>Feature sequence01 353 1339 gene locus_tag LOCUS_00010 353 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3866 1944 gene locus_tag LOCUS_00020 3866 1944 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230961.1 protein_id gnl|my_center|LOCUS_00020 5399 3930 gene locus_tag LOCUS_00030 5399 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6269 6195 gene locus_tag LOCUS_t00010 6269 6195 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6355 6810 gene locus_tag LOCUS_00040 6355 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6900 8339 gene locus_tag LOCUS_00050 6900 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8683 8336 gene locus_tag LOCUS_00060 8683 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8804 9397 gene locus_tag LOCUS_00070 8804 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9397 10224 gene locus_tag LOCUS_00080 9397 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10232 10420 gene locus_tag LOCUS_00090 10232 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11807 10509 gene locus_tag LOCUS_00100 11807 10509 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 protein_id gnl|my_center|LOCUS_00100 12248 11835 gene locus_tag LOCUS_00110 12248 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13161 12382 gene locus_tag LOCUS_00120 13161 12382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13350 13718 gene locus_tag LOCUS_00130 13350 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14496 13789 gene locus_tag LOCUS_00140 14496 13789 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228008.1 protein_id gnl|my_center|LOCUS_00140 14595 16400 gene locus_tag LOCUS_00150 14595 16400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16465 17250 gene locus_tag LOCUS_00160 16465 17250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17250 18176 gene locus_tag LOCUS_00170 17250 18176 CDS product MEDS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847606.1 protein_id gnl|my_center|LOCUS_00170 18289 19338 gene locus_tag LOCUS_00180 18289 19338 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_00180 19410 21140 gene locus_tag LOCUS_00190 gene alsS 19410 21140 CDS product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103515.1 protein_id gnl|my_center|LOCUS_00190 21151 22014 gene locus_tag LOCUS_00200 gene alsD 21151 22014 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215019.1 protein_id gnl|my_center|LOCUS_00200 23169 22114 gene locus_tag LOCUS_00210 23169 22114 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973478.1 protein_id gnl|my_center|LOCUS_00210 23253 24164 gene locus_tag LOCUS_00220 23253 24164 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_00220 24196 25887 gene locus_tag LOCUS_00230 gene pruA 24196 25887 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_00230 26142 26972 gene locus_tag LOCUS_00240 26142 26972 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226373.1 protein_id gnl|my_center|LOCUS_00240 27976 27104 gene locus_tag LOCUS_00250 27976 27104 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222502.1 protein_id gnl|my_center|LOCUS_00250 28562 28098 gene locus_tag LOCUS_00260 28562 28098 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 protein_id gnl|my_center|LOCUS_00260 30765 29002 gene locus_tag LOCUS_00270 30765 29002 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227653.1 protein_id gnl|my_center|LOCUS_00270 31535 30762 gene locus_tag LOCUS_00280 31535 30762 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227652.1 protein_id gnl|my_center|LOCUS_00280 31903 32916 gene locus_tag LOCUS_00290 gene dhaK 31903 32916 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972071.1 protein_id gnl|my_center|LOCUS_00290 32965 33594 gene locus_tag LOCUS_00300 gene dhaL 32965 33594 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031416.1 protein_id gnl|my_center|LOCUS_00300 33594 33989 gene locus_tag LOCUS_00310 33594 33989 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164277346.1 protein_id gnl|my_center|LOCUS_00310 34771 34520 gene locus_tag LOCUS_00320 34771 34520 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_00320 35021 38353 gene locus_tag LOCUS_00330 35021 38353 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258737.1 protein_id gnl|my_center|LOCUS_00330 38835 38407 gene locus_tag LOCUS_00340 38835 38407 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729927.1 protein_id gnl|my_center|LOCUS_00340 39088 39735 gene locus_tag LOCUS_00350 39088 39735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 40665 39715 gene locus_tag LOCUS_00360 40665 39715 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028575.1 protein_id gnl|my_center|LOCUS_00360 40715 41182 gene locus_tag LOCUS_00370 40715 41182 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 protein_id gnl|my_center|LOCUS_00370 41303 41953 gene locus_tag LOCUS_00380 41303 41953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 41961 43442 gene locus_tag LOCUS_00390 41961 43442 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082328.1 protein_id gnl|my_center|LOCUS_00390 44151 43504 gene locus_tag LOCUS_00400 44151 43504 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726958.1 protein_id gnl|my_center|LOCUS_00400 45389 44142 gene locus_tag LOCUS_00410 45389 44142 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104242.1 protein_id gnl|my_center|LOCUS_00410 47113 45653 gene locus_tag LOCUS_00420 gene der 47113 45653 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_00420 47808 47140 gene locus_tag LOCUS_00430 gene cmk 47808 47140 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_00430 48569 47940 gene locus_tag LOCUS_00440 48569 47940 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312123.1 protein_id gnl|my_center|LOCUS_00440 48727 50883 gene locus_tag LOCUS_00450 48727 50883 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730364.1 protein_id gnl|my_center|LOCUS_00450 52094 51000 gene locus_tag LOCUS_00460 52094 51000 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_00460 52505 52146 gene locus_tag LOCUS_00470 gene aroH 52505 52146 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_00470 54657 52618 gene locus_tag LOCUS_00480 54657 52618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 55508 54654 gene locus_tag LOCUS_00490 55508 54654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 56541 55672 gene locus_tag LOCUS_00500 56541 55672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00500 57278 57739 gene locus_tag LOCUS_00510 57278 57739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 58040 57675 gene locus_tag LOCUS_00520 58040 57675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 58130 59251 gene locus_tag LOCUS_00530 58130 59251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 60333 59440 gene locus_tag LOCUS_00540 60333 59440 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_00540 61369 60455 gene locus_tag LOCUS_00550 gene xerD 61369 60455 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_00550 62016 61405 gene locus_tag LOCUS_00560 62016 61405 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_00560 63698 62013 gene locus_tag LOCUS_00570 63698 62013 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027968.1 protein_id gnl|my_center|LOCUS_00570 63855 64574 gene locus_tag LOCUS_00580 63855 64574 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977515.1 protein_id gnl|my_center|LOCUS_00580 64779 65396 gene locus_tag LOCUS_00590 64779 65396 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896486.1 protein_id gnl|my_center|LOCUS_00590 66141 65386 gene locus_tag LOCUS_00600 66141 65386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 66624 66145 gene locus_tag LOCUS_00610 66624 66145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 66707 68014 gene locus_tag LOCUS_00620 66707 68014 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729017.1 protein_id gnl|my_center|LOCUS_00620 70289 68178 gene locus_tag LOCUS_00630 gene uvrB 70289 68178 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_00630 71572 70427 gene locus_tag LOCUS_00640 71572 70427 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104175.1 protein_id gnl|my_center|LOCUS_00640 72258 71668 gene locus_tag LOCUS_00650 gene coaE 72258 71668 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_00650 72738 72283 gene locus_tag LOCUS_00660 72738 72283 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230160.1 protein_id gnl|my_center|LOCUS_00660 74439 72970 gene locus_tag LOCUS_00670 gene rpsA 74439 72970 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_00670 75712 74639 gene locus_tag LOCUS_00680 75712 74639 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225108.1 protein_id gnl|my_center|LOCUS_00680 75764 76816 gene locus_tag LOCUS_00690 75764 76816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 79491 76810 gene locus_tag LOCUS_00700 gene polA 79491 76810 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_00700 79554 79970 gene locus_tag LOCUS_00710 79554 79970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 80394 81677 gene locus_tag LOCUS_00720 80394 81677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 81691 82680 gene locus_tag LOCUS_00730 81691 82680 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525178.1 protein_id gnl|my_center|LOCUS_00730 82670 83602 gene locus_tag LOCUS_00740 82670 83602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_00740 83599 84486 gene locus_tag LOCUS_00750 83599 84486 