11288 11130 gene locus_tag LOCUS_16820 11288 11130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 11832 14222 gene locus_tag LOCUS_16830 11832 14222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 14246 15751 gene locus_tag LOCUS_16840 14246 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 15748 16935 gene locus_tag LOCUS_16850 15748 16935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 17190 17738 gene locus_tag LOCUS_16860 17190 17738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 17725 20259 gene locus_tag LOCUS_16870 17725 20259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 20529 21851 gene locus_tag LOCUS_16880 gene glmM 20529 21851 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_16880 21931 24009 gene locus_tag LOCUS_16890 21931 24009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 24006 25031 gene locus_tag LOCUS_16900 24006 25031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 25034 26065 gene locus_tag LOCUS_16910 25034 26065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 26081 26641 gene locus_tag LOCUS_16920 26081 26641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 26723 29176 gene locus_tag LOCUS_16930 26723 29176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 29607 30017 gene locus_tag LOCUS_16940 29607 30017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 30155 31213 gene locus_tag LOCUS_16950 30155 31213 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_16950 31603 33498 gene locus_tag LOCUS_16960 31603 33498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 33498 36338 gene locus_tag LOCUS_16970 33498 36338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 36349 37827 gene locus_tag LOCUS_16980 36349 37827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 37837 39924 gene locus_tag LOCUS_16990 37837 39924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 39990 40853 gene locus_tag LOCUS_17000 39990 40853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 41143 41538 gene locus_tag LOCUS_17010 41143 41538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17010 41535 41954 gene locus_tag LOCUS_17020 41535 41954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17020 42460 42140 gene locus_tag LOCUS_17030 42460 42140 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172486.1 protein_id gnl|my_center|LOCUS_17030 43815 42460 gene locus_tag LOCUS_17040 43815 42460 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626009.1 protein_id gnl|my_center|LOCUS_17040 45883 44204 gene locus_tag LOCUS_17050 45883 44204 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044710.1 protein_id gnl|my_center|LOCUS_17050 47768 46098 gene locus_tag LOCUS_17060 47768 46098 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263560.1 protein_id gnl|my_center|LOCUS_17060 48911 47799 gene locus_tag LOCUS_17070 gene ugpC 48911 47799 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313062.1 protein_id gnl|my_center|LOCUS_17070 50503 49142 gene locus_tag LOCUS_17080 50503 49142 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_17080 51386 50541 gene locus_tag LOCUS_17090 51386 50541 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975209.1 protein_id gnl|my_center|LOCUS_17090 52384 51383 gene locus_tag LOCUS_17100 52384 51383 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769959.1 protein_id gnl|my_center|LOCUS_17100 53711 52446 gene locus_tag LOCUS_17110 53711 52446 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173996.1 protein_id gnl|my_center|LOCUS_17110 54032 55015 gene locus_tag LOCUS_17120 54032 55015 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262519.1 protein_id gnl|my_center|LOCUS_17120 55529 55251 gene locus_tag LOCUS_17130 55529 55251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 56630 55650 gene locus_tag LOCUS_17140 56630 55650 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_17140 58087 56633 gene locus_tag LOCUS_17150 58087 56633 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 protein_id gnl|my_center|LOCUS_17150 58727 62059 gene locus_tag LOCUS_17160 58727 62059 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105234.1 protein_id gnl|my_center|LOCUS_17160 62129 64738 gene locus_tag LOCUS_17170 62129 64738 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266502.1 protein_id gnl|my_center|LOCUS_17170 64751 65635 gene locus_tag LOCUS_17180 64751 65635 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105232.1 protein_id gnl|my_center|LOCUS_17180 66107 67576 gene locus_tag LOCUS_17190 66107 67576 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970779.1 protein_id gnl|my_center|LOCUS_17190 67789 68865 gene locus_tag LOCUS_17200 67789 68865 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_17200 68949 69398 gene locus_tag LOCUS_17210 68949 69398 CDS product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 protein_id gnl|my_center|LOCUS_17210 69536 69886 gene locus_tag LOCUS_17220 69536 69886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 71656 69953 gene locus_tag LOCUS_17230 71656 69953 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114562.1 protein_id gnl|my_center|LOCUS_17230 72377 71817 gene locus_tag LOCUS_17240 72377 71817 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838224.1 protein_id gnl|my_center|LOCUS_17240 72518 73486 gene locus_tag LOCUS_17250 72518 73486 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530666.1 protein_id gnl|my_center|LOCUS_17250 73586 74197 gene locus_tag LOCUS_17260 73586 74197 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479827.1 protein_id gnl|my_center|LOCUS_17260 74629 75093 gene locus_tag LOCUS_17270 74629 75093 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707488.1 protein_id gnl|my_center|LOCUS_17270 75149 75640 gene locus_tag LOCUS_17280 75149 75640 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705794.1 protein_id gnl|my_center|LOCUS_17280 75643 76065 gene locus_tag LOCUS_17290 75643 76065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 76696 76079 gene locus_tag LOCUS_17300 gene cobO 76696 76079 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071298.1 protein_id gnl|my_center|LOCUS_17300 78248 76701 gene locus_tag LOCUS_17310 78248 76701 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071297.1 protein_id gnl|my_center|LOCUS_17310 79054 78275 gene locus_tag LOCUS_17320 79054 78275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072480.1 protein_id gnl|my_center|LOCUS_17320 79483 79130 gene locus_tag LOCUS_17330 79483 79130 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 protein_id gnl|my_center|LOCUS_17330 79857 79480 gene locus_tag LOCUS_17340 79857 79480 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_17340 80678 79854 gene locus_tag LOCUS_17350 80678 79854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 82005 80779 gene locus_tag LOCUS_17360 82005 80779 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_17360 82169 83329 gene locus_tag LOCUS_17370 82169 83329 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706804.1 protein_id gnl|my_center|LOCUS_17370 84305 83313 gene locus_tag LOCUS_17380 84305 83313 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100363.1 protein_id gnl|my_center|LOCUS_17380 84413 85174 gene locus_tag LOCUS_17390 84413 85174 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266540.1 protein_id gnl|my_center|LOCUS_17390 85273 85602 gene locus_tag LOCUS_17400 85273 85602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 86306 85848 gene locus_tag LOCUS_17410 86306 85848 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367940.1 protein_id gnl|my_center|LOCUS_17410 86502 87542 gene locus_tag LOCUS_17420 86502 87542 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167652.1 protein_id gnl|my_center|LOCUS_17420 89576 87570 gene locus_tag LOCUS_17430 89576 87570 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707122.1 protein_id gnl|my_center|LOCUS_17430 89743 91581 gene locus_tag LOCUS_17440 gene sppA 89743 91581 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707123.1 protein_id gnl|my_center|LOCUS_17440 91581 92597 gene locus_tag LOCUS_17450 gene ansA 91581 92597 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707130.1 protein_id gnl|my_center|LOCUS_17450 93135 92650 gene locus_tag LOCUS_17460 93135 92650 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817527.1 protein_id gnl|my_center|LOCUS_17460 93248 94252 gene locus_tag LOCUS_17470 93248 94252 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113297.1 protein_id gnl|my_center|LOCUS_17470 94713 94411 gene locus_tag LOCUS_17480 94713 94411 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243014.1 protein_id gnl|my_center|LOCUS_17480 94789 95199 gene locus_tag LOCUS_17490 94789 95199 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 protein_id gnl|my_center|LOCUS_17490 95305 96345 gene locus_tag LOCUS_17500 95305 96345 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818104.1 protein_id gnl|my_center|LOCUS_17500 97342 96578 gene locus_tag LOCUS_17510 97342 96578 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226013954.1 protein_id gnl|my_center|LOCUS_17510 98336 97329 gene locus_tag LOCUS_17520 gene btuC 98336 97329 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706548.1 protein_id gnl|my_center|LOCUS_17520 98494 99345 gene locus_tag LOCUS_17530 98494 99345 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706234.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence17 138 281 gene locus_tag LOCUS_17540 138 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence18 2956 272 gene locus_tag LOCUS_17550 2956 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 3196 4227 gene locus_tag LOCUS_17560 3196 4227 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401259.1 protein_id gnl|my_center|LOCUS_17560 4592 4263 gene locus_tag LOCUS_17570 4592 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 5673 4708 gene locus_tag LOCUS_17580 gene glk 5673 4708 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815870.1 protein_id gnl|my_center|LOCUS_17580 5922 6236 gene locus_tag LOCUS_17590 5922 6236 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_17590 6503 6724 gene locus_tag LOCUS_17600 6503 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 6960 7541 gene locus_tag LOCUS_17610 6960 7541 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 protein_id gnl|my_center|LOCUS_17610 7675 8772 gene locus_tag LOCUS_17620 gene vexE 7675 8772 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484214.1 protein_id gnl|my_center|LOCUS_17620 8769 11819 gene locus_tag LOCUS_17630 8769 11819 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 protein_id gnl|my_center|LOCUS_17630 12655 11828 gene locus_tag LOCUS_17640 12655 11828 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_17640 13736 12891 gene locus_tag LOCUS_17650 13736 12891 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454987.1 protein_id gnl|my_center|LOCUS_17650 15034 13826 gene locus_tag LOCUS_17660 15034 13826 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886905.1 protein_id gnl|my_center|LOCUS_17660 15266 15856 gene locus_tag LOCUS_17670 gene mobA 15266 15856 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706868.1 protein_id gnl|my_center|LOCUS_17670 16480 15923 gene locus_tag LOCUS_17680 16480 15923 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707121.1 protein_id gnl|my_center|LOCUS_17680 17757 16690 gene locus_tag LOCUS_17690 gene purK 17757 16690 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073384.1 protein_id gnl|my_center|LOCUS_17690 18248 17754 gene locus_tag LOCUS_17700 gene purE 18248 17754 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073383.1 protein_id gnl|my_center|LOCUS_17700 18474 19280 gene locus_tag LOCUS_17710 18474 19280 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114733.1 protein_id gnl|my_center|LOCUS_17710 19290 20801 gene locus_tag LOCUS_17720 19290 20801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 20817 23042 gene locus_tag LOCUS_17730 20817 23042 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388417.1 protein_id gnl|my_center|LOCUS_17730 23152 23793 gene locus_tag LOCUS_17740 23152 23793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 24855 23923 gene locus_tag LOCUS_17750 24855 23923 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073535.1 protein_id gnl|my_center|LOCUS_17750 25119 26087 gene locus_tag LOCUS_17760 25119 26087 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073534.1 protein_id gnl|my_center|LOCUS_17760 26091 27116 gene locus_tag LOCUS_17770 26091 27116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444437.1 protein_id gnl|my_center|LOCUS_17770 27118 27933 gene locus_tag LOCUS_17780 27118 27933 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330817.1 protein_id gnl|my_center|LOCUS_17780 28015 28575 gene locus_tag LOCUS_17790 28015 28575 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330816.1 protein_id gnl|my_center|LOCUS_17790 28863 28558 gene locus_tag LOCUS_17800 28863 28558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 29018 30028 gene locus_tag LOCUS_17810 29018 30028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 30300 32546 gene locus_tag LOCUS_17820 30300 32546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 33770 32640 gene locus_tag LOCUS_17830 gene solA 33770 32640 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872833.1 protein_id gnl|my_center|LOCUS_17830 34618 33866 gene locus_tag LOCUS_17840 34618 33866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 35887 34628 gene locus_tag LOCUS_17850 gene folC 35887 34628 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043123896.1 protein_id gnl|my_center|LOCUS_17850 36750 35887 gene locus_tag LOCUS_17860 gene accD 36750 35887 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706493.1 protein_id gnl|my_center|LOCUS_17860 37772 36975 gene locus_tag LOCUS_17870 gene truA 37772 36975 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706494.1 protein_id gnl|my_center|LOCUS_17870 39667 37865 gene locus_tag LOCUS_17880 39667 37865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 40914 39811 gene locus_tag LOCUS_17890 40914 39811 CDS product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706497.1 protein_id gnl|my_center|LOCUS_17890 41028 41762 gene locus_tag LOCUS_17900 41028 41762 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706498.1 protein_id gnl|my_center|LOCUS_17900 43207 41993 gene locus_tag LOCUS_17910 gene fabB 43207 41993 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705793.1 protein_id gnl|my_center|LOCUS_17910 43313 45304 gene locus_tag LOCUS_17920 gene mnmC 43313 45304 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819840.1 protein_id gnl|my_center|LOCUS_17920 45915 45442 gene locus_tag LOCUS_17930 45915 45442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 46134 47081 gene locus_tag LOCUS_17940 gene corA 46134 47081 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705843.1 protein_id gnl|my_center|LOCUS_17940 48889 47051 gene locus_tag LOCUS_17950 gene nrdD 48889 47051 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 protein_id gnl|my_center|LOCUS_17950 49341 48886 gene locus_tag LOCUS_17960 gene nrdG 49341 48886 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203409.1 protein_id gnl|my_center|LOCUS_17960 49566 50012 gene locus_tag LOCUS_17970 49566 50012 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935051.1 protein_id gnl|my_center|LOCUS_17970 52112 50112 gene locus_tag LOCUS_17980 gene uvrB 52112 50112 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706281.1 protein_id gnl|my_center|LOCUS_17980 52267 52342 gene locus_tag LOCUS_t00400 52267 52342 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 54524 53025 gene locus_tag LOCUS_17990 gene nagE 54524 53025 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023164.1 protein_id gnl|my_center|LOCUS_17990 54749 55552 gene locus_tag LOCUS_18000 gene nagB 54749 55552 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705423.1 protein_id gnl|my_center|LOCUS_18000 55559 56704 gene locus_tag LOCUS_18010 gene nagA 55559 56704 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705422.1 protein_id gnl|my_center|LOCUS_18010 56701 57915 gene locus_tag LOCUS_18020 56701 57915 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350209.1 protein_id gnl|my_center|LOCUS_18020 57912 58229 gene locus_tag LOCUS_18030 57912 58229 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043123987.1 protein_id gnl|my_center|LOCUS_18030 58463 59011 gene locus_tag LOCUS_18040 58463 59011 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633534.1 protein_id gnl|my_center|LOCUS_18040 60480 59053 gene locus_tag LOCUS_18050 gene nhaD 60480 59053 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482814.1 protein_id gnl|my_center|LOCUS_18050 60861 62189 gene locus_tag LOCUS_18060 gene argA 60861 62189 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706389.1 protein_id gnl|my_center|LOCUS_18060 62494 63831 gene locus_tag LOCUS_18070 gene lysC 62494 63831 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706390.1 protein_id gnl|my_center|LOCUS_18070 65268 63985 gene locus_tag LOCUS_18080 65268 63985 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 protein_id gnl|my_center|LOCUS_18080 65977 65291 gene locus_tag LOCUS_18090 65977 65291 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532554.1 protein_id gnl|my_center|LOCUS_18090 66713 65988 gene locus_tag LOCUS_18100 66713 65988 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704255.1 protein_id gnl|my_center|LOCUS_18100 67846 66725 gene locus_tag LOCUS_18110 gene ald 67846 66725 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_18110 67991 68533 gene locus_tag LOCUS_18120 67991 68533 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704252.1 protein_id gnl|my_center|LOCUS_18120 69413 68874 gene locus_tag LOCUS_18130 69413 68874 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972947.1 protein_id gnl|my_center|LOCUS_18130 70272 69424 gene locus_tag LOCUS_18140 gene potI 70272 69424 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061658.1 protein_id gnl|my_center|LOCUS_18140 71168 70275 gene locus_tag LOCUS_18150 gene potH 71168 70275 CDS product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105427.1 protein_id gnl|my_center|LOCUS_18150 72300 71179 gene locus_tag LOCUS_18160 gene potG 72300 71179 CDS product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996007.1 protein_id gnl|my_center|LOCUS_18160 72039 72127 gene locus_tag LOCUS_t00410 72039 72127 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 73462 72350 gene locus_tag LOCUS_18170 gene potF 73462 72350 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171171.1 protein_id gnl|my_center|LOCUS_18170 74844 73477 gene locus_tag LOCUS_18180 74844 73477 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 protein_id gnl|my_center|LOCUS_18180 76221 74863 gene locus_tag LOCUS_18190 76221 74863 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707799.1 protein_id gnl|my_center|LOCUS_18190 76439 77797 gene locus_tag LOCUS_18200 76439 77797 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112937.1 protein_id gnl|my_center|LOCUS_18200 77813 79087 gene locus_tag LOCUS_18210 77813 79087 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037492.1 protein_id gnl|my_center|LOCUS_18210 79141 79401 gene locus_tag LOCUS_18220 79141 79401 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706179.1 protein_id gnl|my_center|LOCUS_18220 80243 79398 gene locus_tag LOCUS_18230 80243 79398 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_18230 80837 80394 gene locus_tag LOCUS_18240 gene moaE 80837 80394 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705489.1 protein_id gnl|my_center|LOCUS_18240 81084 80839 gene locus_tag LOCUS_18250 gene moaD 81084 80839 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598624.1 protein_id gnl|my_center|LOCUS_18250 81557 81081 gene locus_tag LOCUS_18260 gene moaC 81557 81081 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461493.1 protein_id gnl|my_center|LOCUS_18260 82071 81562 gene locus_tag LOCUS_18270 gene moaB 82071 81562 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091240.1 protein_id gnl|my_center|LOCUS_18270 82800 82207 gene locus_tag LOCUS_18280 82800 82207 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705485.1 protein_id gnl|my_center|LOCUS_18280 83253 82810 gene locus_tag LOCUS_18290 83253 82810 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705484.1 protein_id gnl|my_center|LOCUS_18290 84137 83274 gene locus_tag LOCUS_18300 gene napH 84137 83274 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_18300 84880 84137 gene locus_tag LOCUS_18310 gene napG 84880 84137 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705482.1 protein_id gnl|my_center|LOCUS_18310 87373 84884 gene locus_tag LOCUS_18320 gene napA 87373 84884 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 protein_id gnl|my_center|LOCUS_18320 87642 87370 gene locus_tag LOCUS_18330 87642 87370 CDS product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705480.1 protein_id gnl|my_center|LOCUS_18330 88157 87639 gene locus_tag LOCUS_18340 gene napF 88157 87639 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705479.1 protein_id gnl|my_center|LOCUS_18340 89340 88360 gene locus_tag LOCUS_18350 gene moaA 89340 88360 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106017.1 protein_id gnl|my_center|LOCUS_18350 89640 90293 gene locus_tag LOCUS_18360 89640 90293 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208537.1 protein_id gnl|my_center|LOCUS_18360 90860 90486 gene locus_tag LOCUS_18370 90860 90486 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705471.1 protein_id gnl|my_center|LOCUS_18370 92233 90857 gene locus_tag LOCUS_18380 92233 90857 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106018.1 protein_id gnl|my_center|LOCUS_18380 93217 92459 gene locus_tag LOCUS_18390 93217 92459 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706625.1 protein_id gnl|my_center|LOCUS_18390 93269 94081 gene locus_tag LOCUS_18400 93269 94081 CDS product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207554.1 protein_id gnl|my_center|LOCUS_18400 94159 94086 gene locus_tag LOCUS_t00420 94159 94086 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 94246 94171 gene locus_tag LOCUS_t00430 94246 94171 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 94439 96160 gene locus_tag LOCUS_18410 gene ggt 94439 96160 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262987.1 protein_id gnl|my_center|LOCUS_18410 96320 97873 gene locus_tag LOCUS_18420 96320 97873 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706890.1 protein_id gnl|my_center|LOCUS_18420 97877 98212 gene locus_tag LOCUS_18430 97877 98212 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706891.1 protein_id gnl|my_center|LOCUS_18430 98389 98225 gene locus_tag LOCUS_18440 98389 98225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303277.1 protein_id gnl|my_center|LOCUS_18440 101146 98522 gene locus_tag LOCUS_18450 gene topA 101146 98522 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706893.1 protein_id gnl|my_center|LOCUS_18450 101482 102819 gene locus_tag LOCUS_18460 gene astB 101482 102819 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706894.1 protein_id gnl|my_center|LOCUS_18460 103904 102882 gene locus_tag LOCUS_18470 gene sohB 103904 102882 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706895.1 protein_id gnl|my_center|LOCUS_18470 104052 104819 gene locus_tag LOCUS_18480 104052 104819 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706896.1 protein_id gnl|my_center|LOCUS_18480 104919 105818 gene locus_tag LOCUS_18490 104919 105818 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706897.1 protein_id gnl|my_center|LOCUS_18490 105879 107015 gene locus_tag LOCUS_18500 105879 107015 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_18500 107217 108200 gene locus_tag LOCUS_18510 107217 108200 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_18510 108335 110923 gene locus_tag LOCUS_18520 108335 110923 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195227.1 protein_id gnl|my_center|LOCUS_18520 111173 111083 gene locus_tag LOCUS_t00440 111173 111083 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 111434 111225 gene locus_tag LOCUS_18530 111434 111225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 111572 112147 gene locus_tag LOCUS_18540 111572 112147 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071599.1 protein_id gnl|my_center|LOCUS_18540 112281 113063 gene locus_tag LOCUS_18550 112281 113063 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102209.1 protein_id gnl|my_center|LOCUS_18550 113994 113131 gene locus_tag LOCUS_18560 113994 113131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112677.1 protein_id gnl|my_center|LOCUS_18560 115231 114206 gene locus_tag LOCUS_18570 gene astE 115231 114206 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706669.1 protein_id gnl|my_center|LOCUS_18570 117226 115583 gene locus_tag LOCUS_18580 gene pgm 117226 115583 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_18580 117747 117247 gene locus_tag LOCUS_18590 gene seqA 117747 117247 CDS product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927592.1 protein_id gnl|my_center|LOCUS_18590 117865 118632 gene locus_tag LOCUS_18600 117865 118632 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_18600 118686 118910 gene locus_tag LOCUS_18610 118686 118910 CDS product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705431.1 protein_id gnl|my_center|LOCUS_18610 118914 119198 gene locus_tag LOCUS_18620 gene ybfE 118914 119198 CDS product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705430.1 protein_id gnl|my_center|LOCUS_18620 119244 119771 gene locus_tag LOCUS_18630 gene fldA 119244 119771 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705429.1 protein_id gnl|my_center|LOCUS_18630 119882 120787 gene locus_tag LOCUS_18640 119882 120787 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478383.1 protein_id gnl|my_center|LOCUS_18640 121358 121116 gene locus_tag LOCUS_18650 121358 121116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 121957 121487 gene locus_tag LOCUS_18660 121957 121487 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943809.1 protein_id gnl|my_center|LOCUS_18660 122117 122566 gene locus_tag LOCUS_18670 gene fur 122117 122566 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705427.1 protein_id gnl|my_center|LOCUS_18670 124573 122912 gene locus_tag LOCUS_18680 gene glnS 124573 122912 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705426.1 protein_id gnl|my_center|LOCUS_18680 126490 124706 gene locus_tag LOCUS_18690 126490 124706 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486234.1 protein_id gnl|my_center|LOCUS_18690 126950 126615 gene locus_tag LOCUS_18700 126950 126615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 128214 127006 gene locus_tag LOCUS_18710 128214 127006 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106441.1 protein_id gnl|my_center|LOCUS_18710 128861 128253 gene locus_tag LOCUS_18720 128861 128253 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705821.1 protein_id gnl|my_center|LOCUS_18720 129857 129932 gene locus_tag LOCUS_t00450 129857 129932 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 129948 130023 gene locus_tag LOCUS_t00460 129948 130023 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 130038 130113 gene locus_tag LOCUS_t00470 130038 130113 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 130128 130203 gene locus_tag LOCUS_t00480 130128 130203 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 130311 132128 gene locus_tag LOCUS_18730 130311 132128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 132603 132109 gene locus_tag LOCUS_18740 132603 132109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706315.1 protein_id gnl|my_center|LOCUS_18740 132735 133130 gene locus_tag LOCUS_18750 132735 133130 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705940.1 protein_id gnl|my_center|LOCUS_18750 134503 133217 gene locus_tag LOCUS_18760 gene aroA 134503 133217 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633771.1 protein_id gnl|my_center|LOCUS_18760 135713 134613 gene locus_tag LOCUS_18770 gene hisC 135713 134613 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_18770 136924 135845 gene locus_tag LOCUS_18780 gene serC 136924 135845 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705848.1 protein_id gnl|my_center|LOCUS_18780 139776 137125 gene locus_tag LOCUS_18790 gene gyrA 139776 137125 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706172.1 protein_id gnl|my_center|LOCUS_18790 139929 140627 gene locus_tag LOCUS_18800 gene ubiG 139929 140627 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350657.1 protein_id gnl|my_center|LOCUS_18800 140631 141305 gene locus_tag LOCUS_18810 140631 141305 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706174.1 protein_id gnl|my_center|LOCUS_18810 141650 143923 gene locus_tag LOCUS_18820 gene nrdA 141650 143923 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819935.1 protein_id gnl|my_center|LOCUS_18820 143975 145108 gene locus_tag LOCUS_18830 gene nrdB 143975 145108 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706176.1 protein_id gnl|my_center|LOCUS_18830 145105 145377 gene locus_tag LOCUS_18840 gene yfaE 145105 145377 CDS product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688918.1 protein_id gnl|my_center|LOCUS_18840 145634 145374 gene locus_tag LOCUS_18850 145634 145374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 145707 148055 gene locus_tag LOCUS_18860 145707 148055 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113604.1 protein_id gnl|my_center|LOCUS_18860 148216 148452 gene locus_tag LOCUS_18870 148216 148452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 148869 148690 gene locus_tag LOCUS_18880 148869 148690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 151117 149078 gene locus_tag LOCUS_18890 151117 149078 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204831.1 protein_id gnl|my_center|LOCUS_18890 152456 151110 gene locus_tag LOCUS_18900 152456 151110 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179209223.1 protein_id gnl|my_center|LOCUS_18900 153109 153774 gene locus_tag LOCUS_18910 153109 153774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 154018 158577 gene locus_tag LOCUS_18920 154018 158577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 159072 158806 gene locus_tag LOCUS_18930 159072 158806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 160527 159085 gene locus_tag LOCUS_18940 gene trbL 160527 159085 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001405816.1 protein_id gnl|my_center|LOCUS_18940 160804 160574 gene locus_tag LOCUS_18950 gene trbK 160804 160574 CDS product entry exclusion lipoprotein TrbK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718002.1 protein_id gnl|my_center|LOCUS_18950 161586 160816 gene locus_tag LOCUS_18960 gene trbJ 161586 160816 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836966.1 protein_id gnl|my_center|LOCUS_18960 162230 161811 gene locus_tag LOCUS_18970 162230 161811 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769733.1 protein_id gnl|my_center|LOCUS_18970 162481 162227 gene locus_tag LOCUS_18980 162481 162227 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101799467.1 protein_id gnl|my_center|LOCUS_18980 164325 162547 gene locus_tag LOCUS_18990 164325 162547 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938884.1 protein_id gnl|my_center|LOCUS_18990 164696 164322 gene locus_tag LOCUS_19000 gene traJ 164696 164322 CDS product conjugal transfer transcriptional regulator TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205281.1 protein_id gnl|my_center|LOCUS_19000 166316 165555 gene locus_tag LOCUS_19010 166316 165555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 167148 166297 gene locus_tag LOCUS_19020 167148 166297 CDS product helicase RepA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880559.1 protein_id gnl|my_center|LOCUS_19020 167383 167153 gene locus_tag LOCUS_19030 167383 167153 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388106.1 protein_id gnl|my_center|LOCUS_19030 169363 167948 gene locus_tag LOCUS_19040 169363 167948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 170915 169722 gene locus_tag LOCUS_19050 170915 169722 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039727.1 protein_id gnl|my_center|LOCUS_19050 172800 171223 gene locus_tag LOCUS_19060 gene guaA 172800 171223 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138282.1 protein_id gnl|my_center|LOCUS_19060 174354 172891 gene locus_tag LOCUS_19070 gene guaB 174354 172891 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705859.1 protein_id gnl|my_center|LOCUS_19070 174512 175858 gene locus_tag LOCUS_19080 gene xseA 174512 175858 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_19080 177541 175874 gene locus_tag LOCUS_19090 177541 175874 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080109.1 protein_id gnl|my_center|LOCUS_19090 177740 178240 gene locus_tag LOCUS_19100 177740 178240 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172875.1 protein_id gnl|my_center|LOCUS_19100 179286 178414 gene locus_tag LOCUS_19110 gene sucD 179286 178414 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025475.1 protein_id gnl|my_center|LOCUS_19110 180514 179291 gene locus_tag LOCUS_19120 gene sucC 180514 179291 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705801.1 protein_id gnl|my_center|LOCUS_19120 181728 180538 gene locus_tag LOCUS_19130 gene odhB 181728 180538 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705800.1 protein_id gnl|my_center|LOCUS_19130 184560 181747 gene locus_tag LOCUS_19140 gene sucA 184560 181747 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043162312.1 protein_id gnl|my_center|LOCUS_19140 185372 184656 gene locus_tag LOCUS_19150 185372 184656 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705798.1 protein_id gnl|my_center|LOCUS_19150 187162 185387 gene locus_tag LOCUS_19160 gene sdhA 187162 185387 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705797.1 protein_id gnl|my_center|LOCUS_19160 187499 187155 gene locus_tag LOCUS_19170 gene sdhD 187499 187155 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705796.1 protein_id gnl|my_center|LOCUS_19170 187882 187493 gene locus_tag LOCUS_19180 gene sdhC 187882 187493 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478785.1 protein_id gnl|my_center|LOCUS_19180 188290 189576 gene locus_tag LOCUS_19190 188290 189576 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300205.1 protein_id gnl|my_center|LOCUS_19190 190181 189642 gene locus_tag LOCUS_19200 gene hsp20 190181 189642 CDS product small heat shock protein sHSP20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152117.1 protein_id gnl|my_center|LOCUS_19200 191359 190340 gene locus_tag LOCUS_19210 gene fbp 191359 190340 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705872.1 protein_id gnl|my_center|LOCUS_19210 192221 191472 gene locus_tag LOCUS_19220 gene kdsB 192221 191472 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706580.1 protein_id gnl|my_center|LOCUS_19220 192406 192218 gene locus_tag LOCUS_19230 192406 192218 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706581.1 protein_id gnl|my_center|LOCUS_19230 193355 192396 gene locus_tag LOCUS_19240 gene lpxK 193355 192396 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706582.1 protein_id gnl|my_center|LOCUS_19240 195106 193355 gene locus_tag LOCUS_19250 gene msbA 195106 193355 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706583.1 protein_id gnl|my_center|LOCUS_19250 197326 195134 gene locus_tag LOCUS_19260 197326 195134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19260 197381 197866 gene locus_tag LOCUS_19270 197381 197866 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072737.1 protein_id gnl|my_center|LOCUS_19270 197866 198366 gene locus_tag LOCUS_19280 197866 198366 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_19280 198762 198409 gene locus_tag LOCUS_19290 198762 198409 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073079.1 protein_id gnl|my_center|LOCUS_19290 200099 198858 gene locus_tag LOCUS_19300 gene lolE 200099 198858 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705877.1 protein_id gnl|my_center|LOCUS_19300 200782 200099 gene locus_tag LOCUS_19310 gene lolD 200782 200099 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817672.1 protein_id gnl|my_center|LOCUS_19310 201986 200775 gene locus_tag LOCUS_19320 201986 200775 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705875.1 protein_id gnl|my_center|LOCUS_19320 202079 202651 gene locus_tag LOCUS_19330 202079 202651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705874.1 protein_id gnl|my_center|LOCUS_19330 202648 206088 gene locus_tag LOCUS_19340 gene mfd 202648 206088 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705873.1 protein_id gnl|my_center|LOCUS_19340 206088 207656 gene locus_tag LOCUS_19350 206088 207656 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028024693.1 protein_id gnl|my_center|LOCUS_19350 208154 208480 gene locus_tag LOCUS_19360 208154 208480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 208655 209239 gene locus_tag LOCUS_19370 208655 209239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283202.1 protein_id gnl|my_center|LOCUS_19370 209236 210201 gene locus_tag LOCUS_19380 209236 210201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 210367 210798 gene locus_tag LOCUS_19390 210367 210798 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706242.1 protein_id gnl|my_center|LOCUS_19390 210902 211276 gene locus_tag LOCUS_19400 210902 211276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 211363 211824 gene locus_tag LOCUS_19410 211363 211824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 211975 212709 gene locus_tag LOCUS_19420 211975 212709 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532133.1 protein_id gnl|my_center|LOCUS_19420 212799 213176 gene locus_tag LOCUS_19430 212799 213176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 213761 214072 gene locus_tag LOCUS_19440 213761 214072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 214232 215620 gene locus_tag LOCUS_19450 214232 215620 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071592.1 protein_id gnl|my_center|LOCUS_19450 216708 215980 gene locus_tag LOCUS_19460 216708 215980 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284930.1 protein_id gnl|my_center|LOCUS_19460 216828 217727 gene locus_tag LOCUS_19470 216828 217727 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 protein_id gnl|my_center|LOCUS_19470 217839 218072 gene locus_tag LOCUS_19480 217839 218072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 219688 218456 gene locus_tag LOCUS_19490 gene alr 219688 218456 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706424.1 protein_id gnl|my_center|LOCUS_19490 220548 220153 gene locus_tag LOCUS_19500 220548 220153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 222003 220711 gene locus_tag LOCUS_19510 222003 220711 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706404.1 protein_id gnl|my_center|LOCUS_19510 223361 222348 gene locus_tag LOCUS_19520 gene nagZ 223361 222348 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529291.1 protein_id gnl|my_center|LOCUS_19520 224179 223361 gene locus_tag LOCUS_19530 224179 223361 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817953.1 protein_id gnl|my_center|LOCUS_19530 224783 224169 gene locus_tag LOCUS_19540 224783 224169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635332.1 protein_id gnl|my_center|LOCUS_19540 225144 224794 gene locus_tag LOCUS_19550 gene hinT 225144 224794 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633658.1 protein_id gnl|my_center|LOCUS_19550 225243 226589 gene locus_tag LOCUS_19560 225243 226589 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706420.1 protein_id gnl|my_center|LOCUS_19560 226690 226766 gene locus_tag LOCUS_t00490 226690 226766 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 228169 226895 gene locus_tag LOCUS_19570 gene gbcA 228169 226895 CDS product glycine-betaine demethylase subunit GbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269222.1 protein_id gnl|my_center|LOCUS_19570 228473 229576 gene locus_tag LOCUS_19580 gene gbcB 228473 229576 CDS product glycine-betaine demethylase subunit GbcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096769.1 protein_id gnl|my_center|LOCUS_19580 229845 229522 gene locus_tag LOCUS_19590 229845 229522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 231261 230104 gene locus_tag LOCUS_19600 231261 230104 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969412.1 protein_id gnl|my_center|LOCUS_19600 231645 232709 gene locus_tag LOCUS_19610 231645 232709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402229.1 protein_id gnl|my_center|LOCUS_19610 