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_00750 84615 85091 gene locus_tag LOCUS_00760 84615 85091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 86545 85256 gene locus_tag LOCUS_00770 86545 85256 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_00770 87392 86814 gene locus_tag LOCUS_00780 87392 86814 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_00780 87531 87606 gene locus_tag LOCUS_t00020 87531 87606 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 88883 87714 gene locus_tag LOCUS_00790 88883 87714 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027309.1 protein_id gnl|my_center|LOCUS_00790 89071 89901 gene locus_tag LOCUS_00800 89071 89901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978152.1 protein_id gnl|my_center|LOCUS_00800 89898 90677 gene locus_tag LOCUS_00810 89898 90677 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978153.1 protein_id gnl|my_center|LOCUS_00810 90674 91564 gene locus_tag LOCUS_00820 90674 91564 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027308.1 protein_id gnl|my_center|LOCUS_00820 91557 92645 gene locus_tag LOCUS_00830 91557 92645 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027307.1 protein_id gnl|my_center|LOCUS_00830 92606 93868 gene locus_tag LOCUS_00840 92606 93868 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978156.1 protein_id gnl|my_center|LOCUS_00840 95780 93966 gene locus_tag LOCUS_00850 95780 93966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 protein_id gnl|my_center|LOCUS_00850 97567 95777 gene locus_tag LOCUS_00860 97567 95777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730691.1 protein_id gnl|my_center|LOCUS_00860 99241 97811 gene locus_tag LOCUS_00870 gene pyk 99241 97811 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_00870 99453 100208 gene locus_tag LOCUS_00880 99453 100208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 100205 100435 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgatcatgcacaggttcg 102335 100698 gene locus_tag LOCUS_00890 102335 100698 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229919.1 protein_id gnl|my_center|LOCUS_00890 104106 102622 gene locus_tag LOCUS_00900 104106 102622 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228800.1 protein_id gnl|my_center|LOCUS_00900 108555 104119 gene locus_tag LOCUS_00910 gene gltB 108555 104119 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742213.1 protein_id gnl|my_center|LOCUS_00910 108844 110367 gene locus_tag LOCUS_00920 108844 110367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 111420 110494 gene locus_tag LOCUS_00930 111420 110494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 112136 111417 gene locus_tag LOCUS_00940 112136 111417 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_00940 113410 112133 gene locus_tag LOCUS_00950 113410 112133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 114222 113476 gene locus_tag LOCUS_00960 114222 113476 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715374.1 protein_id gnl|my_center|LOCUS_00960 114868 114296 gene locus_tag LOCUS_00970 114868 114296 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_00970 115798 115004 gene locus_tag LOCUS_00980 gene trpA 115798 115004 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976780.1 protein_id gnl|my_center|LOCUS_00980 117092 115818 gene locus_tag LOCUS_00990 gene trpB 117092 115818 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976779.1 protein_id gnl|my_center|LOCUS_00990 117913 117095 gene locus_tag LOCUS_01000 gene trpC 117913 117095 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_01000 118441 118058 gene locus_tag LOCUS_01010 118441 118058 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028111.1 protein_id gnl|my_center|LOCUS_01010 119188 118502 gene locus_tag LOCUS_01020 119188 118502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 119680 119246 gene locus_tag LOCUS_01030 119680 119246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01030 120618 119884 gene locus_tag LOCUS_01040 120618 119884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 120965 120615 gene locus_tag LOCUS_01050 gene hisI 120965 120615 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 protein_id gnl|my_center|LOCUS_01050 121324 121995 gene locus_tag LOCUS_01060 121324 121995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 122744 122022 gene locus_tag LOCUS_01070 122744 122022 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223103.1 protein_id gnl|my_center|LOCUS_01070 123554 122748 gene locus_tag LOCUS_01080 123554 122748 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223104.1 protein_id gnl|my_center|LOCUS_01080 123652 124719 gene locus_tag LOCUS_01090 123652 124719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286312.1 protein_id gnl|my_center|LOCUS_01090 124787 126013 gene locus_tag LOCUS_01100 124787 126013 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223107.1 protein_id gnl|my_center|LOCUS_01100 126376 127251 gene locus_tag LOCUS_01110 126376 127251 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223108.1 protein_id gnl|my_center|LOCUS_01110 127248 128045 gene locus_tag LOCUS_01120 127248 128045 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223109.1 protein_id gnl|my_center|LOCUS_01120 129857 128046 gene locus_tag LOCUS_01130 129857 128046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_01130 131632 129854 gene locus_tag LOCUS_01140 131632 129854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01140 131888 132520 gene locus_tag LOCUS_01150 131888 132520 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_01150 132592 132771 gene locus_tag LOCUS_01160 132592 132771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 132888 133049 gene locus_tag LOCUS_01170 132888 133049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 133184 134587 gene locus_tag LOCUS_01180 133184 134587 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674116.1 protein_id gnl|my_center|LOCUS_01180 134699 135079 gene locus_tag LOCUS_01190 134699 135079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01190 135170 135724 gene locus_tag LOCUS_01200 135170 135724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01200 135886 136317 gene locus_tag LOCUS_01210 135886 136317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 137293 136523 gene locus_tag LOCUS_01220 gene hisF 137293 136523 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466799.1 protein_id gnl|my_center|LOCUS_01220 137697 137290 gene locus_tag LOCUS_01230 137697 137290 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_01230 138419 137694 gene locus_tag LOCUS_01240 gene priA 138419 137694 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976766.1 protein_id gnl|my_center|LOCUS_01240 138761 138423 gene locus_tag LOCUS_01250 138761 138423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 139416 138796 gene locus_tag LOCUS_01260 gene hisH 139416 138796 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_01260 139577 139425 gene locus_tag LOCUS_01270 139577 139425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 140176 139577 gene locus_tag LOCUS_01280 gene hisB 140176 139577 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_01280 141246 140173 gene locus_tag LOCUS_01290 141246 140173 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_01290 142550 141243 gene locus_tag LOCUS_01300 gene hisD 142550 141243 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028117.1 protein_id gnl|my_center|LOCUS_01300 144072 142735 gene locus_tag LOCUS_01310 144072 142735 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223198.1 protein_id gnl|my_center|LOCUS_01310 144209 144706 gene locus_tag LOCUS_01320 gene ybaK 144209 144706 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_01320 144788 146209 gene locus_tag LOCUS_01330 144788 146209 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_01330 146673 146185 gene locus_tag LOCUS_01340 146673 146185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 146753 148075 gene locus_tag LOCUS_01350 gene murA 146753 148075 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 protein_id gnl|my_center|LOCUS_01350 148127 150706 gene locus_tag LOCUS_01360 148127 150706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 151822 150923 gene locus_tag LOCUS_01370 151822 150923 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030266.1 protein_id gnl|my_center|LOCUS_01370 155390 151869 gene locus_tag LOCUS_01380 gene dnaE 155390 151869 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976751.1 protein_id gnl|my_center|LOCUS_01380 156401 155457 gene locus_tag LOCUS_01390 156401 155457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 156700 158928 gene locus_tag LOCUS_01400 156700 158928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 159483 158941 gene locus_tag LOCUS_01410 159483 158941 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224228.1 protein_id gnl|my_center|LOCUS_01410 161171 159714 gene locus_tag LOCUS_01420 161171 159714 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_01420 164114 161295 gene locus_tag LOCUS_01430 164114 161295 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838916.1 protein_id gnl|my_center|LOCUS_01430 164365 165987 gene locus_tag LOCUS_01440 164365 165987 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486587.1 protein_id gnl|my_center|LOCUS_01440 166142 167446 gene locus_tag LOCUS_01450 166142 167446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 168420 167491 gene