233820 233029 gene locus_tag LOCUS_19620 gene fdhD 233820 233029 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809308.1 protein_id gnl|my_center|LOCUS_19620 236683 233834 gene locus_tag LOCUS_19630 gene fdhF 236683 233834 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809310.1 protein_id gnl|my_center|LOCUS_19630 238224 236683 gene locus_tag LOCUS_19640 238224 236683 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 protein_id gnl|my_center|LOCUS_19640 238715 238224 gene locus_tag LOCUS_19650 238715 238224 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330013.1 protein_id gnl|my_center|LOCUS_19650 240194 238986 gene locus_tag LOCUS_19660 gene fdhA 240194 238986 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118811.1 protein_id gnl|my_center|LOCUS_19660 240601 241203 gene locus_tag LOCUS_19670 gene betI 240601 241203 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097647.1 protein_id gnl|my_center|LOCUS_19670 241194 242657 gene locus_tag LOCUS_19680 gene betB 241194 242657 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477313.1 protein_id gnl|my_center|LOCUS_19680 242676 244358 gene locus_tag LOCUS_19690 gene betA 242676 244358 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214391123.1 protein_id gnl|my_center|LOCUS_19690 244442 244708 gene locus_tag LOCUS_19700 244442 244708 CDS product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_19700 246368 244980 gene locus_tag LOCUS_19710 gene ccoG 246368 244980 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707874.1 protein_id gnl|my_center|LOCUS_19710 247929 246520 gene locus_tag LOCUS_19720 247929 246520 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816561.1 protein_id gnl|my_center|LOCUS_19720 248490 247930 gene locus_tag LOCUS_19730 248490 247930 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_19730 248705 250261 gene locus_tag LOCUS_19740 gene tyrR 248705 250261 CDS product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705761.1 protein_id gnl|my_center|LOCUS_19740 251231 250584 gene locus_tag LOCUS_19750 251231 250584 CDS product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172128.1 protein_id gnl|my_center|LOCUS_19750 251587 251231 gene locus_tag LOCUS_19760 251587 251231 CDS product DUF4810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215846.1 protein_id gnl|my_center|LOCUS_19760 252275 251604 gene locus_tag LOCUS_19770 252275 251604 CDS product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172134.1 protein_id gnl|my_center|LOCUS_19770 252927 252559 gene locus_tag LOCUS_19780 252927 252559 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368764.1 protein_id gnl|my_center|LOCUS_19780 253661 252924 gene locus_tag LOCUS_19790 gene lpxH 253661 252924 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095922.1 protein_id gnl|my_center|LOCUS_19790 254231 253734 gene locus_tag LOCUS_19800 254231 253734 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302674.1 protein_id gnl|my_center|LOCUS_19800 254718 254344 gene locus_tag LOCUS_19810 254718 254344 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682922.1 protein_id gnl|my_center|LOCUS_19810 256687 254705 gene locus_tag LOCUS_19820 256687 254705 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074224.1 protein_id gnl|my_center|LOCUS_19820 258441 256801 gene locus_tag LOCUS_19830 258441 256801 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072121.1 protein_id gnl|my_center|LOCUS_19830 259810 258554 gene locus_tag LOCUS_19840 259810 258554 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094037.1 protein_id gnl|my_center|LOCUS_19840 260480 259794 gene locus_tag LOCUS_19850 260480 259794 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_19850 260772 262151 gene locus_tag LOCUS_19860 gene cysS 260772 262151 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478905.1 protein_id gnl|my_center|LOCUS_19860 262251 262538 gene locus_tag LOCUS_19870 262251 262538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 262825 263151 gene locus_tag LOCUS_19880 262825 263151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 264210 263353 gene locus_tag LOCUS_19890 gene folD 264210 263353 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705731.1 protein_id gnl|my_center|LOCUS_19890 264394 264470 gene locus_tag LOCUS_t00500 264394 264470 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 264477 264552 gene locus_tag LOCUS_t00510 264477 264552 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 265201 264557 gene locus_tag LOCUS_19900 265201 264557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 266210 265212 gene locus_tag LOCUS_19910 266210 265212 CDS product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705757.1 protein_id gnl|my_center|LOCUS_19910 267610 266207 gene locus_tag LOCUS_19920 267610 266207 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819824.1 protein_id gnl|my_center|LOCUS_19920 267996 267607 gene locus_tag LOCUS_19930 gene pspC 267996 267607 CDS product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024941345.1 protein_id gnl|my_center|LOCUS_19930 268214 267981 gene locus_tag LOCUS_19940 gene pspB 268214 267981 CDS product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300084.1 protein_id gnl|my_center|LOCUS_19940 268879 268214 gene locus_tag LOCUS_19950 gene pspA 268879 268214 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705754.1 protein_id gnl|my_center|LOCUS_19950 269089 270096 gene locus_tag LOCUS_19960 gene pspF 269089 270096 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 protein_id gnl|my_center|LOCUS_19960 270099 271697 gene locus_tag LOCUS_19970 gene sapA 270099 271697 CDS product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819989.1 protein_id gnl|my_center|LOCUS_19970 271700 272662 gene locus_tag LOCUS_19980 271700 272662 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705751.1 protein_id gnl|my_center|LOCUS_19980 272646 273539 gene locus_tag LOCUS_19990 272646 273539 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705750.1 protein_id gnl|my_center|LOCUS_19990 273539 274540 gene locus_tag LOCUS_20000 273539 274540 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705749.1 protein_id gnl|my_center|LOCUS_20000 274537 275331 gene locus_tag LOCUS_20010 274537 275331 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705748.1 protein_id gnl|my_center|LOCUS_20010 276084 275347 gene locus_tag LOCUS_20020 gene miaE 276084 275347 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705747.1 protein_id gnl|my_center|LOCUS_20020 276254 277285 gene locus_tag LOCUS_20030 276254 277285 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121736.1 protein_id gnl|my_center|LOCUS_20030 277451 277870 gene locus_tag LOCUS_20040 gene rbsD 277451 277870 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706155.1 protein_id gnl|my_center|LOCUS_20040 277878 279380 gene locus_tag LOCUS_20050 gene rbsA 277878 279380 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180345411.1 protein_id gnl|my_center|LOCUS_20050 279377 280345 gene locus_tag LOCUS_20060 gene rbsC 279377 280345 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463702.1 protein_id gnl|my_center|LOCUS_20060 280378 281259 gene locus_tag LOCUS_20070 gene rbsB 280378 281259 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463703.1 protein_id gnl|my_center|LOCUS_20070 281430 282341 gene locus_tag LOCUS_20080 gene rbsK 281430 282341 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038380.1 protein_id gnl|my_center|LOCUS_20080 282341 283360 gene locus_tag LOCUS_20090 282341 283360 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224436.1 protein_id gnl|my_center|LOCUS_20090 283397 284290 gene locus_tag LOCUS_20100 283397 284290 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532275.1 protein_id gnl|my_center|LOCUS_20100 284397 285146 gene locus_tag LOCUS_20110 284397 285146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 285143 286459 gene locus_tag LOCUS_20120 285143 286459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 286456 288552 gene locus_tag LOCUS_20130 286456 288552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 288704 289249 gene locus_tag LOCUS_20140 288704 289249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 289335 289874 gene locus_tag LOCUS_20150 289335 289874 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_20150 289937 290812 gene locus_tag LOCUS_20160 289937 290812 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 protein_id gnl|my_center|LOCUS_20160 290862 300848 gene locus_tag LOCUS_20170 290862 300848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 300913 302391 gene locus_tag LOCUS_20180 300913 302391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 303721 302735 gene locus_tag LOCUS_20190 gene iolG 303721 302735 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 protein_id gnl|my_center|LOCUS_20190 304639 303764 gene locus_tag LOCUS_20200 gene iolB 304639 303764 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098250.1 protein_id gnl|my_center|LOCUS_20200 305626 304781 gene locus_tag LOCUS_20210 305626 304781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 306866 305694 gene locus_tag LOCUS_20220 306866 305694 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974678.1 protein_id gnl|my_center|LOCUS_20220 307663 307040 gene locus_tag LOCUS_20230 307663 307040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20230 307962 307615 gene locus_tag LOCUS_20240 307962 307615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20240 308448 309311 gene locus_tag LOCUS_20250 308448 309311 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243149.1 protein_id gnl|my_center|LOCUS_20250 310639 309485 gene locus_tag LOCUS_20260 310639 309485 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031356.1 protein_id gnl|my_center|LOCUS_20260 311484 310636 gene locus_tag LOCUS_20270 311484 310636 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975713.1 protein_id gnl|my_center|LOCUS_20270 311599 312633 gene locus_tag LOCUS_20280 311599 312633 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031357.1 protein_id gnl|my_center|LOCUS_20280 313009 314469 gene locus_tag LOCUS_20290 313009 314469 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 protein_id gnl|my_center|LOCUS_20290 316554 314710 gene locus_tag LOCUS_20300 gene iolD 316554 314710 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223774.1 protein_id gnl|my_center|LOCUS_20300 317545 316796 gene locus_tag LOCUS_20310 317545 316796 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973298.1 protein_id gnl|my_center|LOCUS_20310 319194 317722 gene locus_tag LOCUS_20320 gene xylE 319194 317722 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_20320 320580 319543 gene locus_tag LOCUS_20330 320580 319543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380853.1 protein_id gnl|my_center|LOCUS_20330 322087 320603 gene locus_tag LOCUS_20340 322087 320603 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268315.1 protein_id gnl|my_center|LOCUS_20340 323066 322143 gene locus_tag LOCUS_20350 323066 322143 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246965.1 protein_id gnl|my_center|LOCUS_20350 324470 323460 gene locus_tag LOCUS_20360 324470 323460 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975109.1 protein_id gnl|my_center|LOCUS_20360 324691 325704 gene locus_tag LOCUS_20370 324691 325704 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817367.1 protein_id gnl|my_center|LOCUS_20370 325724 326542 gene locus_tag LOCUS_20380 325724 326542 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973957.1 protein_id gnl|my_center|LOCUS_20380 326694 327245 gene locus_tag LOCUS_20390 326694 327245 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707244.1 protein_id gnl|my_center|LOCUS_20390 327249 327548 gene locus_tag LOCUS_20400 327249 327548 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 protein_id gnl|my_center|LOCUS_20400 327709 327993 gene locus_tag LOCUS_20410 327709 327993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 328133 328978 gene locus_tag LOCUS_20420 gene galU 328133 328978 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818749.1 protein_id gnl|my_center|LOCUS_20420 329945 328971 gene locus_tag LOCUS_20430 329945 328971 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707250.1 protein_id gnl|my_center|LOCUS_20430 330087 330767 gene locus_tag LOCUS_20440 330087 330767 CDS product DnaT-like ssDNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707252.1 protein_id gnl|my_center|LOCUS_20440 330751 331593 gene locus_tag LOCUS_20450 330751 331593 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707253.1 protein_id gnl|my_center|LOCUS_20450 331726 333360 gene locus_tag LOCUS_20460 331726 333360 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669463.1 protein_id gnl|my_center|LOCUS_20460 333357 334061 gene locus_tag LOCUS_20470 333357 334061 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857631.1 protein_id gnl|my_center|LOCUS_20470 334268 334062 gene locus_tag LOCUS_20480 334268 334062 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809966.1 protein_id gnl|my_center|LOCUS_20480 334492 335496 gene locus_tag LOCUS_20490 334492 335496 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869089.1 protein_id gnl|my_center|LOCUS_20490 335549 336037 gene locus_tag LOCUS_20500 335549 336037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 336092 337606 gene locus_tag LOCUS_20510 336092 337606 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464542.1 protein_id gnl|my_center|LOCUS_20510 340608 337726 gene locus_tag LOCUS_20520 gene gcvP 340608 337726 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705609.1 protein_id gnl|my_center|LOCUS_20520 341230 340841 gene locus_tag LOCUS_20530 gene gcvH 341230 340841 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634317.1 protein_id gnl|my_center|LOCUS_20530 342353 341250 gene locus_tag LOCUS_20540 gene gcvT 342353 341250 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705608.1 protein_id gnl|my_center|LOCUS_20540 343885 342674 gene locus_tag LOCUS_20550 343885 342674 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819774.1 protein_id gnl|my_center|LOCUS_20550 345079 343889 gene locus_tag LOCUS_20560 gene ubiH 345079 343889 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705606.1 protein_id gnl|my_center|LOCUS_20560 345668 345102 gene locus_tag LOCUS_20570 345668 345102 CDS product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705605.1 protein_id gnl|my_center|LOCUS_20570 345896 346117 gene locus_tag LOCUS_20580 345896 346117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 346338 346571 gene locus_tag LOCUS_20590 346338 346571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 346640 347218 gene locus_tag LOCUS_20600 346640 347218 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706539.1 protein_id gnl|my_center|LOCUS_20600 347285 347944 gene locus_tag LOCUS_20610 gene rpiA 347285 347944 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420746.1 protein_id gnl|my_center|LOCUS_20610 348123 348878 gene locus_tag LOCUS_20620 gene modA 348123 348878 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258350.1 protein_id gnl|my_center|LOCUS_20620 348924 349610 gene locus_tag LOCUS_20630 gene modB 348924 349610 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_20630 349607 350674 gene locus_tag LOCUS_20640 gene modC 349607 350674 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_20640 350740 351513 gene locus_tag LOCUS_20650 gene modE 350740 351513 CDS product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168058.1 protein_id gnl|my_center|LOCUS_20650 354406 351692 gene locus_tag LOCUS_20660 gene acnA 354406 351692 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105996.1 protein_id gnl|my_center|LOCUS_20660 354704 355606 gene locus_tag LOCUS_20670 gene rimK 354704 355606 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_20670 355606 356625 gene locus_tag LOCUS_20680 355606 356625 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183315.1 protein_id gnl|my_center|LOCUS_20680 357953 356724 gene locus_tag LOCUS_20690 gene serA 357953 356724 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024946386.1 protein_id gnl|my_center|LOCUS_20690 358858 358148 gene locus_tag LOCUS_20700 358858 358148 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300114.1 protein_id gnl|my_center|LOCUS_20700 359414 358914 gene locus_tag LOCUS_20710 359414 358914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 360668 359460 gene locus_tag LOCUS_20720 360668 359460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 362701 360791 gene locus_tag LOCUS_20730 362701 360791 CDS product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706510.1 protein_id gnl|my_center|LOCUS_20730 363297 362704 gene locus_tag LOCUS_20740 363297 362704 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263954.1 protein_id gnl|my_center|LOCUS_20740 364002 363406 gene locus_tag LOCUS_20750 364002 363406 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461003.1 protein_id gnl|my_center|LOCUS_20750 365329 364016 gene locus_tag LOCUS_20760 365329 364016 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_20760 366734 365349 gene locus_tag LOCUS_20770 366734 365349 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_20770 368874 366727 gene locus_tag LOCUS_20780 368874 366727 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706513.1 protein_id gnl|my_center|LOCUS_20780 370317 369238 gene locus_tag LOCUS_20790 gene fbaA 370317 369238 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 protein_id gnl|my_center|LOCUS_20790 371547 370384 gene locus_tag LOCUS_20800 gene pgk 371547 370384 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157067.1 protein_id gnl|my_center|LOCUS_20800 372600 371569 gene locus_tag LOCUS_20810 gene epd 372600 371569 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635047.1 protein_id gnl|my_center|LOCUS_20810 373079 372840 gene locus_tag LOCUS_20820 373079 372840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 374459 373095 gene locus_tag LOCUS_20830 374459 373095 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387979.1 protein_id gnl|my_center|LOCUS_20830 376819 374648 gene locus_tag LOCUS_20840 376819 374648 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113258.1 protein_id gnl|my_center|LOCUS_20840 377155 379458 gene locus_tag LOCUS_20850 377155 379458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 381004 379502 gene locus_tag LOCUS_20860 381004 379502 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098259.1 protein_id gnl|my_center|LOCUS_20860 381909 381019 gene locus_tag LOCUS_20870 gene iolE 381909 381019 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 protein_id gnl|my_center|LOCUS_20870 383988 382135 gene locus_tag LOCUS_20880 gene iolD 383988 382135 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196072.1 protein_id gnl|my_center|LOCUS_20880 385904 383991 gene locus_tag LOCUS_20890 gene iolC 385904 383991 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098252.1 protein_id gnl|my_center|LOCUS_20890 387077 385941 gene locus_tag LOCUS_20900 387077 385941 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168149.1 protein_id gnl|my_center|LOCUS_20900 387957 388820 gene locus_tag LOCUS_20910 387957 388820 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368536.1 protein_id gnl|my_center|LOCUS_20910 389563 388856 gene locus_tag LOCUS_20920 gene phoU 389563 388856 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334097.1 protein_id gnl|my_center|LOCUS_20920 390394 389576 gene locus_tag LOCUS_20930 gene pstB 390394 389576 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706615.1 protein_id gnl|my_center|LOCUS_20930 392074 390425 gene locus_tag LOCUS_20940 gene pstA 392074 390425 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706616.1 protein_id gnl|my_center|LOCUS_20940 394309 392090 gene locus_tag LOCUS_20950 394309 392090 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706617.1 protein_id gnl|my_center|LOCUS_20950 394463 394963 gene locus_tag LOCUS_20960 394463 394963 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351315.1 protein_id gnl|my_center|LOCUS_20960 395040 397094 gene locus_tag LOCUS_20970 gene ppk1 395040 397094 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706631.1 protein_id gnl|my_center|LOCUS_20970 397101 398588 gene locus_tag LOCUS_20980 gene ppx 397101 398588 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706632.1 protein_id gnl|my_center|LOCUS_20980 399083 398592 gene locus_tag LOCUS_20990 gene tadA 399083 398592 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050413802.1 protein_id gnl|my_center|LOCUS_20990 399262 399338 gene locus_tag LOCUS_t00520 399262 399338 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 399881 399420 gene locus_tag LOCUS_21000 399881 399420 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480622.1 protein_id gnl|my_center|LOCUS_21000 400486 400214 gene locus_tag LOCUS_21010 400486 400214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 400618 401385 gene locus_tag LOCUS_21020 400618 401385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 402714 401476 gene locus_tag LOCUS_21030 gene arsJ 402714 401476 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070878.1 protein_id gnl|my_center|LOCUS_21030 403735 402725 gene locus_tag LOCUS_21040 403735 402725 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 protein_id gnl|my_center|LOCUS_21040 404224 403811 gene locus_tag LOCUS_21050 404224 403811 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023042.1 protein_id gnl|my_center|LOCUS_21050 404947 404441 gene locus_tag LOCUS_21060 404947 404441 CDS product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819239.1 protein_id gnl|my_center|LOCUS_21060 406000 404978 gene locus_tag LOCUS_21070 gene arsB 406000 404978 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_21070 406734 406024 gene locus_tag LOCUS_21080 gene arsH 406734 406024 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113752.1 protein_id gnl|my_center|LOCUS_21080 407078 406740 gene locus_tag LOCUS_21090 407078 406740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21090 408289 407318 gene locus_tag LOCUS_21100 408289 407318 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705170.1 protein_id gnl|my_center|LOCUS_21100 409777 408461 gene locus_tag LOCUS_21110 gene phoR 409777 408461 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705169.1 protein_id gnl|my_center|LOCUS_21110 410474 409785 gene locus_tag LOCUS_21120 gene phoB 410474 409785 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298527.1 protein_id gnl|my_center|LOCUS_21120 411022 410561 gene locus_tag LOCUS_21130 411022 410561 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706840.1 protein_id gnl|my_center|LOCUS_21130 411194 412105 gene locus_tag LOCUS_21140 gene rdgC 411194 412105 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 protein_id gnl|my_center|LOCUS_21140 413459 412398 gene locus_tag LOCUS_21150 gene nadA 413459 412398 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818805.1 protein_id gnl|my_center|LOCUS_21150 413654 413579 gene locus_tag LOCUS_t00530 413654 413579 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 413766 413691 gene locus_tag LOCUS_t00540 413766 413691 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 413849 413774 gene locus_tag LOCUS_t00550 413849 413774 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 413933 413858 gene locus_tag LOCUS_t00560 413933 413858 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 414063 413988 gene locus_tag LOCUS_t00570 414063 413988 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 414146 414071 gene locus_tag LOCUS_t00580 414146 414071 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 414230 414155 gene locus_tag LOCUS_t00590 414230 414155 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 414344 414269 gene locus_tag LOCUS_t00600 414344 414269 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 414427 414352 gene locus_tag LOCUS_t00610 414427 414352 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 415267 414575 gene locus_tag LOCUS_21160 gene ybgF 415267 414575 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072685.1 protein_id gnl|my_center|LOCUS_21160 415877 415356 gene locus_tag LOCUS_21170 gene pal 415877 415356 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304908.1 protein_id gnl|my_center|LOCUS_21170 417055 415904 gene locus_tag LOCUS_21180 gene tolB 417055 415904 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707363.1 protein_id gnl|my_center|LOCUS_21180 418461 417205 gene locus_tag LOCUS_21190 418461 417205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 418894 418469 gene locus_tag LOCUS_21200 gene tolR 418894 418469 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 protein_id gnl|my_center|LOCUS_21200 419574 418894 gene locus_tag LOCUS_21210 gene tolQ 419574 418894 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707366.1 protein_id gnl|my_center|LOCUS_21210 420010 419564 gene locus_tag LOCUS_21220 gene ybgC 420010 419564 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707367.1 protein_id gnl|my_center|LOCUS_21220 421144 420137 gene locus_tag LOCUS_21230 gene ruvB 421144 420137 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707371.1 protein_id gnl|my_center|LOCUS_21230 421753 421148 gene locus_tag LOCUS_21240 gene ruvA 421753 421148 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486097.1 protein_id gnl|my_center|LOCUS_21240 422431 421988 gene locus_tag LOCUS_21250 422431 421988 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818372.1 protein_id gnl|my_center|LOCUS_21250 422853 422434 gene locus_tag LOCUS_21260 422853 422434 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479368.1 protein_id gnl|my_center|LOCUS_21260 422980 425994 gene locus_tag LOCUS_21270 422980 425994 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819762.1 protein_id gnl|my_center|LOCUS_21270 426445 425975 gene locus_tag LOCUS_21280 426445 425975 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971406.1 protein_id gnl|my_center|LOCUS_21280 426596 427270 gene locus_tag LOCUS_21290 426596 427270 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_21290 427251 428588 gene locus_tag LOCUS_21300 427251 428588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 430726 428729 gene locus_tag LOCUS_21310 gene tkt 430726 428729 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706909.1 protein_id gnl|my_center|LOCUS_21310 430976 432133 gene locus_tag LOCUS_21320 gene metK 430976 432133 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071209.1 protein_id gnl|my_center|LOCUS_21320 432458 432988 gene locus_tag LOCUS_21330 432458 432988 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706911.1 protein_id gnl|my_center|LOCUS_21330 432985 433455 gene locus_tag LOCUS_21340 432985 433455 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705182.1 protein_id gnl|my_center|LOCUS_21340 433571 434275 gene locus_tag LOCUS_21350 433571 434275 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060390007.1 protein_id gnl|my_center|LOCUS_21350 434253 434984 gene locus_tag LOCUS_21360 gene rsmE 434253 434984 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706913.1 protein_id gnl|my_center|LOCUS_21360 434981 435928 gene locus_tag LOCUS_21370 gene gshB 434981 435928 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706914.1 protein_id gnl|my_center|LOCUS_21370 435992 436546 gene locus_tag LOCUS_21380 435992 436546 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351591.1 protein_id gnl|my_center|LOCUS_21380 436543 436959 gene locus_tag LOCUS_21390 gene ruvX 436543 436959 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 protein_id gnl|my_center|LOCUS_21390 438099 437143 gene locus_tag LOCUS_21400 438099 437143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21400 438438 438199 gene locus_tag LOCUS_21410 438438 438199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21410 439147 438944 gene locus_tag LOCUS_21420 gene cspE 439147 438944 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210893.1 protein_id gnl|my_center|LOCUS_21420 442636 439409 gene locus_tag LOCUS_21430 gene carB 442636 439409 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706535.1 protein_id gnl|my_center|LOCUS_21430 443687 442656 gene locus_tag LOCUS_21440 gene carA 443687 442656 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706536.1 protein_id gnl|my_center|LOCUS_21440 445021 444209 gene locus_tag LOCUS_21450 gene dapB 445021 444209 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706537.1 protein_id gnl|my_center|LOCUS_21450 445762 445151 gene locus_tag LOCUS_21460 445762 445151 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298548.1 protein_id gnl|my_center|LOCUS_21460 446734 445814 gene locus_tag LOCUS_21470 446734 445814 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705173.1 protein_id gnl|my_center|LOCUS_21470 447534 446743 gene locus_tag LOCUS_21480 447534 446743 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705171.1 protein_id gnl|my_center|LOCUS_21480 447885 447625 gene locus_tag LOCUS_21490 447885 447625 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705196.1 protein_id gnl|my_center|LOCUS_21490 448281 449234 gene locus_tag LOCUS_21500 gene ompA 448281 449234 CDS product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705193.1 protein_id gnl|my_center|LOCUS_21500 449342 449800 gene locus_tag LOCUS_21510 449342 449800 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819879.1 protein_id gnl|my_center|LOCUS_21510 449837 450673 gene locus_tag LOCUS_21520 gene purU 449837 450673 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705222.1 protein_id gnl|my_center|LOCUS_21520 451187 450897 gene locus_tag LOCUS_21530 451187 450897 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091898.1 protein_id gnl|my_center|LOCUS_21530 451256 451849 gene locus_tag LOCUS_21540 gene yfbR 451256 451849 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705878.1 protein_id gnl|my_center|LOCUS_21540 452367 451846 gene locus_tag LOCUS_21550 452367 451846 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705036.1 protein_id gnl|my_center|LOCUS_21550 452851 452369 gene locus_tag LOCUS_21560 452851 452369 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819977.1 protein_id gnl|my_center|LOCUS_21560 453336 452854 gene locus_tag LOCUS_21570 453336 452854 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103433.1 protein_id gnl|my_center|LOCUS_21570 454559 453306 gene locus_tag LOCUS_21580 454559 453306 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705033.1 protein_id gnl|my_center|LOCUS_21580 455289 454570 gene locus_tag LOCUS_21590 455289 454570 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705032.1 protein_id gnl|my_center|LOCUS_21590 456533 455286 gene locus_tag LOCUS_21600 456533 455286 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684174.1 protein_id gnl|my_center|LOCUS_21600 457258 456530 gene locus_tag LOCUS_21610 457258 456530 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705030.1 protein_id gnl|my_center|LOCUS_21610 457677 457255 gene locus_tag LOCUS_21620 457677 457255 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705029.1 protein_id gnl|my_center|LOCUS_21620 459083 457674 gene locus_tag LOCUS_21630 gene phrB 459083 457674 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705028.1 protein_id gnl|my_center|LOCUS_21630 459900 459055 gene locus_tag LOCUS_21640 459900 459055 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705027.1 protein_id gnl|my_center|LOCUS_21640 460843 459890 gene locus_tag LOCUS_21650 460843 459890 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705026.1 protein_id gnl|my_center|LOCUS_21650 461271 460993 gene locus_tag LOCUS_21660 461271 460993 CDS product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707127.1 protein_id gnl|my_center|LOCUS_21660 462802 461372 gene locus_tag LOCUS_21670 462802 461372 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102988105.1 protein_id gnl|my_center|LOCUS_21670 462992 463741 gene locus_tag LOCUS_21680 462992 463741 CDS product DUF2989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707125.1 protein_id gnl|my_center|LOCUS_21680 464003 464998 gene locus_tag LOCUS_21690 gene gapA 464003 464998 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224141.1 protein_id gnl|my_center|LOCUS_21690 465074 465931 gene locus_tag LOCUS_21700 465074 465931 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707359.1 protein_id gnl|my_center|LOCUS_21700 465912 466568 gene locus_tag LOCUS_21710 465912 466568 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706997.1 protein_id gnl|my_center|LOCUS_21710 466565 467869 gene locus_tag LOCUS_21720 466565 467869 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104914.1 protein_id gnl|my_center|LOCUS_21720 467929 468288 gene locus_tag LOCUS_21730 467929 468288 CDS product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756596.1 protein_id gnl|my_center|LOCUS_21730 468381 469754 gene locus_tag LOCUS_21740 gene yegQ 468381 469754 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704950.1 protein_id gnl|my_center|LOCUS_21740 472036 469889 gene locus_tag LOCUS_21750 gene pnp 472036 469889 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707071.1 protein_id gnl|my_center|LOCUS_21750 472909 472133 gene locus_tag LOCUS_21760 472909 472133 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268115.1 protein_id gnl|my_center|LOCUS_21760 473381 473112 gene locus_tag LOCUS_21770 gene rpsO 473381 473112 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298162.1 protein_id gnl|my_center|LOCUS_21770 474433 473498 gene locus_tag LOCUS_21780 gene truB 474433 473498 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351717.1 protein_id gnl|my_center|LOCUS_21780 474846 474436 gene locus_tag LOCUS_21790 gene rbfA 474846 474436 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707073.1 protein_id gnl|my_center|LOCUS_21790 477622 474929 gene locus_tag LOCUS_21800 gene infB 477622 474929 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481598.1 protein_id gnl|my_center|LOCUS_21800 479144 477642 gene locus_tag LOCUS_21810 gene nusA 479144 477642 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707075.1 protein_id gnl|my_center|LOCUS_21810 479617 479159 gene locus_tag LOCUS_21820 gene rimP 479617 479159 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351719.1 protein_id gnl|my_center|LOCUS_21820 479871 479795 gene locus_tag LOCUS_t00620 479871 479795 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 480016 479930 gene locus_tag LOCUS_t00630 480016 479930 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 480359 480024 gene locus_tag LOCUS_21830 gene secG 480359 480024 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005050778.1 protein_id gnl|my_center|LOCUS_21830 482001 480676 gene locus_tag LOCUS_21840 gene glmM 482001 480676 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_21840 482789 482007 gene locus_tag LOCUS_21850 gene folP 482789 482007 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707079.1 protein_id gnl|my_center|LOCUS_21850 484806 482911 gene locus_tag LOCUS_21860 gene ftsH 484806 482911 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 protein_id gnl|my_center|LOCUS_21860 485534 484905 gene locus_tag LOCUS_21870 gene rlmE 485534 484905 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707081.1 protein_id gnl|my_center|LOCUS_21870 485620 485916 gene locus_tag LOCUS_21880 gene yhbY 485620 485916 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298134.1 protein_id gnl|my_center|LOCUS_21880 486064 486672 gene locus_tag LOCUS_21890 486064 486672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 487184 486708 gene locus_tag LOCUS_21900 gene greA 487184 486708 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707083.1 protein_id gnl|my_center|LOCUS_21900 488452 487319 gene locus_tag LOCUS_21910 gene dnaJ 488452 487319 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706780.1 protein_id gnl|my_center|LOCUS_21910 490467 488545 gene locus_tag LOCUS_21920 gene dnaK 490467 488545 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706781.1 protein_id gnl|my_center|LOCUS_21920 491194 490592 gene locus_tag LOCUS_21930 gene grpE 491194 490592 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706782.1 protein_id gnl|my_center|LOCUS_21930 491382 492266 gene locus_tag LOCUS_21940 gene nadK 491382 492266 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303013.1 protein_id gnl|my_center|LOCUS_21940 492438 494108 gene locus_tag LOCUS_21950 gene recN 492438 494108 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706784.1 protein_id gnl|my_center|LOCUS_21950 494905 494147 gene locus_tag LOCUS_21960 gene udp 494905 494147 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705364.1 protein_id gnl|my_center|LOCUS_21960 495073 495411 gene locus_tag LOCUS_21970 495073 495411 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705347.1 protein_id gnl|my_center|LOCUS_21970 495823 495482 gene locus_tag LOCUS_21980 495823 495482 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705345.1 protein_id gnl|my_center|LOCUS_21980 496253 495804 gene locus_tag LOCUS_21990 496253 495804 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705344.1 protein_id gnl|my_center|LOCUS_21990 496390 496875 gene locus_tag LOCUS_22000 gene smpB 496390 496875 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705343.1 protein_id gnl|my_center|LOCUS_22000 496921 497279 gene locus_tag LOCUS_tm00010 496921 497279 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 499997 497343 gene locus_tag LOCUS_22010 499997 497343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 500321 501349 gene locus_tag LOCUS_22020 500321 501349 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 protein_id gnl|my_center|LOCUS_22020 501346 502146 gene locus_tag LOCUS_22030 501346 502146 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 protein_id gnl|my_center|LOCUS_22030 502162 502809 gene locus_tag LOCUS_22040 502162 502809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 503075 503674 gene locus_tag LOCUS_22050 503075 503674 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071909.1 protein_id gnl|my_center|LOCUS_22050 505258 503738 gene locus_tag LOCUS_22060 gene purF 505258 503738 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705746.1 protein_id gnl|my_center|LOCUS_22060 505767 505279 gene locus_tag LOCUS_22070 505767 505279 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072963.1 protein_id gnl|my_center|LOCUS_22070 507534 505918 gene locus_tag LOCUS_22080 507534 505918 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484923.1 protein_id gnl|my_center|LOCUS_22080 507865 508092 gene locus_tag LOCUS_22090 507865 508092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 509436 508138 gene locus_tag LOCUS_22100 gene serS 509436 508138 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705744.1 protein_id gnl|my_center|LOCUS_22100 510858 509509 gene locus_tag LOCUS_22110 510858 509509 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196299305.1 protein_id gnl|my_center|LOCUS_22110 511540 510932 gene locus_tag LOCUS_22120 gene lolA 511540 510932 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705742.1 protein_id gnl|my_center|LOCUS_22120 514141 511544 gene locus_tag LOCUS_22130 514141 511544 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705741.1 protein_id gnl|my_center|LOCUS_22130 514816 514313 gene locus_tag LOCUS_22140 gene lrp 514816 514313 CDS product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228473.1 protein_id gnl|my_center|LOCUS_22140 515467 516423 gene locus_tag LOCUS_22150 gene trxB 515467 516423 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073137.1 protein_id gnl|my_center|LOCUS_22150 518229 516436 gene locus_tag LOCUS_22160 gene dauA 518229 516436 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925752.1 protein_id gnl|my_center|LOCUS_22160 518339 518512 gene locus_tag LOCUS_22170 518339 518512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 518527 519222 gene locus_tag LOCUS_22180 gene aat 518527 519222 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705736.1 protein_id gnl|my_center|LOCUS_22180 519219 519923 gene locus_tag LOCUS_22190 519219 519923 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705735.1 protein_id gnl|my_center|LOCUS_22190 520000 520218 gene locus_tag LOCUS_22200 gene infA 520000 520218 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 protein_id gnl|my_center|LOCUS_22200 522644 520386 gene locus_tag LOCUS_22210 gene clpA 522644 520386 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705733.1 protein_id gnl|my_center|LOCUS_22210 523011 522694 gene locus_tag LOCUS_22220 gene clpS 523011 522694 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300028.1 protein_id gnl|my_center|LOCUS_22220 523399 523614 gene locus_tag LOCUS_22230 gene cspD 523399 523614 CDS product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211350.1 