locus_tag LOCUS_01460 168420 167491 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_01460 168895 168413 gene locus_tag LOCUS_01470 gene lspA 168895 168413 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947675.1 protein_id gnl|my_center|LOCUS_01470 169344 168949 gene locus_tag LOCUS_01480 169344 168949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 169778 169440 gene locus_tag LOCUS_01490 169778 169440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 169997 173155 gene locus_tag LOCUS_01500 gene ileS 169997 173155 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_01500 175743 173455 gene locus_tag LOCUS_01510 175743 173455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 176664 175798 gene locus_tag LOCUS_01520 176664 175798 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080209.1 protein_id gnl|my_center|LOCUS_01520 177003 176716 gene locus_tag LOCUS_01530 177003 176716 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976737.1 protein_id gnl|my_center|LOCUS_01530 177613 177086 gene locus_tag LOCUS_01540 gene sepF 177613 177086 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_01540 178464 177748 gene locus_tag LOCUS_01550 178464 177748 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_01550 179901 178477 gene locus_tag LOCUS_01560 179901 178477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 180798 180124 gene locus_tag LOCUS_01570 180798 180124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01570 182192 180795 gene locus_tag LOCUS_01580 gene murC 182192 180795 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_01580 183321 182242 gene locus_tag LOCUS_01590 gene murG 183321 182242 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_01590 184590 183340 gene locus_tag LOCUS_01600 gene ftsW 184590 183340 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_01600 185978 184587 gene locus_tag LOCUS_01610 gene murD 185978 184587 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_01610 187033 185960 gene locus_tag LOCUS_01620 gene mraY 187033 185960 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_01620 188397 187030 gene locus_tag LOCUS_01630 188397 187030 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228041.1 protein_id gnl|my_center|LOCUS_01630 190070 188523 gene locus_tag LOCUS_01640 190070 188523 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_01640 192705 190120 gene locus_tag LOCUS_01650 192705 190120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 193382 192702 gene locus_tag LOCUS_01660 193382 192702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 194470 193379 gene locus_tag LOCUS_01670 gene rsmH 194470 193379 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_01670 195006 194575 gene locus_tag LOCUS_01680 gene mraZ 195006 194575 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_01680 195467 196447 gene locus_tag LOCUS_01690 195467 196447 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_01690 196458 197684 gene locus_tag LOCUS_01700 196458 197684 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_01700 197681 200260 gene locus_tag LOCUS_01710 197681 200260 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_01710 200756 200370 gene locus_tag LOCUS_01720 200756 200370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 202142 200904 gene locus_tag LOCUS_01730 gene dinB 202142 200904 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_01730 202940 202221 gene locus_tag LOCUS_01740 202940 202221 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_01740 203458 203048 gene locus_tag LOCUS_01750 gene nusB 203458 203048 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_01750 204020 203460 gene locus_tag LOCUS_01760 gene efp 204020 203460 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 protein_id gnl|my_center|LOCUS_01760 205109 204048 gene locus_tag LOCUS_01770 205109 204048 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_01770 206759 205119 gene locus_tag LOCUS_01780 206759 205119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 206870 207427 gene locus_tag LOCUS_01790 206870 207427 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228785.1 protein_id gnl|my_center|LOCUS_01790 208511 207477 gene locus_tag LOCUS_01800 208511 207477 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731394.1 protein_id gnl|my_center|LOCUS_01800 209173 208595 gene locus_tag LOCUS_01810 209173 208595 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_01810 210291 209170 gene locus_tag LOCUS_01820 210291 209170 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727161.1 protein_id gnl|my_center|LOCUS_01820 209879 209806 gene locus_tag LOCUS_t00030 209879 209806 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 211432 210284 gene locus_tag LOCUS_01830 211432 210284 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_01830 212372 211425 gene locus_tag LOCUS_01840 212372 211425 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_01840 212483 213088 gene locus_tag LOCUS_01850 212483 213088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 protein_id gnl|my_center|LOCUS_01850 213514 213209 gene locus_tag LOCUS_01860 213514 213209 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_01860 213673 214506 gene locus_tag LOCUS_01870 213673 214506 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226851.1 protein_id gnl|my_center|LOCUS_01870 214479 215225 gene locus_tag LOCUS_01880 214479 215225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226850.1 protein_id gnl|my_center|LOCUS_01880 215222 216217 gene locus_tag LOCUS_01890 215222 216217 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026153082.1 protein_id gnl|my_center|LOCUS_01890 216214 217347 gene locus_tag LOCUS_01900 216214 217347 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226848.1 protein_id gnl|my_center|LOCUS_01900 218020 217490 gene locus_tag LOCUS_01910 218020 217490 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805205.1 protein_id gnl|my_center|LOCUS_01910 218647 218177 gene locus_tag LOCUS_01920 gene ribH 218647 218177 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224642.1 protein_id gnl|my_center|LOCUS_01920 219888 218644 gene locus_tag LOCUS_01930 219888 218644 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977384.1 protein_id gnl|my_center|LOCUS_01930 220517 219885 gene locus_tag LOCUS_01940 220517 219885 CDS product nicotinamide mononucleotide transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977383.1 protein_id gnl|my_center|LOCUS_01940 221110 220514 gene locus_tag LOCUS_01950 221110 220514 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_01950 222196 221111 gene locus_tag LOCUS_01960 gene ribD 222196 221111 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976111.1 protein_id gnl|my_center|LOCUS_01960 222810 223883 gene locus_tag LOCUS_01970 222810 223883 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973865.1 protein_id gnl|my_center|LOCUS_01970 223903 225690 gene locus_tag LOCUS_01980 223903 225690 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973864.1 protein_id gnl|my_center|LOCUS_01980 225776 226756 gene locus_tag LOCUS_01990 225776 226756 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973863.1 protein_id gnl|my_center|LOCUS_01990 226833 227897 gene locus_tag LOCUS_02000 226833 227897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973862.1 protein_id gnl|my_center|LOCUS_02000 227894 228925 gene locus_tag LOCUS_02010 227894 228925 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973861.1 protein_id gnl|my_center|LOCUS_02010 229655 228996 gene locus_tag LOCUS_02020 gene rpe 229655 228996 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_02020 229763 230128 gene locus_tag LOCUS_02030 229763 230128 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140688.1 protein_id gnl|my_center|LOCUS_02030 230203 231036 gene locus_tag LOCUS_02040 230203 231036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 232332 231049 gene locus_tag LOCUS_02050 232332 231049 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_02050 233457 232528 gene locus_tag LOCUS_02060 gene fmt 233457 232528 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_02060 234005 233457 gene locus_tag LOCUS_02070 gene def 234005 233457 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_02070 235263 234049 gene locus_tag LOCUS_02080 235263 234049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976912.1 protein_id gnl|my_center|LOCUS_02080 236960 235287 gene locus_tag LOCUS_02090 236960 235287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 239082 237001 gene locus_tag LOCUS_02100 239082 237001 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 protein_id gnl|my_center|LOCUS_02100 239141 239812 gene locus_tag LOCUS_02110 239141 239812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_02110 241256 240069 gene locus_tag LOCUS_02120 gene metK 241256 240069 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_02120 241802 241428 gene locus_tag LOCUS_02130 241802 241428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 243106 241913 gene locus_tag LOCUS_02140 gene coaBC 243106 241913 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_02140 243443 243180 gene locus_tag LOCUS_02150 gene rpoZ 243443 243180 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_02150 244102 243455 gene locus_tag LOCUS_02160 gene gmk 244102 243455 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 protein_id gnl|my_center|LOCUS_02160 244464 244141 gene locus_tag LOCUS_02170 244464 244141 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_02170 245686 244979 gene locus_tag LOCUS_02180 gene pyrF 245686 244979 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_02180 246606 245683 gene locus_tag LOCUS_02190 gene pyrD 246606 245683 CDS product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081057.1 protein_id gnl|my_center|LOCUS_02190 247536 246679 gene locus_tag LOCUS_02200 247536 246679 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_02200 250829 247551 gene locus_tag LOCUS_02210 gene carB 250829 247551 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_02210 251949 250822 gene locus_tag LOCUS_02220 gene carA 251949 250822 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_02220 253247 251946 gene locus_tag LOCUS_02230 253247 251946 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_02230 254217 253285 gene locus_tag LOCUS_02240 254217 253285 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_02240 254771 254214 gene locus_tag LOCUS_02250 gene pyrR 254771 254214 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_02250 255175 255669 gene locus_tag LOCUS_02260 gene bldD 255175 255669 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_02260 255946 257190 gene locus_tag LOCUS_02270 255946 257190 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 protein_id gnl|my_center|LOCUS_02270 257659 257225 gene locus_tag LOCUS_02280 257659 257225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 258931 258092 gene locus_tag LOCUS_02290 258931 258092 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776667.1 protein_id gnl|my_center|LOCUS_02290 259061 259537 gene locus_tag LOCUS_02300 259061 259537 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104384.1 protein_id gnl|my_center|LOCUS_02300 259648 260199 gene locus_tag LOCUS_02310 259648 260199 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224203.1 protein_id gnl|my_center|LOCUS_02310 261139 260210 gene locus_tag LOCUS_02320 gene metF 261139 260210 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_02320 261287 262354 gene locus_tag LOCUS_02330 261287 262354 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_02330 263116 262463 gene locus_tag LOCUS_02340 gene thiE 263116 262463 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976712.1 protein_id gnl|my_center|LOCUS_02340 263519 263145 gene locus_tag LOCUS_02350 263519 263145 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_02350 264741 263563 gene locus_tag LOCUS_02360 264741 263563 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486236.1 protein_id gnl|my_center|LOCUS_02360 265032 264805 gene locus_tag LOCUS_02370 265032 264805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 264970 266277 gene locus_tag LOCUS_02380 gene thiO 264970 266277 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_02380 266274 266474 gene locus_tag LOCUS_02390 gene thiS 266274 266474 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_02390 266471 267289 gene locus_tag LOCUS_02400 266471 267289 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_02400 267465 269435 gene locus_tag LOCUS_02410 gene pknB 267465 269435 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_02410 270502 269528 gene locus_tag LOCUS_02420 gene alc 270502 269528 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730744.1 protein_id gnl|my_center|LOCUS_02420 271835 270504 gene locus_tag LOCUS_02430 gene allB 271835 270504 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223822.1 protein_id gnl|my_center|LOCUS_02430 273181 271832 gene locus_tag LOCUS_02440 273181 271832 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727577.1 protein_id gnl|my_center|LOCUS_02440 273814 273341 gene locus_tag LOCUS_02450 273814 273341 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226423.1 protein_id gnl|my_center|LOCUS_02450 274674 273811 gene locus_tag LOCUS_02460 274674 273811 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030706.1 protein_id gnl|my_center|LOCUS_02460 275542 274679 gene locus_tag LOCUS_02470 gene pucL 275542 274679 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223818.1 protein_id gnl|my_center|LOCUS_02470 275891 275544 gene locus_tag LOCUS_02480 gene uraH 275891 275544 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223819.1 protein_id gnl|my_center|LOCUS_02480 276361 275888 gene locus_tag LOCUS_02490 gene uraD 276361 275888 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076325.1 protein_id gnl|my_center|LOCUS_02490 276499 277338 gene locus_tag LOCUS_02500 276499 277338 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976705.1 protein_id gnl|my_center|LOCUS_02500 278827 278066 gene locus_tag LOCUS_02510 278827 278066 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_02510 280015 278888 gene locus_tag LOCUS_02520 280015 278888 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_02520 280645 280034 gene locus_tag LOCUS_02530 280645 280034 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976704.1 protein_id gnl|my_center|LOCUS_02530 280942 281982 gene locus_tag LOCUS_02540 gene aroF 280942 281982 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_02540 283748 282546 gene locus_tag LOCUS_02550 gene thiI 283748 282546 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_02550 284538 283861 gene locus_tag LOCUS_02560 284538 283861 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_02560 285776 284535 gene locus_tag LOCUS_02570 285776 284535 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976694.1 protein_id gnl|my_center|LOCUS_02570 287155 286130 gene locus_tag LOCUS_02580 287155 286130 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_02580 287448 288356 gene locus_tag LOCUS_02590 287448 288356 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230946.1 protein_id gnl|my_center|LOCUS_02590 289607 288408 gene locus_tag LOCUS_02600 289607 288408 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615430.1 protein_id gnl|my_center|LOCUS_02600 290123 291034 gene locus_tag LOCUS_02610 290123 291034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 291031 293622 gene locus_tag LOCUS_02620 291031 293622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 294003 294857 gene locus_tag LOCUS_02630 gene mmuM 294003 294857 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246467.1 protein_id gnl|my_center|LOCUS_02630 296419 294881 gene locus_tag LOCUS_02640 296419 294881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 297184 296486 gene locus_tag LOCUS_02650 297184 296486 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977603.1 protein_id gnl|my_center|LOCUS_02650 297312 298076 gene locus_tag LOCUS_02660 297312 298076 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_02660 298089 298556 gene locus_tag LOCUS_02670 298089 298556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976691.1 protein_id gnl|my_center|LOCUS_02670 299827 298682 gene locus_tag LOCUS_02680 299827 298682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 300666 299965 gene locus_tag LOCUS_02690 300666 299965 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976690.1 protein_id gnl|my_center|LOCUS_02690 301626 300685 gene locus_tag LOCUS_02700 301626 300685 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976689.1 protein_id gnl|my_center|LOCUS_02700 302275 301784 gene locus_tag LOCUS_02710 302275 301784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 303330 302272 gene locus_tag LOCUS_02720 303330 302272 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256376.1 protein_id gnl|my_center|LOCUS_02720 303866 303429 gene locus_tag LOCUS_02730 303866 303429 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_02730 304648 303881 gene locus_tag LOCUS_02740 304648 303881 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028154.1 protein_id gnl|my_center|LOCUS_02740 304888 306672 gene locus_tag LOCUS_02750 304888 306672 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_02750 307959 306730 gene locus_tag LOCUS_02760 307959 306730 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_02760 308945 308088 gene locus_tag LOCUS_02770 308945 308088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 309163 310563 gene locus_tag LOCUS_02780 309163 310563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 310614 311582 gene locus_tag LOCUS_02790 310614 311582 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729997.1 protein_id gnl|my_center|LOCUS_02790 311699 312859 gene locus_tag LOCUS_02800 311699 312859 CDS product NAD-dependent formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169958.1 protein_id gnl|my_center|LOCUS_02800 313035 315119 gene locus_tag LOCUS_02810 313035 315119 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727118.1 protein_id gnl|my_center|LOCUS_02810 315397 315239 gene locus_tag LOCUS_02820 315397 315239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 316570 315545 gene locus_tag LOCUS_02830 316570 315545 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028313.1 protein_id gnl|my_center|LOCUS_02830 316812 317711 gene locus_tag LOCUS_02840 316812 317711 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225571.1 protein_id gnl|my_center|LOCUS_02840 318772 317756 gene locus_tag LOCUS_02850 318772 317756 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929295.1 protein_id gnl|my_center|LOCUS_02850 319790 318921 gene locus_tag LOCUS_02860 319790 318921 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230390.1 protein_id gnl|my_center|LOCUS_02860 319998 321092 gene locus_tag LOCUS_02870 gene thrC 