protein_id gnl|my_center|LOCUS_22230 523780 524190 gene locus_tag LOCUS_22240 gene mscL 523780 524190 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243783.1 protein_id gnl|my_center|LOCUS_22240 524199 524519 gene locus_tag LOCUS_22250 524199 524519 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943418.1 protein_id gnl|my_center|LOCUS_22250 526195 524522 gene locus_tag LOCUS_22260 gene treC 526195 524522 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707528.1 protein_id gnl|my_center|LOCUS_22260 527679 526264 gene locus_tag LOCUS_22270 gene treB 527679 526264 CDS product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042066915.1 protein_id gnl|my_center|LOCUS_22270 527815 528777 gene locus_tag LOCUS_22280 gene treR 527815 528777 CDS product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707530.1 protein_id gnl|my_center|LOCUS_22280 528849 531479 gene locus_tag LOCUS_22290 gene glnD 528849 531479 CDS product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705092.1 protein_id gnl|my_center|LOCUS_22290 531637 532668 gene locus_tag LOCUS_22300 gene dapD 531637 532668 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113860.1 protein_id gnl|my_center|LOCUS_22300 533065 534441 gene locus_tag LOCUS_22310 gene dbpA 533065 534441 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704511.1 protein_id gnl|my_center|LOCUS_22310 534779 534516 gene locus_tag LOCUS_22320 534779 534516 CDS product DUF3081 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464900.1 protein_id gnl|my_center|LOCUS_22320 536759 534921 gene locus_tag LOCUS_22330 536759 534921 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_22330 537023 537856 gene locus_tag LOCUS_22340 537023 537856 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817517.1 protein_id gnl|my_center|LOCUS_22340 538341 537901 gene locus_tag LOCUS_22350 538341 537901 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705087.1 protein_id gnl|my_center|LOCUS_22350 539267 538353 gene locus_tag LOCUS_22360 gene glsB 539267 538353 CDS product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927734.1 protein_id gnl|my_center|LOCUS_22360 540049 539318 gene locus_tag LOCUS_22370 gene truC 540049 539318 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705086.1 protein_id gnl|my_center|LOCUS_22370 540381 540046 gene locus_tag LOCUS_22380 540381 540046 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705085.1 protein_id gnl|my_center|LOCUS_22380 540469 541506 gene locus_tag LOCUS_22390 540469 541506 CDS product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705084.1 protein_id gnl|my_center|LOCUS_22390 541499 541801 gene locus_tag LOCUS_22400 541499 541801 CDS product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261354.1 protein_id gnl|my_center|LOCUS_22400 541827 542054 gene locus_tag LOCUS_22410 541827 542054 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771165.1 protein_id gnl|my_center|LOCUS_22410 542071 542349 gene locus_tag LOCUS_22420 542071 542349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 542349 543122 gene locus_tag LOCUS_22430 542349 543122 CDS product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705081.1 protein_id gnl|my_center|LOCUS_22430 543657 543127 gene locus_tag LOCUS_22440 543657 543127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 543712 544566 gene locus_tag LOCUS_22450 gene queF 543712 544566 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819527.1 protein_id gnl|my_center|LOCUS_22450 544768 546918 gene locus_tag LOCUS_22460 544768 546918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705078.1 protein_id gnl|my_center|LOCUS_22460 546958 548484 gene locus_tag LOCUS_22470 546958 548484 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705077.1 protein_id gnl|my_center|LOCUS_22470 548514 549869 gene locus_tag LOCUS_22480 gene ppnN 548514 549869 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705076.1 protein_id gnl|my_center|LOCUS_22480 549876 550658 gene locus_tag LOCUS_22490 gene xni 549876 550658 CDS product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927567.1 protein_id gnl|my_center|LOCUS_22490 550739 551746 gene locus_tag LOCUS_22500 550739 551746 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705074.1 protein_id gnl|my_center|LOCUS_22500 551842 552234 gene locus_tag LOCUS_22510 551842 552234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 553302 552211 gene locus_tag LOCUS_22520 gene rlmM 553302 552211 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705072.1 protein_id gnl|my_center|LOCUS_22520 553685 553299 gene locus_tag LOCUS_22530 553685 553299 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705071.1 protein_id gnl|my_center|LOCUS_22530 554289 553675 gene locus_tag LOCUS_22540 554289 553675 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705070.1 protein_id gnl|my_center|LOCUS_22540 555197 554286 gene locus_tag LOCUS_22550 555197 554286 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303519.1 protein_id gnl|my_center|LOCUS_22550 555398 556018 gene locus_tag LOCUS_22560 555398 556018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 556076 556609 gene locus_tag LOCUS_22570 556076 556609 CDS product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183353796.1 protein_id gnl|my_center|LOCUS_22570 557344 556610 gene locus_tag LOCUS_22580 557344 556610 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477841.1 protein_id gnl|my_center|LOCUS_22580 559225 557354 gene locus_tag LOCUS_22590 559225 557354 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421488.1 protein_id gnl|my_center|LOCUS_22590 560944 559307 gene locus_tag LOCUS_22600 560944 559307 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 protein_id gnl|my_center|LOCUS_22600 561318 561242 gene locus_tag LOCUS_t00640 561318 561242 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 562582 561455 gene locus_tag LOCUS_22610 562582 561455 CDS product TIGR03503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705466.1 protein_id gnl|my_center|LOCUS_22610 563316 562579 gene locus_tag LOCUS_22620 gene dnaQ 563316 562579 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705465.1 protein_id gnl|my_center|LOCUS_22620 563463 563924 gene locus_tag LOCUS_22630 gene rnhA 563463 563924 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705464.1 protein_id gnl|my_center|LOCUS_22630 564628 563912 gene locus_tag LOCUS_22640 564628 563912 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350242.1 protein_id gnl|my_center|LOCUS_22640 564676 565446 gene locus_tag LOCUS_22650 gene gloB 564676 565446 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705462.1 protein_id gnl|my_center|LOCUS_22650 565801 566919 gene locus_tag LOCUS_22660 565801 566919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 567723 566953 gene locus_tag LOCUS_22670 567723 566953 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262419.1 protein_id gnl|my_center|LOCUS_22670 568162 567764 gene locus_tag LOCUS_22680 gene yciA 568162 567764 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077272.1 protein_id gnl|my_center|LOCUS_22680 568252 568803 gene locus_tag LOCUS_22690 gene yjjX 568252 568803 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226224.1 protein_id gnl|my_center|LOCUS_22690 569569 568757 gene locus_tag LOCUS_22700 569569 568757 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705457.1 protein_id gnl|my_center|LOCUS_22700 571466 569559 gene locus_tag LOCUS_22710 571466 569559 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705455.1 protein_id gnl|my_center|LOCUS_22710 571777 572103 gene locus_tag LOCUS_22720 gene raiA 571777 572103 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705453.1 protein_id gnl|my_center|LOCUS_22720 572444 574333 gene locus_tag LOCUS_22730 572444 574333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 575580 574450 gene locus_tag LOCUS_22740 gene tyrA 575580 574450 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705546.1 protein_id gnl|my_center|LOCUS_22740 576784 575714 gene locus_tag LOCUS_22750 576784 575714 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705545.1 protein_id gnl|my_center|LOCUS_22750 577023 577319 gene locus_tag LOCUS_22760 577023 577319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 577414 578010 gene locus_tag LOCUS_22770 577414 578010 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931044.1 protein_id gnl|my_center|LOCUS_22770 578951 578163 gene locus_tag LOCUS_22780 578951 578163 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301472.1 protein_id gnl|my_center|LOCUS_22780 580236 579025 gene locus_tag LOCUS_22790 gene ccmI 580236 579025 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705304.1 protein_id gnl|my_center|LOCUS_22790 580711 580238 gene locus_tag LOCUS_22800 580711 580238 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 protein_id gnl|my_center|LOCUS_22800 581248 580715 gene locus_tag LOCUS_22810 581248 580715 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298853.1 protein_id gnl|my_center|LOCUS_22810 583200 581245 gene locus_tag LOCUS_22820 583200 581245 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705302.1 protein_id gnl|my_center|LOCUS_22820 583691 583197 gene locus_tag LOCUS_22830 gene ccmE 583691 583197 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705301.1 protein_id gnl|my_center|LOCUS_22830 583894 583688 gene locus_tag LOCUS_22840 gene ccmD 583894 583688 CDS product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705300.1 protein_id gnl|my_center|LOCUS_22840 584639 583884 gene locus_tag LOCUS_22850 584639 583884 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705299.1 protein_id gnl|my_center|LOCUS_22850 585390 584722 gene locus_tag LOCUS_22860 gene ccmB 585390 584722 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705298.1 protein_id gnl|my_center|LOCUS_22860 586019 585387 gene locus_tag LOCUS_22870 gene ccmA 586019 585387 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705297.1 protein_id gnl|my_center|LOCUS_22870 586026 586250 gene locus_tag LOCUS_22880 586026 586250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 586791 586207 gene locus_tag LOCUS_22890 586791 586207 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029627583.1 protein_id gnl|my_center|LOCUS_22890 586976 587419 gene locus_tag LOCUS_22900 586976 587419 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482841.1 protein_id gnl|my_center|LOCUS_22900 587923 587519 gene locus_tag LOCUS_22910 587923 587519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 588411 587923 gene locus_tag LOCUS_22920 588411 587923 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298836.1 protein_id gnl|my_center|LOCUS_22920 589201 588431 gene locus_tag LOCUS_22930 589201 588431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 589929 589198 gene locus_tag LOCUS_22940 589929 589198 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705294.1 protein_id gnl|my_center|LOCUS_22940 590823 589987 gene locus_tag LOCUS_22950 590823 589987 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705293.1 protein_id gnl|my_center|LOCUS_22950 591563 590820 gene locus_tag LOCUS_22960 591563 590820 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943899.1 protein_id gnl|my_center|LOCUS_22960 592674 591565 gene locus_tag LOCUS_22970 592674 591565 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705291.1 protein_id gnl|my_center|LOCUS_22970 594765 592702 gene locus_tag LOCUS_22980 594765 592702 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705290.1 protein_id gnl|my_center|LOCUS_22980 595524 594775 gene locus_tag LOCUS_22990 595524 594775 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705289.1 protein_id gnl|my_center|LOCUS_22990 595919 595536 gene locus_tag LOCUS_23000 gene cheY 595919 595536 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634617.1 protein_id gnl|my_center|LOCUS_23000 596761 596045 gene locus_tag LOCUS_23010 596761 596045 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705288.1 protein_id gnl|my_center|LOCUS_23010 597638 596754 gene locus_tag LOCUS_23020 597638 596754 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634619.1 protein_id gnl|my_center|LOCUS_23020 598998 597631 gene locus_tag LOCUS_23030 gene flhF 598998 597631 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705286.1 protein_id gnl|my_center|LOCUS_23030 601112 599016 gene locus_tag LOCUS_23040 gene flhA 601112 599016 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705285.1 protein_id gnl|my_center|LOCUS_23040 602355 601222 gene locus_tag LOCUS_23050 gene flhB 602355 601222 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705284.1 protein_id gnl|my_center|LOCUS_23050 603144 602356 gene locus_tag LOCUS_23060 gene fliR 603144 602356 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705283.1 protein_id gnl|my_center|LOCUS_23060 603706 603437 gene locus_tag LOCUS_23070 gene fliQ 603706 603437 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705282.1 protein_id gnl|my_center|LOCUS_23070 604449 603706 gene locus_tag LOCUS_23080 gene fliP 604449 603706 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705281.1 protein_id gnl|my_center|LOCUS_23080 604795 604436 gene locus_tag LOCUS_23090 gene fliO 604795 604436 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228179.1 protein_id gnl|my_center|LOCUS_23090 605193 604795 gene locus_tag LOCUS_23100 gene fliN 605193 604795 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705280.1 protein_id gnl|my_center|LOCUS_23100 606248 605190 gene locus_tag LOCUS_23110 gene fliM 606248 605190 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705279.1 protein_id gnl|my_center|LOCUS_23110 606729 606256 gene locus_tag LOCUS_23120 gene fliL 606729 606256 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705278.1 protein_id gnl|my_center|LOCUS_23120 608730 606772 gene locus_tag LOCUS_23130 608730 606772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 609249 608812 gene locus_tag LOCUS_23140 gene fliJ 609249 608812 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705276.1 protein_id gnl|my_center|LOCUS_23140 610580 609249 gene locus_tag LOCUS_23150 gene fliI 610580 609249 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705275.1 protein_id gnl|my_center|LOCUS_23150 611379 610567 gene locus_tag LOCUS_23160 gene fliH 611379 610567 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705274.1 protein_id gnl|my_center|LOCUS_23160 612422 611376 gene locus_tag LOCUS_23170 gene fliG 612422 611376 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705273.1 protein_id gnl|my_center|LOCUS_23170 614127 612415 gene locus_tag LOCUS_23180 gene fliF 614127 612415 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705272.1 protein_id gnl|my_center|LOCUS_23180 614450 614136 gene locus_tag LOCUS_23190 gene fliE 614450 614136 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705271.1 protein_id gnl|my_center|LOCUS_23190 615898 614558 gene locus_tag LOCUS_23200 615898 614558 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706626.1 protein_id gnl|my_center|LOCUS_23200 616946 615912 gene locus_tag LOCUS_23210 616946 615912 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706627.1 protein_id gnl|my_center|LOCUS_23210 618646 617123 gene locus_tag LOCUS_23220 618646 617123 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_23220 620162 618720 gene locus_tag LOCUS_23230 620162 618720 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818210.1 protein_id gnl|my_center|LOCUS_23230 620715 621713 gene locus_tag LOCUS_23240 gene pseB 620715 621713 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_23240 621717 622871 gene locus_tag LOCUS_23250 gene pseC 621717 622871 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_23250 622906 623793 gene locus_tag LOCUS_23260 622906 623793 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869424.1 protein_id gnl|my_center|LOCUS_23260 623853 625817 gene locus_tag LOCUS_23270 623853 625817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 625817 626932 gene locus_tag LOCUS_23280 gene pseG 625817 626932 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867753.1 protein_id gnl|my_center|LOCUS_23280 626970 627452 gene locus_tag LOCUS_23290 gene pseH 626970 627452 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265718.1 protein_id gnl|my_center|LOCUS_23290 627464 628519 gene locus_tag LOCUS_23300 gene pseI 627464 628519 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867750.1 protein_id gnl|my_center|LOCUS_23300 628587 629909 gene locus_tag LOCUS_23310 628587 629909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 629887 630636 gene locus_tag LOCUS_23320 629887 630636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 631636 630686 gene locus_tag LOCUS_23330 631636 630686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 633754 631646 gene locus_tag LOCUS_23340 633754 631646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 634174 633788 gene locus_tag LOCUS_23350 gene fliS 634174 633788 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073117.1 protein_id gnl|my_center|LOCUS_23350 634480 634184 gene locus_tag LOCUS_23360 634480 634184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 635862 634477 gene locus_tag LOCUS_23370 gene fliD 635862 634477 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073119.1 protein_id gnl|my_center|LOCUS_23370 636284 635874 gene locus_tag LOCUS_23380 gene flaG 636284 635874 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481049.1 protein_id gnl|my_center|LOCUS_23380 637259 636438 gene locus_tag LOCUS_23390 637259 636438 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073122.1 protein_id gnl|my_center|LOCUS_23390 637500 637679 gene locus_tag LOCUS_23400 637500 637679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 638991 637762 gene locus_tag LOCUS_23410 gene flgL 638991 637762 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420383.1 protein_id gnl|my_center|LOCUS_23410 640947 639001 gene locus_tag LOCUS_23420 gene flgK 640947 639001 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073124.1 protein_id gnl|my_center|LOCUS_23420 641940 640957 gene locus_tag LOCUS_23430 gene flgJ 641940 640957 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065604908.1 protein_id gnl|my_center|LOCUS_23430 643432 642329 gene locus_tag LOCUS_23440 643432 642329 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706637.1 protein_id gnl|my_center|LOCUS_23440 644267 643593 gene locus_tag LOCUS_23450 gene flgH 644267 643593 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706638.1 protein_id gnl|my_center|LOCUS_23450 645070 644282 gene locus_tag LOCUS_23460 gene flgG 645070 644282 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706639.1 protein_id gnl|my_center|LOCUS_23460 645828 645082 gene locus_tag LOCUS_23470 gene flgF 645828 645082 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706640.1 protein_id gnl|my_center|LOCUS_23470 645929 646309 gene locus_tag LOCUS_23480 645929 646309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 647651 646395 gene locus_tag LOCUS_23490 gene flgE 647651 646395 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706641.1 protein_id gnl|my_center|LOCUS_23490 648361 647663 gene locus_tag LOCUS_23500 648361 647663 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706642.1 protein_id gnl|my_center|LOCUS_23500 648787 648368 gene locus_tag LOCUS_23510 gene flgC 648787 648368 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706643.1 protein_id gnl|my_center|LOCUS_23510 649185 648784 gene locus_tag LOCUS_23520 gene flgB 649185 648784 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706644.1 protein_id gnl|my_center|LOCUS_23520 650070 649249 gene locus_tag LOCUS_23530 650070 649249 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706645.1 protein_id gnl|my_center|LOCUS_23530 651004 650090 gene locus_tag LOCUS_23540 651004 650090 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706646.1 protein_id gnl|my_center|LOCUS_23540 651220 651879 gene locus_tag LOCUS_23550 gene flgA 651220 651879 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161785096.1 protein_id gnl|my_center|LOCUS_23550 651951 652274 gene locus_tag LOCUS_23560 gene flgM 651951 652274 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098742.1 protein_id gnl|my_center|LOCUS_23560 652271 652684 gene locus_tag LOCUS_23570 652271 652684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence19 1676 408 gene locus_tag LOCUS_23580 1676 408 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969451.1 protein_id gnl|my_center|LOCUS_23580 2173 1673 gene locus_tag LOCUS_23590 2173 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 3190 2219 gene locus_tag LOCUS_23600 3190 2219 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 protein_id gnl|my_center|LOCUS_23600 4022 3312 gene locus_tag LOCUS_23610 4022 3312 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930981.1 protein_id gnl|my_center|LOCUS_23610 5061 4030 gene locus_tag LOCUS_23620 gene gtdA 5061 4030 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113291.1 protein_id gnl|my_center|LOCUS_23620 6316 5108 gene locus_tag LOCUS_23630 6316 5108 CDS product 3-hydroxybenzoate 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150113.1 protein_id gnl|my_center|LOCUS_23630 6992 6351 gene locus_tag LOCUS_23640 gene maiA 6992 6351 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706104.1 protein_id gnl|my_center|LOCUS_23640 7704 7006 gene locus_tag LOCUS_23650 7704 7006 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089781.1 protein_id gnl|my_center|LOCUS_23650 7884 8813 gene locus_tag LOCUS_23660 7884 8813 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089777.1 protein_id gnl|my_center|LOCUS_23660 9854 8907 gene locus_tag LOCUS_23670 9854 8907 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450998.1 protein_id gnl|my_center|LOCUS_23670 10920 9979 gene locus_tag LOCUS_23680 10920 9979 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456630.1 protein_id gnl|my_center|LOCUS_23680 11890 10922 gene locus_tag LOCUS_23690 11890 10922 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456615.1 protein_id gnl|my_center|LOCUS_23690 13210 11903 gene locus_tag LOCUS_23700 13210 11903 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456652.1 protein_id gnl|my_center|LOCUS_23700 14452 13232 gene locus_tag LOCUS_23710 14452 13232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 14976 14467 gene locus_tag LOCUS_23720 14976 14467 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456608.1 protein_id gnl|my_center|LOCUS_23720 15437 14973 gene locus_tag LOCUS_23730 15437 14973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 16774 15437 gene locus_tag LOCUS_23740 16774 15437 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451008.1 protein_id gnl|my_center|LOCUS_23740 17058 16789 gene locus_tag LOCUS_23750 17058 16789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 18472 17069 gene locus_tag LOCUS_23760 18472 17069 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456668.1 protein_id gnl|my_center|LOCUS_23760 19294 18512 gene locus_tag LOCUS_23770 gene cpaB 19294 18512 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 protein_id gnl|my_center|LOCUS_23770 20581 19343 gene locus_tag LOCUS_23780 20581 19343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456587.1 protein_id gnl|my_center|LOCUS_23780 21044 20757 gene locus_tag LOCUS_23790 21044 20757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 21549 21340 gene locus_tag LOCUS_23800 21549 21340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 22509 22342 gene locus_tag LOCUS_23810 22509 22342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 23920 22613 gene locus_tag LOCUS_23820 23920 22613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 24328 23984 gene locus_tag LOCUS_23830 24328 23984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 24448 25848 gene locus_tag LOCUS_23840 gene asnS 24448 25848 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705384.1 protein_id gnl|my_center|LOCUS_23840 26081 27757 gene locus_tag LOCUS_23850 26081 27757 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706435.1 protein_id gnl|my_center|LOCUS_23850 27754 28467 gene locus_tag LOCUS_23860 gene btsR 27754 28467 CDS product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706436.1 protein_id gnl|my_center|LOCUS_23860 28616 30043 gene locus_tag LOCUS_23870 28616 30043 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706437.1 protein_id gnl|my_center|LOCUS_23870 31444 30152 gene locus_tag LOCUS_23880 31444 30152 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456001.1 protein_id gnl|my_center|LOCUS_23880 32299 31748 gene locus_tag LOCUS_23890 32299 31748 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105229.1 protein_id gnl|my_center|LOCUS_23890 32955 32302 gene locus_tag LOCUS_23900 gene ureG 32955 32302 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_23900 33612 32959 gene locus_tag LOCUS_23910 33612 32959 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 protein_id gnl|my_center|LOCUS_23910 34087 33614 gene locus_tag LOCUS_23920 gene ureE 34087 33614 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095526.1 protein_id gnl|my_center|LOCUS_23920 36052 34346 gene locus_tag LOCUS_23930 gene ureC 36052 34346 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 protein_id gnl|my_center|LOCUS_23930 36368 36039 gene locus_tag LOCUS_23940 36368 36039 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084271.1 protein_id gnl|my_center|LOCUS_23940 36680 36378 gene locus_tag LOCUS_23950 gene ureA 36680 36378 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317023.1 protein_id gnl|my_center|LOCUS_23950 37575 36694 gene locus_tag LOCUS_23960 37575 36694 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269030.1 protein_id gnl|my_center|LOCUS_23960 37679 37825 gene locus_tag LOCUS_23970 37679 37825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 39185 37830 gene locus_tag LOCUS_23980 39185 37830 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459893.1 protein_id gnl|my_center|LOCUS_23980 41685 39802 gene locus_tag LOCUS_23990 41685 39802 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625986.1 protein_id gnl|my_center|LOCUS_23990 43512 42061 gene locus_tag LOCUS_24000 43512 42061 CDS product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706120.1 protein_id gnl|my_center|LOCUS_24000 44974 43862 gene locus_tag LOCUS_24010 gene prpC 44974 43862 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271319.1 protein_id gnl|my_center|LOCUS_24010 45842 44967 gene locus_tag LOCUS_24020 gene prpB 45842 44967 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464610.1 protein_id gnl|my_center|LOCUS_24020 46486 45839 gene locus_tag LOCUS_24030 46486 45839 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842742.1 protein_id gnl|my_center|LOCUS_24030 48844 46943 gene locus_tag LOCUS_24040 48844 46943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 49407 48847 gene locus_tag LOCUS_24050 49407 48847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349563.1 protein_id gnl|my_center|LOCUS_24050 53203 49760 gene locus_tag LOCUS_24060 gene mscK 53203 49760 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704612.1 protein_id gnl|my_center|LOCUS_24060 53297 53539 gene locus_tag LOCUS_24070 53297 53539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 55469 53526 gene locus_tag LOCUS_24080 55469 53526 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706940.1 protein_id gnl|my_center|LOCUS_24080 56435 55566 gene locus_tag LOCUS_24090 gene purU 56435 55566 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763680.1 protein_id gnl|my_center|LOCUS_24090 57005 56523 gene locus_tag LOCUS_24100 57005 56523 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706386.1 protein_id gnl|my_center|LOCUS_24100 57356 57042 gene locus_tag LOCUS_24110 57356 57042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 58984 57353 gene locus_tag LOCUS_24120 58984 57353 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669793.1 protein_id gnl|my_center|LOCUS_24120 59133 59774 gene locus_tag LOCUS_24130 59133 59774 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928746.1 protein_id gnl|my_center|LOCUS_24130 60466 59783 gene locus_tag LOCUS_24140 60466 59783 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728517.1 protein_id gnl|my_center|LOCUS_24140 60667 61929 gene locus_tag LOCUS_24150 60667 61929 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338735.1 protein_id gnl|my_center|LOCUS_24150 63753 61963 gene locus_tag LOCUS_24160 63753 61963 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267534.1 protein_id gnl|my_center|LOCUS_24160 64590 63979 gene locus_tag LOCUS_24170 64590 63979 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929111.1 protein_id gnl|my_center|LOCUS_24170 64699 65712 gene locus_tag LOCUS_24180 64699 65712 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391989.1 protein_id gnl|my_center|LOCUS_24180 65980 65621 gene locus_tag LOCUS_24190 65980 65621 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707692.1 protein_id gnl|my_center|LOCUS_24190 66080 66283 gene locus_tag LOCUS_24200 66080 66283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528374.1 protein_id gnl|my_center|LOCUS_24200 67653 66694 gene locus_tag LOCUS_24210 gene gcvA 67653 66694 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200344113.1 protein_id gnl|my_center|LOCUS_24210 67844 68827 gene locus_tag LOCUS_24220 67844 68827 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480142.1 protein_id gnl|my_center|LOCUS_24220 69158 70045 gene locus_tag LOCUS_24230 69158 70045 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219805.1 protein_id gnl|my_center|LOCUS_24230 71470 70604 gene locus_tag LOCUS_24240 71470 70604 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103368.1 protein_id gnl|my_center|LOCUS_24240 72368 71478 gene locus_tag LOCUS_24250 gene rarD 72368 71478 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268385.1 protein_id gnl|my_center|LOCUS_24250 72655 73506 gene locus_tag LOCUS_24260 72655 73506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 74224 73514 gene locus_tag LOCUS_24270 74224 73514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 74668 74228 gene locus_tag LOCUS_24280 74668 74228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 75297 74671 gene locus_tag LOCUS_24290 75297 74671 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_24290 75990 75379 gene locus_tag LOCUS_24300 75990 75379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 76888 76133 gene locus_tag LOCUS_24310 76888 76133 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086532.1 protein_id gnl|my_center|LOCUS_24310 77073 78119 gene locus_tag LOCUS_24320 77073 78119 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818921.1 protein_id gnl|my_center|LOCUS_24320 78122 78925 gene locus_tag LOCUS_24330 78122 78925 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463458.1 protein_id gnl|my_center|LOCUS_24330 79099 79908 gene locus_tag LOCUS_24340 79099 79908 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091588.1 protein_id gnl|my_center|LOCUS_24340 79901 80683 gene locus_tag LOCUS_24350 79901 80683 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263896.1 protein_id gnl|my_center|LOCUS_24350 80683 81699 gene locus_tag LOCUS_24360 80683 81699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479814.1 protein_id gnl|my_center|LOCUS_24360 81699 82352 gene locus_tag LOCUS_24370 81699 82352 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816005.1 protein_id gnl|my_center|LOCUS_24370 82873 84630 gene locus_tag LOCUS_24380 82873 84630 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070895.1 protein_id gnl|my_center|LOCUS_24380 85807 84656 gene locus_tag LOCUS_24390 gene yiaY 85807 84656 CDS product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369197.1 protein_id gnl|my_center|LOCUS_24390 87447 85930 gene locus_tag LOCUS_24400 87447 85930 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819563.1 protein_id gnl|my_center|LOCUS_24400 87687 89411 gene locus_tag LOCUS_24410 87687 89411 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705165.1 protein_id gnl|my_center|LOCUS_24410 90490 89408 gene locus_tag LOCUS_24420 90490 89408 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071377.1 protein_id gnl|my_center|LOCUS_24420 91326 90676 gene locus_tag LOCUS_24430 91326 90676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444495.1 protein_id gnl|my_center|LOCUS_24430 91580 92146 gene locus_tag LOCUS_24440 91580 92146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 92264 92178 gene locus_tag LOCUS_t00650 92264 92178 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 92358 92285 gene locus_tag LOCUS_t00660 92358 92285 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 93068 92520 gene locus_tag LOCUS_24450 gene pgsA 93068 92520 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706577.1 protein_id gnl|my_center|LOCUS_24450 94947 93118 gene locus_tag LOCUS_24460 gene uvrC 94947 93118 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706578.1 protein_id gnl|my_center|LOCUS_24460 95517 94954 gene locus_tag LOCUS_24470 gene uvrY 95517 94954 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706579.1 protein_id gnl|my_center|LOCUS_24470 97699 95804 gene locus_tag LOCUS_24480 gene ppiD 97699 95804 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817666.1 protein_id gnl|my_center|LOCUS_24480 98094 97816 gene locus_tag LOCUS_24490 gene hupB 98094 97816 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_24490 100655 98304 gene locus_tag LOCUS_24500 gene lon 100655 98304 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705882.1 protein_id gnl|my_center|LOCUS_24500 102073 100793 gene locus_tag LOCUS_24510 gene clpX 102073 100793 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301524.1 protein_id gnl|my_center|LOCUS_24510 102756 102154 gene locus_tag LOCUS_24520 gene clpP 102756 102154 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482529.1 protein_id gnl|my_center|LOCUS_24520 104175 102865 gene locus_tag LOCUS_24530 gene tig 104175 102865 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705880.1 protein_id gnl|my_center|LOCUS_24530 107194 104528 gene locus_tag LOCUS_24540 gene adhE 107194 104528 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533913.1 protein_id gnl|my_center|LOCUS_24540 109144 107447 gene locus_tag LOCUS_24550 109144 107447 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705191.1 protein_id gnl|my_center|LOCUS_24550 110342 109257 gene locus_tag LOCUS_24560 110342 109257 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705188.1 protein_id gnl|my_center|LOCUS_24560 110547 110954 gene locus_tag LOCUS_24570 110547 110954 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043162216.1 protein_id gnl|my_center|LOCUS_24570 110967 112100 gene locus_tag LOCUS_24580 gene dapE 110967 112100 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705377.1 protein_id gnl|my_center|LOCUS_24580 112097 112771 gene locus_tag LOCUS_24590 112097 112771 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208550.1 protein_id gnl|my_center|LOCUS_24590 112775 112990 gene locus_tag LOCUS_24600 112775 112990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298986.1 protein_id gnl|my_center|LOCUS_24600 115357 113009 gene locus_tag LOCUS_24610 115357 113009 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489176.1 protein_id gnl|my_center|LOCUS_24610 116464 115460 gene locus_tag LOCUS_24620 gene bamC 116464 115460 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262400.1 protein_id gnl|my_center|LOCUS_24620 117344 116457 gene locus_tag LOCUS_24630 gene dapA 117344 116457 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704836.1 protein_id gnl|my_center|LOCUS_24630 117477 118004 gene locus_tag LOCUS_24640 117477 118004 CDS product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349586.1 protein_id gnl|my_center|LOCUS_24640 118022 118489 gene locus_tag LOCUS_24650 gene bcp 118022 118489 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704834.1 protein_id gnl|my_center|LOCUS_24650 119167 118646 gene locus_tag LOCUS_24660 gene ruvC 119167 118646 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298649.1 protein_id gnl|my_center|LOCUS_24660 119991 119251 gene locus_tag LOCUS_24670 119991 119251 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096082.1 protein_id gnl|my_center|LOCUS_24670 120439 119978 gene locus_tag LOCUS_24680 gene nudB 120439 119978 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323636.1 protein_id gnl|my_center|LOCUS_24680 122224 120443 gene locus_tag LOCUS_24690 gene aspS 122224 120443 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169176.1 protein_id gnl|my_center|LOCUS_24690 122615 123457 gene locus_tag LOCUS_24700 122615 123457 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705417.1 protein_id gnl|my_center|LOCUS_24700 123631 124359 gene locus_tag LOCUS_24710 gene cmoA 123631 124359 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705416.1 protein_id gnl|my_center|LOCUS_24710 124356 125366 gene locus_tag LOCUS_24720 gene cmoB 124356 125366 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216623.1 protein_id gnl|my_center|LOCUS_24720 125359 126129 gene locus_tag LOCUS_24730 125359 126129 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350202.1 protein_id gnl|my_center|LOCUS_24730 126135 127649 gene locus_tag LOCUS_24740 126135 127649 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 protein_id gnl|my_center|LOCUS_24740 127642 128613 gene locus_tag LOCUS_24750 127642 128613 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 protein_id gnl|my_center|LOCUS_24750 129701 128778 gene locus_tag LOCUS_24760 gene rluB 129701 128778 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706718.1 protein_id gnl|my_center|LOCUS_24760 130331 129711 gene locus_tag LOCUS_24770 130331 129711 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295575.1 protein_id gnl|my_center|LOCUS_24770 131175 130351 gene locus_tag LOCUS_24780 131175 130351 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706722.1 protein_id gnl|my_center|LOCUS_24780 131564 133114 gene locus_tag LOCUS_24790 131564 133114 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706723.1 protein_id gnl|my_center|LOCUS_24790 133107 133703 gene locus_tag LOCUS_24800 133107 133703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24800 133700 134707 gene locus_tag LOCUS_24810 gene trpD 133700 134707 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706725.1 protein_id gnl|my_center|LOCUS_24810 134701 136089 gene locus_tag LOCUS_24820 gene trpCF 134701 136089 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818276.1 protein_id gnl|my_center|LOCUS_24820 136086 137279 gene locus_tag LOCUS_24830 gene trpB 136086 137279 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706727.1 protein_id gnl|my_center|LOCUS_24830 137276 138082 gene locus_tag LOCUS_24840 gene trpA 137276 138082 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706728.1 protein_id gnl|my_center|LOCUS_24840 138731 138159 gene locus_tag LOCUS_24850 138731 138159 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097615831.1 protein_id gnl|my_center|LOCUS_24850 139186 138728 gene locus_tag LOCUS_24860 139186 138728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 139405 139983 gene locus_tag LOCUS_24870 139405 139983 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071613.1 protein_id gnl|my_center|LOCUS_24870 139980 142892 gene locus_tag LOCUS_24880 139980 142892 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071612.1 protein_id gnl|my_center|LOCUS_24880 142904 146032 gene locus_tag LOCUS_24890 142904 146032 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742338.1 protein_id gnl|my_center|LOCUS_24890 146583 146092 gene locus_tag LOCUS_24900 146583 146092 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971886.1 protein_id gnl|my_center|LOCUS_24900 147766 146789 gene locus_tag LOCUS_24910 147766 146789 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_24910 148489 148046 gene locus_tag LOCUS_24920 148489 148046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 148856 150277 gene locus_tag LOCUS_24930 gene nirK 148856 150277 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200986.1 protein_id gnl|my_center|LOCUS_24930 150277 151050 gene locus_tag LOCUS_24940 150277 151050 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220499.1 protein_id gnl|my_center|LOCUS_24940 151010 151549 gene locus_tag LOCUS_24950 151010 151549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 152186 151554 gene locus_tag LOCUS_24960 152186 151554 CDS product DUF480 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706673.1 protein_id gnl|my_center|LOCUS_24960 152582 154465 gene locus_tag LOCUS_24970 gene mlp37 152582 154465 CDS product methyl-accepting chemotaxis protein Mlp37 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672477.1 protein_id gnl|my_center|LOCUS_24970 154560 155111 gene locus_tag LOCUS_24980 154560 155111 