319998 321092 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878813.1 protein_id gnl|my_center|LOCUS_02870 321598 321218 gene locus_tag LOCUS_02880 321598 321218 CDS product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285721.1 protein_id gnl|my_center|LOCUS_02880 321678 322391 gene locus_tag LOCUS_02890 321678 322391 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027589.1 protein_id gnl|my_center|LOCUS_02890 323111 322584 gene locus_tag LOCUS_02900 323111 322584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 323002 323205 gene locus_tag LOCUS_02910 323002 323205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 325179 324214 gene locus_tag LOCUS_02920 325179 324214 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028159.1 protein_id gnl|my_center|LOCUS_02920 326703 325387 gene locus_tag LOCUS_02930 326703 325387 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 protein_id gnl|my_center|LOCUS_02930 326911 328665 gene locus_tag LOCUS_02940 326911 328665 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_02940 328717 329004 gene locus_tag LOCUS_02950 328717 329004 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_02950 330312 329269 gene locus_tag LOCUS_02960 gene trpD 330312 329269 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_02960 330760 330347 gene locus_tag LOCUS_02970 330760 330347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 protein_id gnl|my_center|LOCUS_02970 331013 331540 gene locus_tag LOCUS_02980 331013 331540 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_02980 331558 332370 gene locus_tag LOCUS_02990 331558 332370 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805020.1 protein_id gnl|my_center|LOCUS_02990 332367 333446 gene locus_tag LOCUS_03000 332367 333446 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_03000 333446 335077 gene locus_tag LOCUS_03010 333446 335077 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_03010 336355 335186 gene locus_tag LOCUS_03020 336355 335186 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 protein_id gnl|my_center|LOCUS_03020 336902 336507 gene locus_tag LOCUS_03030 336902 336507 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_03030 338563 336899 gene locus_tag LOCUS_03040 gene ctaD 338563 336899 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_03040 339255 338560 gene locus_tag LOCUS_03050 gene coxB 339255 338560 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028168.1 protein_id gnl|my_center|LOCUS_03050 339579 340712 gene locus_tag LOCUS_03060 339579 340712 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03060 340712 341035 gene locus_tag LOCUS_03070 340712 341035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03070 342211 341225 gene locus_tag LOCUS_03080 342211 341225 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_03080 342747 342394 gene locus_tag LOCUS_03090 342747 342394 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_03090 342980 344134 gene locus_tag LOCUS_03100 gene nadA 342980 344134 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_03100 344728 344180 gene locus_tag LOCUS_03110 344728 344180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_03110 345621 344728 gene locus_tag LOCUS_03120 gene htpX 345621 344728 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_03120 345899 345621 gene locus_tag LOCUS_03130 345899 345621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 protein_id gnl|my_center|LOCUS_03130 346666 345896 gene locus_tag LOCUS_03140 346666 345896 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_03140 346836 347450 gene locus_tag LOCUS_03150 346836 347450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 347808 349835 gene locus_tag LOCUS_03160 347808 349835 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228163.1 protein_id gnl|my_center|LOCUS_03160 349862 350863 gene locus_tag LOCUS_03170 349862 350863 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_03170 351074 350868 gene locus_tag LOCUS_03180 351074 350868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_03180 351229 352326 gene locus_tag LOCUS_03190 351229 352326 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869456.1 protein_id gnl|my_center|LOCUS_03190 352417 353244 gene locus_tag LOCUS_03200 352417 353244 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028180.1 protein_id gnl|my_center|LOCUS_03200 353495 354982 gene locus_tag LOCUS_03210 353495 354982 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_03210 355061 356440 gene locus_tag LOCUS_03220 gene lpdA 355061 356440 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_03220 356472 357974 gene locus_tag LOCUS_03230 356472 357974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 358189 359091 gene locus_tag LOCUS_03240 358189 359091 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_03240 359122 359862 gene locus_tag LOCUS_03250 359122 359862 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_03250 359875 360534 gene locus_tag LOCUS_03260 gene lipB 359875 360534 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895681.1 protein_id gnl|my_center|LOCUS_03260 360539 361468 gene locus_tag LOCUS_03270 gene lipA 360539 361468 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466774.1 protein_id gnl|my_center|LOCUS_03270 361517 362170 gene locus_tag LOCUS_03280 361517 362170 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_03280 362229 363017 gene locus_tag LOCUS_03290 362229 363017 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_03290 363521 363060 gene locus_tag LOCUS_03300 363521 363060 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_03300 363635 364738 gene locus_tag LOCUS_03310 363635 364738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029802.1 protein_id gnl|my_center|LOCUS_03310 364979 366355 gene locus_tag LOCUS_03320 gene glnA 364979 366355 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223133.1 protein_id gnl|my_center|LOCUS_03320 366649 366383 gene locus_tag LOCUS_03330 366649 366383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 366965 367720 gene locus_tag LOCUS_03340 366965 367720 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072477587.1 protein_id gnl|my_center|LOCUS_03340 368235 368005 gene locus_tag LOCUS_03350 368235 368005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 368491 368853 gene locus_tag LOCUS_03360 368491 368853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03360 368895 369302 gene locus_tag LOCUS_03370 368895 369302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03370 369776 369414 gene locus_tag LOCUS_03380 369776 369414 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974289.1 protein_id gnl|my_center|LOCUS_03380 371558 370254 gene locus_tag LOCUS_03390 371558 370254 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169733975.1 protein_id gnl|my_center|LOCUS_03390 371640 371903 gene locus_tag LOCUS_03400 371640 371903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03400 372510 371998 gene locus_tag LOCUS_03410 372510 371998 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978113.1 protein_id gnl|my_center|LOCUS_03410 373246 372731 gene locus_tag LOCUS_03420 373246 372731 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224813.1 protein_id gnl|my_center|LOCUS_03420 373548 374444 gene locus_tag LOCUS_03430 373548 374444 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109964.1 protein_id gnl|my_center|LOCUS_03430 374614 374405 gene locus_tag LOCUS_03440 374614 374405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 374631 375155 gene locus_tag LOCUS_03450 374631 375155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 375334 375528 gene locus_tag LOCUS_03460 375334 375528 CDS product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229783.1 protein_id gnl|my_center|LOCUS_03460 376251 375742 gene locus_tag LOCUS_03470 376251 375742 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225897.1 protein_id gnl|my_center|LOCUS_03470 376765 376968 gene locus_tag LOCUS_03480 376765 376968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 378267 377299 gene locus_tag LOCUS_03490 378267 377299 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786700.1 protein_id gnl|my_center|LOCUS_03490 378335 380026 gene locus_tag LOCUS_03500 378335 380026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 380137 381312 gene locus_tag LOCUS_03510 380137 381312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 381517 382158 gene locus_tag LOCUS_03520 381517 382158 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404111.1 protein_id gnl|my_center|LOCUS_03520 382622 382233 gene locus_tag LOCUS_03530 382622 382233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03530 383329 382730 gene locus_tag LOCUS_03540 383329 382730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 383459 383845 gene locus_tag LOCUS_03550 383459 383845 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523606.1 protein_id gnl|my_center|LOCUS_03550 385217 383916 gene locus_tag LOCUS_03560 385217 383916 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224589.1 protein_id gnl|my_center|LOCUS_03560 385267 385818 gene locus_tag LOCUS_03570 385267 385818 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224590.1 protein_id gnl|my_center|LOCUS_03570 385987 386520 gene locus_tag LOCUS_03580 385987 386520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 386556 387266 gene locus_tag LOCUS_03590 386556 387266 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225832.1 protein_id