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_24980 156656 155235 gene locus_tag LOCUS_24990 156656 155235 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706925.1 protein_id gnl|my_center|LOCUS_24990 157077 158030 gene locus_tag LOCUS_25000 gene tal 157077 158030 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351598.1 protein_id gnl|my_center|LOCUS_25000 158175 158369 gene locus_tag LOCUS_25010 158175 158369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 159243 158569 gene locus_tag LOCUS_25020 gene ung 159243 158569 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004496.1 protein_id gnl|my_center|LOCUS_25020 159455 160642 gene locus_tag LOCUS_25030 159455 160642 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706715.1 protein_id gnl|my_center|LOCUS_25030 161798 160935 gene locus_tag LOCUS_25040 gene tesB 161798 160935 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706717.1 protein_id gnl|my_center|LOCUS_25040 163927 162653 gene locus_tag LOCUS_25050 gene thrC 163927 162653 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706814.1 protein_id gnl|my_center|LOCUS_25050 164880 163924 gene locus_tag LOCUS_25060 gene thrB 164880 163924 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706815.1 protein_id gnl|my_center|LOCUS_25060 167340 164881 gene locus_tag LOCUS_25070 gene thrA 167340 164881 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706816.1 protein_id gnl|my_center|LOCUS_25070 168256 167558 gene locus_tag LOCUS_25080 168256 167558 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706818.1 protein_id gnl|my_center|LOCUS_25080 168413 170152 gene locus_tag LOCUS_25090 gene aceK 168413 170152 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706819.1 protein_id gnl|my_center|LOCUS_25090 170714 170223 gene locus_tag LOCUS_25100 170714 170223 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706822.1 protein_id gnl|my_center|LOCUS_25100 171154 171870 gene locus_tag LOCUS_25110 gene arcA 171154 171870 CDS product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856501.1 protein_id gnl|my_center|LOCUS_25110 172642 172067 gene locus_tag LOCUS_25120 172642 172067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 173295 172756 gene locus_tag LOCUS_25130 173295 172756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 173542 173469 gene locus_tag LOCUS_t00670 173542 173469 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 173836 174204 gene locus_tag LOCUS_25140 gene rcsF 173836 174204 CDS product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633326.1 protein_id gnl|my_center|LOCUS_25140 174205 174927 gene locus_tag LOCUS_25150 gene tsaA 174205 174927 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 protein_id gnl|my_center|LOCUS_25150 174989 176707 gene locus_tag LOCUS_25160 gene proS 174989 176707 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260691.1 protein_id gnl|my_center|LOCUS_25160 176917 178068 gene locus_tag LOCUS_25170 176917 178068 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705128.1 protein_id gnl|my_center|LOCUS_25170 179524 178199 gene locus_tag LOCUS_25180 gene tilS 179524 178199 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705125.1 protein_id gnl|my_center|LOCUS_25180 182406 179521 gene locus_tag LOCUS_25190 182406 179521 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881117.1 protein_id gnl|my_center|LOCUS_25190 183514 182558 gene locus_tag LOCUS_25200 gene accA 183514 182558 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349878.1 protein_id gnl|my_center|LOCUS_25200 186997 183524 gene locus_tag LOCUS_25210 gene dnaE 186997 183524 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705106.1 protein_id gnl|my_center|LOCUS_25210 187590 186994 gene locus_tag LOCUS_25220 gene rnhB 187590 186994 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927570.1 protein_id gnl|my_center|LOCUS_25220 188756 187587 gene locus_tag LOCUS_25230 gene lpxB 188756 187587 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705104.1 protein_id gnl|my_center|LOCUS_25230 189504 188731 gene locus_tag LOCUS_25240 gene lpxA 189504 188731 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705103.1 protein_id gnl|my_center|LOCUS_25240 189986 189525 gene locus_tag LOCUS_25250 gene fabZ 189986 189525 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634777.1 protein_id gnl|my_center|LOCUS_25250 191078 190050 gene locus_tag LOCUS_25260 gene lpxD 191078 190050 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705102.1 protein_id gnl|my_center|LOCUS_25260 191593 191090 gene locus_tag LOCUS_25270 191593 191090 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705101.1 protein_id gnl|my_center|LOCUS_25270 194212 191798 gene locus_tag LOCUS_25280 gene bamA 194212 191798 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705100.1 protein_id gnl|my_center|LOCUS_25280 195591 194242 gene locus_tag LOCUS_25290 gene rseP 195591 194242 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705099.1 protein_id gnl|my_center|LOCUS_25290 196781 195591 gene locus_tag LOCUS_25300 gene ispC 196781 195591 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705098.1 protein_id gnl|my_center|LOCUS_25300 197638 196784 gene locus_tag LOCUS_25310 197638 196784 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303453.1 protein_id gnl|my_center|LOCUS_25310 198631 197864 gene locus_tag LOCUS_25320 gene uppS 198631 197864 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 protein_id gnl|my_center|LOCUS_25320 199263 198706 gene locus_tag LOCUS_25330 gene frr 199263 198706 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705096.1 protein_id gnl|my_center|LOCUS_25330 200050 199322 gene locus_tag LOCUS_25340 gene pyrH 200050 199322 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705095.1 protein_id gnl|my_center|LOCUS_25340 200999 200121 gene locus_tag LOCUS_25350 gene tsf 200999 200121 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705094.1 protein_id gnl|my_center|LOCUS_25350 201818 201108 gene locus_tag LOCUS_25360 gene rpsB 201818 201108 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303470.1 protein_id gnl|my_center|LOCUS_25360 202165 202950 gene locus_tag LOCUS_25370 gene map 202165 202950 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958195.1 protein_id gnl|my_center|LOCUS_25370 204349 203096 gene locus_tag LOCUS_25380 gene icd 204349 203096 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705337.1 protein_id gnl|my_center|LOCUS_25380 204613 205206 gene locus_tag LOCUS_25390 gene rluE 204613 205206 CDS product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098720.1 protein_id gnl|my_center|LOCUS_25390 205203 205667 gene locus_tag LOCUS_25400 205203 205667 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705317.1 protein_id gnl|my_center|LOCUS_25400 205923 207029 gene locus_tag LOCUS_25410 gene mnmA 205923 207029 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705316.1 protein_id gnl|my_center|LOCUS_25410 207026 207649 gene locus_tag LOCUS_25420 gene hflD 207026 207649 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334622.1 protein_id gnl|my_center|LOCUS_25420 207691 209061 gene locus_tag LOCUS_25430 gene purB 207691 209061 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705315.1 protein_id gnl|my_center|LOCUS_25430 209218 210366 gene locus_tag LOCUS_25440 209218 210366 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705314.1 protein_id gnl|my_center|LOCUS_25440 210909 210412 gene locus_tag LOCUS_25450 210909 210412 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705313.1 protein_id gnl|my_center|LOCUS_25450 211553 210918 gene locus_tag LOCUS_25460 gene pdxH 211553 210918 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705227.1 protein_id gnl|my_center|LOCUS_25460 211752 212003 gene locus_tag LOCUS_25470 211752 212003 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334896.1 protein_id gnl|my_center|LOCUS_25470 213239 212046 gene locus_tag LOCUS_25480 gene emrD 213239 212046 CDS product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459347.1 protein_id gnl|my_center|LOCUS_25480 213846 213352 gene locus_tag LOCUS_25490 gene pagL 213846 213352 CDS product lipid A 3-O-deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099307.1 protein_id gnl|my_center|LOCUS_25490 214094 214897 gene locus_tag LOCUS_25500 gene suhB 214094 214897 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350372.1 protein_id gnl|my_center|LOCUS_25500 216928 215153 gene locus_tag LOCUS_25510 216928 215153 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080084.1 protein_id gnl|my_center|LOCUS_25510 217760 217518 gene locus_tag LOCUS_25520 217760 217518 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791529.1 protein_id gnl|my_center|LOCUS_25520 221025 217969 gene locus_tag LOCUS_25530 221025 217969 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817986.1 protein_id gnl|my_center|LOCUS_25530 221240 222517 gene locus_tag LOCUS_25540 gene tyrS 221240 222517 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704551.1 protein_id gnl|my_center|LOCUS_25540 223427 222537 gene locus_tag LOCUS_25550 gene rluF 223427 222537 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419811.1 protein_id gnl|my_center|LOCUS_25550 224023 223556 gene locus_tag LOCUS_25560 224023 223556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 225780 224023 gene locus_tag LOCUS_25570 225780 224023 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705399.1 protein_id gnl|my_center|LOCUS_25570 226493 225882 gene locus_tag LOCUS_25580 226493 225882 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071742.1 protein_id gnl|my_center|LOCUS_25580 226741 227745 gene locus_tag LOCUS_25590 226741 227745 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070910.1 protein_id gnl|my_center|LOCUS_25590 227749 228702 gene locus_tag LOCUS_25600 227749 228702 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_25600 229243 228731 gene locus_tag LOCUS_25610 229243 228731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 229681 229340 gene locus_tag LOCUS_25620 229681 229340 CDS product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261059.1 protein_id gnl|my_center|LOCUS_25620 230940 229741 gene locus_tag LOCUS_25630 230940 229741 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706445.1 protein_id gnl|my_center|LOCUS_25630 231015 232760 gene locus_tag LOCUS_25640 231015 232760 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706440.1 protein_id gnl|my_center|LOCUS_25640 232836 234266 gene locus_tag LOCUS_25650 gene dacB 232836 234266 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706441.1 protein_id gnl|my_center|LOCUS_25650 234340 234603 gene locus_tag LOCUS_25660 234340 234603 CDS product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809455.1 protein_id gnl|my_center|LOCUS_25660 234891 236105 gene locus_tag LOCUS_25670 234891 236105 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706443.1 protein_id gnl|my_center|LOCUS_25670 237769 236312 gene locus_tag LOCUS_25680 gene cls 237769 236312 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705220.1 protein_id gnl|my_center|LOCUS_25680 237846 238391 gene locus_tag LOCUS_25690 237846 238391 CDS product DUF1439 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080151.1 protein_id gnl|my_center|LOCUS_25690 240148 238394 gene locus_tag LOCUS_25700 240148 238394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 244214 240324 gene locus_tag LOCUS_25710 gene purL 244214 240324 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819788.1 protein_id gnl|my_center|LOCUS_25710 244407 245822 gene locus_tag LOCUS_25720 gene mltF 244407 245822 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705651.1 protein_id gnl|my_center|LOCUS_25720 245918 246067 gene locus_tag LOCUS_25730 245918 246067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 247759 246251 gene locus_tag LOCUS_25740 gene der 247759 246251 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705649.1 protein_id gnl|my_center|LOCUS_25740 249006 247834 gene locus_tag LOCUS_25750 gene bamB 249006 247834 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944077.1 protein_id gnl|my_center|LOCUS_25750 249653 249009 gene locus_tag LOCUS_25760 249653 249009 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705647.1 protein_id gnl|my_center|LOCUS_25760 250931 249654 gene locus_tag LOCUS_25770 gene hisS 250931 249654 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705646.1 protein_id gnl|my_center|LOCUS_25770 252091 250973 gene locus_tag LOCUS_25780 gene ispG 252091 250973 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705645.1 protein_id gnl|my_center|LOCUS_25780 253088 252111 gene locus_tag LOCUS_25790 253088 252111 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705644.1 protein_id gnl|my_center|LOCUS_25790 253824 253078 gene locus_tag LOCUS_25800 gene tapF 253824 253078 CDS product PilW family type IVa pilus biogenesis/stability lipoprotein TapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705643.1 protein_id gnl|my_center|LOCUS_25800 255002 253884 gene locus_tag LOCUS_25810 255002 253884 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705642.1 protein_id gnl|my_center|LOCUS_25810 255582 255151 gene locus_tag LOCUS_25820 gene ndk 255582 255151 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072285.1 protein_id gnl|my_center|LOCUS_25820 256985 255708 gene locus_tag LOCUS_25830 gene pepB 256985 255708 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705640.1 protein_id gnl|my_center|LOCUS_25830 258289 256985 gene locus_tag LOCUS_25840 gene pepB 258289 256985 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705639.1 protein_id gnl|my_center|LOCUS_25840 258881 258681 gene locus_tag LOCUS_25850 gene iscX 258881 258681 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417922.1 protein_id gnl|my_center|LOCUS_25850 259233 258895 gene locus_tag LOCUS_25860 gene fdx 259233 258895 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460237.1 protein_id gnl|my_center|LOCUS_25860 261080 259236 gene locus_tag LOCUS_25870 gene hscA 261080 259236 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705638.1 protein_id gnl|my_center|LOCUS_25870 261604 261086 gene locus_tag LOCUS_25880 gene hscB 261604 261086 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105747.1 protein_id gnl|my_center|LOCUS_25880 261939 261616 gene locus_tag LOCUS_25890 gene iscA 261939 261616 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705636.1 protein_id gnl|my_center|LOCUS_25890 262338 261952 gene locus_tag LOCUS_25900 gene iscU 262338 261952 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299770.1 protein_id gnl|my_center|LOCUS_25900 263592 262378 gene locus_tag LOCUS_25910 263592 262378 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705635.1 protein_id gnl|my_center|LOCUS_25910 264149 263643 gene locus_tag LOCUS_25920 gene iscR 264149 263643 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705634.1 protein_id gnl|my_center|LOCUS_25920 264951 264220 gene locus_tag LOCUS_25930 gene trmJ 264951 264220 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705633.1 protein_id gnl|my_center|LOCUS_25930 265532 265017 gene locus_tag LOCUS_25940 265532 265017 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387097.1 protein_id gnl|my_center|LOCUS_25940 265685 266680 gene locus_tag LOCUS_25950 265685 266680 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705630.1 protein_id gnl|my_center|LOCUS_25950 266689 267591 gene locus_tag LOCUS_25960 266689 267591 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481567.1 protein_id gnl|my_center|LOCUS_25960 268490 267615 gene locus_tag LOCUS_25970 gene nlpI 268490 267615 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705628.1 protein_id gnl|my_center|LOCUS_25970 269552 268608 gene locus_tag LOCUS_25980 gene secF 269552 268608 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460198.1 protein_id gnl|my_center|LOCUS_25980 271385 269565 gene locus_tag LOCUS_25990 gene secD 271385 269565 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 protein_id gnl|my_center|LOCUS_25990 271766 271440 gene locus_tag LOCUS_26000 gene yajC 271766 271440 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705624.1 protein_id gnl|my_center|LOCUS_26000 273127 271979 gene locus_tag LOCUS_26010 gene tgt 273127 271979 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634306.1 protein_id gnl|my_center|LOCUS_26010 274364 273303 gene locus_tag LOCUS_26020 gene queA 274364 273303 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705623.1 protein_id gnl|my_center|LOCUS_26020 274564 275073 gene locus_tag LOCUS_26030 274564 275073 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598452.1 protein_id gnl|my_center|LOCUS_26030 275070 275651 gene locus_tag LOCUS_26040 275070 275651 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705571.1 protein_id gnl|my_center|LOCUS_26040 277808 275991 gene locus_tag LOCUS_26050 277808 275991 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070916.1 protein_id gnl|my_center|LOCUS_26050 279038 277812 gene locus_tag LOCUS_26060 279038 277812 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072332.1 protein_id gnl|my_center|LOCUS_26060 280024 279047 gene locus_tag LOCUS_26070 280024 279047 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072331.1 protein_id gnl|my_center|LOCUS_26070 281208 280024 gene locus_tag LOCUS_26080 281208 280024 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072330.1 protein_id gnl|my_center|LOCUS_26080 281095 281307 gene locus_tag LOCUS_26090 281095 281307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 283539 281326 gene locus_tag LOCUS_26100 283539 281326 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071497.1 protein_id gnl|my_center|LOCUS_26100 285297 283699 gene locus_tag LOCUS_26110 285297 283699 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 protein_id gnl|my_center|LOCUS_26110 286111 286677 gene locus_tag LOCUS_26120 gene ahpC 286111 286677 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 protein_id gnl|my_center|LOCUS_26120 286772 288319 gene locus_tag LOCUS_26130 gene ahpF 286772 288319 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705620.1 protein_id gnl|my_center|LOCUS_26130 289275 288376 gene locus_tag LOCUS_26140 289275 288376 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705410.1 protein_id gnl|my_center|LOCUS_26140 290423 289425 gene locus_tag LOCUS_26150 gene yejK 290423 289425 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350315.1 protein_id gnl|my_center|LOCUS_26150 290501 290728 gene locus_tag LOCUS_26160 290501 290728 CDS product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135904.1 protein_id gnl|my_center|LOCUS_26160 290761 292617 gene locus_tag LOCUS_26170 290761 292617 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705555.1 protein_id gnl|my_center|LOCUS_26170 293078 292683 gene locus_tag LOCUS_26180 293078 292683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 293351 294004 gene locus_tag LOCUS_26190 293351 294004 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705225.1 protein_id gnl|my_center|LOCUS_26190 294018 294854 gene locus_tag LOCUS_26200 294018 294854 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705224.1 protein_id gnl|my_center|LOCUS_26200 296384 295047 gene locus_tag LOCUS_26210 296384 295047 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456537.1 protein_id gnl|my_center|LOCUS_26210 297482 296409 gene locus_tag LOCUS_26220 297482 296409 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705564.1 protein_id gnl|my_center|LOCUS_26220 297715 297494 gene locus_tag LOCUS_26230 297715 297494 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072784.1 protein_id gnl|my_center|LOCUS_26230 297835 299277 gene locus_tag LOCUS_26240 297835 299277 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350322.1 protein_id gnl|my_center|LOCUS_26240 299737 299291 gene locus_tag LOCUS_26250 299737 299291 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705567.1 protein_id gnl|my_center|LOCUS_26250 299799 300149 gene locus_tag LOCUS_26260 gene arsC 299799 300149 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262403.1 protein_id gnl|my_center|LOCUS_26260 300146 300526 gene locus_tag LOCUS_26270 300146 300526 CDS product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705569.1 protein_id gnl|my_center|LOCUS_26270 301351 300629 gene locus_tag LOCUS_26280 gene hda 301351 300629 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205596950.1 protein_id gnl|my_center|LOCUS_26280 302327 301344 gene locus_tag LOCUS_26290 302327 301344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 303660 302392 gene locus_tag LOCUS_26300 303660 302392 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457676.1 protein_id gnl|my_center|LOCUS_26300 304383 303712 gene locus_tag LOCUS_26310 gene upp 304383 303712 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302745.1 protein_id gnl|my_center|LOCUS_26310 304578 305615 gene locus_tag LOCUS_26320 gene purM 304578 305615 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706623.1 protein_id gnl|my_center|LOCUS_26320 305612 306250 gene locus_tag LOCUS_26330 gene purN 305612 306250 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818195.1 protein_id gnl|my_center|LOCUS_26330 307017 306235 gene locus_tag LOCUS_26340 307017 306235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 309422 307014 gene locus_tag LOCUS_26350 309422 307014 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112820.1 protein_id gnl|my_center|LOCUS_26350 310308 309517 gene locus_tag LOCUS_26360 310308 309517 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705470.1 protein_id gnl|my_center|LOCUS_26360 310895 310314 gene locus_tag LOCUS_26370 gene lpcA 310895 310314 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284054.1 protein_id gnl|my_center|LOCUS_26370 311129 313573 gene locus_tag LOCUS_26380 gene fadE 311129 313573 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705468.1 protein_id gnl|my_center|LOCUS_26380 313825 314592 gene locus_tag LOCUS_26390 313825 314592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487053.1 protein_id gnl|my_center|LOCUS_26390 314596 315498 gene locus_tag LOCUS_26400 314596 315498 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335750.1 protein_id gnl|my_center|LOCUS_26400 315495 317456 gene locus_tag LOCUS_26410 gene fhuB 315495 317456 CDS product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115021.1 protein_id gnl|my_center|LOCUS_26410 317572 319695 gene locus_tag LOCUS_26420 317572 319695 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626173.1 protein_id gnl|my_center|LOCUS_26420 319741 320604 gene locus_tag LOCUS_26430 319741 320604 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705822.1 protein_id gnl|my_center|LOCUS_26430 320671 322806 gene locus_tag LOCUS_26440 320671 322806 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705823.1 protein_id gnl|my_center|LOCUS_26440 324364 322943 gene locus_tag LOCUS_26450 324364 322943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 325822 324368 gene locus_tag LOCUS_26460 325822 324368 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064848.1 protein_id gnl|my_center|LOCUS_26460 326356 325919 gene locus_tag LOCUS_26470 326356 325919 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704532.1 protein_id gnl|my_center|LOCUS_26470 326534 327880 gene locus_tag LOCUS_26480 326534 327880 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665631.1 protein_id gnl|my_center|LOCUS_26480 327877 328677 gene locus_tag LOCUS_26490 327877 328677 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216798.1 protein_id gnl|my_center|LOCUS_26490 328758 329162 gene locus_tag LOCUS_26500 328758 329162 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329247.1 protein_id gnl|my_center|LOCUS_26500 329320 330111 gene locus_tag LOCUS_26510 329320 330111 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351298.1 protein_id gnl|my_center|LOCUS_26510 330166 331116 gene locus_tag LOCUS_26520 330166 331116 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041213497.1 protein_id gnl|my_center|LOCUS_26520 331125 331874 gene locus_tag LOCUS_26530 331125 331874 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706607.1 protein_id gnl|my_center|LOCUS_26530 331912 332865 gene locus_tag LOCUS_26540 gene mmuM 331912 332865 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246467.1 protein_id gnl|my_center|LOCUS_26540 333340 332876 gene locus_tag LOCUS_26550 333340 332876 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402853.1 protein_id gnl|my_center|LOCUS_26550 334333 333485 gene locus_tag LOCUS_26560 gene kdsA 334333 333485 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706931.1 protein_id gnl|my_center|LOCUS_26560 335148 334342 gene locus_tag LOCUS_26570 335148 334342 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706932.1 protein_id gnl|my_center|LOCUS_26570 335983 335126 gene locus_tag LOCUS_26580 gene prmC 335983 335126 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706934.1 protein_id gnl|my_center|LOCUS_26580 337069 335984 gene locus_tag LOCUS_26590 gene prfA 337069 335984 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456867.1 protein_id gnl|my_center|LOCUS_26590 338353 337094 gene locus_tag LOCUS_26600 gene hemA 338353 337094 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927715.1 protein_id gnl|my_center|LOCUS_26600 338476 339054 gene locus_tag LOCUS_26610 gene lolB 338476 339054 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706937.1 protein_id gnl|my_center|LOCUS_26610 339051 339920 gene locus_tag LOCUS_26620 gene ispE 339051 339920 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 protein_id gnl|my_center|LOCUS_26620 340173 341120 gene locus_tag LOCUS_26630 340173 341120 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298464.1 protein_id gnl|my_center|LOCUS_26630 342115 341387 gene locus_tag LOCUS_26640 342115 341387 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039197.1 protein_id gnl|my_center|LOCUS_26640 342308 342904 gene locus_tag LOCUS_26650 gene pth 342308 342904 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706941.1 protein_id gnl|my_center|LOCUS_26650 342921 344012 gene locus_tag LOCUS_26660 gene ychF 342921 344012 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505850.1 protein_id gnl|my_center|LOCUS_26660 344231 344307 gene locus_tag LOCUS_t00680 344231 344307 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 344314 344388 gene locus_tag LOCUS_t00690 344314 344388 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 344513 344587 gene locus_tag LOCUS_t00700 344513 344587 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 344705 344781 gene locus_tag LOCUS_t00710 344705 344781 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 344789 344873 gene locus_tag LOCUS_t00720 344789 344873 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 344882 344956 gene locus_tag LOCUS_t00730 344882 344956 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 346505 345336 gene locus_tag LOCUS_26670 346505 345336 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707015.1 protein_id gnl|my_center|LOCUS_26670 346668 348098 gene locus_tag LOCUS_26680 gene miaB 346668 348098 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707016.1 protein_id gnl|my_center|LOCUS_26680 348258 349292 gene locus_tag LOCUS_26690 348258 349292 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707017.1 protein_id gnl|my_center|LOCUS_26690 349289 349759 gene locus_tag LOCUS_26700 gene ybeY 349289 349759 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707018.1 protein_id gnl|my_center|LOCUS_26700 349885 350646 gene locus_tag LOCUS_26710 gene corC 349885 350646 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707019.1 protein_id gnl|my_center|LOCUS_26710 350649 352178 gene locus_tag LOCUS_26720 gene lnt 350649 352178 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707020.1 protein_id gnl|my_center|LOCUS_26720 352688 352203 gene locus_tag LOCUS_26730 352688 352203 CDS product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298255.1 protein_id gnl|my_center|LOCUS_26730 352810 355389 gene locus_tag LOCUS_26740 gene leuS 352810 355389 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077392314.1 protein_id gnl|my_center|LOCUS_26740 355575 356060 gene locus_tag LOCUS_26750 gene lptE 355575 356060 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707022.1 protein_id gnl|my_center|LOCUS_26750 356060 357082 gene locus_tag LOCUS_26760 gene holA 356060 357082 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707024.1 protein_id gnl|my_center|LOCUS_26760 357079 357726 gene locus_tag LOCUS_26770 gene nadD 357079 357726 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_26770 357761 358105 gene locus_tag LOCUS_26780 gene rsfS 357761 358105 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707026.1 protein_id gnl|my_center|LOCUS_26780 358102 358572 gene locus_tag LOCUS_26790 gene rlmH 358102 358572 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701620.1 protein_id gnl|my_center|LOCUS_26790 358575 360461 gene locus_tag LOCUS_26800 gene mrdA 358575 360461 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707027.1 protein_id gnl|my_center|LOCUS_26800 360454 361560 gene locus_tag LOCUS_26810 gene rodA 360454 361560 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818663.1 protein_id gnl|my_center|LOCUS_26810 361573 362544 gene locus_tag LOCUS_26820 gene mltB 361573 362544 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216677.1 protein_id gnl|my_center|LOCUS_26820 362528 363349 gene locus_tag LOCUS_26830 362528 363349 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071396.1 protein_id gnl|my_center|LOCUS_26830 363517 363362 gene locus_tag LOCUS_26840 363517 363362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 363495 364586 gene locus_tag LOCUS_26850 363495 364586 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707032.1 protein_id gnl|my_center|LOCUS_26850 364750 365013 gene locus_tag LOCUS_26860 gene ybeD 364750 365013 CDS product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298227.1 protein_id gnl|my_center|LOCUS_26860 365023 365676 gene locus_tag LOCUS_26870 gene lipB 365023 365676 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071393.1 protein_id gnl|my_center|LOCUS_26870 365673 366638 gene locus_tag LOCUS_26880 gene lipA 365673 366638 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707035.1 protein_id gnl|my_center|LOCUS_26880 368012 366957 gene locus_tag LOCUS_26890 gene aroG 368012 366957 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705850.1 protein_id gnl|my_center|LOCUS_26890 368230 368439 gene locus_tag LOCUS_26900 368230 368439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 368474 368875 gene locus_tag LOCUS_26910 368474 368875 CDS product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706662.1 protein_id gnl|my_center|LOCUS_26910 368875 369315 gene locus_tag LOCUS_26920 368875 369315 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095815.1 protein_id gnl|my_center|LOCUS_26920 369399 369941 gene locus_tag LOCUS_26930 369399 369941 CDS product DUF1439 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080151.1 protein_id gnl|my_center|LOCUS_26930 370164 370766 gene locus_tag LOCUS_26940 370164 370766 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705371.1 protein_id gnl|my_center|LOCUS_26940 371023 373071 gene locus_tag LOCUS_26950 371023 373071 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481629.1 protein_id gnl|my_center|LOCUS_26950 373068 373571 gene locus_tag LOCUS_26960 373068 373571 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907521.1 protein_id gnl|my_center|LOCUS_26960 374519 374091 gene locus_tag LOCUS_26970 374519 374091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 375820 374564 gene locus_tag LOCUS_26980 375820 374564 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707185.1 protein_id gnl|my_center|LOCUS_26980 376932 375829 gene locus_tag LOCUS_26990 gene proB 376932 375829 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707186.1 protein_id gnl|my_center|LOCUS_26990 377446 377048 gene locus_tag LOCUS_27000 gene crl 377446 377048 CDS product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707187.1 protein_id gnl|my_center|LOCUS_27000 378804 377551 gene locus_tag LOCUS_27010 gene frsA 378804 377551 CDS product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707188.1 protein_id gnl|my_center|LOCUS_27010 379337 378867 gene locus_tag LOCUS_27020 gene gpt 379337 378867 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002889733.1 protein_id gnl|my_center|LOCUS_27020 379672 381306 gene locus_tag LOCUS_27030 379672 381306 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205011.1 protein_id gnl|my_center|LOCUS_27030 381462 382928 gene locus_tag LOCUS_27040 381462 382928 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707191.1 protein_id gnl|my_center|LOCUS_27040 383024 383362 gene locus_tag LOCUS_27050 383024 383362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 384444 383401 gene locus_tag LOCUS_27060 gene dinB 384444 383401 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167525.1 protein_id gnl|my_center|LOCUS_27060 384809 384585 gene locus_tag LOCUS_27070 gene nqrM 384809 384585 CDS product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705066.1 protein_id gnl|my_center|LOCUS_27070 385845 384811 gene locus_tag LOCUS_27080 385845 384811 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705065.1 protein_id gnl|my_center|LOCUS_27080 387089 385866 gene locus_tag LOCUS_27090 gene nqrF 387089 385866 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705064.1 protein_id gnl|my_center|LOCUS_27090 387712 387116 gene locus_tag LOCUS_27100 gene nqrE 387712 387116 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436652.1 protein_id gnl|my_center|LOCUS_27100 388346 387714 gene locus_tag LOCUS_27110 388346 387714 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303545.1 protein_id gnl|my_center|LOCUS_27110 389109 388339 gene locus_tag LOCUS_27120 389109 388339 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705063.1 protein_id gnl|my_center|LOCUS_27120 390340 389102 gene locus_tag LOCUS_27130 390340 389102 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418132.1 protein_id gnl|my_center|LOCUS_27130 391573 390344 gene locus_tag LOCUS_27140 391573 390344 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705061.1 protein_id gnl|my_center|LOCUS_27140 392381 392064 gene locus_tag LOCUS_27150 392381 392064 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705060.1 protein_id gnl|my_center|LOCUS_27150 393044 392442 gene locus_tag LOCUS_27160 393044 392442 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_27160 393107 394243 gene locus_tag LOCUS_27170 393107 394243 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705059.1 protein_id gnl|my_center|LOCUS_27170 394256 394834 gene locus_tag LOCUS_27180 394256 394834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 394918 395493 gene locus_tag LOCUS_27190 394918 395493 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303575.1 protein_id gnl|my_center|LOCUS_27190 395496 396845 gene locus_tag LOCUS_27200 395496 396845 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_27200 397002 397850 gene locus_tag LOCUS_27210 397002 397850 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705056.1 protein_id gnl|my_center|LOCUS_27210 398365 397883 gene locus_tag LOCUS_27220 398365 397883 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705055.1 protein_id gnl|my_center|LOCUS_27220 398494 399414 gene locus_tag LOCUS_27230 398494 399414 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705054.1 protein_id gnl|my_center|LOCUS_27230 400868 399420 gene locus_tag LOCUS_27240 gene thiI 400868 399420 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705585.1 protein_id gnl|my_center|LOCUS_27240 401870 400977 gene locus_tag LOCUS_27250 401870 400977 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707084.1 protein_id gnl|my_center|LOCUS_27250 402625 401870 gene locus_tag LOCUS_27260 gene pomA 402625 401870 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 protein_id gnl|my_center|LOCUS_27260 402842 403090 gene locus_tag LOCUS_27270 gene xseB 402842 403090 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483079.1 protein_id gnl|my_center|LOCUS_27270 403087 403980 gene locus_tag LOCUS_27280 gene ispA 403087 403980 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707087.1 protein_id gnl|my_center|LOCUS_27280 404002 405867 gene locus_tag LOCUS_27290 gene dxs 404002 405867 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707088.1 protein_id gnl|my_center|LOCUS_27290 407333 405933 gene locus_tag LOCUS_27300 407333 405933 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_27300 408613 407375 gene locus_tag LOCUS_27310 gene kynU 408613 407375 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818477.1 protein_id gnl|my_center|LOCUS_27310 409242 408610 gene locus_tag LOCUS_27320 gene kynB 409242 408610 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198883.1 protein_id gnl|my_center|LOCUS_27320 410112 409255 gene locus_tag LOCUS_27330 gene kynA 410112 409255 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530854.1 protein_id gnl|my_center|LOCUS_27330 410217 411119 gene locus_tag LOCUS_27340 gene metR 410217 411119 CDS product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092181.1 protein_id gnl|my_center|LOCUS_27340 412031 411120 gene locus_tag LOCUS_27350 412031 411120 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206215.1 protein_id gnl|my_center|LOCUS_27350 412620 412090 gene locus_tag LOCUS_27360 412620 412090 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206712.1 protein_id gnl|my_center|LOCUS_27360 413863 412622 gene locus_tag LOCUS_27370 413863 412622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206711.1 protein_id gnl|my_center|LOCUS_27370 414687 413899 gene locus_tag LOCUS_27380 414687 413899 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206710.1 protein_id gnl|my_center|LOCUS_27380 415937 414702 gene locus_tag LOCUS_27390 415937 414702 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113399.1 protein_id gnl|my_center|LOCUS_27390 416248 417228 gene locus_tag LOCUS_27400 416248 417228 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206714.1 protein_id gnl|my_center|LOCUS_27400 418546 417287 gene locus_tag LOCUS_27410 418546 417287 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087197.1 protein_id gnl|my_center|LOCUS_27410 419094 418543 gene locus_tag LOCUS_27420 419094 418543 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969450.1 protein_id gnl|my_center|LOCUS_27420 420140 419154 gene locus_tag LOCUS_27430 420140 419154 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087196.1 protein_id gnl|my_center|LOCUS_27430 421013 420228 gene locus_tag LOCUS_27440 421013 420228 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_27440 422483 421023 gene locus_tag LOCUS_27450 422483 421023 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_27450 423522 422599 gene locus_tag LOCUS_27460 423522 422599 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086600.1 protein_id gnl|my_center|LOCUS_27460 423869 423528 gene locus_tag LOCUS_27470 423869 423528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 424240 424049 gene locus_tag LOCUS_27480 424240 424049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 425099 424308 gene locus_tag LOCUS_27490 425099 424308 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_27490 426127 425096 gene locus_tag LOCUS_27500 gene dmpG 426127 425096 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013499.1 protein_id gnl|my_center|LOCUS_27500 427049 426141 gene locus_tag LOCUS_27510 427049 426141 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064835.1 protein_id gnl|my_center|LOCUS_27510 428102 427089 gene locus_tag LOCUS_27520 gene antC 428102 427089 CDS product anthranilate 1,2-dioxygenase electron transfer component AntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206715.1 protein_id gnl|my_center|LOCUS_27520 428605 428120 gene locus_tag LOCUS_27530 gene antB 428605 428120 CDS product anthranilate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113311.1 protein_id gnl|my_center|LOCUS_27530 429997 428609 gene locus_tag LOCUS_27540 gene antA 429997 428609 CDS product anthranilate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206716.1 protein_id gnl|my_center|LOCUS_27540 430298 431278 gene locus_tag LOCUS_27550 430298 431278 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113309.1 protein_id gnl|my_center|LOCUS_27550 431878 431288 gene locus_tag LOCUS_27560 431878 431288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 432085 433281 gene locus_tag LOCUS_27570 gene hmpA 432085 433281 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704625.1 protein_id gnl|my_center|LOCUS_27570 433561 434463 gene locus_tag LOCUS_27580 433561 434463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 436197 434494 gene locus_tag LOCUS_27590 436197 434494 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_27590 436536 436835 gene locus_tag LOCUS_27600 436536 436835 CDS product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206219.1 protein_id gnl|my_center|LOCUS_27600 436862 437848 gene locus_tag LOCUS_27610 436862 437848 CDS product aromatic/alkene monooxygenase hydroxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206218.1 protein_id gnl|my_center|LOCUS_27610 437862 438131 gene locus_tag LOCUS_27620 437862 438131 CDS product MmoB/DmpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049448.1 protein_id gnl|my_center|LOCUS_27620 438146 439651 gene locus_tag LOCUS_27630 438146 439651 CDS product aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 protein_id gnl|my_center|LOCUS_27630 439706 440068 gene locus_tag LOCUS_27640 439706 440068 CDS product phenol hydroxylase subunit P4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132745.1 protein_id gnl|my_center|LOCUS_27640 440078 441139 gene locus_tag LOCUS_27650 440078 441139 CDS product phenol 2-monooxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206216.1 protein_id gnl|my_center|LOCUS_27650 441186 442322 gene locus_tag LOCUS_27660 441186 442322 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162708822.1 protein_id gnl|my_center|LOCUS_27660 442359 442649 gene locus_tag LOCUS_27670 gene catC 442359 442649 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366454.1 protein_id gnl|my_center|LOCUS_27670 442705 443646 gene locus_tag LOCUS_27680 gene catA 442705 443646 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113307.1 protein_id gnl|my_center|LOCUS_27680 443991 444827 gene locus_tag LOCUS_27690 443991 444827 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925778.1 protein_id gnl|my_center|LOCUS_27690 447434 444861 gene locus_tag LOCUS_27700 447434 444861 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930590.1 protein_id gnl|my_center|LOCUS_27700 447868 447575 gene locus_tag LOCUS_27710 447868 447575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 447970 448893 gene locus_tag LOCUS_27720 447970 448893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 449867 448926 gene locus_tag LOCUS_27730 gene lafU 449867 448926 CDS product putative lateral flagellar export/assembly protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191775997.1 protein_id gnl|my_center|LOCUS_27730 450727 449867 gene locus_tag LOCUS_27740 gene motA 450727 449867 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462768.1 protein_id gnl|my_center|LOCUS_27740 451449 450727 gene locus_tag LOCUS_27750 gene lafS 451449 450727 CDS product lateral flagellar system RNA polymerase sigma factor LafS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462772.1 protein_id gnl|my_center|LOCUS_27750 451949 451458 gene locus_tag LOCUS_27760 451949 451458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 452998 451964 gene locus_tag LOCUS_27770 452998 451964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 453351 452995 gene locus_tag LOCUS_27780 453351 452995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 453808 453413 gene locus_tag LOCUS_27790 gene fliS 453808 453413 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462778.1 protein_id gnl|my_center|LOCUS_27790 455159 453828 gene locus_tag LOCUS_27800 gene fliD 455159 453828 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462779.1 protein_id gnl|my_center|LOCUS_27800 456490 455651 gene locus_tag LOCUS_27810 gene lafA 456490 455651 CDS product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462780.1 protein_id gnl|my_center|LOCUS_27810 457954 456941 gene locus_tag LOCUS_27820 457954 456941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 458854 457958 gene locus_tag LOCUS_27830 gene flgL 458854 457958 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463980.1 protein_id gnl|my_center|LOCUS_27830 460201 458879 gene locus_tag LOCUS_27840 gene flgK 460201 458879 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367245.1 protein_id gnl|my_center|LOCUS_27840 460592 460206 gene locus_tag LOCUS_27850 460592 460206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 461710 460601 gene locus_tag LOCUS_27860 461710 460601 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042468851.1 protein_id gnl|my_center|LOCUS_27860 462390 461719 gene locus_tag LOCUS_27870 gene flgH 462390 461719 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106240.1 protein_id gnl|my_center|LOCUS_27870 463175 462390 gene locus_tag LOCUS_27880 gene flgG 463175 462390 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481471.1 protein_id gnl|my_center|LOCUS_27880 463944 463216 gene locus_tag LOCUS_27890 463944 463216 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464045.1 protein_id gnl|my_center|LOCUS_27890 465535 463955 gene locus_tag LOCUS_27900 465535 463955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 466211 465555 gene locus_tag LOCUS_27910 gene flgD 466211 465555 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463939.1 protein_id gnl|my_center|LOCUS_27910 466633 466214 gene locus_tag LOCUS_27920 gene flgC 466633 466214 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464013.1 protein_id gnl|my_center|LOCUS_27920 467001 466636 gene locus_tag LOCUS_27930 gene flgB 467001 466636 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463947.1 protein_id gnl|my_center|LOCUS_27930 467083 467826 gene locus_tag LOCUS_27940 467083 467826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 467895 468176 gene locus_tag LOCUS_27950 gene flgM 467895 468176 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464040.1 protein_id gnl|my_center|LOCUS_27950 468173 468595 gene locus_tag LOCUS_27960 468173 468595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 469487 469074 gene locus_tag LOCUS_27970 469487 469074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 470814 469480 gene locus_tag LOCUS_27980 gene fliI 470814 469480 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478244.1 protein_id gnl|my_center|LOCUS_27980 471496 470801 gene locus_tag LOCUS_27990 gene fliH 471496 470801 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478070.1 protein_id gnl|my_center|LOCUS_27990 472509 471496 gene locus_tag LOCUS_28000 472509 471496 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478340.1 protein_id gnl|my_center|LOCUS_28000 474226 472502 gene locus_tag LOCUS_28010 gene fliF 474226 472502 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106531.1 protein_id gnl|my_center|LOCUS_28010 474556 474236 gene locus_tag LOCUS_28020 gene fliE 474556 474236 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462799.1 protein_id gnl|my_center|LOCUS_28020 475930 474566 gene locus_tag LOCUS_28030 475930 474566 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478291.1 protein_id gnl|my_center|LOCUS_28030 476688 475927 gene locus_tag LOCUS_28040 gene motY 476688 475927 CDS product flagellar protein MotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072693.1 protein_id gnl|my_center|LOCUS_28040 479214 477139 gene locus_tag LOCUS_28050 gene flhA 479214 477139 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478396.1 protein_id gnl|my_center|LOCUS_28050 480356 479211 gene locus_tag LOCUS_28060 gene flhB 480356 479211 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462787.1 protein_id gnl|my_center|LOCUS_28060 481139 480360 gene locus_tag LOCUS_28070 gene fliR 481139 480360 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462790.1 protein_id gnl|my_center|LOCUS_28070 481405 481136 gene locus_tag LOCUS_28080 gene fliQ 481405 481136 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462792.1 protein_id gnl|my_center|LOCUS_28080 482143 481406 gene locus_tag LOCUS_28090 gene fliP 482143 481406 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462793.1 protein_id gnl|my_center|LOCUS_28090 482480 482133 gene locus_tag LOCUS_28100 482480 482133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 483407 482511 gene locus_tag LOCUS_28110 483407 482511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 483763 483389 gene locus_tag LOCUS_28120 483763 483389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 483698 484828 gene locus_tag LOCUS_28130 gene chrA 483698 484828 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261328.1 protein_id gnl|my_center|LOCUS_28130 487307 484839 gene locus_tag LOCUS_28140 487307 484839 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613683.1 protein_id gnl|my_center|LOCUS_28140 488921 487404 gene locus_tag LOCUS_28150 488921 487404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 490414 488918 gene locus_tag LOCUS_28160 490414 488918 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545971.1 protein_id gnl|my_center|LOCUS_28160 491865 490411 gene locus_tag LOCUS_28170 491865 490411 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090055.1 protein_id gnl|my_center|LOCUS_28170 492134 491865 gene locus_tag LOCUS_28180 492134 491865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 492850 492164 gene locus_tag LOCUS_28190 492850 492164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28190 493125 492847 gene locus_tag LOCUS_28200 493125 492847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 493420 493118 gene locus_tag LOCUS_28210 493420 493118 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_28210 493709 493407 gene locus_tag LOCUS_28220 493709 493407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 494173 493709 gene locus_tag LOCUS_28230 494173 493709 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090050.1 protein_id gnl|my_center|LOCUS_28230 494699 494295 gene locus_tag LOCUS_28240 gene cueR 494699 494295 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939394.1 protein_id gnl|my_center|LOCUS_28240 495028 494837 gene locus_tag LOCUS_28250 495028 494837 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811035.1 protein_id gnl|my_center|LOCUS_28250 498218 495102 gene locus_tag LOCUS_28260 498218 495102 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244431.1 protein_id gnl|my_center|LOCUS_28260 499867 498221 gene locus_tag LOCUS_28270 499867 498221 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 protein_id gnl|my_center|LOCUS_28270 501123 499867 gene locus_tag LOCUS_28280 501123 499867 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244563.1 protein_id gnl|my_center|LOCUS_28280 501297 502733 gene locus_tag LOCUS_28290 gene pcoS 501297 502733 CDS product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046494163.1 protein_id gnl|my_center|LOCUS_28290 504999 502687 gene locus_tag LOCUS_28300 504999 502687 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931165.1 protein_id gnl|my_center|LOCUS_28300 505665 505009 gene locus_tag LOCUS_28310 505665 505009 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461889.1 protein_id gnl|my_center|LOCUS_28310 505897 505670 gene locus_tag LOCUS_28320 505897 505670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 506312 505947 gene locus_tag LOCUS_28330 506312 505947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 506765 506442 gene locus_tag LOCUS_28340 506765 506442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 507525 507127 gene locus_tag LOCUS_28350 507525 507127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 508057 507659 gene locus_tag LOCUS_28360 508057 507659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 508616 508119 gene locus_tag LOCUS_28370 508616 508119 CDS product cupredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815302.1 protein_id gnl|my_center|LOCUS_28370 509492 508662 gene locus_tag LOCUS_28380 509492 508662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 511312 509510 gene locus_tag LOCUS_28390 511312 509510 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040631.1 protein_id gnl|my_center|LOCUS_28390 511512 512192 gene locus_tag LOCUS_28400 gene cusR 511512 512192 CDS product copper response regulator transcription factor CusR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807068.1 protein_id gnl|my_center|LOCUS_28400 513529 512249 gene locus_tag LOCUS_28410 gene gabT 513529 512249 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464684.1 protein_id gnl|my_center|LOCUS_28410 515018 513555 gene locus_tag LOCUS_28420 515018 513555 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706799.1 protein_id gnl|my_center|LOCUS_28420 515253 516164 gene locus_tag LOCUS_28430 515253 516164 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245546.1 protein_id gnl|my_center|LOCUS_28430 516546 516316 gene locus_tag LOCUS_28440 516546 516316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 516431 517438 gene locus_tag LOCUS_28450 516431 517438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 517539 518030 gene locus_tag LOCUS_28460 517539 518030 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243030.1 protein_id gnl|my_center|LOCUS_28460 518030 519346 gene locus_tag LOCUS_28470 518030 519346 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_28470 519353 519775 gene locus_tag LOCUS_28480 519353 519775 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339636.1 protein_id gnl|my_center|LOCUS_28480 520306 519878 gene locus_tag LOCUS_28490 gene zntR 520306 519878 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309469.1 protein_id gnl|my_center|LOCUS_28490 520503 522086 gene locus_tag LOCUS_28500 gene purH 520503 522086 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456445.1 protein_id gnl|my_center|LOCUS_28500 522435 523721 gene locus_tag LOCUS_28510 gene purD 522435 523721 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704786.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence20 131 207 gene locus_tag LOCUS_t00740 131 207 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 247 322 gene locus_tag LOCUS_t00750 247 322 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence21 106 215 gene locus_tag LOCUS_r00020 106 215 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 251 327 gene locus_tag LOCUS_t00760 251 327 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 588 1286 gene locus_tag LOCUS_28520 588 1286 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208820.1 protein_id gnl|my_center|LOCUS_28520 2187 1288 gene locus_tag LOCUS_28530 2187 1288 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707662.1 protein_id gnl|my_center|LOCUS_28530 3213 2257 gene locus_tag LOCUS_28540 3213 2257 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707531.1 protein_id gnl|my_center|LOCUS_28540 3741 3334 gene locus_tag LOCUS_28550 gene rnk 3741 3334 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706600.1 protein_id gnl|my_center|LOCUS_28550 4226 4017 gene locus_tag LOCUS_28560 4226 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 4113 4592 gene locus_tag LOCUS_28570 4113 4592 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707635.1 protein_id gnl|my_center|LOCUS_28570 5890 4679 gene locus_tag LOCUS_28580 gene lhgO 5890 4679 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271983.1 protein_id gnl|my_center|LOCUS_28580 6967 5999 gene locus_tag LOCUS_28590 gene glaH 6967 5999 CDS product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993092.1 protein_id gnl|my_center|LOCUS_28590 7117 7821 gene locus_tag LOCUS_28600 gene csiR 7117 7821 CDS product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368060.1 protein_id gnl|my_center|LOCUS_28600 8076 10364 gene locus_tag LOCUS_28610 gene metE 8076 10364 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176312.1 protein_id gnl|my_center|LOCUS_28610 10401 11297 gene locus_tag LOCUS_28620 gene metF 10401 11297 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306036.1 protein_id gnl|my_center|LOCUS_28620 13617 11362 gene locus_tag LOCUS_28630 13617 11362 CDS product zinc/cadmium/mercury/lead-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819304.1 protein_id gnl|my_center|LOCUS_28630 14874 13951 gene locus_tag LOCUS_28640 14874 13951 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704527.1 protein_id gnl|my_center|LOCUS_28640 14972 15601 gene locus_tag LOCUS_28650 14972 15601 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482474.1 protein_id gnl|my_center|LOCUS_28650 17353 15596 gene locus_tag LOCUS_28660 17353 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 18838 17435 gene locus_tag LOCUS_28670 gene cls 18838 17435 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191365.1 protein_id gnl|my_center|LOCUS_28670 20273 19005 gene locus_tag LOCUS_28680 20273 19005 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482970.1 protein_id gnl|my_center|LOCUS_28680 21704 20340 gene locus_tag LOCUS_28690 21704 20340 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 protein_id gnl|my_center|LOCUS_28690 22419 21694 gene locus_tag LOCUS_28700 22419 21694 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_28700 22602 23072 gene locus_tag LOCUS_28710 22602 23072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 23738 23268 gene locus_tag LOCUS_28720 gene asnC 23738 23268 CDS product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707730.1 protein_id gnl|my_center|LOCUS_28720 23882 24874 gene locus_tag LOCUS_28730 gene asnA 23882 24874 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212256.1 protein_id gnl|my_center|LOCUS_28730 25350 24943 gene locus_tag LOCUS_28740 25350 24943 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707727.1 protein_id gnl|my_center|LOCUS_28740 25854 27281 gene locus_tag LOCUS_28750 25854 27281 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707724.1 protein_id gnl|my_center|LOCUS_28750 27293 27790 gene locus_tag LOCUS_28760 27293 27790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 27787 29127 gene locus_tag LOCUS_28770 gene glrR 27787 29127 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 protein_id gnl|my_center|LOCUS_28770 29190 30203 gene locus_tag LOCUS_28780 gene msrP 29190 30203 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707720.1 protein_id gnl|my_center|LOCUS_28780 30203 30823 gene locus_tag LOCUS_28790 gene msrQ 30203 30823 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707719.1 protein_id gnl|my_center|LOCUS_28790 30865 31326 gene locus_tag LOCUS_28800 30865 31326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 31382 33328 gene locus_tag LOCUS_28810 31382 33328 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707714.1 protein_id gnl|my_center|LOCUS_28810 33411 34583 gene locus_tag LOCUS_28820 33411 34583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 35456 34590 gene locus_tag LOCUS_28830 35456 34590 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037818.1 protein_id gnl|my_center|LOCUS_28830 36058 35459 gene locus_tag LOCUS_28840 36058 35459 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 protein_id gnl|my_center|LOCUS_28840 36468 36055 gene locus_tag LOCUS_28850 36468 36055 CDS product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 protein_id gnl|my_center|LOCUS_28850 36657 37691 gene locus_tag LOCUS_28860 gene murB 36657 37691 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707708.1 protein_id gnl|my_center|LOCUS_28860 37679 38653 gene locus_tag LOCUS_28870 gene birA 37679 38653 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 protein_id gnl|my_center|LOCUS_28870 39627 38686 gene locus_tag LOCUS_28880 gene coaA 39627 38686 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707706.1 protein_id gnl|my_center|LOCUS_28880 39877 39952 gene locus_tag LOCUS_t00770 39877 39952 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 39962 40046 gene locus_tag LOCUS_t00780 39962 40046 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 40115 40189 gene locus_tag LOCUS_t00790 40115 40189 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 40192 40267 gene locus_tag LOCUS_t00800 40192 40267 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 40366 41550 gene locus_tag LOCUS_28890 gene tuf 40366 41550 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707694.1 protein_id gnl|my_center|LOCUS_28890 41603 41679 gene locus_tag LOCUS_t00810 41603 41679 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 41744 42115 gene locus_tag LOCUS_28900 gene secE 41744 42115 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707705.1 protein_id gnl|my_center|LOCUS_28900 42125 42667 gene locus_tag LOCUS_28910 gene nusG 42125 42667 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306318.1 protein_id gnl|my_center|LOCUS_28910 42796 43224 gene locus_tag LOCUS_28920 gene rplK 42796 43224 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005318556.1 protein_id gnl|my_center|LOCUS_28920 43229 43927 gene locus_tag LOCUS_28930 gene rplA 43229 43927 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210673.1 protein_id gnl|my_center|LOCUS_28930 44167 44670 gene locus_tag LOCUS_28940 gene rplJ 44167 44670 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070609.1 protein_id gnl|my_center|LOCUS_28940 44725 45090 gene locus_tag LOCUS_28950 gene rplL 44725 45090 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707702.1 protein_id gnl|my_center|LOCUS_28950 45315 49343 gene locus_tag LOCUS_28960 gene rpoB 45315 49343 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635847.1 protein_id gnl|my_center|LOCUS_28960 49431 53639 gene locus_tag LOCUS_28970 gene rpoC 49431 53639 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707700.1 protein_id gnl|my_center|LOCUS_28970 54461 53700 gene locus_tag LOCUS_28980 54461 53700 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945832.1 protein_id gnl|my_center|LOCUS_28980 54546 55004 gene locus_tag LOCUS_28990 54546 55004 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707377.1 protein_id gnl|my_center|LOCUS_28990 55131 56933 gene locus_tag LOCUS_29000 55131 56933 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261116.1 protein_id gnl|my_center|LOCUS_29000 56935 58626 gene locus_tag LOCUS_29010 gene cysI 56935 58626 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707137.1 protein_id gnl|my_center|LOCUS_29010 58616 59383 gene locus_tag LOCUS_29020 58616 59383 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707138.1 protein_id gnl|my_center|LOCUS_29020 59410 59811 gene locus_tag LOCUS_29030 59410 59811 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707313.1 protein_id gnl|my_center|LOCUS_29030 59903 61306 gene locus_tag LOCUS_29040 gene cysG 59903 61306 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707310.1 protein_id gnl|my_center|LOCUS_29040 62130 61303 gene locus_tag LOCUS_29050 62130 61303 CDS product TIGR03899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818770.1 protein_id gnl|my_center|LOCUS_29050 62931 62386 gene locus_tag LOCUS_29060 62931 62386 CDS product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815436.1 protein_id gnl|my_center|LOCUS_29060 63586 63056 gene locus_tag LOCUS_29070 gene ppa 63586 63056 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707292.1 protein_id gnl|my_center|LOCUS_29070 63783 65141 gene locus_tag LOCUS_29080 gene mpl 63783 65141 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707291.1 protein_id gnl|my_center|LOCUS_29080 65134 65766 gene locus_tag LOCUS_29090 65134 65766 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707290.1 protein_id gnl|my_center|LOCUS_29090 65849 66379 gene locus_tag LOCUS_29100 gene hpt 65849 66379 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707288.1 protein_id gnl|my_center|LOCUS_29100 66466 67386 gene locus_tag LOCUS_29110 66466 67386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707287.1 protein_id gnl|my_center|LOCUS_29110 67383 68156 gene locus_tag LOCUS_29120 67383 68156 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 protein_id gnl|my_center|LOCUS_29120 68720 68334 gene locus_tag LOCUS_29130 68720 68334 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 protein_id gnl|my_center|LOCUS_29130 69746 68904 gene locus_tag LOCUS_29140 gene panC 69746 68904 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707282.1 protein_id gnl|my_center|LOCUS_29140 70550 69756 gene locus_tag LOCUS_29150 gene panB 70550 69756 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707281.1 protein_id gnl|my_center|LOCUS_29150 71051 70563 gene locus_tag LOCUS_29160 gene folK 71051 70563 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707280.1 protein_id gnl|my_center|LOCUS_29160 72379 71048 gene locus_tag LOCUS_29170 gene pcnB 72379 71048 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707279.1 protein_id gnl|my_center|LOCUS_29170 73406 72483 gene locus_tag LOCUS_29180 gene gluQRS 73406 72483 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818759.1 protein_id gnl|my_center|LOCUS_29180 73874 73422 gene locus_tag LOCUS_29190 gene dksA 73874 73422 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304459.1 protein_id gnl|my_center|LOCUS_29190 74160 74864 gene locus_tag LOCUS_29200 gene sfsA 74160 74864 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095633.1 protein_id gnl|my_center|LOCUS_29200 75372 74854 gene locus_tag LOCUS_29210 gene thpR 75372 74854 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820023.1 protein_id gnl|my_center|LOCUS_29210 75437 77869 gene locus_tag LOCUS_29220 gene hrpB 75437 77869 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818758.1 protein_id gnl|my_center|LOCUS_29220 77872 80226 gene locus_tag LOCUS_29230 gene mrcB 77872 80226 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707274.1 protein_id gnl|my_center|LOCUS_29230 80288 80713 gene locus_tag LOCUS_29240 80288 80713 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009876549.1 protein_id gnl|my_center|LOCUS_29240 82021 80735 gene locus_tag LOCUS_29250 gene hemL 82021 80735 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707264.1 protein_id gnl|my_center|LOCUS_29250 82176 82814 gene locus_tag LOCUS_29260 82176 82814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 82871 83215 gene locus_tag LOCUS_29270 gene erpA 82871 83215 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304404.1 protein_id gnl|my_center|LOCUS_29270 83224 83541 gene locus_tag LOCUS_29280 83224 83541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 83538 83966 gene locus_tag LOCUS_29290 83538 83966 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704842.1 protein_id gnl|my_center|LOCUS_29290 84458 84030 gene locus_tag LOCUS_29300 84458 84030 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635648.1 protein_id gnl|my_center|LOCUS_29300 86022 84739 gene locus_tag LOCUS_29310 86022 84739 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706904.1 protein_id gnl|my_center|LOCUS_29310 86289 87485 gene locus_tag LOCUS_29320 gene tyrS 86289 87485 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633247.1 protein_id gnl|my_center|LOCUS_29320 88259 87630 gene locus_tag LOCUS_29330 88259 87630 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705587.1 protein_id gnl|my_center|LOCUS_29330 89136 88324 gene locus_tag LOCUS_29340 89136 88324 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705594.1 protein_id gnl|my_center|LOCUS_29340 90088 89159 gene locus_tag LOCUS_29350 90088 89159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 90792 90094 gene locus_tag LOCUS_29360 gene mtnN 90792 90094 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705596.1 protein_id gnl|my_center|LOCUS_29360 92377 90962 gene locus_tag LOCUS_29370 92377 90962 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706516.1 protein_id gnl|my_center|LOCUS_29370 96847 92390 gene locus_tag LOCUS_29380 gene gltB 96847 92390 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706515.1 protein_id gnl|my_center|LOCUS_29380 97454 99784 gene locus_tag LOCUS_29390 gene arcB 97454 99784 CDS product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704845.1 protein_id gnl|my_center|LOCUS_29390 99781 101136 gene locus_tag LOCUS_29400 gene dgt 99781 101136 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704846.1 protein_id gnl|my_center|LOCUS_29400 101253 102440 gene locus_tag LOCUS_29410 101253 102440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 102953 102456 gene locus_tag LOCUS_29420 gene rfaH 102953 102456 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349600.1 protein_id gnl|my_center|LOCUS_29420 103870 103049 gene locus_tag LOCUS_29430 103870 103049 CDS product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459159.1 protein_id gnl|my_center|LOCUS_29430 104543 103890 gene locus_tag LOCUS_29440 104543 103890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704854.1 protein_id gnl|my_center|LOCUS_29440 105567 104524 gene locus_tag LOCUS_29450 gene metN 105567 104524 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704855.1 protein_id gnl|my_center|LOCUS_29450 105814 106833 gene locus_tag LOCUS_29460 105814 106833 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818730.1 protein_id gnl|my_center|LOCUS_29460 106826 107872 gene locus_tag LOCUS_29470 106826 107872 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707196.1 protein_id gnl|my_center|LOCUS_29470 107885 109684 gene locus_tag LOCUS_29480 107885 109684 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707195.1 protein_id gnl|my_center|LOCUS_29480 109684 110661 gene locus_tag LOCUS_29490 109684 110661 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707194.1 protein_id gnl|my_center|LOCUS_29490 110661 111689 gene locus_tag LOCUS_29500 110661 111689 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 protein_id gnl|my_center|LOCUS_29500 111705 112262 gene locus_tag LOCUS_29510 gene gmhB 111705 112262 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044801009.1 protein_id gnl|my_center|LOCUS_29510 >Feature sequence22 221 296 gene locus_tag LOCUS_t00820 221 296 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence23 >Feature sequence24 476 946 gene locus_tag LOCUS_29520 476 946 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704113.1 protein_id gnl|my_center|LOCUS_29520 1746 955 gene locus_tag LOCUS_29530 gene murI 1746 955 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704112.1 protein_id gnl|my_center|LOCUS_29530 3636 1828 gene locus_tag LOCUS_29540 3636 1828 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704111.1 protein_id gnl|my_center|LOCUS_29540 4894 4112 gene locus_tag LOCUS_29550 4894 4112 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090029.1 protein_id gnl|my_center|LOCUS_29550 6362 4977 gene locus_tag LOCUS_29560 6362 4977 CDS product NCS1 family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272625.1 protein_id gnl|my_center|LOCUS_29560 7226 6492 gene locus_tag LOCUS_29570 7226 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 8324 7608 gene locus_tag LOCUS_29580 8324 7608 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 protein_id gnl|my_center|LOCUS_29580 9144 8428 gene locus_tag LOCUS_29590 9144 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 9484 9164 gene locus_tag LOCUS_29600 9484 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 10347 9577 gene locus_tag LOCUS_29610 gene bioH 10347 9577 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 protein_id gnl|my_center|LOCUS_29610 10376 11071 gene locus_tag LOCUS_29620 10376 11071 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704303.1 protein_id gnl|my_center|LOCUS_29620 11143 11721 gene locus_tag LOCUS_29630 gene nfuA 11143 11721 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704302.1 protein_id gnl|my_center|LOCUS_29630 13040 12033 gene locus_tag LOCUS_29640 gene gpsA 13040 12033 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 protein_id gnl|my_center|LOCUS_29640 13525 13040 gene locus_tag LOCUS_29650 gene secB 13525 13040 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704300.1 protein_id gnl|my_center|LOCUS_29650 13989 13561 gene locus_tag LOCUS_29660 13989 13561 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307875.1 protein_id gnl|my_center|LOCUS_29660 14218 15750 gene locus_tag LOCUS_29670 gene gpmM 14218 15750 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043126577.1 protein_id gnl|my_center|LOCUS_29670 15761 17077 gene locus_tag LOCUS_29680 gene envC 15761 17077 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704298.1 protein_id gnl|my_center|LOCUS_29680 17248 17063 gene locus_tag LOCUS_29690 17248 17063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 17405 17782 gene locus_tag LOCUS_29700 17405 17782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 17855 19231 gene locus_tag LOCUS_29710 gene fumC 17855 19231 CDS product class II fumarate hydratase FumC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112741.1 protein_id gnl|my_center|LOCUS_29710 20290 19433 gene locus_tag LOCUS_29720 gene sseA 20290 19433 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203698.1 protein_id gnl|my_center|LOCUS_29720 20862 21179 gene locus_tag LOCUS_29730 20862 21179 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704337.1 protein_id gnl|my_center|LOCUS_29730 21467 21186 gene locus_tag LOCUS_29740 21467 21186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 22060 21464 gene locus_tag LOCUS_29750 gene rsmD 22060 21464 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704347.1 protein_id gnl|my_center|LOCUS_29750 22193 23875 gene locus_tag LOCUS_29760 22193 23875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 23876 24541 gene locus_tag LOCUS_29770 gene ftsE 23876 24541 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_29770 24538 25491 gene locus_tag LOCUS_29780 gene ftsX 24538 25491 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704350.1 protein_id gnl|my_center|LOCUS_29780 25653 26525 gene locus_tag LOCUS_29790 gene rpoH 25653 26525 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704351.1 protein_id gnl|my_center|LOCUS_29790 26608 27258 gene locus_tag LOCUS_29800 gene can 26608 27258 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_29800 27288 28295 gene locus_tag LOCUS_29810 gene glpX 27288 28295 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704437.1 protein_id gnl|my_center|LOCUS_29810 31834 28370 gene locus_tag LOCUS_29820 gene bcsC 31834 28370 CDS product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817392.1 protein_id gnl|my_center|LOCUS_29820 32928 31822 gene locus_tag LOCUS_29830 gene bcsZ 32928 31822 CDS product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817393.1 protein_id gnl|my_center|LOCUS_29830 35214 32932 gene locus_tag LOCUS_29840 gene bcsB 35214 32932 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018077.1 protein_id gnl|my_center|LOCUS_29840 37799 35211 gene locus_tag LOCUS_29850 gene bcsA 37799 35211 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369239.1 protein_id gnl|my_center|LOCUS_29850 38509 37793 gene locus_tag LOCUS_29860 gene bcsQ 38509 37793 CDS product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174891.1 protein_id gnl|my_center|LOCUS_29860 38727 38506 gene locus_tag LOCUS_29870 38727 38506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 40319 38697 gene locus_tag LOCUS_29880 gene bcsG 40319 38697 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174899.1 protein_id gnl|my_center|LOCUS_29880 40506 40306 gene locus_tag LOCUS_29890 40506 40306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 42043 40511 gene locus_tag LOCUS_29900 gene bcsE 42043 40511 CDS product cellulose biosynthesis protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817396.1 protein_id gnl|my_center|LOCUS_29900 42543 43334 gene locus_tag LOCUS_29910 42543 43334 CDS product glycosyltransferase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064624.1 protein_id gnl|my_center|LOCUS_29910 43623 44252 gene locus_tag LOCUS_29920 gene gmk 43623 44252 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348898.1 protein_id gnl|my_center|LOCUS_29920 44302 44577 gene locus_tag LOCUS_29930 gene rpoZ 44302 44577 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307060.1 protein_id gnl|my_center|LOCUS_29930 44683 46800 gene locus_tag LOCUS_29940 gene spoT 44683 46800 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704079.1 protein_id gnl|my_center|LOCUS_29940 46898 47938 gene locus_tag LOCUS_29950 46898 47938 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704076.1 protein_id gnl|my_center|LOCUS_29950 47973 48767 gene locus_tag LOCUS_29960 47973 48767 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704075.1 protein_id gnl|my_center|LOCUS_29960 49215 48769 gene locus_tag LOCUS_29970 49215 48769 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106124.1 protein_id gnl|my_center|LOCUS_29970 49318 49503 gene locus_tag LOCUS_29980 49318 49503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 49506 50597 gene locus_tag LOCUS_29990 49506 50597 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477894.1 protein_id gnl|my_center|LOCUS_29990 50614 51528 gene locus_tag LOCUS_30000 gene murQ 50614 51528 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180252.1 protein_id gnl|my_center|LOCUS_30000 51863 51525 gene locus_tag LOCUS_30010 51863 51525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 52021 52899 gene locus_tag LOCUS_30020 52021 52899 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843742.1 protein_id gnl|my_center|LOCUS_30020 55124 53106 gene locus_tag LOCUS_30030 gene betT 55124 53106 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131044.1 protein_id gnl|my_center|LOCUS_30030 56774 55137 gene locus_tag LOCUS_30040 56774 55137 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114638.1 protein_id gnl|my_center|LOCUS_30040 58303 56771 gene locus_tag LOCUS_30050 gene betC 58303 56771 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114636.1 protein_id gnl|my_center|LOCUS_30050 58579 59502 gene locus_tag LOCUS_30060 58579 59502 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122286.1 protein_id gnl|my_center|LOCUS_30060 60710 59538 gene locus_tag LOCUS_30070 60710 59538 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819957.1 protein_id gnl|my_center|LOCUS_30070 60806 61978 gene locus_tag LOCUS_30080 60806 61978 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706206.1 protein_id gnl|my_center|LOCUS_30080 62116 62556 gene locus_tag LOCUS_30090 62116 62556 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635648.1 protein_id gnl|my_center|LOCUS_30090 63505 62582 gene locus_tag LOCUS_30100 63505 62582 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704088.1 protein_id gnl|my_center|LOCUS_30100 63971 64834 gene locus_tag LOCUS_30110 63971 64834 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704084.1 protein_id gnl|my_center|LOCUS_30110 64938 65912 gene locus_tag LOCUS_30120 64938 65912 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704193.1 protein_id gnl|my_center|LOCUS_30120 66345 67346 gene locus_tag LOCUS_30130 66345 67346 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815993.1 protein_id gnl|my_center|LOCUS_30130 67404 69317 gene locus_tag LOCUS_30140 67404 69317 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704982.1 protein_id gnl|my_center|LOCUS_30140 70209 69334 gene locus_tag LOCUS_30150 70209 69334 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 protein_id gnl|my_center|LOCUS_30150 71047 70289 gene locus_tag LOCUS_30160 71047 70289 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704126.1 protein_id gnl|my_center|LOCUS_30160 73421 71016 gene locus_tag LOCUS_30170 73421 71016 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704125.1 protein_id gnl|my_center|LOCUS_30170 75573 73531 gene locus_tag LOCUS_30180 gene prlC 75573 73531 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_30180 75795 77147 gene locus_tag LOCUS_30190 gene gorA 75795 77147 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478739.1 protein_id gnl|my_center|LOCUS_30190 80302 77228 gene locus_tag LOCUS_30200 80302 77228 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267753.1 protein_id gnl|my_center|LOCUS_30200 80434 81378 gene locus_tag LOCUS_30210 80434 81378 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810463.1 protein_id gnl|my_center|LOCUS_30210 81593 82285 gene locus_tag LOCUS_30220 gene pirR 81593 82285 CDS product response regulator transcription factor PirR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102425.1 protein_id gnl|my_center|LOCUS_30220 82282 83628 gene locus_tag LOCUS_30230 gene pfeS 82282 83628 CDS product two-component system sensor histidine kinase PfeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113403.1 protein_id gnl|my_center|LOCUS_30230 83743 85665 gene locus_tag LOCUS_30240 83743 85665 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073464.1 protein_id gnl|my_center|LOCUS_30240 85718 86857 gene locus_tag LOCUS_30250 gene yiuA 85718 86857 CDS product iron-siderophore ABC transporter substrate-binding protein YiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 protein_id gnl|my_center|LOCUS_30250 86859 87935 gene locus_tag LOCUS_30260 86859 87935 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128344.1 protein_id gnl|my_center|LOCUS_30260 87936 88712 gene locus_tag LOCUS_30270 87936 88712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814657.1 protein_id gnl|my_center|LOCUS_30270 88726 89004 gene locus_tag LOCUS_30280 88726 89004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 89097 89552 gene