gnl|my_center|LOCUS_03590 388840 387350 gene locus_tag LOCUS_03600 388840 387350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 392132 389028 gene locus_tag LOCUS_03610 392132 389028 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_03610 393048 392290 gene locus_tag LOCUS_03620 393048 392290 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978258.1 protein_id gnl|my_center|LOCUS_03620 393134 394000 gene locus_tag LOCUS_03630 393134 394000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 395000 394191 gene locus_tag LOCUS_03640 395000 394191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228025.1 protein_id gnl|my_center|LOCUS_03640 395333 395211 gene locus_tag LOCUS_03650 395333 395211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 395486 396283 gene locus_tag LOCUS_03660 395486 396283 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031856.1 protein_id gnl|my_center|LOCUS_03660 397394 396834 gene locus_tag LOCUS_03670 397394 396834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 397651 398115 gene locus_tag LOCUS_03680 397651 398115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 398215 399093 gene locus_tag LOCUS_03690 398215 399093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 400529 399168 gene locus_tag LOCUS_03700 gene glnA 400529 399168 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_03700 401663 400680 gene locus_tag LOCUS_03710 401663 400680 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 protein_id gnl|my_center|LOCUS_03710 401727 402944 gene locus_tag LOCUS_03720 401727 402944 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_03720 403020 404771 gene locus_tag LOCUS_03730 403020 404771 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208946.1 protein_id gnl|my_center|LOCUS_03730 405413 404814 gene locus_tag LOCUS_03740 405413 404814 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729044.1 protein_id gnl|my_center|LOCUS_03740 406992 405427 gene locus_tag LOCUS_03750 406992 405427 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030040.1 protein_id gnl|my_center|LOCUS_03750 408316 407123 gene locus_tag LOCUS_03760 408316 407123 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230592.1 protein_id gnl|my_center|LOCUS_03760 408545 409414 gene locus_tag LOCUS_03770 gene panB 408545 409414 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_03770 410415 409498 gene locus_tag LOCUS_03780 410415 409498 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227667.1 protein_id gnl|my_center|LOCUS_03780 411720 410611 gene locus_tag LOCUS_03790 gene megL 411720 410611 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_03790 412010 412693 gene locus_tag LOCUS_03800 412010 412693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 413407 412718 gene locus_tag LOCUS_03810 gene npdG 413407 412718 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_03810 414643 413495 gene locus_tag LOCUS_03820 414643 413495 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230171.1 protein_id gnl|my_center|LOCUS_03820 414774 415352 gene locus_tag LOCUS_03830 414774 415352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028233.1 protein_id gnl|my_center|LOCUS_03830 416345 415389 gene locus_tag LOCUS_03840 416345 415389 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972197.1 protein_id gnl|my_center|LOCUS_03840 416451 416771 gene locus_tag LOCUS_03850 416451 416771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 416970 416791 gene locus_tag LOCUS_03860 416970 416791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 417013 417861 gene locus_tag LOCUS_03870 gene map 417013 417861 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_03870 419869 417875 gene locus_tag LOCUS_03880 419869 417875 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228600.1 protein_id gnl|my_center|LOCUS_03880 420441 419866 gene locus_tag LOCUS_03890 420441 419866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 421879 420593 gene locus_tag LOCUS_03900 421879 420593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 423670 422150 gene locus_tag LOCUS_03910 423670 422150 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728731.1 protein_id gnl|my_center|LOCUS_03910 423823 426009 gene locus_tag LOCUS_03920 gene pucD 423823 426009 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226424.1 protein_id gnl|my_center|LOCUS_03920 427856 426114 gene locus_tag LOCUS_03930 427856 426114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 428105 427869 gene locus_tag LOCUS_03940 428105 427869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 428013 429131 gene locus_tag LOCUS_03950 gene ald 428013 429131 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_03950 429902 429207 gene locus_tag LOCUS_03960 429902 429207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 430013 430693 gene locus_tag LOCUS_03970 430013 430693 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_03970 430755 431051 gene locus_tag LOCUS_03980 430755 431051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 432545 431487 gene locus_tag LOCUS_03990 432545 431487 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_03990 433246 432593 gene locus_tag LOCUS_04000 433246 432593 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325632.1 protein_id gnl|my_center|LOCUS_04000 435371 433278 gene locus_tag LOCUS_04010 435371 433278 CDS product DUF6421 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082817098.1 protein_id gnl|my_center|LOCUS_04010 436712 435858 gene locus_tag LOCUS_04020 436712 435858 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535503.1 protein_id gnl|my_center|LOCUS_04020 436827 437417 gene locus_tag LOCUS_04030 436827 437417 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972709.1 protein_id gnl|my_center|LOCUS_04030 437796 437524 gene locus_tag LOCUS_04040 437796 437524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 438138 437905 gene locus_tag LOCUS_04050 438138 437905 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_04050 438959 438138 gene locus_tag LOCUS_04060 438959 438138 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_04060 439159 439668 gene locus_tag LOCUS_04070 439159 439668 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 protein_id gnl|my_center|LOCUS_04070 440063 442441 gene locus_tag LOCUS_04080 440063 442441 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222121.1 protein_id gnl|my_center|LOCUS_04080 443758 442475 gene locus_tag LOCUS_04090 443758 442475 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258492.1 protein_id gnl|my_center|LOCUS_04090 444454 443909 gene locus_tag LOCUS_04100 444454 443909 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976199.1 protein_id gnl|my_center|LOCUS_04100 444801 445289 gene locus_tag LOCUS_04110 444801 445289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 445350 445670 gene locus_tag LOCUS_04120 445350 445670 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230909.1 protein_id gnl|my_center|LOCUS_04120 446474 448468 gene locus_tag LOCUS_04130 446474 448468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 448642 449820 gene locus_tag LOCUS_04140 448642 449820 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224417.1 protein_id gnl|my_center|LOCUS_04140 450249 449827 gene locus_tag LOCUS_04150 450249 449827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 450878 452215 gene locus_tag LOCUS_04160 450878 452215 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205737.1 protein_id gnl|my_center|LOCUS_04160 452256 453083 gene locus_tag LOCUS_04170 452256 453083 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878082.1 protein_id gnl|my_center|LOCUS_04170 453136 453555 gene locus_tag LOCUS_04180 453136 453555 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230086.1 protein_id gnl|my_center|LOCUS_04180 454097 453687 gene locus_tag LOCUS_04190 454097 453687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 455362 454955 gene locus_tag LOCUS_04200 455362 454955 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225512.1 protein_id gnl|my_center|LOCUS_04200 456109 455396 gene locus_tag LOCUS_04210 456109 455396 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225513.1 protein_id gnl|my_center|LOCUS_04210 457773 456532 gene locus_tag LOCUS_04220 457773 456532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 458430 458134 gene locus_tag LOCUS_04230 458430 458134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 458593 458817 gene locus_tag LOCUS_04240 458593 458817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 458843 459052 gene locus_tag LOCUS_04250 458843 459052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 460112 459042 gene locus_tag LOCUS_04260 460112 459042 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972913.1 protein_id gnl|my_center|LOCUS_04260 460555 460631 gene locus_tag LOCUS_t00040 460555 460631 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 461589 461233 gene locus_tag LOCUS_04270 461589 461233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 461757 462011 gene locus_tag LOCUS_04280 461757 462011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 463005 462109 gene locus_tag LOCUS_04290 463005 462109 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228190.1 protein_id gnl|my_center|LOCUS_04290 464464 463262 gene locus_tag LOCUS_04300 464464 463262 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227969.1 protein_id gnl|my_center|LOCUS_04300 464659 465165 gene locus_tag LOCUS_04310 