locus_tag LOCUS_30290 89097 89552 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933541.1 protein_id gnl|my_center|LOCUS_30290 90169 89687 gene locus_tag LOCUS_30300 90169 89687 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072083.1 protein_id gnl|my_center|LOCUS_30300 90405 90881 gene locus_tag LOCUS_30310 90405 90881 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395796.1 protein_id gnl|my_center|LOCUS_30310 91054 91626 gene locus_tag LOCUS_30320 gene phaR 91054 91626 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813585.1 protein_id gnl|my_center|LOCUS_30320 92310 91672 gene locus_tag LOCUS_30330 92310 91672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 92567 94705 gene locus_tag LOCUS_30340 92567 94705 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_30340 94717 95289 gene locus_tag LOCUS_30350 94717 95289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_30350 95741 97516 gene locus_tag LOCUS_30360 gene gcl 95741 97516 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527189.1 protein_id gnl|my_center|LOCUS_30360 97583 98365 gene locus_tag LOCUS_30370 gene hyi 97583 98365 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087181.1 protein_id gnl|my_center|LOCUS_30370 98432 99319 gene locus_tag LOCUS_30380 98432 99319 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105826.1 protein_id gnl|my_center|LOCUS_30380 99500 100768 gene locus_tag LOCUS_30390 99500 100768 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114300.1 protein_id gnl|my_center|LOCUS_30390 100952 101452 gene locus_tag LOCUS_30400 100952 101452 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415815.1 protein_id gnl|my_center|LOCUS_30400 102034 103485 gene locus_tag LOCUS_30410 102034 103485 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 protein_id gnl|my_center|LOCUS_30410 103725 104837 gene locus_tag LOCUS_30420 gene nspC 103725 104837 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973611.1 protein_id gnl|my_center|LOCUS_30420 104890 106128 gene locus_tag LOCUS_30430 104890 106128 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976328.1 protein_id gnl|my_center|LOCUS_30430 >Feature sequence25 2303 612 gene locus_tag LOCUS_30440 2303 612 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044710.1 protein_id gnl|my_center|LOCUS_30440 3455 2325 gene locus_tag LOCUS_30450 gene ugpC 3455 2325 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535873.1 protein_id gnl|my_center|LOCUS_30450 3915 5081 gene locus_tag LOCUS_30460 gene malE 3915 5081 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_30460 5150 6724 gene locus_tag LOCUS_30470 gene malF 5150 6724 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095044.1 protein_id gnl|my_center|LOCUS_30470 6726 7616 gene locus_tag LOCUS_30480 gene malG 6726 7616 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299600.1 protein_id gnl|my_center|LOCUS_30480 7762 9687 gene locus_tag LOCUS_30490 gene glgX 7762 9687 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263622.1 protein_id gnl|my_center|LOCUS_30490 9776 11893 gene locus_tag LOCUS_30500 gene ovoA 9776 11893 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_30500 14693 11982 gene locus_tag LOCUS_30510 gene malT 14693 11982 CDS product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208926.1 protein_id gnl|my_center|LOCUS_30510 15725 14898 gene locus_tag LOCUS_30520 gene malM 15725 14898 CDS product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212093.1 protein_id gnl|my_center|LOCUS_30520 17135 15909 gene locus_tag LOCUS_30530 17135 15909 CDS product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212092.1 protein_id gnl|my_center|LOCUS_30530 18327 17221 gene locus_tag LOCUS_30540 gene malK 18327 17221 CDS product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179177.1 protein_id gnl|my_center|LOCUS_30540 19302 18331 gene locus_tag LOCUS_30550 19302 18331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 19693 20877 gene locus_tag LOCUS_30560 gene malE 19693 20877 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817305.1 protein_id gnl|my_center|LOCUS_30560 20969 22552 gene locus_tag LOCUS_30570 gene malF 20969 22552 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368773.1 protein_id gnl|my_center|LOCUS_30570 22569 23459 gene locus_tag LOCUS_30580 gene malG 22569 23459 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817307.1 protein_id gnl|my_center|LOCUS_30580 25003 23591 gene locus_tag LOCUS_30590 25003 23591 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 protein_id gnl|my_center|LOCUS_30590 26168 25356 gene locus_tag LOCUS_30600 26168 25356 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706506.1 protein_id gnl|my_center|LOCUS_30600 26367 28745 gene locus_tag LOCUS_30610 gene ppsA 26367 28745 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818062.1 protein_id gnl|my_center|LOCUS_30610 28877 29485 gene locus_tag LOCUS_30620 28877 29485 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010205556.1 protein_id gnl|my_center|LOCUS_30620 29485 30309 gene locus_tag LOCUS_30630 29485 30309 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704137.1 protein_id gnl|my_center|LOCUS_30630 30396 31103 gene locus_tag LOCUS_30640 gene queC 30396 31103 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975901.1 protein_id gnl|my_center|LOCUS_30640 31091 31447 gene locus_tag LOCUS_30650 gene queD 31091 31447 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533306.1 protein_id gnl|my_center|LOCUS_30650 31444 32163 gene locus_tag LOCUS_30660 gene queE 31444 32163 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172402078.1 protein_id gnl|my_center|LOCUS_30660 33018 32245 gene locus_tag LOCUS_30670 gene moeB 33018 32245 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705494.1 protein_id gnl|my_center|LOCUS_30670 34259 33018 gene locus_tag LOCUS_30680 gene moeA 34259 33018 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705495.1 protein_id gnl|my_center|LOCUS_30680 34425 35081 gene locus_tag LOCUS_30690 gene folE 34425 35081 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705496.1 protein_id gnl|my_center|LOCUS_30690 35975 35097 gene locus_tag LOCUS_30700 35975 35097 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705501.1 protein_id gnl|my_center|LOCUS_30700 36599 37159 gene locus_tag LOCUS_30710 36599 37159 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705502.1 protein_id gnl|my_center|LOCUS_30710 37175 37903 gene locus_tag LOCUS_30720 37175 37903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 37991 38263 gene locus_tag LOCUS_30730 37991 38263 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705505.1 protein_id gnl|my_center|LOCUS_30730 39976 38243 gene locus_tag LOCUS_30740 39976 38243 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705506.1 protein_id gnl|my_center|LOCUS_30740 40418 42322 gene locus_tag LOCUS_30750 gene speA 40418 42322 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705508.1 protein_id gnl|my_center|LOCUS_30750 >Feature sequence26 169 278 gene locus_tag LOCUS_r00030 169 278 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 314 390 gene locus_tag LOCUS_t00830 314 390 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 597 818 gene locus_tag LOCUS_30760 597 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 3127 866 gene locus_tag LOCUS_30770 3127 866 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191939.1 protein_id gnl|my_center|LOCUS_30770 3349 3960 gene locus_tag LOCUS_30780 3349 3960 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042064868.1 protein_id gnl|my_center|LOCUS_30780 5307 3937 gene locus_tag LOCUS_30790 5307 3937 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705339.1 protein_id gnl|my_center|LOCUS_30790 6729 5398 gene locus_tag LOCUS_30800 6729 5398 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_30800 8840 6804 gene locus_tag LOCUS_30810 8840 6804 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 protein_id gnl|my_center|LOCUS_30810 9114 8833 gene locus_tag LOCUS_30820 9114 8833 CDS product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422760.1 protein_id gnl|my_center|LOCUS_30820 9692 9183 gene locus_tag LOCUS_30830 gene crr 9692 9183 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303134.1 protein_id gnl|my_center|LOCUS_30830 10907 9939 gene locus_tag LOCUS_30840 gene cysK 10907 9939 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706833.1 protein_id gnl|my_center|LOCUS_30840 11285 12673 gene locus_tag LOCUS_30850 11285 12673 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819550.1 protein_id gnl|my_center|LOCUS_30850 12878 13426 gene locus_tag LOCUS_30860 12878 13426 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705140.1 protein_id gnl|my_center|LOCUS_30860 14091 13390 gene locus_tag LOCUS_30870 gene cysZ 14091 13390 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705142.1 protein_id gnl|my_center|LOCUS_30870 14547 14380 gene locus_tag LOCUS_30880 14547 14380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 14501 15505 gene locus_tag LOCUS_30890 gene zipA 14501 15505 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705144.1 protein_id gnl|my_center|LOCUS_30890 15566 17608 gene locus_tag LOCUS_30900 gene ligA 15566 17608 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705145.1 protein_id gnl|my_center|LOCUS_30900 18189 17641 gene locus_tag LOCUS_30910 18189 17641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 18412 19824 gene locus_tag LOCUS_30920 gene gltX 18412 19824 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707206.1 protein_id gnl|my_center|LOCUS_30920 20034 20109 gene locus_tag LOCUS_t00840 20034 20109 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20148 20223 gene locus_tag LOCUS_t00850 20148 20223 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20338 20413 gene locus_tag LOCUS_t00860 20338 20413 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20435 20510 gene locus_tag LOCUS_t00870 20435 20510 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20704 21387 gene locus_tag LOCUS_30930 20704 21387 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074284.1 protein_id gnl|my_center|LOCUS_30930 21974 21372 gene locus_tag LOCUS_30940 21974 21372 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707238.1 protein_id gnl|my_center|LOCUS_30940 21973 22665 gene locus_tag LOCUS_30950 21973 22665 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 protein_id gnl|my_center|LOCUS_30950 22652 25084 gene locus_tag LOCUS_30960 22652 25084 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707236.1 protein_id gnl|my_center|LOCUS_30960 27726 25081 gene locus_tag LOCUS_30970 27726 25081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 28657 27749 gene locus_tag LOCUS_30980 28657 27749 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707235.1 protein_id gnl|my_center|LOCUS_30980 29395 28895 gene locus_tag LOCUS_30990 gene tpx 29395 28895 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366280.1 protein_id gnl|my_center|LOCUS_30990 31716 29548 gene locus_tag LOCUS_31000 gene pta 31716 29548 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017410280.1 protein_id gnl|my_center|LOCUS_31000 32929 31727 gene locus_tag LOCUS_31010 gene ackA 32929 31727 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095689.1 protein_id gnl|my_center|LOCUS_31010 33210 33650 gene locus_tag LOCUS_31020 gene yfbV 33210 33650 CDS product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704832.1 protein_id gnl|my_center|LOCUS_31020 34024 33656 gene locus_tag LOCUS_31030 gene frdD 34024 33656 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884009.1 protein_id gnl|my_center|LOCUS_31030 34582 34193 gene locus_tag LOCUS_31040 gene frdC 34582 34193 CDS product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421183.1 protein_id gnl|my_center|LOCUS_31040 35318 34593 gene locus_tag LOCUS_31050 35318 34593 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421182.1 protein_id gnl|my_center|LOCUS_31050 37093 35315 gene locus_tag LOCUS_31060 gene frdA 37093 35315 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166592.1 protein_id gnl|my_center|LOCUS_31060 37309 37572 gene locus_tag LOCUS_31070 37309 37572 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479047.1 protein_id gnl|my_center|LOCUS_31070 37572 37718 gene locus_tag LOCUS_31080 gene ykgO 37572 37718 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859006.1 protein_id gnl|my_center|LOCUS_31080 37875 39314 gene locus_tag LOCUS_31090 gene aspA 37875 39314 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704801.1 protein_id gnl|my_center|LOCUS_31090 39401 40702 gene locus_tag LOCUS_31100 39401 40702 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704800.1 protein_id gnl|my_center|LOCUS_31100 40842 41867 gene locus_tag LOCUS_31110 40842 41867 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970722.1 protein_id gnl|my_center|LOCUS_31110 41935 42693 gene locus_tag LOCUS_31120 41935 42693 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 protein_id gnl|my_center|LOCUS_31120 43402 44895 gene locus_tag LOCUS_31130 43402 44895 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705934.1 protein_id gnl|my_center|LOCUS_31130 45078 46523 gene locus_tag LOCUS_31140 45078 46523 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174317.1 protein_id gnl|my_center|LOCUS_31140 47008 46520 gene locus_tag LOCUS_31150 47008 46520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 48132 47401 gene locus_tag LOCUS_31160 48132 47401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 48479 49021 gene locus_tag LOCUS_31170 48479 49021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 50397 49048 gene locus_tag LOCUS_31180 gene mgtE 50397 49048 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071378.1 protein_id gnl|my_center|LOCUS_31180 50802 51029 gene locus_tag LOCUS_31190 50802 51029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 51344 52567 gene locus_tag LOCUS_31200 51344 52567 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085257.1 protein_id gnl|my_center|LOCUS_31200 52664 53641 gene locus_tag LOCUS_31210 52664 53641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 53942 54418 gene locus_tag LOCUS_31220 53942 54418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 54434 54901 gene locus_tag LOCUS_31230 54434 54901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 54898 55176 gene locus_tag LOCUS_31240 54898 55176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 55173 55574 gene locus_tag LOCUS_31250 55173 55574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 55571 56188 gene locus_tag LOCUS_31260 55571 56188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 56198 57601 gene locus_tag LOCUS_31270 56198 57601 CDS product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042065.1 protein_id gnl|my_center|LOCUS_31270 57987 58292 gene locus_tag LOCUS_31280 57987 58292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31280 58285 58581 gene locus_tag LOCUS_31290 58285 58581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31290 58541 58762 gene locus_tag LOCUS_31300 58541 58762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 59440 60342 gene locus_tag LOCUS_31310 59440 60342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 61333 61926 gene locus_tag LOCUS_31320 61333 61926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 62287 62487 gene locus_tag LOCUS_31330 62287 62487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 62500 64137 gene locus_tag LOCUS_31340 62500 64137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 64349 64669 gene locus_tag LOCUS_31350 64349 64669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 65096 64797 gene locus_tag LOCUS_31360 gene fis 65096 64797 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309538.1 protein_id gnl|my_center|LOCUS_31360 66087 65122 gene locus_tag LOCUS_31370 gene dusB 66087 65122 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707259.1 protein_id gnl|my_center|LOCUS_31370 66378 67706 gene locus_tag LOCUS_31380 66378 67706 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171281526.1 protein_id gnl|my_center|LOCUS_31380 67703 68674 gene locus_tag LOCUS_31390 67703 68674 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707257.1 protein_id gnl|my_center|LOCUS_31390 68674 69768 gene locus_tag LOCUS_31400 68674 69768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707256.1 protein_id gnl|my_center|LOCUS_31400 69765 70874 gene locus_tag LOCUS_31410 69765 70874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707255.1 protein_id gnl|my_center|LOCUS_31410 71896 71021 gene locus_tag LOCUS_31420 gene prmA 71896 71021 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010675412.1 protein_id gnl|my_center|LOCUS_31420 73483 72029 gene locus_tag LOCUS_31430 gene panF 73483 72029 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707115.1 protein_id gnl|my_center|LOCUS_31430 73715 73473 gene locus_tag LOCUS_31440 73715 73473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 74201 73836 gene locus_tag LOCUS_31450 74201 73836 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152368.1 protein_id gnl|my_center|LOCUS_31450 75760 74420 gene locus_tag LOCUS_31460 gene accC 75760 74420 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707113.1 protein_id gnl|my_center|LOCUS_31460 76252 75770 gene locus_tag LOCUS_31470 gene accB 76252 75770 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163113.1 protein_id gnl|my_center|LOCUS_31470 76736 76287 gene locus_tag LOCUS_31480 gene aroQ 76736 76287 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174343.1 protein_id gnl|my_center|LOCUS_31480 77388 76954 gene locus_tag LOCUS_31490 77388 76954 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263098.1 protein_id gnl|my_center|LOCUS_31490 77749 77399 gene locus_tag LOCUS_31500 77749 77399 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_31500 78533 77754 gene locus_tag LOCUS_31510 78533 77754 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_31510 79280 78558 gene locus_tag LOCUS_31520 79280 78558 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_31520 81377 79428 gene locus_tag LOCUS_31530 gene acs 81377 79428 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707110.1 protein_id gnl|my_center|LOCUS_31530 82170 81556 gene locus_tag LOCUS_31540 82170 81556 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262772.1 protein_id gnl|my_center|LOCUS_31540 83960 82170 gene locus_tag LOCUS_31550 83960 82170 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262771.1 protein_id gnl|my_center|LOCUS_31550 84493 84065 gene locus_tag LOCUS_31560 84493 84065 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037208.1 protein_id gnl|my_center|LOCUS_31560 84837 84493 gene locus_tag LOCUS_31570 84837 84493 CDS product DUF2956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704941.1 protein_id gnl|my_center|LOCUS_31570 85457 84837 gene locus_tag LOCUS_31580 gene torD 85457 84837 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707104.1 protein_id gnl|my_center|LOCUS_31580 85746 86999 gene locus_tag LOCUS_31590 85746 86999 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707102.1 protein_id gnl|my_center|LOCUS_31590 87178 87627 gene locus_tag LOCUS_31600 gene nrdR 87178 87627 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010675395.1 protein_id gnl|my_center|LOCUS_31600 87628 88743 gene locus_tag LOCUS_31610 gene ribD 87628 88743 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707100.1 protein_id gnl|my_center|LOCUS_31610 88743 89396 gene locus_tag LOCUS_31620 88743 89396 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707099.1 protein_id gnl|my_center|LOCUS_31620 89412 90521 gene locus_tag LOCUS_31630 gene ribBA 89412 90521 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 protein_id gnl|my_center|LOCUS_31630 90653 92656 gene locus_tag LOCUS_31640 gene siaA 90653 92656 CDS product biofilm regulation protein phosphatase SiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112649.1 protein_id gnl|my_center|LOCUS_31640 92670 93212 gene locus_tag LOCUS_31650 gene siaB 92670 93212 CDS product biofilm formation regulator kinase SiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083916.1 protein_id gnl|my_center|LOCUS_31650 93209 93610 gene locus_tag LOCUS_31660 gene siaC 93209 93610 CDS product biofilm formation regulator SiaD modulator protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 protein_id gnl|my_center|LOCUS_31660 93603 94391 gene locus_tag LOCUS_31670 gene siaD 93603 94391 CDS product biofilm regulation diguanylate cyclase SiaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118588.1 protein_id gnl|my_center|LOCUS_31670 94434 94979 gene locus_tag LOCUS_31680 94434 94979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 94983 95645 gene locus_tag LOCUS_31690 94983 95645 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_31690 95658 96005 gene locus_tag LOCUS_31700 95658 96005 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_31700 97061 96180 gene locus_tag LOCUS_31710 97061 96180 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 protein_id gnl|my_center|LOCUS_31710 97951 97208 gene locus_tag LOCUS_31720 gene pflA 97951 97208 CDS product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705579.1 protein_id gnl|my_center|LOCUS_31720 100570 98288 gene locus_tag LOCUS_31730 gene pflB 100570 98288 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292822.1 protein_id gnl|my_center|LOCUS_31730 101063 100746 gene locus_tag LOCUS_31740 101063 100746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 101076 101543 gene locus_tag LOCUS_31750 gene ribE 101076 101543 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351731.1 protein_id gnl|my_center|LOCUS_31750 101557 101967 gene locus_tag LOCUS_31760 gene nusB 101557 101967 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707095.1 protein_id gnl|my_center|LOCUS_31760 102015 102980 gene locus_tag LOCUS_31770 gene thiL 102015 102980 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_31770 102981 103460 gene locus_tag LOCUS_31780 102981 103460 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 protein_id gnl|my_center|LOCUS_31780 103905 103606 gene locus_tag LOCUS_31790 103905 103606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 104267 106006 gene locus_tag LOCUS_31800 104267 106006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707092.1 protein_id gnl|my_center|LOCUS_31800 106027 107583 gene locus_tag LOCUS_31810 106027 107583 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421494.1 protein_id gnl|my_center|LOCUS_31810 107903 108877 gene locus_tag LOCUS_31820 107903 108877 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707090.1 protein_id gnl|my_center|LOCUS_31820 108883 109818 gene locus_tag LOCUS_31830 108883 109818 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277181.1 protein_id gnl|my_center|LOCUS_31830 110020 111375 gene locus_tag LOCUS_31840 110020 111375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 protein_id gnl|my_center|LOCUS_31840 111548 113641 gene locus_tag LOCUS_31850 gene fusA 111548 113641 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071132.1 protein_id gnl|my_center|LOCUS_31850 114646 113741 gene locus_tag LOCUS_31860 114646 113741 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084035.1 protein_id gnl|my_center|LOCUS_31860 114904 114713 gene locus_tag LOCUS_31870 114904 114713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 114905 115897 gene locus_tag LOCUS_31880 114905 115897 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809108.1 protein_id gnl|my_center|LOCUS_31880 116007 117146 gene locus_tag LOCUS_31890 116007 117146 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_31890 117159 117908 gene locus_tag LOCUS_31900 117159 117908 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091107.1 protein_id gnl|my_center|LOCUS_31900 117908 118840 gene locus_tag LOCUS_31910 117908 118840 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_31910 118960 120303 gene locus_tag LOCUS_31920 118960 120303 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986374.1 protein_id gnl|my_center|LOCUS_31920 120370 122001 gene locus_tag LOCUS_31930 120370 122001 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102932.1 protein_id gnl|my_center|LOCUS_31930 122910 122062 gene locus_tag LOCUS_31940 122910 122062 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973725.1 protein_id gnl|my_center|LOCUS_31940 123031 123663 gene locus_tag LOCUS_31950 123031 123663 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707009.1 protein_id gnl|my_center|LOCUS_31950 124124 123813 gene locus_tag LOCUS_31960 124124 123813 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460963.1 protein_id gnl|my_center|LOCUS_31960 124831 124121 gene locus_tag LOCUS_31970 124831 124121 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480275.1 protein_id gnl|my_center|LOCUS_31970 126715 125048 gene locus_tag LOCUS_31980 gene ettA 126715 125048 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704886.1 protein_id gnl|my_center|LOCUS_31980 127954 126896 gene locus_tag LOCUS_31990 127954 126896 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_31990 128380 128189 gene locus_tag LOCUS_32000 128380 128189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 128687 129475 gene locus_tag LOCUS_32010 128687 129475 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206030.1 protein_id gnl|my_center|LOCUS_32010 129711 130019 gene locus_tag LOCUS_32020 129711 130019 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117586.1 protein_id gnl|my_center|LOCUS_32020 130034 130333 gene locus_tag LOCUS_32030 130034 130333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070730.1 protein_id gnl|my_center|LOCUS_32030 130366 131400 gene locus_tag LOCUS_32040 130366 131400 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070727.1 protein_id gnl|my_center|LOCUS_32040 131393 132151 gene locus_tag LOCUS_32050 131393 132151 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098651.1 protein_id gnl|my_center|LOCUS_32050 132176 133114 gene locus_tag LOCUS_32060 132176 133114 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206032.1 protein_id gnl|my_center|LOCUS_32060 133118 134338 gene locus_tag LOCUS_32070 133118 134338 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206033.1 protein_id gnl|my_center|LOCUS_32070 134361 135617 gene locus_tag LOCUS_32080 134361 135617 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206034.1 protein_id gnl|my_center|LOCUS_32080 135706 136227 gene locus_tag LOCUS_32090 135706 136227 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206035.1 protein_id gnl|my_center|LOCUS_32090 136230 137078 gene locus_tag LOCUS_32100 136230 137078 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206036.1 protein_id gnl|my_center|LOCUS_32100 137075 137869 gene locus_tag LOCUS_32110 137075 137869 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009973.1 protein_id gnl|my_center|LOCUS_32110 137878 138669 gene locus_tag LOCUS_32120 137878 138669 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206037.1 protein_id gnl|my_center|LOCUS_32120 138681 140147 gene locus_tag LOCUS_32130 138681 140147 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206038.1 protein_id gnl|my_center|LOCUS_32130 140185 141825 gene locus_tag LOCUS_32140 140185 141825 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206039.1 protein_id gnl|my_center|LOCUS_32140 142425 143405 gene locus_tag LOCUS_32150 142425 143405 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_32150 143510 143959 gene locus_tag LOCUS_32160 143510 143959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 144045 145565 gene locus_tag LOCUS_32170 144045 145565 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925786.1 protein_id gnl|my_center|LOCUS_32170 145698 146534 gene locus_tag LOCUS_32180 145698 146534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112677.1 protein_id gnl|my_center|LOCUS_32180 146699 147298 gene locus_tag LOCUS_32190 146699 147298 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704899.1 protein_id gnl|my_center|LOCUS_32190 147356 147604 gene locus_tag LOCUS_32200 147356 147604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704519.1 protein_id gnl|my_center|LOCUS_32200 148373 147606 gene locus_tag LOCUS_32210 148373 147606 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704900.1 protein_id gnl|my_center|LOCUS_32210 149386 148370 gene locus_tag LOCUS_32220 149386 148370 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819447.1 protein_id gnl|my_center|LOCUS_32220 150207 149383 gene locus_tag LOCUS_32230 150207 149383 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479207.1 protein_id gnl|my_center|LOCUS_32230 150629 150204 gene locus_tag LOCUS_32240 150629 150204 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261839.1 protein_id gnl|my_center|LOCUS_32240 151246 150626 gene locus_tag LOCUS_32250 151246 150626 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445085.1 protein_id gnl|my_center|LOCUS_32250 152002 151250 gene locus_tag LOCUS_32260 152002 151250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 152110 154119 gene locus_tag LOCUS_32270 152110 154119 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073464.1 protein_id gnl|my_center|LOCUS_32270 154135 154644 gene locus_tag LOCUS_32280 gene hutX 154135 154644 CDS product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445093.1 protein_id gnl|my_center|LOCUS_32280 154637 155164 gene locus_tag LOCUS_32290 gene hutZ 154637 155164 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704904.1 protein_id gnl|my_center|LOCUS_32290 155298 155738 gene locus_tag LOCUS_32300 155298 155738 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071100.1 protein_id gnl|my_center|LOCUS_32300 156508 155885 gene locus_tag LOCUS_32310 156508 155885 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818910.1 protein_id gnl|my_center|LOCUS_32310 156549 157697 gene locus_tag LOCUS_32320 156549 157697 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707630.1 protein_id gnl|my_center|LOCUS_32320 159029 157731 gene locus_tag LOCUS_32330 159029 157731 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_32330 160275 159154 gene locus_tag LOCUS_32340 160275 159154 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749934.1 protein_id gnl|my_center|LOCUS_32340 162572 161064 gene locus_tag LOCUS_32350 162572 161064 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464542.1 protein_id gnl|my_center|LOCUS_32350 163068 162595 gene locus_tag LOCUS_32360 163068 162595 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281721.1 protein_id gnl|my_center|LOCUS_32360 164138 163134 gene locus_tag LOCUS_32370 164138 163134 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869089.1 protein_id gnl|my_center|LOCUS_32370 165352 164174 gene locus_tag LOCUS_32380 gene tcuB 165352 164174 CDS product tricarballylate utilization 4Fe-4S protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704751.1 protein_id gnl|my_center|LOCUS_32380 166763 165339 gene locus_tag LOCUS_32390 gene tcuA 166763 165339 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228705.1 protein_id gnl|my_center|LOCUS_32390 166878 167567 gene locus_tag LOCUS_32400 166878 167567 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966590.1 protein_id gnl|my_center|LOCUS_32400 <169248 167961 gene locus_tag LOCUS_32410 <169248 167961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070790.1:bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase >Feature sequence27 1566 250 gene locus_tag LOCUS_32420 1566 250 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210164.1 protein_id gnl|my_center|LOCUS_32420 1953 2966 gene locus_tag LOCUS_32430 1953 2966 CDS product autoinducer 2-binding periplasmic protein LuxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823678.1 protein_id gnl|my_center|LOCUS_32430 2944 6045 gene locus_tag LOCUS_32440 2944 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 6397 8586 gene locus_tag LOCUS_32450 gene katG 6397 8586 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074054.1 protein_id gnl|my_center|LOCUS_32450 10471 8639 gene locus_tag LOCUS_32460 gene glmS 10471 8639 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707902.1 protein_id gnl|my_center|LOCUS_32460 11252 10482 gene locus_tag LOCUS_32470 11252 10482 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269443.1 protein_id gnl|my_center|LOCUS_32470 12872 11478 gene locus_tag LOCUS_32480 gene glmU 12872 11478 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707907.1 protein_id gnl|my_center|LOCUS_32480 13365 12940 gene locus_tag LOCUS_32490 13365 12940 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307217.1 protein_id gnl|my_center|LOCUS_32490 14772 13384 gene locus_tag LOCUS_32500 gene atpD 14772 13384 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307215.1 protein_id gnl|my_center|LOCUS_32500 15552 14806 gene locus_tag LOCUS_32510 gene atpG 15552 14806 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707909.1 protein_id gnl|my_center|LOCUS_32510 17250 15709 gene locus_tag LOCUS_32520 gene atpA 17250 15709 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707910.1 protein_id gnl|my_center|LOCUS_32520 17795 17265 gene locus_tag LOCUS_32530 gene atpH 17795 17265 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707911.1 protein_id gnl|my_center|LOCUS_32530 18279 17809 gene locus_tag LOCUS_32540 gene atpF 18279 17809 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004107293.1 protein_id gnl|my_center|LOCUS_32540 18553 18329 gene locus_tag LOCUS_32550 gene atpE 18553 18329 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307205.1 protein_id gnl|my_center|LOCUS_32550 19172 18615 gene locus_tag LOCUS_32560 19172 18615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 19795 19403 gene locus_tag LOCUS_32570 19795 19403 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029302496.1 protein_id gnl|my_center|LOCUS_32570 20891 19986 gene locus_tag LOCUS_32580 20891 19986 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707915.1 protein_id gnl|my_center|LOCUS_32580 21691 20888 gene locus_tag LOCUS_32590 21691 20888 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 protein_id gnl|my_center|LOCUS_32590 22324 21701 gene locus_tag LOCUS_32600 gene rsmG 22324 21701 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707917.1 protein_id gnl|my_center|LOCUS_32600 24222 22333 gene locus_tag LOCUS_32610 gene mnmG 24222 22333 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707918.1 protein_id gnl|my_center|LOCUS_32610 25159 24713 gene locus_tag LOCUS_32620 gene mioC 25159 24713 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352400.1 protein_id gnl|my_center|LOCUS_32620 25950 25255 gene locus_tag LOCUS_32630 25950 25255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 27649 25934 gene locus_tag LOCUS_32640 27649 25934 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_32640 28477 27914 gene locus_tag LOCUS_32650 28477 27914 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467005.1 protein_id gnl|my_center|LOCUS_32650 30191 29271 gene locus_tag LOCUS_32660 30191 29271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 32427 30340 gene locus_tag LOCUS_32670 gene gspD 32427 30340 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533584.1 protein_id gnl|my_center|LOCUS_32670 32969 32424 gene locus_tag LOCUS_32680 32969 32424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 33577 32966 gene locus_tag LOCUS_32690 33577 32966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 34656 33574 gene locus_tag LOCUS_32700 34656 33574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 35568 34669 gene locus_tag LOCUS_32710 35568 34669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 36229 35558 gene locus_tag LOCUS_32720 36229 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 36627 36226 gene locus_tag LOCUS_32730 36627 36226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 37015 36620 gene locus_tag LOCUS_32740 37015 36620 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411575.1 protein_id gnl|my_center|LOCUS_32740 37472 37041 gene locus_tag LOCUS_32750 gene gspG 37472 37041 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_32750 38703 37483 gene locus_tag LOCUS_32760 gene gspF 38703 37483 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417566.1 protein_id gnl|my_center|LOCUS_32760 40420 38705 gene locus_tag LOCUS_32770 gene gspE 40420 38705 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 protein_id gnl|my_center|LOCUS_32770 40648 42000 gene locus_tag LOCUS_32780 gene gdhA 40648 42000 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289187.1 protein_id gnl|my_center|LOCUS_32780 42250 43560 gene locus_tag LOCUS_32790 gene urtA 42250 43560 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529436.1 protein_id gnl|my_center|LOCUS_32790 43839 45437 gene locus_tag LOCUS_32800 gene urtB 43839 45437 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531848.1 protein_id gnl|my_center|LOCUS_32800 45441 46547 gene locus_tag LOCUS_32810 gene urtC 45441 46547 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976303.1 protein_id gnl|my_center|LOCUS_32810 46544 47389 gene locus_tag LOCUS_32820 gene urtD 46544 47389 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_32820 47389 48087 gene locus_tag LOCUS_32830 gene urtE 47389 48087 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149319367.1 protein_id gnl|my_center|LOCUS_32830 48747 48382 gene locus_tag LOCUS_32840 48747 48382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 48958 50421 gene locus_tag LOCUS_32850 48958 50421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 50393 51754 gene locus_tag LOCUS_32860 gene zraR 50393 51754 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148522.1 protein_id gnl|my_center|LOCUS_32860 52101 51751 gene locus_tag LOCUS_32870 52101 51751 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 protein_id gnl|my_center|LOCUS_32870 52199 53998 gene locus_tag LOCUS_32880 52199 53998 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819666.1 protein_id gnl|my_center|LOCUS_32880 55229 54111 gene locus_tag LOCUS_32890 55229 54111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 58213 55406 gene locus_tag LOCUS_32900 58213 55406 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188699.1 protein_id gnl|my_center|LOCUS_32900 59124 58471 gene locus_tag LOCUS_32910 59124 58471 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706378.1 protein_id gnl|my_center|LOCUS_32910 60542 59124 gene locus_tag LOCUS_32920 60542 59124 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 protein_id gnl|my_center|LOCUS_32920 61305 60532 gene locus_tag LOCUS_32930 61305 60532 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706380.1 protein_id gnl|my_center|LOCUS_32930 63340 61640 gene locus_tag LOCUS_32940 63340 61640 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626068.1 protein_id gnl|my_center|LOCUS_32940 63500 64405 gene locus_tag LOCUS_32950 63500 64405 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706382.1 protein_id gnl|my_center|LOCUS_32950 64418 65455 gene locus_tag LOCUS_32960 64418 65455 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134026.1 protein_id gnl|my_center|LOCUS_32960 66757 65720 gene locus_tag LOCUS_32970 66757 65720 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986861.1 protein_id gnl|my_center|LOCUS_32970 66908 67804 gene locus_tag LOCUS_32980 66908 67804 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312133.1 protein_id gnl|my_center|LOCUS_32980 68376 67801 gene locus_tag LOCUS_32990 68376 67801 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704693.1 protein_id gnl|my_center|LOCUS_32990 68517 69563 gene locus_tag LOCUS_33000 68517 69563 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819342.1 protein_id gnl|my_center|LOCUS_33000 71226 69598 gene locus_tag LOCUS_33010 71226 69598 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705497.1 protein_id gnl|my_center|LOCUS_33010 71838 71374 gene locus_tag LOCUS_33020 71838 71374 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422212.1 protein_id gnl|my_center|LOCUS_33020 72094 71828 gene locus_tag LOCUS_33030 72094 71828 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 protein_id gnl|my_center|LOCUS_33030 72969 72247 gene locus_tag LOCUS_33040 72969 72247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 73503 73039 gene locus_tag LOCUS_33050 73503 73039 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477216.1 protein_id gnl|my_center|LOCUS_33050 73642 74580 gene locus_tag LOCUS_33060 73642 74580 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477082.1 protein_id gnl|my_center|LOCUS_33060 75599 74658 gene locus_tag LOCUS_33070 75599 74658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 76419 75790 gene locus_tag LOCUS_33080 76419 75790 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707553.1 protein_id gnl|my_center|LOCUS_33080 76484 77407 gene locus_tag LOCUS_33090 76484 77407 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707554.1 protein_id gnl|my_center|LOCUS_33090 78797 77436 gene locus_tag LOCUS_33100 gene mnmE 78797 77436 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707924.1 protein_id gnl|my_center|LOCUS_33100 80537 78876 gene locus_tag LOCUS_33110 gene yidC 80537 78876 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707925.1 protein_id gnl|my_center|LOCUS_33110 81112 80750 gene locus_tag LOCUS_33120 gene rnpA 81112 80750 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707927.1 protein_id gnl|my_center|LOCUS_33120 82242 81502 gene locus_tag LOCUS_33130 82242 81502 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707928.1 protein_id gnl|my_center|LOCUS_33130 82915 82250 gene locus_tag LOCUS_33140 82915 82250 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707929.1 protein_id gnl|my_center|LOCUS_33140 83676 82918 gene locus_tag LOCUS_33150 83676 82918 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307144.1 protein_id gnl|my_center|LOCUS_33150 84332 83880 gene locus_tag LOCUS_33160 gene azu 84332 83880 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706751.1 protein_id gnl|my_center|LOCUS_33160 84689 86053 gene locus_tag LOCUS_33170 gene dnaA 84689 86053 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307141.1 protein_id gnl|my_center|LOCUS_33170 86067 87167 gene locus_tag LOCUS_33180 gene dnaN 86067 87167 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704048.1 protein_id gnl|my_center|LOCUS_33180 87170 88261 gene locus_tag LOCUS_33190 gene recF 87170 88261 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704049.1 protein_id gnl|my_center|LOCUS_33190 88266 90683 gene locus_tag LOCUS_33200 gene gyrB 88266 90683 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704050.1 protein_id gnl|my_center|LOCUS_33200 90742 91092 gene locus_tag LOCUS_33210 90742 91092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33210 91053 91367 gene locus_tag LOCUS_33220 91053 91367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33220 91429 91851 gene locus_tag LOCUS_33230 91429 91851 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635612.1 protein_id gnl|my_center|LOCUS_33230 93168 91915 gene locus_tag LOCUS_33240 93168 91915 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704054.1 protein_id gnl|my_center|LOCUS_33240 93647 93306 gene locus_tag LOCUS_33250 93647 93306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 95868 93799 gene locus_tag LOCUS_33260 gene glyS 95868 93799 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704155.1 protein_id gnl|my_center|LOCUS_33260 96784 95873 gene locus_tag LOCUS_33270 gene glyQ 96784 95873 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175094.1 protein_id gnl|my_center|LOCUS_33270 96886 97455 gene locus_tag LOCUS_33280 96886 97455 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704156.1 protein_id gnl|my_center|LOCUS_33280 97542 98192 gene locus_tag LOCUS_33290 97542 98192 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175106.1 protein_id gnl|my_center|LOCUS_33290 99191 98265 gene locus_tag LOCUS_33300 99191 98265 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_33300 99516 99271 gene locus_tag LOCUS_33310 gene tusA 99516 99271 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307416.1 protein_id gnl|my_center|LOCUS_33310 100810 99647 gene locus_tag LOCUS_33320 gene fadA 100810 99647 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704164.1 protein_id gnl|my_center|LOCUS_33320 102977 100833 gene locus_tag LOCUS_33330 gene fadB 102977 100833 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704165.1 protein_id gnl|my_center|LOCUS_33330 103258 103881 gene locus_tag LOCUS_33340 103258 103881 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704168.1 protein_id gnl|my_center|LOCUS_33340 103905 105362 gene locus_tag LOCUS_33350 103905 105362 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160591.1 protein_id gnl|my_center|LOCUS_33350 105372 105896 gene locus_tag LOCUS_33360 gene hemG 105372 105896 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945460.1 protein_id gnl|my_center|LOCUS_33360 >Feature sequence28 729 112 gene locus_tag LOCUS_33370 729 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 1780 1286 gene locus_tag LOCUS_33380 1780 1286 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198641.1 protein_id gnl|my_center|LOCUS_33380 2422 1865 gene locus_tag LOCUS_33390 2422 1865 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170245.1 protein_id gnl|my_center|LOCUS_33390 2734 2498 gene locus_tag LOCUS_33400 2734 2498 CDS product DUF3565 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922503.1 protein_id gnl|my_center|LOCUS_33400 3248 2742 gene locus_tag LOCUS_33410 3248 2742 CDS product DUF3087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071687.1 protein_id gnl|my_center|LOCUS_33410 3636 3331 gene locus_tag LOCUS_33420 3636 3331 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241605.1 protein_id gnl|my_center|LOCUS_33420 4213 3719 gene locus_tag LOCUS_33430 gene yhhY 4213 3719 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314206.1 protein_id gnl|my_center|LOCUS_33430 5077 4292 gene locus_tag LOCUS_33440 5077 4292 CDS product DUF5602 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020850.1 protein_id gnl|my_center|LOCUS_33440 5781 5272 gene locus_tag LOCUS_33450 5781 5272 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208072.1 protein_id gnl|my_center|LOCUS_33450 6104 5871 gene locus_tag LOCUS_33460 6104 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 6326 7684 gene locus_tag LOCUS_33470 gene yegD 6326 7684 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072221.1 protein_id gnl|my_center|LOCUS_33470 7832 8017 gene locus_tag LOCUS_33480 7832 8017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 8618 8157 gene locus_tag LOCUS_33490 8618 8157 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 protein_id gnl|my_center|LOCUS_33490 9295 8780 gene locus_tag LOCUS_33500 gene def 9295 8780 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395192.1 protein_id gnl|my_center|LOCUS_33500 9886 9392 gene locus_tag LOCUS_33510 9886 9392 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_33510 10394 9963 gene locus_tag LOCUS_33520 10394 9963 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706242.1 protein_id gnl|my_center|LOCUS_33520 12060 10741 gene locus_tag LOCUS_33530 12060 10741 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483370.1 protein_id gnl|my_center|LOCUS_33530 12492 12205 gene locus_tag LOCUS_33540 gene rplY 12492 12205 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945378.1 protein_id gnl|my_center|LOCUS_33540 16595 12708 gene locus_tag LOCUS_33550 gene hrpA 16595 12708 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139499.1 protein_id gnl|my_center|LOCUS_33550 17612 16653 gene locus_tag LOCUS_33560 17612 16653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 18654 18181 gene locus_tag LOCUS_33570 18654 18181 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996417.1 protein_id gnl|my_center|LOCUS_33570 19312 18896 gene locus_tag LOCUS_33580 19312 18896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 20541 19405 gene locus_tag LOCUS_33590 20541 19405 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367480.1 protein_id gnl|my_center|LOCUS_33590 21362 20634 gene locus_tag LOCUS_33600 21362 20634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706230.1 protein_id gnl|my_center|LOCUS_33600 23019 21397 gene locus_tag LOCUS_33610 23019 21397 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706231.1 protein_id gnl|my_center|LOCUS_33610 23333 23052 gene locus_tag LOCUS_33620 gene ppiC 23333 23052 CDS product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883180.1 protein_id gnl|my_center|LOCUS_33620 >Feature sequence29 <1 1288 gene locus_tag LOCUS_33630 <1 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070790.1:bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase 1409 1765 gene locus_tag LOCUS_33640 1409 1765 CDS product YacL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704605.1 protein_id gnl|my_center|LOCUS_33640 2220 1804 gene locus_tag LOCUS_33650 gene arfB 2220 1804 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704614.1 protein_id gnl|my_center|LOCUS_33650 2398 2736 gene locus_tag LOCUS_33660 gene glnK 2398 2736 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767166.1 protein_id gnl|my_center|LOCUS_33660 2749 3978 gene locus_tag LOCUS_33670 2749 3978 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 protein_id gnl|my_center|LOCUS_33670 4207 5220 gene locus_tag LOCUS_33680 4207 5220 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704616.1 protein_id gnl|my_center|LOCUS_33680 5274 6878 gene locus_tag LOCUS_33690 5274 6878 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704617.1 protein_id gnl|my_center|LOCUS_33690 6878 7942 gene locus_tag LOCUS_33700 6878 7942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704618.1 protein_id gnl|my_center|LOCUS_33700 8056 8967 gene locus_tag LOCUS_33710 8056 8967 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704619.1 protein_id gnl|my_center|LOCUS_33710 9656 9156 gene locus_tag LOCUS_33720 gene argR 9656 9156 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308670.1 protein_id gnl|my_center|LOCUS_33720 9919 10527 gene locus_tag LOCUS_33730 9919 10527 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308671.1 protein_id gnl|my_center|LOCUS_33730 10549 11289 gene locus_tag LOCUS_33740 10549 11289 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704620.1 protein_id gnl|my_center|LOCUS_33740 11294 11938 gene locus_tag LOCUS_33750 gene artQ 11294 11938 CDS product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704621.1 protein_id gnl|my_center|LOCUS_33750 11931 12608 gene locus_tag LOCUS_33760 gene artM 11931 12608 CDS product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704622.1 protein_id gnl|my_center|LOCUS_33760 12732 13670 gene locus_tag LOCUS_33770 gene mdh 12732 13670 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861563.1 protein_id gnl|my_center|LOCUS_33770 13962 15581 gene locus_tag LOCUS_33780 gene pgi 13962 15581 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704176.1 protein_id gnl|my_center|LOCUS_33780 15725 16723 gene locus_tag LOCUS_33790 gene gntR 15725 16723 CDS product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209514.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence30 207 316 gene locus_tag LOCUS_r00040 207 316 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 693 2072 gene locus_tag LOCUS_33800 693 2072 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704812.1 protein_id gnl|my_center|LOCUS_33800 2764 2069 gene locus_tag LOCUS_33810 gene thiQ 2764 2069 CDS product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704814.1 protein_id gnl|my_center|LOCUS_33810 4349 2748 gene locus_tag LOCUS_33820 gene thiP 4349 2748 CDS product thiamine/thiamine pyrophosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704815.1 protein_id gnl|my_center|LOCUS_33820 5332 4349 gene locus_tag LOCUS_33830 gene thiB 5332 4349 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704816.1 protein_id gnl|my_center|LOCUS_33830 5504 5794 gene locus_tag LOCUS_33840 5504 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 5870 6295 gene locus_tag LOCUS_33850 5870 6295 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070493.1 protein_id gnl|my_center|LOCUS_33850 6927 6328 gene locus_tag LOCUS_33860 gene leuD 6927 6328 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704819.1 protein_id gnl|my_center|LOCUS_33860 8335 6938 gene locus_tag LOCUS_33870 gene leuC 8335 6938 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704820.1 protein_id gnl|my_center|LOCUS_33870 9435 8335 gene locus_tag LOCUS_33880 gene leuB 9435 8335 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704821.1 protein_id gnl|my_center|LOCUS_33880 11003 9438 gene locus_tag LOCUS_33890 gene leuA 11003 9438 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704822.1 protein_id gnl|my_center|LOCUS_33890 11807 13525 gene locus_tag LOCUS_33900 11807 13525 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704827.1 protein_id gnl|my_center|LOCUS_33900 13525 14019 gene locus_tag LOCUS_33910 gene ilvN 13525 14019 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704829.1 protein_id gnl|my_center|LOCUS_33910 14132 14851 gene locus_tag LOCUS_33920 14132 14851 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306294.1 protein_id gnl|my_center|LOCUS_33920 14864 15247 gene locus_tag LOCUS_33930 14864 15247 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707699.1 protein_id gnl|my_center|LOCUS_33930 15295 15696 gene locus_tag LOCUS_33940 gene tusD 15295 15696 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209690.1 protein_id gnl|my_center|LOCUS_33940 15696 16052 gene locus_tag LOCUS_33950 gene tusC 15696 16052 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458285.1 protein_id gnl|my_center|LOCUS_33950 16060 16344 gene locus_tag LOCUS_33960 gene tusB 16060 16344 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945207.1 protein_id gnl|my_center|LOCUS_33960 16479 16853 gene locus_tag LOCUS_33970 gene rpsL 16479 16853 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212323.1 protein_id gnl|my_center|LOCUS_33970 16935 17405 gene locus_tag LOCUS_33980 gene rpsG 16935 17405 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306266.1 protein_id gnl|my_center|LOCUS_33980 17482 19581 gene locus_tag LOCUS_33990 gene fusA 17482 19581 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707695.1 protein_id gnl|my_center|LOCUS_33990 19645 20829 gene locus_tag LOCUS_34000 gene tuf 19645 20829 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707694.1 protein_id gnl|my_center|LOCUS_34000 20982 21407 gene locus_tag LOCUS_34010 20982 21407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 21411 23111 gene locus_tag LOCUS_34020 21411 23111 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_34020 23194 23385 gene locus_tag LOCUS_34030 23194 23385 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352142.1 protein_id gnl|my_center|LOCUS_34030 23659 24120 gene locus_tag LOCUS_34040 23659 24120 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818875.1 protein_id gnl|my_center|LOCUS_34040 24735 24163 gene locus_tag LOCUS_34050 24735 24163 CDS product superinfection exclusion B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635988.1 protein_id gnl|my_center|LOCUS_34050 24977 25408 gene locus_tag LOCUS_34060 24977 25408 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 protein_id gnl|my_center|LOCUS_34060 25577 26197 gene locus_tag LOCUS_34070 25577 26197 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087183.1 protein_id gnl|my_center|LOCUS_34070 27540 26194 gene locus_tag LOCUS_34080 27540 26194 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818594.1 protein_id gnl|my_center|LOCUS_34080 27849 29294 gene locus_tag LOCUS_34090 gene xdhA 27849 29294 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 protein_id gnl|my_center|LOCUS_34090 29287 31689 gene locus_tag LOCUS_34100 gene xdhB 29287 31689 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_34100 31772 32605 gene locus_tag LOCUS_34110 gene xdhC 31772 32605 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267256.1 protein_id gnl|my_center|LOCUS_34110 32633 33940 gene locus_tag LOCUS_34120 gene guaD 32633 33940 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419799.1 protein_id gnl|my_center|LOCUS_34120 34140 34880 gene locus_tag LOCUS_34130 34140 34880 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267254.1 protein_id gnl|my_center|LOCUS_34130 35107 35502 gene locus_tag LOCUS_34140 35107 35502 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975812.1 protein_id gnl|my_center|LOCUS_34140 35532 36956 gene locus_tag LOCUS_34150 35532 36956 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975813.1 protein_id gnl|my_center|LOCUS_34150 37113 38579 gene locus_tag LOCUS_34160 37113 38579 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 protein_id gnl|my_center|LOCUS_34160 38948 40711 gene locus_tag LOCUS_34170 gene xsc 38948 40711 CDS product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808155.1 protein_id gnl|my_center|LOCUS_34170 40999 41940 gene locus_tag LOCUS_34180 40999 41940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 41965 42258 gene locus_tag LOCUS_34190 41965 42258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 43258 42275 gene locus_tag LOCUS_34200 43258 42275 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207210.1 protein_id gnl|my_center|LOCUS_34200 44017 43514 gene locus_tag LOCUS_34210 44017 43514 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085072.1 protein_id gnl|my_center|LOCUS_34210 45472 44129 gene locus_tag LOCUS_34220 45472 44129 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331270.1 protein_id gnl|my_center|LOCUS_34220 46042 45488 gene locus_tag LOCUS_34230 46042 45488 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724859.1 protein_id gnl|my_center|LOCUS_34230 47125 46109 gene locus_tag LOCUS_34240 47125 46109 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565859.1 protein_id gnl|my_center|LOCUS_34240 49187 47412 gene locus_tag LOCUS_34250 gene cobT 49187 47412 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918558.1 protein_id gnl|my_center|LOCUS_34250 50612 49632 gene locus_tag LOCUS_34260 gene cobS 50612 49632 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_34260 52515 50722 gene locus_tag LOCUS_34270 52515 50722 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447544.1 protein_id gnl|my_center|LOCUS_34270 52666 53985 gene locus_tag LOCUS_34280 52666 53985 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037479.1 protein_id gnl|my_center|LOCUS_34280 54177 54584 gene locus_tag LOCUS_34290 54177 54584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 54979 54731 gene locus_tag LOCUS_34300 54979 54731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 55211 55552 gene locus_tag LOCUS_34310 55211 55552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 56965 55622 gene locus_tag LOCUS_34320 56965 55622 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087209.1 protein_id gnl|my_center|LOCUS_34320 57412 57059 gene locus_tag LOCUS_34330 gene uraH 57412 57059 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087207.1 protein_id gnl|my_center|LOCUS_34330 57773 58696 gene locus_tag LOCUS_34340 gene puuE 57773 58696 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 protein_id gnl|my_center|LOCUS_34340 58696 59211 gene locus_tag LOCUS_34350 gene uraD 58696 59211 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 protein_id gnl|my_center|LOCUS_34350 59264 59773 gene locus_tag LOCUS_34360 59264 59773 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083329.1 protein_id gnl|my_center|LOCUS_34360 60783 60040 gene locus_tag LOCUS_34370 60783 60040 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705251.1 protein_id gnl|my_center|LOCUS_34370 60925 62157 gene locus_tag LOCUS_34380 60925 62157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 62226 62528 gene locus_tag LOCUS_34390 62226 62528 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 protein_id gnl|my_center|LOCUS_34390 63584 62535 gene locus_tag LOCUS_34400 63584 62535 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113380.1 protein_id gnl|my_center|LOCUS_34400 63735 64742 gene locus_tag LOCUS_34410 63735 64742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550161.1 protein_id gnl|my_center|LOCUS_34410 66397 64727 gene locus_tag LOCUS_34420 66397 64727 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706289.1 protein_id gnl|my_center|LOCUS_34420 66593 68503 gene locus_tag LOCUS_34430 66593 68503 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266678.1 protein_id gnl|my_center|LOCUS_34430 68985 68560 gene locus_tag LOCUS_34440 68985 68560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 69206 69000 gene locus_tag LOCUS_34450 69206 69000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 69445 69221 gene locus_tag LOCUS_34460 69445 69221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 70415 69438 gene locus_tag LOCUS_34470 70415 69438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 70575 72722 gene locus_tag LOCUS_34480 70575 72722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 73153 72737 gene locus_tag LOCUS_34490 73153 72737 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100368.1 protein_id gnl|my_center|LOCUS_34490 73292 74110 gene locus_tag LOCUS_34500 73292 74110 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 protein_id gnl|my_center|LOCUS_34500 75326 74133 gene locus_tag LOCUS_34510 75326 74133 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_34510 75447 76313 gene locus_tag LOCUS_34520 75447 76313 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532539.1 protein_id gnl|my_center|LOCUS_34520 76408 77340 gene locus_tag LOCUS_34530 76408 77340 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027134.1 protein_id gnl|my_center|LOCUS_34530 77619 77383 gene locus_tag LOCUS_34540 77619 77383 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_34540 77761 78090 gene locus_tag LOCUS_34550 77761 78090 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929326.1 protein_id gnl|my_center|LOCUS_34550 78241 78165 gene locus_tag LOCUS_t00880 78241 78165 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 80224 78383 gene locus_tag LOCUS_34560 gene rpoD 80224 78383 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704782.1 protein_id gnl|my_center|LOCUS_34560 82234 80456 gene locus_tag LOCUS_34570 gene dnaG 82234 80456 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704781.1 protein_id gnl|my_center|LOCUS_34570 82752 82309 gene locus_tag LOCUS_34580 82752 82309 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_34580 82983 82768 gene locus_tag LOCUS_34590 gene rpsU 82983 82768 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_34590 83156 84172 gene locus_tag LOCUS_34600 gene tsaD 83156 84172 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704779.1 protein_id gnl|my_center|LOCUS_34600 84834 84229 gene locus_tag LOCUS_34610 gene plsY 84834 84229 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352149.1 protein_id gnl|my_center|LOCUS_34610 84939 85310 gene locus_tag LOCUS_34620 gene folB 84939 85310 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707547.1 protein_id gnl|my_center|LOCUS_34620 85376 86179 gene locus_tag LOCUS_34630 85376 86179 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_34630 87402 86170 gene locus_tag LOCUS_34640 87402 86170 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817222.1 protein_id gnl|my_center|LOCUS_34640 87516 87896 gene locus_tag LOCUS_34650 87516 87896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 87956 88477 gene locus_tag LOCUS_34660 87956 88477 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162471704.1 protein_id gnl|my_center|LOCUS_34660 88553 90130 gene locus_tag LOCUS_34670 88553 90130 CDS product copper resistance CopC/CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529536.1 protein_id gnl|my_center|LOCUS_34670 93713 90543 gene locus_tag LOCUS_34680 gene putA 93713 90543 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704727.1 protein_id gnl|my_center|LOCUS_34680 94515 93898 gene locus_tag LOCUS_34690 94515 93898 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704726.1 protein_id gnl|my_center|LOCUS_34690 95869 94604 gene locus_tag LOCUS_34700 95869 94604 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707483.1 protein_id gnl|my_center|LOCUS_34700 96553 95891 gene locus_tag LOCUS_34710 96553 95891 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305357.1 protein_id gnl|my_center|LOCUS_34710 96739 98250 gene locus_tag LOCUS_34720 96739 98250 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447090.1 protein_id gnl|my_center|LOCUS_34720 98589 98254 gene locus_tag LOCUS_34730 98589 98254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073543.1 protein_id gnl|my_center|LOCUS_34730 99215 98586 gene locus_tag LOCUS_34740 99215 98586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 99639 99226 gene locus_tag LOCUS_34750 99639 99226 CDS product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007645549.1 protein_id gnl|my_center|LOCUS_34750 99807 102671 gene locus_tag LOCUS_34760 gene glnE 99807 102671 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819368.1 protein_id gnl|my_center|LOCUS_34760 103681 102758 gene locus_tag LOCUS_34770 gene lpxL 103681 102758 CDS product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707479.1 protein_id gnl|my_center|LOCUS_34770 103821 105245 gene locus_tag LOCUS_34780 gene hldE 103821 105245 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707478.1 protein_id gnl|my_center|LOCUS_34780 105751 105431 gene locus_tag LOCUS_34790 gene nirD 105751 105431 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463771.1 protein_id gnl|my_center|LOCUS_34790 108258 105748 gene locus_tag LOCUS_34800 gene nirB 108258 105748 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707173.1 protein_id gnl|my_center|LOCUS_34800 109510 108749 gene locus_tag LOCUS_34810 gene cobA 109510 108749 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707178.1 protein_id gnl|my_center|LOCUS_34810 110499 109693 gene locus_tag LOCUS_34820 110499 109693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 113310 110701 gene locus_tag LOCUS_34830 113310 110701 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707179.1 protein_id gnl|my_center|LOCUS_34830 114819 113518 gene locus_tag LOCUS_34840 gene tolC 114819 113518 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944694.1 protein_id gnl|my_center|LOCUS_34840 115033 115653 gene locus_tag LOCUS_34850 gene nudF 115033 115653 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 protein_id gnl|my_center|LOCUS_34850 115674 116117 gene locus_tag LOCUS_34860 115674 116117 CDS product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305333.1 protein_id gnl|my_center|LOCUS_34860 116174 116959 gene locus_tag LOCUS_34870 gene cpdA 116174 116959 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707475.1 protein_id gnl|my_center|LOCUS_34870 117021 118316 gene locus_tag LOCUS_34880 gene nasR 117021 118316 CDS product nitrate regulatory protein NasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705088.1 protein_id gnl|my_center|LOCUS_34880 119166 118318 gene locus_tag LOCUS_34890 119166 118318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085589.1 protein_id gnl|my_center|LOCUS_34890 120035 119178 gene locus_tag LOCUS_34900 gene ntrB 120035 119178 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397940.1 protein_id gnl|my_center|LOCUS_34900 121362 120055 gene locus_tag LOCUS_34910 121362 120055 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973417.1 protein_id gnl|my_center|LOCUS_34910 121698 122270 gene locus_tag LOCUS_34920 121698 122270 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707474.1 protein_id gnl|my_center|LOCUS_34920 122382 124277 gene locus_tag LOCUS_34930 gene parE 122382 124277 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305312.1 protein_id gnl|my_center|LOCUS_34930 124288 126537 gene locus_tag LOCUS_34940 gene parC 124288 126537 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707468.1 protein_id gnl|my_center|LOCUS_34940 126738 127109 gene locus_tag LOCUS_34950 126738 127109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 127112 127498 gene locus_tag LOCUS_34960 127112 127498 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051076796.1 protein_id gnl|my_center|LOCUS_34960 129437 127866 gene locus_tag LOCUS_34970 129437 127866 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_34970 130442 129447 gene locus_tag LOCUS_34980 gene gguC 130442 129447 CDS product GguC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111007.1 protein_id gnl|my_center|LOCUS_34980 131620 130448 gene locus_tag LOCUS_34990 131620 130448 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_34990 132765 131740 gene locus_tag LOCUS_35000 132765 131740 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113700.1 protein_id gnl|my_center|LOCUS_35000 134054 132768 gene locus_tag LOCUS_35010 134054 132768 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937320.1 protein_id gnl|my_center|LOCUS_35010 134608 134051 gene locus_tag LOCUS_35020 134608 134051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 135646 134675 gene locus_tag LOCUS_35030 135646 134675 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969404.1 protein_id gnl|my_center|LOCUS_35030 135919 136650 gene locus_tag LOCUS_35040 135919 136650 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008142.1 protein_id gnl|my_center|LOCUS_35040 >Feature sequence31 470 955 gene locus_tag LOCUS_35050 470 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 1048 1464 gene locus_tag LOCUS_35060 1048 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 1649 2131 gene locus_tag LOCUS_35070 1649 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 2207 3340 gene locus_tag LOCUS_35080 2207 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 3416 3925 gene locus_tag LOCUS_35090 3416 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 3972 5633 gene locus_tag LOCUS_35100 3972 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947786.1 protein_id gnl|my_center|LOCUS_35100 5781 5951 gene locus_tag LOCUS_35110 5781 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 6377 7615 gene locus_tag LOCUS_35120 6377 7615 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644782.1 protein_id gnl|my_center|LOCUS_35120 8693 7635 gene locus_tag LOCUS_35130 8693 7635 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973985.1 protein_id gnl|my_center|LOCUS_35130 8849 9934 gene locus_tag LOCUS_35140 8849 9934 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940869.1 protein_id gnl|my_center|LOCUS_35140 11299 10565 gene locus_tag LOCUS_35150 11299 10565 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022781.1 protein_id gnl|my_center|LOCUS_35150 13715 11430 gene locus_tag LOCUS_35160 13715 11430 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445450.1 protein_id gnl|my_center|LOCUS_35160 14983 13775 gene locus_tag LOCUS_35170 14983 13775 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_35170 17350 14987 gene locus_tag LOCUS_35180 17350 14987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_35180 18086 17361 gene locus_tag LOCUS_35190 18086 17361 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_35190 18286 19794 gene locus_tag LOCUS_35200 18286 19794 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444662.1 protein_id gnl|my_center|LOCUS_35200 19791 20681 gene locus_tag LOCUS_35210 19791 20681 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 protein_id gnl|my_center|LOCUS_35210 21366 20692 gene locus_tag LOCUS_35220 21366 20692 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085585.1 protein_id gnl|my_center|LOCUS_35220 21892 22716 gene locus_tag LOCUS_35230 gene proC 21892 22716 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_35230 22774 23826 gene locus_tag LOCUS_35240 22774 23826 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_35240 23904 24413 gene locus_tag LOCUS_35250 23904 24413 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243030.1 protein_id gnl|my_center|LOCUS_35250 24410 25735 gene locus_tag LOCUS_35260 24410 25735 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_35260 25817 26767 gene locus_tag LOCUS_35270 25817 26767 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 protein_id gnl|my_center|LOCUS_35270 28135 26780 gene locus_tag LOCUS_35280 28135 26780 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555126.1 protein_id gnl|my_center|LOCUS_35280 28335 28676 gene locus_tag LOCUS_35290 28335 28676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 28850 29641 gene locus_tag LOCUS_35300 28850 29641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 29761 30354 gene locus_tag LOCUS_35310 29761 30354 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056276.1 protein_id gnl|my_center|LOCUS_35310 30587 31648 gene locus_tag LOCUS_35320 30587 31648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 32272 31649 gene locus_tag LOCUS_35330 32272 31649 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365424.1 protein_id gnl|my_center|LOCUS_35330 32880 32272 gene locus_tag LOCUS_35340 32880 32272 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349742.1 protein_id gnl|my_center|LOCUS_35340 33904 32978 gene locus_tag LOCUS_35350 33904 32978 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704970.1 protein_id gnl|my_center|LOCUS_35350 34104 34778 gene locus_tag LOCUS_35360 gene yjjG 34104 34778 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925810.1 protein_id gnl|my_center|LOCUS_35360 36042 35191 gene locus_tag LOCUS_35370 36042 35191 CDS product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976208.1 protein_id gnl|my_center|LOCUS_35370 36214 37089 gene locus_tag LOCUS_35380 36214 37089 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705524.1 protein_id gnl|my_center|LOCUS_35380 37950 37090 gene locus_tag LOCUS_35390 37950 37090 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208736.1 protein_id gnl|my_center|LOCUS_35390 38709 37981 gene locus_tag LOCUS_35400 38709 37981 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097221.1 protein_id gnl|my_center|LOCUS_35400 39346 38696 gene locus_tag LOCUS_35410 39346 38696 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689664.1 protein_id gnl|my_center|LOCUS_35410 40008 39343 gene locus_tag LOCUS_35420 40008 39343 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705412.1 protein_id gnl|my_center|LOCUS_35420 40829 40020 gene locus_tag LOCUS_35430 40829 40020 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446864.1 protein_id gnl|my_center|LOCUS_35430 41804 41103 gene locus_tag LOCUS_35440 41804 41103 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387279.1 protein_id gnl|my_center|LOCUS_35440 42059 43156 gene locus_tag LOCUS_35450 gene trmA 42059 43156 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 protein_id gnl|my_center|LOCUS_35450 44448 43204 gene locus_tag LOCUS_35460 44448 43204 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465132.1 protein_id gnl|my_center|LOCUS_35460 45306 44545 gene locus_tag LOCUS_35470 45306 44545 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266373.1 protein_id gnl|my_center|LOCUS_35470 45634 45419 gene locus_tag LOCUS_35480 gene rpmE 45634 45419 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625828.1 protein_id gnl|my_center|LOCUS_35480 45773 47968 gene locus_tag LOCUS_35490 gene priA 45773 47968 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707854.1 protein_id gnl|my_center|LOCUS_35490 48562 47972 gene locus_tag LOCUS_35500 48562 47972 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705475.1 protein_id gnl|my_center|LOCUS_35500 48731 50485 gene locus_tag LOCUS_35510 gene argS 48731 50485 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707774.1 protein_id gnl|my_center|LOCUS_35510 50489 51061 gene locus_tag LOCUS_35520 50489 51061 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884022.1 protein_id gnl|my_center|LOCUS_35520 51143 51673 gene locus_tag LOCUS_35530 gene hslV 51143 51673 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306539.1 protein_id gnl|my_center|LOCUS_35530 51723 53051 gene locus_tag LOCUS_35540 gene hslU 51723 53051 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707776.1 protein_id gnl|my_center|LOCUS_35540 53148 53633 gene locus_tag LOCUS_35550 gene rraA 53148 53633 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306574.1 protein_id gnl|my_center|LOCUS_35550 53762 54529 gene locus_tag LOCUS_35560 53762 54529 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261096.1 protein_id gnl|my_center|LOCUS_35560 54529 54993 gene locus_tag LOCUS_35570 54529 54993 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954087.1 protein_id gnl|my_center|LOCUS_35570 55234 55025 gene locus_tag LOCUS_35580 55234 55025 CDS product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349028.1 protein_id gnl|my_center|LOCUS_35580 56158 55376 gene locus_tag LOCUS_35590 gene cysE 56158 55376 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 protein_id gnl|my_center|LOCUS_35590 57097 56162 gene locus_tag LOCUS_35600 57097 56162 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704209.1 protein_id gnl|my_center|LOCUS_35600 57542 57240 gene locus_tag LOCUS_35610 57542 57240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 58125 57661 gene locus_tag LOCUS_35620 gene trmL 58125 57661 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074146.1 protein_id gnl|my_center|LOCUS_35620 59485 58118 gene locus_tag LOCUS_35630 gene dinF 59485 58118 CDS product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819117.1 protein_id gnl|my_center|LOCUS_35630 60236 59589 gene locus_tag LOCUS_35640 60236 59589 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819116.1 protein_id gnl|my_center|LOCUS_35640 61125 60229 gene locus_tag LOCUS_35650 gene cyoE 61125 60229 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074210.1 protein_id gnl|my_center|LOCUS_35650 62093 61086 gene locus_tag LOCUS_35660 62093 61086 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 protein_id gnl|my_center|LOCUS_35660 62533 62102 gene locus_tag LOCUS_35670 62533 62102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 63170 62523 gene locus_tag LOCUS_35680 63170 62523 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946158.1 protein_id gnl|my_center|LOCUS_35680 63224 63430 gene locus_tag LOCUS_35690 63224 63430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 64318 63449 gene locus_tag LOCUS_35700 64318 63449 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 protein_id gnl|my_center|LOCUS_35700 64860 64333 gene locus_tag LOCUS_35710 64860 64333 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_35710 66472 64847 gene locus_tag LOCUS_35720 gene ctaD 66472 64847 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074203.1 protein_id gnl|my_center|LOCUS_35720 67615 66482 gene locus_tag LOCUS_35730 67615 66482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 68518 67901 gene locus_tag LOCUS_35740 gene lexA 68518 67901 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704201.1 protein_id gnl|my_center|LOCUS_35740 69531 68659 gene locus_tag LOCUS_35750 gene ubiA 69531 68659 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704199.1 protein_id gnl|my_center|LOCUS_35750 70079 69528 gene locus_tag LOCUS_35760 70079 69528 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704198.1 protein_id gnl|my_center|LOCUS_35760 70212 70613 gene locus_tag LOCUS_35770 70212 70613 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704197.1 protein_id gnl|my_center|LOCUS_35770 71449 70607 gene locus_tag LOCUS_35780 gene glpG 71449 70607 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704134.1 protein_id gnl|my_center|LOCUS_35780 71766 71449 gene locus_tag LOCUS_35790 gene glpE 71766 71449 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704135.1 protein_id gnl|my_center|LOCUS_35790 72526 71822 gene locus_tag LOCUS_35800 72526 71822 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704138.1 protein_id gnl|my_center|LOCUS_35800 73293 72529 gene locus_tag LOCUS_35810 gene livG 73293 72529 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082125.1 protein_id gnl|my_center|LOCUS_35810 74531 73290 gene locus_tag LOCUS_35820 74531 73290 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017410832.1 protein_id gnl|my_center|LOCUS_35820 75451 74528 gene locus_tag LOCUS_35830 gene livH 75451 74528 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704141.1 protein_id gnl|my_center|LOCUS_35830 76659 75544 gene locus_tag LOCUS_35840 76659 75544 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704142.1 protein_id gnl|my_center|LOCUS_35840 76979 77992 gene locus_tag LOCUS_35850 76979 77992 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704143.1 protein_id gnl|my_center|LOCUS_35850 79160 78135 gene locus_tag LOCUS_35860 gene tdh 79160 78135 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478141.1 protein_id gnl|my_center|LOCUS_35860 80364 79174 gene locus_tag LOCUS_35870 80364 79174 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707887.1 protein_id gnl|my_center|LOCUS_35870 81135 80461 gene locus_tag LOCUS_35880 81135 80461 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707886.1 protein_id gnl|my_center|LOCUS_35880 81265 82218 gene locus_tag LOCUS_35890 gene rfaD 81265 82218 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 protein_id gnl|my_center|LOCUS_35890 82233 84005 gene locus_tag LOCUS_35900 82233 84005 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023767.1 protein_id gnl|my_center|LOCUS_35900 85020 84073 gene locus_tag LOCUS_35910 85020 84073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 85213 86244 gene locus_tag LOCUS_35920 gene waaF 85213 86244 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704188.1 