464659 465165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 465155 465490 gene locus_tag LOCUS_04320 465155 465490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 466313 465624 gene locus_tag LOCUS_04330 466313 465624 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 protein_id gnl|my_center|LOCUS_04330 467865 466285 gene locus_tag LOCUS_04340 467865 466285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 469109 467862 gene locus_tag LOCUS_04350 469109 467862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 469636 469106 gene locus_tag LOCUS_04360 gene kdpC 469636 469106 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973321.1 protein_id gnl|my_center|LOCUS_04360 471723 469636 gene locus_tag LOCUS_04370 gene kdpB 471723 469636 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 protein_id gnl|my_center|LOCUS_04370 473488 471800 gene locus_tag LOCUS_04380 gene kdpA 473488 471800 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405318.1 protein_id gnl|my_center|LOCUS_04380 473765 473571 gene locus_tag LOCUS_04390 473765 473571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 473791 474384 gene locus_tag LOCUS_04400 473791 474384 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870827.1 protein_id gnl|my_center|LOCUS_04400 475369 474464 gene locus_tag LOCUS_04410 475369 474464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 475412 476671 gene locus_tag LOCUS_04420 475412 476671 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_04420 476752 477462 gene locus_tag LOCUS_04430 476752 477462 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227511.1 protein_id gnl|my_center|LOCUS_04430 477676 478314 gene locus_tag LOCUS_04440 477676 478314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 481034 478356 gene locus_tag LOCUS_04450 481034 478356 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104583.1 protein_id gnl|my_center|LOCUS_04450 481500 482999 gene locus_tag LOCUS_04460 481500 482999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 482996 484363 gene locus_tag LOCUS_04470 482996 484363 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_04470 485451 484360 gene locus_tag LOCUS_04480 485451 484360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 486789 485527 gene locus_tag LOCUS_04490 486789 485527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 487029 487277 gene locus_tag LOCUS_04500 487029 487277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 487695 488393 gene locus_tag LOCUS_04510 487695 488393 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_04510 488806 488880 gene locus_tag LOCUS_t00050 488806 488880 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 489677 488958 gene locus_tag LOCUS_04520 489677 488958 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078653512.1 protein_id gnl|my_center|LOCUS_04520 489857 490825 gene locus_tag LOCUS_04530 489857 490825 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530928.1 protein_id gnl|my_center|LOCUS_04530 491407 490946 gene locus_tag LOCUS_04540 491407 490946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 492107 491628 gene locus_tag LOCUS_04550 492107 491628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 494054 492402 gene locus_tag LOCUS_04560 494054 492402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 494807 494265 gene locus_tag LOCUS_04570 494807 494265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 496185 494896 gene locus_tag LOCUS_04580 496185 494896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 497001 496270 gene locus_tag LOCUS_04590 497001 496270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 497492 496998 gene locus_tag LOCUS_04600 497492 496998 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975479.1 protein_id gnl|my_center|LOCUS_04600 497762 498124 gene locus_tag LOCUS_04610 497762 498124 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_04610 498121 499401 gene locus_tag LOCUS_04620 498121 499401 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_04620 500464 499451 gene locus_tag LOCUS_04630 gene speB 500464 499451 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_04630 501944 500586 gene locus_tag LOCUS_04640 501944 500586 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929838.1 protein_id gnl|my_center|LOCUS_04640 502019 503020 gene locus_tag LOCUS_04650 502019 503020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 503133 502930 gene locus_tag LOCUS_04660 503133 502930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 503161 503616 gene locus_tag LOCUS_04670 503161 503616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 503673 504038 gene locus_tag LOCUS_04680 503673 504038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975153.1 protein_id gnl|my_center|LOCUS_04680 504145 504882 gene locus_tag LOCUS_04690 504145 504882 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730386.1 protein_id gnl|my_center|LOCUS_04690 505713 504895 gene locus_tag LOCUS_04700 505713 504895 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918580.1 protein_id gnl|my_center|LOCUS_04700 506268 505783 gene locus_tag LOCUS_04710 506268 505783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 506894 506478 gene locus_tag LOCUS_04720 506894 506478 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028624.1 protein_id gnl|my_center|LOCUS_04720 506975 507448 gene locus_tag LOCUS_04730 506975 507448 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229200.1 protein_id gnl|my_center|LOCUS_04730 507987 507478 gene locus_tag LOCUS_04740 507987 507478 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701899.1 protein_id gnl|my_center|LOCUS_04740 508028 508594 gene locus_tag LOCUS_04750 508028 508594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 508667 509218 gene locus_tag LOCUS_04760 508667 509218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 510002 509223 gene locus_tag LOCUS_04770 510002 509223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 510408 510025 gene locus_tag LOCUS_04780 510408 510025 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226104.1 protein_id gnl|my_center|LOCUS_04780 513104 510471 gene locus_tag LOCUS_04790 513104 510471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 514939 513101 gene locus_tag LOCUS_04800 514939 513101 CDS product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027769.1 protein_id gnl|my_center|LOCUS_04800 515135 515656 gene locus_tag LOCUS_04810 515135 515656 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222738.1 protein_id gnl|my_center|LOCUS_04810 517111 515717 gene locus_tag LOCUS_04820 517111 515717 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971441.1 protein_id gnl|my_center|LOCUS_04820 519348 517108 gene locus_tag LOCUS_04830 519348 517108 CDS product terpene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030632.1 protein_id gnl|my_center|LOCUS_04830 520746 519355 gene locus_tag LOCUS_04840 520746 519355 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_04840 521745 520810 gene locus_tag LOCUS_04850 521745 520810 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467730.1 protein_id gnl|my_center|LOCUS_04850 522902 521832 gene locus_tag LOCUS_04860 522902 521832 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512886.1 protein_id gnl|my_center|LOCUS_04860 523188 523985 gene locus_tag LOCUS_04870 523188 523985 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226844.1 protein_id gnl|my_center|LOCUS_04870 524177 525385 gene locus_tag LOCUS_04880 524177 525385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 525382 525705 gene locus_tag LOCUS_04890 525382 525705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 525716 526300 gene locus_tag LOCUS_04900 525716 526300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 526395 526847 gene locus_tag LOCUS_04910 526395 526847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 526913 527869 gene locus_tag LOCUS_04920 526913 527869 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727160.1 protein_id gnl|my_center|LOCUS_04920 528456 527899 gene locus_tag LOCUS_04930 528456 527899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 529750 528548 gene locus_tag LOCUS_04940 529750 528548 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727166.1 protein_id gnl|my_center|LOCUS_04940 530554 529814 gene locus_tag LOCUS_04950 530554 529814 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727165.1 protein_id gnl|my_center|LOCUS_04950 531526 530621 gene locus_tag LOCUS_04960 531526 530621 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898418.1 protein_id gnl|my_center|LOCUS_04960 532443 531532 gene locus_tag LOCUS_04970 532443 531532 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876861.1 protein_id gnl|my_center|LOCUS_04970 534849 532459 gene locus_tag LOCUS_04980 534849 532459 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_04980 535331 534846 gene locus_tag LOCUS_04990 535331 534846 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892165.1 protein_id gnl|my_center|LOCUS_04990 536208 535333 gene locus_tag LOCUS_05000 536208 535333 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_05000 536953 536417 gene locus_tag LOCUS_05010 gene lepB 536953 536417 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804625.1 protein_id gnl|my_center|LOCUS_05010 537027 537785 gene locus_tag LOCUS_05020 537027 537785 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065023.1 protein_id gnl|my_center|LOCUS_05020 537943 539436 gene locus_tag