protein_id gnl|my_center|LOCUS_35920 86259 87020 gene locus_tag LOCUS_35930 86259 87020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 87029 88294 gene locus_tag LOCUS_35940 gene waaA 87029 88294 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704189.1 protein_id gnl|my_center|LOCUS_35940 88986 88279 gene locus_tag LOCUS_35950 88986 88279 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704082.1 protein_id gnl|my_center|LOCUS_35950 89071 90132 gene locus_tag LOCUS_35960 89071 90132 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704081.1 protein_id gnl|my_center|LOCUS_35960 90129 90908 gene locus_tag LOCUS_35970 90129 90908 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704187.1 protein_id gnl|my_center|LOCUS_35970 91902 90877 gene locus_tag LOCUS_35980 91902 90877 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704186.1 protein_id gnl|my_center|LOCUS_35980 91980 92459 gene locus_tag LOCUS_35990 gene coaD 91980 92459 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 protein_id gnl|my_center|LOCUS_35990 93296 92484 gene locus_tag LOCUS_36000 gene mutM 93296 92484 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704183.1 protein_id gnl|my_center|LOCUS_36000 93557 93390 gene locus_tag LOCUS_36010 gene rpmG 93557 93390 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307500.1 protein_id gnl|my_center|LOCUS_36010 93805 93569 gene locus_tag LOCUS_36020 gene rpmB 93805 93569 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417050.1 protein_id gnl|my_center|LOCUS_36020 94611 93937 gene locus_tag LOCUS_36030 gene radC 94611 93937 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_36030 94719 95927 gene locus_tag LOCUS_36040 gene coaBC 94719 95927 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_36040 95899 96369 gene locus_tag LOCUS_36050 gene dut 95899 96369 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704179.1 protein_id gnl|my_center|LOCUS_36050 96387 96986 gene locus_tag LOCUS_36060 gene slmA 96387 96986 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704178.1 protein_id gnl|my_center|LOCUS_36060 97072 97947 gene locus_tag LOCUS_36070 97072 97947 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_36070 98637 97996 gene locus_tag LOCUS_36080 gene pyrE 98637 97996 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707877.1 protein_id gnl|my_center|LOCUS_36080 99385 98660 gene locus_tag LOCUS_36090 gene rph 99385 98660 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247093.1 protein_id gnl|my_center|LOCUS_36090 99545 100408 gene locus_tag LOCUS_36100 99545 100408 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707879.1 protein_id gnl|my_center|LOCUS_36100 100606 100809 gene locus_tag LOCUS_36110 100606 100809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 100873 101385 gene locus_tag LOCUS_36120 100873 101385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 101525 102298 gene locus_tag LOCUS_36130 101525 102298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 102304 103218 gene locus_tag LOCUS_36140 102304 103218 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_36140 104222 103407 gene locus_tag LOCUS_36150 104222 103407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 104867 104502 gene locus_tag LOCUS_36160 104867 104502 CDS product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113995426.1 protein_id gnl|my_center|LOCUS_36160 105502 104891 gene locus_tag LOCUS_36170 gene fabR 105502 104891 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308043.1 protein_id gnl|my_center|LOCUS_36170 105635 106765 gene locus_tag LOCUS_36180 105635 106765 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704344.1 protein_id gnl|my_center|LOCUS_36180 106944 108293 gene locus_tag LOCUS_36190 106944 108293 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014164074.1 protein_id gnl|my_center|LOCUS_36190 110667 108475 gene locus_tag LOCUS_36200 110667 108475 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819168.1 protein_id gnl|my_center|LOCUS_36200 111119 110805 gene locus_tag LOCUS_36210 111119 110805 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098276.1 protein_id gnl|my_center|LOCUS_36210 111312 111130 gene locus_tag LOCUS_36220 111312 111130 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698145.1 protein_id gnl|my_center|LOCUS_36220 113097 111313 gene locus_tag LOCUS_36230 113097 111313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 113195 113551 gene locus_tag LOCUS_36240 113195 113551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 113957 113532 gene locus_tag LOCUS_36250 113957 113532 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704327.1 protein_id gnl|my_center|LOCUS_36250 114116 114505 gene locus_tag LOCUS_36260 114116 114505 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_36260 116162 114630 gene locus_tag LOCUS_36270 116162 114630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 116363 117322 gene locus_tag LOCUS_36280 116363 117322 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308002.1 protein_id gnl|my_center|LOCUS_36280 117389 118468 gene locus_tag LOCUS_36290 gene ftsZ 117389 118468 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389003.1 protein_id gnl|my_center|LOCUS_36290 119051 118542 gene locus_tag LOCUS_36300 119051 118542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017410927.1 protein_id gnl|my_center|LOCUS_36300 120550 119429 gene locus_tag LOCUS_36310 120550 119429 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818673.1 protein_id gnl|my_center|LOCUS_36310 120624 120917 gene locus_tag LOCUS_36320 120624 120917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 121056 121721 gene locus_tag LOCUS_36330 121056 121721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 121901 122581 gene locus_tag LOCUS_36340 121901 122581 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073279.1 protein_id gnl|my_center|LOCUS_36340 123078 122617 gene locus_tag LOCUS_36350 123078 122617 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263284.1 protein_id gnl|my_center|LOCUS_36350 124649 123327 gene locus_tag LOCUS_36360 124649 123327 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930659.1 protein_id gnl|my_center|LOCUS_36360 125213 124797 gene locus_tag LOCUS_36370 125213 124797 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 protein_id gnl|my_center|LOCUS_36370 125825 125223 gene locus_tag LOCUS_36380 125825 125223 CDS product cold shock and DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037374.1 protein_id gnl|my_center|LOCUS_36380 126466 125918 gene locus_tag LOCUS_36390 126466 125918 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071856.1 protein_id gnl|my_center|LOCUS_36390 127545 126649 gene locus_tag LOCUS_36400 127545 126649 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055030104.1 protein_id gnl|my_center|LOCUS_36400 127711 128133 gene locus_tag LOCUS_36410 127711 128133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 128268 129656 gene locus_tag LOCUS_36420 128268 129656 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098348.1 protein_id gnl|my_center|LOCUS_36420 130002 130634 gene locus_tag LOCUS_36430 130002 130634 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861284.1 protein_id gnl|my_center|LOCUS_36430 132500 130698 gene locus_tag LOCUS_36440 132500 130698 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 protein_id gnl|my_center|LOCUS_36440 133556 132579 gene locus_tag LOCUS_36450 gene ftrA 133556 132579 CDS product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050122195.1 protein_id gnl|my_center|LOCUS_36450 133654 134082 gene locus_tag LOCUS_36460 133654 134082 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815713.1 protein_id gnl|my_center|LOCUS_36460 134792 134115 gene locus_tag LOCUS_36470 134792 134115 CDS product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792797.1 protein_id gnl|my_center|LOCUS_36470 135693 135145 gene locus_tag LOCUS_36480 135693 135145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36480 136386 135874 gene locus_tag LOCUS_36490 136386 135874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 138473 136473 gene locus_tag LOCUS_36500 138473 136473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065453.1 protein_id gnl|my_center|LOCUS_36500 140133 138589 gene locus_tag LOCUS_36510 140133 138589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039938459.1 protein_id gnl|my_center|LOCUS_36510 140536 140258 gene locus_tag LOCUS_36520 140536 140258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 141007 140627 gene locus_tag LOCUS_36530 141007 140627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 142468 141509 gene locus_tag LOCUS_36540 142468 141509 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 protein_id gnl|my_center|LOCUS_36540 143527 142595 gene locus_tag LOCUS_36550 143527 142595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 145949 143718 gene locus_tag LOCUS_36560 145949 143718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 146433 147395 gene locus_tag LOCUS_36570 gene zntB 146433 147395 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301878.1 protein_id gnl|my_center|LOCUS_36570 148819 147416 gene locus_tag LOCUS_36580 148819 147416 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_36580 149871 148816 gene locus_tag LOCUS_36590 149871 148816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 150640 149879 gene locus_tag LOCUS_36600 150640 149879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 151026 150637 gene locus_tag LOCUS_36610 151026 150637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 152731 151079 gene locus_tag LOCUS_36620 152731 151079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36620 153292 152780 gene locus_tag LOCUS_36630 153292 152780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 153548 153414 gene locus_tag LOCUS_36640 153548 153414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 154983 153613 gene locus_tag LOCUS_36650 154983 153613 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982234.1 protein_id gnl|my_center|LOCUS_36650 155831 154998 gene locus_tag LOCUS_36660 155831 154998 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766243.1 protein_id gnl|my_center|LOCUS_36660 156763 155828 gene locus_tag LOCUS_36670 156763 155828 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037471335.1 protein_id gnl|my_center|LOCUS_36670 158280 156760 gene locus_tag LOCUS_36680 158280 156760 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034857493.1 protein_id gnl|my_center|LOCUS_36680 158447 158986 gene locus_tag LOCUS_36690 158447 158986 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314628.1 protein_id gnl|my_center|LOCUS_36690 160654 159122 gene locus_tag LOCUS_36700 160654 159122 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170491.1 protein_id gnl|my_center|LOCUS_36700 161500 160964 gene locus_tag LOCUS_36710 161500 160964 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096572.1 protein_id gnl|my_center|LOCUS_36710 162801 161500 gene locus_tag LOCUS_36720 162801 161500 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926703.1 protein_id gnl|my_center|LOCUS_36720 163368 162817 gene locus_tag LOCUS_36730 163368 162817 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930617.1 protein_id gnl|my_center|LOCUS_36730 164410 163427 gene locus_tag LOCUS_36740 gene dctP 164410 163427 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930618.1 protein_id gnl|my_center|LOCUS_36740 164721 165467 gene locus_tag LOCUS_36750 164721 165467 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113623.1 protein_id gnl|my_center|LOCUS_36750 165464 166174 gene locus_tag LOCUS_36760 165464 166174 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 protein_id gnl|my_center|LOCUS_36760 166181 167110 gene locus_tag LOCUS_36770 166181 167110 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147543.1 protein_id gnl|my_center|LOCUS_36770 167274 168443 gene locus_tag LOCUS_36780 167274 168443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227417.1 protein_id gnl|my_center|LOCUS_36780 168655 168440 gene locus_tag LOCUS_36790 168655 168440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 169226 168738 gene locus_tag LOCUS_36800 169226 168738 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071599.1 protein_id gnl|my_center|LOCUS_36800 169327 169896 gene locus_tag LOCUS_36810 169327 169896 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071600.1 protein_id gnl|my_center|LOCUS_36810 170424 170017 gene locus_tag LOCUS_36820 170424 170017 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084560.1 protein_id gnl|my_center|LOCUS_36820 171800 170682 gene locus_tag LOCUS_36830 gene thiH 171800 170682 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260917.1 protein_id gnl|my_center|LOCUS_36830 172567 171797 gene locus_tag LOCUS_36840 172567 171797 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945667.1 protein_id gnl|my_center|LOCUS_36840 172769 172569 gene locus_tag LOCUS_36850 gene thiS 172769 172569 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704010.1 protein_id gnl|my_center|LOCUS_36850 173527 172760 gene locus_tag LOCUS_36860 173527 172760 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704415.1 protein_id gnl|my_center|LOCUS_36860 175034 173517 gene locus_tag LOCUS_36870 gene thiE 175034 173517 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704414.1 protein_id gnl|my_center|LOCUS_36870 176983 175031 gene locus_tag LOCUS_36880 gene thiC 176983 175031 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704413.1 protein_id gnl|my_center|LOCUS_36880 178156 177275 gene locus_tag LOCUS_36890 178156 177275 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819265.1 protein_id gnl|my_center|LOCUS_36890 178295 179209 gene locus_tag LOCUS_36900 gene menC 178295 179209 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704501.1 protein_id gnl|my_center|LOCUS_36900 179315 181282 gene locus_tag LOCUS_36910 179315 181282 CDS product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704526.1 protein_id gnl|my_center|LOCUS_36910 182462 181467 gene locus_tag LOCUS_36920 gene rhuM 182462 181467 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_36920 183496 182549 gene locus_tag LOCUS_36930 183496 182549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 184387 183605 gene locus_tag LOCUS_36940 184387 183605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 185839 184634 gene locus_tag LOCUS_36950 gene pcaF 185839 184634 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075194926.1 protein_id gnl|my_center|LOCUS_36950 186630 185836 gene locus_tag LOCUS_36960 186630 185836 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084062.1 protein_id gnl|my_center|LOCUS_36960 187448 186627 gene locus_tag LOCUS_36970 187448 186627 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_36970 187714 188499 gene locus_tag LOCUS_36980 187714 188499 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402690.1 protein_id gnl|my_center|LOCUS_36980 189412 188510 gene locus_tag LOCUS_36990 189412 188510 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089870.1 protein_id gnl|my_center|LOCUS_36990 189520 190638 gene locus_tag LOCUS_37000 189520 190638 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162708822.1 protein_id gnl|my_center|LOCUS_37000 190676 190966 gene locus_tag LOCUS_37010 gene catC 190676 190966 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807674.1 protein_id gnl|my_center|LOCUS_37010 191017 191955 gene locus_tag LOCUS_37020 gene catA 191017 191955 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113307.1 protein_id gnl|my_center|LOCUS_37020 192050 193426 gene locus_tag LOCUS_37030 192050 193426 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705527.1 protein_id gnl|my_center|LOCUS_37030 193423 193914 gene locus_tag LOCUS_37040 gene benB 193423 193914 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015095.1 protein_id gnl|my_center|LOCUS_37040 193932 194960 gene locus_tag LOCUS_37050 gene benC 193932 194960 CDS product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705526.1 protein_id gnl|my_center|LOCUS_37050 194957 195736 gene locus_tag LOCUS_37060 194957 195736 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705525.1 protein_id gnl|my_center|LOCUS_37060 195841 197181 gene locus_tag LOCUS_37070 195841 197181 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 protein_id gnl|my_center|LOCUS_37070 197401 198624 gene locus_tag LOCUS_37080 gene benE 197401 198624 CDS product benzoate/H(+) symporter BenE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 protein_id gnl|my_center|LOCUS_37080 199580 198681 gene locus_tag LOCUS_37090 gene cysM 199580 198681 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_37090 199745 200098 gene locus_tag LOCUS_37100 199745 200098 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302630.1 protein_id gnl|my_center|LOCUS_37100 201904 200114 gene locus_tag LOCUS_37110 201904 200114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 202196 204862 gene locus_tag LOCUS_37120 202196 204862 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208750.1 protein_id gnl|my_center|LOCUS_37120 204912 205817 gene locus_tag LOCUS_37130 204912 205817 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096918.1 protein_id gnl|my_center|LOCUS_37130 >Feature sequence32 218 293 gene locus_tag LOCUS_t00890 218 293 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence33 1511 69 gene locus_tag LOCUS_37140 1511 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 3186 2290 gene locus_tag LOCUS_37150 3186 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 3232 3426 gene locus_tag LOCUS_37160 3232 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 6896 3432 gene locus_tag LOCUS_37170 6896 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 7189 6890 gene locus_tag LOCUS_37180 7189 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 8000 7182 gene locus_tag LOCUS_37190 8000 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 8211 8005 gene locus_tag LOCUS_37200 8211 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 8570 8208 gene locus_tag LOCUS_37210 8570 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 9504 8617 gene locus_tag LOCUS_37220 9504 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 10088 9486 gene locus_tag LOCUS_37230 10088 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 10668 10075 gene locus_tag LOCUS_37240 10668 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 11237 10665 gene locus_tag LOCUS_37250 11237 10665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 11912 12541 gene locus_tag LOCUS_37260 gene parA 11912 12541 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 protein_id gnl|my_center|LOCUS_37260 12538 12762 gene locus_tag LOCUS_37270 12538 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 12801 13499 gene locus_tag LOCUS_37280 12801 13499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 13521 13709 gene locus_tag LOCUS_37290 13521 13709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 13706 13909 gene locus_tag LOCUS_37300 13706 13909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 13927 14082 gene locus_tag LOCUS_37310 13927 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 14824 14534 gene locus_tag LOCUS_37320 14824 14534 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104666.1 protein_id gnl|my_center|LOCUS_37320 15059 14808 gene locus_tag LOCUS_37330 15059 14808 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740683.1 protein_id gnl|my_center|LOCUS_37330 16119 15814 gene locus_tag LOCUS_37340 16119 15814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 16857 16231 gene locus_tag LOCUS_37350 16857 16231 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172412315.1 protein_id gnl|my_center|LOCUS_37350 16989 16861 gene locus_tag LOCUS_37360 16989 16861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 17327 17061 gene locus_tag LOCUS_37370 17327 17061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 17448 17233 gene locus_tag LOCUS_37380 17448 17233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 >Feature sequence34 2018 837 gene locus_tag LOCUS_37390 2018 837 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071827.1 protein_id gnl|my_center|LOCUS_37390 2516 3679 gene locus_tag LOCUS_37400 2516 3679 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072004.1 protein_id gnl|my_center|LOCUS_37400 4315 5919 gene locus_tag LOCUS_37410 4315 5919 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072003.1 protein_id gnl|my_center|LOCUS_37410 5929 6729 gene locus_tag LOCUS_37420 5929 6729 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483374.1 protein_id gnl|my_center|LOCUS_37420 6719 8686 gene locus_tag LOCUS_37430 gene liuD 6719 8686 CDS product methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113506.1 protein_id gnl|my_center|LOCUS_37430 8679 9584 gene locus_tag LOCUS_37440 8679 9584 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072000.1 protein_id gnl|my_center|LOCUS_37440 9636 10376 gene locus_tag LOCUS_37450 9636 10376 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072112.1 protein_id gnl|my_center|LOCUS_37450 11430 10429 gene locus_tag LOCUS_37460 11430 10429 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310926.1 protein_id gnl|my_center|LOCUS_37460 12734 11457 gene locus_tag LOCUS_37470 12734 11457 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243758.1 protein_id gnl|my_center|LOCUS_37470 13263 12745 gene locus_tag LOCUS_37480 gene yiaM 13263 12745 CDS product 2,3-diketo-L-gulonate TRAP transporter small permease YiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821445.1 protein_id gnl|my_center|LOCUS_37480 13618 14139 gene locus_tag LOCUS_37490 13618 14139 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210265.1 protein_id gnl|my_center|LOCUS_37490 14129 15940 gene locus_tag LOCUS_37500 gene edd 14129 15940 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704294.1 protein_id gnl|my_center|LOCUS_37500 15944 16582 gene locus_tag LOCUS_37510 15944 16582 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416953.1 protein_id gnl|my_center|LOCUS_37510 >Feature sequence35 1732 296 gene locus_tag LOCUS_37520 1732 296 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464554.1 protein_id gnl|my_center|LOCUS_37520 2263 1856 gene locus_tag LOCUS_37530 2263 1856 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637098.1 protein_id gnl|my_center|LOCUS_37530 3584 2313 gene locus_tag LOCUS_37540 gene ectB 3584 2313 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263924.1 protein_id gnl|my_center|LOCUS_37540 4174 3653 gene locus_tag LOCUS_37550 gene ectA 4174 3653 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640101.1 protein_id gnl|my_center|LOCUS_37550 4487 4696 gene locus_tag LOCUS_37560 4487 4696 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554837.1 protein_id gnl|my_center|LOCUS_37560 5069 5407 gene locus_tag LOCUS_37570 5069 5407 CDS product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350309.1 protein_id gnl|my_center|LOCUS_37570 5586 7004 gene locus_tag LOCUS_37580 gene sbcB 5586 7004 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819831.1 protein_id gnl|my_center|LOCUS_37580 7015 7353 gene locus_tag LOCUS_37590 7015 7353 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705771.1 protein_id gnl|my_center|LOCUS_37590 7350 8039 gene locus_tag LOCUS_37600 7350 8039 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705770.1 protein_id gnl|my_center|LOCUS_37600 8060 8896 gene locus_tag LOCUS_37610 gene cdd 8060 8896 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705769.1 protein_id gnl|my_center|LOCUS_37610 9001 9234 gene locus_tag LOCUS_37620 9001 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 10041 9436 gene locus_tag LOCUS_37630 gene recR 10041 9436 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633741.1 protein_id gnl|my_center|LOCUS_37630 10585 10256 gene locus_tag LOCUS_37640 10585 10256 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706069.1 protein_id gnl|my_center|LOCUS_37640 12975 10627 gene locus_tag LOCUS_37650 gene dnaX 12975 10627 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706068.1 protein_id gnl|my_center|LOCUS_37650 13527 12982 gene locus_tag LOCUS_37660 gene apt 13527 12982 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350746.1 protein_id gnl|my_center|LOCUS_37660 13990 13598 gene locus_tag LOCUS_37670 13990 13598 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706066.1 protein_id gnl|my_center|LOCUS_37670 14288 14097 gene locus_tag LOCUS_37680 14288 14097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 14684 16246 gene locus_tag LOCUS_37690 14684 16246 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 protein_id gnl|my_center|LOCUS_37690 17579 16392 gene locus_tag LOCUS_37700 gene ampC 17579 16392 CDS product class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975881.1 protein_id gnl|my_center|LOCUS_37700 17771 18646 gene locus_tag LOCUS_37710 gene ampR 17771 18646 CDS product LysR family transcriptional regulator AmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101291.1 protein_id gnl|my_center|LOCUS_37710 18813 19748 gene locus_tag LOCUS_37720 18813 19748 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196334.1 protein_id gnl|my_center|LOCUS_37720 19745 21094 gene locus_tag LOCUS_37730 gene chrA 19745 21094 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_37730 21348 22340 gene locus_tag LOCUS_37740 gene tauA 21348 22340 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114314.1 protein_id gnl|my_center|LOCUS_37740 22359 23156 gene locus_tag LOCUS_37750 gene tauB 22359 23156 CDS product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767098.1 protein_id gnl|my_center|LOCUS_37750 23153 23971 gene locus_tag LOCUS_37760 gene tauC 23153 23971 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105423.1 protein_id gnl|my_center|LOCUS_37760 24027 24860 gene locus_tag LOCUS_37770 gene tauD 24027 24860 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114311.1 protein_id gnl|my_center|LOCUS_37770 26248 24863 gene locus_tag LOCUS_37780 26248 24863 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083070.1 protein_id gnl|my_center|LOCUS_37780 27958 26282 gene locus_tag LOCUS_37790 27958 26282 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974807.1 protein_id gnl|my_center|LOCUS_37790 28755 27955 gene locus_tag LOCUS_37800 28755 27955 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970497.1 protein_id gnl|my_center|LOCUS_37800 29862 28882 gene locus_tag LOCUS_37810 29862 28882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973037.1 protein_id gnl|my_center|LOCUS_37810 31466 29859 gene locus_tag LOCUS_37820 31466 29859 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973036.1 protein_id gnl|my_center|LOCUS_37820 33410 31767 gene locus_tag LOCUS_37830 33410 31767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528251.1 protein_id gnl|my_center|LOCUS_37830 34224 33403 gene locus_tag LOCUS_37840 34224 33403 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528250.1 protein_id gnl|my_center|LOCUS_37840 35191 34238 gene locus_tag LOCUS_37850 35191 34238 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528249.1 protein_id gnl|my_center|LOCUS_37850 36759 35278 gene locus_tag LOCUS_37860 36759 35278 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536654.1 protein_id gnl|my_center|LOCUS_37860 37830 36892 gene locus_tag LOCUS_37870 37830 36892 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236427.1 protein_id gnl|my_center|LOCUS_37870 38347 39198 gene locus_tag LOCUS_37880 38347 39198 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705818.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37880 39290 40453 gene locus_tag LOCUS_37890 39290 40453 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705817.1 protein_id gnl|my_center|LOCUS_37890 41207 40536 gene locus_tag LOCUS_37900 41207 40536 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816007.1 protein_id gnl|my_center|LOCUS_37900 42190 41204 gene locus_tag LOCUS_37910 42190 41204 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171320.1 protein_id gnl|my_center|LOCUS_37910 43014 42187 gene locus_tag LOCUS_37920 43014 42187 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171322.1 protein_id gnl|my_center|LOCUS_37920 44077 43058 gene locus_tag LOCUS_37930 44077 43058 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077838.1 protein_id gnl|my_center|LOCUS_37930 45145 44372 gene locus_tag LOCUS_37940 45145 44372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 45144 45428 gene locus_tag LOCUS_37950 45144 45428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 45813 46838 gene locus_tag LOCUS_37960 45813 46838 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074246.1 protein_id gnl|my_center|LOCUS_37960 46887 47723 gene locus_tag LOCUS_37970 gene cysT 46887 47723 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074247.1 protein_id gnl|my_center|LOCUS_37970 47742 48608 gene locus_tag LOCUS_37980 gene cysW 47742 48608 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074248.1 protein_id gnl|my_center|LOCUS_37980 48627 49694 gene locus_tag LOCUS_37990 48627 49694 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074249.1 protein_id gnl|my_center|LOCUS_37990 50348 49773 gene locus_tag LOCUS_38000 50348 49773 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105376.1 protein_id gnl|my_center|LOCUS_38000 50595 50341 gene locus_tag LOCUS_38010 50595 50341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 51599 50727 gene locus_tag LOCUS_38020 51599 50727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 51892 52815 gene locus_tag LOCUS_38030 51892 52815 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382910.1 protein_id gnl|my_center|LOCUS_38030 52984 54144 gene locus_tag LOCUS_38040 52984 54144 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382911.1 protein_id gnl|my_center|LOCUS_38040 55103 54168 gene locus_tag LOCUS_38050 gene cbl 55103 54168 CDS product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816563.1 protein_id gnl|my_center|LOCUS_38050 56186 55242 gene locus_tag LOCUS_38060 56186 55242 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418432.1 protein_id gnl|my_center|LOCUS_38060 58007 56436 gene locus_tag LOCUS_38070 58007 56436 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_38070 58824 58075 gene locus_tag LOCUS_38080 58824 58075 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400058.1 protein_id gnl|my_center|LOCUS_38080 60200 58875 gene locus_tag LOCUS_38090 gene gudD 60200 58875 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 protein_id gnl|my_center|LOCUS_38090 61181 60270 gene locus_tag LOCUS_38100 gene kdgD 61181 60270 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969970.1 protein_id gnl|my_center|LOCUS_38100 62900 61356 gene locus_tag LOCUS_38110 gene garD 62900 61356 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246362.1 protein_id gnl|my_center|LOCUS_38110 64441 62909 gene locus_tag LOCUS_38120 64441 62909 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 protein_id gnl|my_center|LOCUS_38120 64904 64461 gene locus_tag LOCUS_38130 64904 64461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 66026 64983 gene locus_tag LOCUS_38140 66026 64983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 67149 66205 gene locus_tag LOCUS_38150 67149 66205 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974076.1 protein_id gnl|my_center|LOCUS_38150 68679 67153 gene locus_tag LOCUS_38160 68679 67153 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 protein_id gnl|my_center|LOCUS_38160 69226 68699 gene locus_tag LOCUS_38170 69226 68699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 70224 69244 gene locus_tag LOCUS_38180 70224 69244 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815698.1 protein_id gnl|my_center|LOCUS_38180 70609 71352 gene locus_tag LOCUS_38190 70609 71352 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400058.1 protein_id gnl|my_center|LOCUS_38190 72610 71615 gene locus_tag LOCUS_38200 72610 71615 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256666.1 protein_id gnl|my_center|LOCUS_38200 73446 72838 gene locus_tag LOCUS_38210 gene ttdB 73446 72838 CDS product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077020.1 protein_id gnl|my_center|LOCUS_38210 74348 73443 gene locus_tag LOCUS_38220 gene ttdA 74348 73443 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206174.1 protein_id gnl|my_center|LOCUS_38220 74597 75520 gene locus_tag LOCUS_38230 74597 75520 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206176.1 protein_id gnl|my_center|LOCUS_38230 77025 75583 gene locus_tag LOCUS_38240 77025 75583 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_38240 78706 77696 gene locus_tag LOCUS_38250 78706 77696 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975109.1 protein_id gnl|my_center|LOCUS_38250 79856 79017 gene locus_tag LOCUS_38260 79856 79017 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782017.1 protein_id gnl|my_center|LOCUS_38260 81082 79853 gene locus_tag LOCUS_38270 81082 79853 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170989.1 protein_id gnl|my_center|LOCUS_38270 81404 81090 gene locus_tag LOCUS_38280 81404 81090 CDS product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975439.1 protein_id gnl|my_center|LOCUS_38280 82514 81429 gene locus_tag LOCUS_38290 82514 81429 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393077.1 protein_id gnl|my_center|LOCUS_38290 83250 82633 gene locus_tag LOCUS_38300 83250 82633 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706362.1 protein_id gnl|my_center|LOCUS_38300 83294 83986 gene locus_tag LOCUS_38310 83294 83986 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706361.1 protein_id gnl|my_center|LOCUS_38310 84127 84768 gene locus_tag LOCUS_38320 84127 84768 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521852.1 protein_id gnl|my_center|LOCUS_38320 84882 85772 gene locus_tag LOCUS_38330 84882 85772 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098830.1 protein_id gnl|my_center|LOCUS_38330 87913 86384 gene locus_tag LOCUS_38340 gene nhaC 87913 86384 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338014.1 protein_id gnl|my_center|LOCUS_38340 89450 88095 gene locus_tag LOCUS_38350 89450 88095 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705582.1 protein_id gnl|my_center|LOCUS_38350 90790 89537 gene locus_tag LOCUS_38360 90790 89537 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767839.1 protein_id gnl|my_center|LOCUS_38360 91899 91015 gene locus_tag LOCUS_38370 91899 91015 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095575.1 protein_id gnl|my_center|LOCUS_38370 92025 93518 gene locus_tag LOCUS_38380 92025 93518 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406390.1 protein_id gnl|my_center|LOCUS_38380 93689 94969 gene locus_tag LOCUS_38390 93689 94969 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112529.1 protein_id gnl|my_center|LOCUS_38390 95635 95099 gene locus_tag LOCUS_38400 95635 95099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 96823 95639 gene locus_tag LOCUS_38410 96823 95639 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_38410 97625 96963 gene locus_tag LOCUS_38420 97625 96963 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064925.1 protein_id gnl|my_center|LOCUS_38420 97515 97826 gene locus_tag LOCUS_38430 97515 97826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 99319 97829 gene locus_tag LOCUS_38440 99319 97829 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206844.1 protein_id gnl|my_center|LOCUS_38440 100715 99372 gene locus_tag LOCUS_38450 100715 99372 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557408.1 protein_id gnl|my_center|LOCUS_38450 101755 100862 gene locus_tag LOCUS_38460 gene bauR 101755 100862 CDS product HTH-type transcriptional activator BauR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083805.1 protein_id gnl|my_center|LOCUS_38460 103478 101961 gene locus_tag LOCUS_38470 103478 101961 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706152.1 protein_id gnl|my_center|LOCUS_38470 103921 103478 gene locus_tag LOCUS_38480 103921 103478 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268760.1 protein_id gnl|my_center|LOCUS_38480 104904 103921 gene locus_tag LOCUS_38490 104904 103921 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170846027.1 protein_id gnl|my_center|LOCUS_38490 105744 105247 gene locus_tag LOCUS_38500 gene rraA 105744 105247 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765718.1 protein_id gnl|my_center|LOCUS_38500 108463 105776 gene locus_tag LOCUS_38510 gene acnA 108463 105776 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528828.1 protein_id gnl|my_center|LOCUS_38510 109474 108590 gene locus_tag LOCUS_38520 109474 108590 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807817.1 protein_id gnl|my_center|LOCUS_38520 110119 109484 gene locus_tag LOCUS_38530 110119 109484 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965772.1 protein_id gnl|my_center|LOCUS_38530 111387 110116 gene locus_tag LOCUS_38540 111387 110116 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194989.1 protein_id gnl|my_center|LOCUS_38540 112527 111457 gene locus_tag LOCUS_38550 112527 111457 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139076345.1 protein_id gnl|my_center|LOCUS_38550 112778 113260 gene locus_tag LOCUS_38560 gene rraA 112778 113260 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731282.1 protein_id gnl|my_center|LOCUS_38560 113278 113946 gene locus_tag LOCUS_38570 113278 113946 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 protein_id gnl|my_center|LOCUS_38570 113952 114719 gene locus_tag LOCUS_38580 113952 114719 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390256.1 protein_id gnl|my_center|LOCUS_38580 114886 116550 gene locus_tag LOCUS_38590 114886 116550 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114967.1 protein_id gnl|my_center|LOCUS_38590 116743 117666 gene locus_tag LOCUS_38600 116743 117666 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016558605.1 protein_id gnl|my_center|LOCUS_38600 117930 118202 gene locus_tag LOCUS_38610 117930 118202 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947651.1 protein_id gnl|my_center|LOCUS_38610 118189 119481 gene locus_tag LOCUS_38620 118189 119481 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032802630.1 protein_id gnl|my_center|LOCUS_38620 120784 119513 gene locus_tag LOCUS_38630 gene pgl 120784 119513 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_38630 122252 121038 gene locus_tag LOCUS_38640 gene mtnK 122252 121038 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816942.1 protein_id gnl|my_center|LOCUS_38640 122494 123462 gene locus_tag LOCUS_38650 gene arsS 122494 123462 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_38650 123459 124124 gene locus_tag LOCUS_38660 123459 124124 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460533.1 protein_id gnl|my_center|LOCUS_38660 124121 124747 gene locus_tag LOCUS_38670 124121 124747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 124758 125573 gene locus_tag LOCUS_38680 124758 125573 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_38680 125570 127729 gene locus_tag LOCUS_38690 125570 127729 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_38690 129122 128682 gene locus_tag LOCUS_38700 129122 128682 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_38700 129235 130158 gene locus_tag LOCUS_38710 129235 130158 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809093.1 protein_id gnl|my_center|LOCUS_38710 131887 130199 gene locus_tag LOCUS_38720 131887 130199 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707307.1 protein_id gnl|my_center|LOCUS_38720 132047 132946 gene locus_tag LOCUS_38730 gene cysD 132047 132946 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640249.1 protein_id gnl|my_center|LOCUS_38730 132946 134853 gene locus_tag LOCUS_38740 gene cysN 132946 134853 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_38740 >Feature sequence36 702 340 gene locus_tag LOCUS_38750 702 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 1343 1119 gene locus_tag LOCUS_38760 1343 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 2722 1466 gene locus_tag LOCUS_38770 2722 1466 CDS product capsular biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161827.1 protein_id gnl|my_center|LOCUS_38770 3238 2891 gene locus_tag LOCUS_38780 3238 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780440.1 protein_id gnl|my_center|LOCUS_38780 4644 3235 gene locus_tag LOCUS_38790 4644 3235 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780438.1 protein_id gnl|my_center|LOCUS_38790 5801 4641 gene locus_tag LOCUS_38800 5801 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384424.1 protein_id gnl|my_center|LOCUS_38800 6193 6489 gene locus_tag LOCUS_38810 6193 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810