LOCUS_05030 537943 539436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209759.1 protein_id gnl|my_center|LOCUS_05030 540004 540855 gene locus_tag LOCUS_05040 540004 540855 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_05040 540868 542277 gene locus_tag LOCUS_05050 540868 542277 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_05050 542274 543761 gene locus_tag LOCUS_05060 542274 543761 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028557.1 protein_id gnl|my_center|LOCUS_05060 543758 544750 gene locus_tag LOCUS_05070 543758 544750 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074634.1 protein_id gnl|my_center|LOCUS_05070 544779 545756 gene locus_tag LOCUS_05080 gene rbsB 544779 545756 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242760.1 protein_id gnl|my_center|LOCUS_05080 545893 547695 gene locus_tag LOCUS_05090 545893 547695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 548808 547795 gene locus_tag LOCUS_05100 548808 547795 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523896.1 protein_id gnl|my_center|LOCUS_05100 550301 548805 gene locus_tag LOCUS_05110 550301 548805 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224953.1 protein_id gnl|my_center|LOCUS_05110 551347 550301 gene locus_tag LOCUS_05120 551347 550301 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224952.1 protein_id gnl|my_center|LOCUS_05120 552786 551500 gene locus_tag LOCUS_05130 552786 551500 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223728.1 protein_id gnl|my_center|LOCUS_05130 553064 552783 gene locus_tag LOCUS_05140 553064 552783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 556629 553327 gene locus_tag LOCUS_05150 556629 553327 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_05150 558849 556735 gene locus_tag LOCUS_05160 558849 556735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 560288 559617 gene locus_tag LOCUS_05170 560288 559617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 560522 560995 gene locus_tag LOCUS_05180 560522 560995 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973023.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05180 562734 561031 gene locus_tag LOCUS_05190 562734 561031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222074.1 protein_id gnl|my_center|LOCUS_05190 563950 562760 gene locus_tag LOCUS_05200 563950 562760 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029389.1 protein_id gnl|my_center|LOCUS_05200 564217 565122 gene locus_tag LOCUS_05210 564217 565122 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_05210 565199 567001 gene locus_tag LOCUS_05220 565199 567001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 566998 567501 gene locus_tag LOCUS_05230 566998 567501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 567582 568703 gene locus_tag LOCUS_05240 gene galK 567582 568703 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_05240 569501 568731 gene locus_tag LOCUS_05250 569501 568731 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225677.1 protein_id gnl|my_center|LOCUS_05250 570709 569528 gene locus_tag LOCUS_05260 570709 569528 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848418.1 protein_id gnl|my_center|LOCUS_05260 571454 571017 gene locus_tag LOCUS_05270 571454 571017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 571633 571560 gene locus_tag LOCUS_t00060 571633 571560 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 571789 572088 gene locus_tag LOCUS_05280 571789 572088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 572688 572185 gene locus_tag LOCUS_05290 572688 572185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 573991 572885 gene locus_tag LOCUS_05300 573991 572885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 576038 574170 gene locus_tag LOCUS_05310 gene dnaG 576038 574170 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976336.1 protein_id gnl|my_center|LOCUS_05310 576523 577086 gene locus_tag LOCUS_05320 576523 577086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 578393 577137 gene locus_tag LOCUS_05330 578393 577137 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976335.1 protein_id gnl|my_center|LOCUS_05330 579822 578527 gene locus_tag LOCUS_05340 579822 578527 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_05340 580066 580890 gene locus_tag LOCUS_05350 580066 580890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976865.1 protein_id gnl|my_center|LOCUS_05350 582733 580895 gene locus_tag LOCUS_05360 582733 580895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 585531 582895 gene locus_tag LOCUS_05370 gene ppdK 585531 582895 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_05370 585885 587363 gene locus_tag LOCUS_05380 585885 587363 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030099.1 protein_id gnl|my_center|LOCUS_05380 588015 587434 gene locus_tag LOCUS_05390 588015 587434 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 protein_id gnl|my_center|LOCUS_05390 589626 588244 gene locus_tag LOCUS_05400 589626 588244 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_05400 590102 589779 gene locus_tag LOCUS_05410 590102 589779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 590126 590608 gene locus_tag LOCUS_05420 590126 590608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 590718 591104 gene locus_tag LOCUS_05430 590718 591104 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_05430 591362 591910 gene locus_tag LOCUS_05440 591362 591910 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977284.1 protein_id gnl|my_center|LOCUS_05440 592638 591955 gene locus_tag LOCUS_05450 592638 591955 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 protein_id gnl|my_center|LOCUS_05450 593589 592756 gene locus_tag LOCUS_05460 gene recO 593589 592756 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_05460 593856 595430 gene locus_tag LOCUS_05470 593856 595430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 595427 596137 gene locus_tag LOCUS_05480 595427 596137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 596167 597558 gene locus_tag LOCUS_05490 596167 597558 CDS product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 protein_id gnl|my_center|LOCUS_05490 597567 599345 gene locus_tag LOCUS_05500 597567 599345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 599950 599450 gene locus_tag LOCUS_05510 599950 599450 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 protein_id gnl|my_center|LOCUS_05510 601147 600224 gene locus_tag LOCUS_05520 601147 600224 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727817.1 protein_id gnl|my_center|LOCUS_05520 601955 601227 gene locus_tag LOCUS_05530 601955 601227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973615.1 protein_id gnl|my_center|LOCUS_05530 602695 601952 gene locus_tag LOCUS_05540 602695 601952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 602761 603459 gene locus_tag LOCUS_05550 602761 603459 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973613.1 protein_id gnl|my_center|LOCUS_05550 603534 603983 gene locus_tag LOCUS_05560 603534 603983 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977610.1 protein_id gnl|my_center|LOCUS_05560 604092 604928 gene locus_tag LOCUS_05570 604092 604928 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 protein_id gnl|my_center|LOCUS_05570 604925 606178 gene locus_tag LOCUS_05580 gene rocD 604925 606178 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727654.1 protein_id gnl|my_center|LOCUS_05580 >Feature sequence02 868 2 gene locus_tag LOCUS_05590 868 2 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975986.1 protein_id gnl|my_center|LOCUS_05590 2167 1127 gene locus_tag LOCUS_05600 2167 1127 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896541.1 protein_id gnl|my_center|LOCUS_05600 4694 2151 gene locus_tag LOCUS_05610 4694 2151 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730344.1 protein_id gnl|my_center|LOCUS_05610 5054 6394 gene locus_tag LOCUS_05620 5054 6394 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730345.1 protein_id gnl|my_center|LOCUS_05620 6391 7317 gene locus_tag LOCUS_05630 6391 7317 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026993.1 protein_id gnl|my_center|LOCUS_05630 7320 8213 gene locus_tag LOCUS_05640 7320 8213 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896545.1 protein_id gnl|my_center|LOCUS_05640 9374 8349 gene locus_tag LOCUS_05650 9374 8349 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225264.1 protein_id gnl|my_center|LOCUS_05650 9642 10919 gene locus_tag LOCUS_05660 9642 10919 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225265.1 protein_id gnl|my_center|LOCUS_05660 10916 11833 gene locus_tag LOCUS_05670 10916 11833 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225266.1 protein_id gnl|my_center|LOCUS_05670 11830 12636 gene locus_tag LOCUS_05680 11830 12636 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225267.1 protein_id gnl|my_center|LOCUS_05680 12735 14624 gene locus_tag LOCUS_05690 12735 14624 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803839.1 protein_id gnl|my_center|LOCUS_05690 15038 15337 gene locus_tag LOCUS_05700 15038 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 18192 15334 gene locus_tag LOCUS_05710 18192 15334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 18478 19500 gene locus_tag LOCUS_05720 18478 19500 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225264.1 protein_id gnl|my_center|LOCUS_05720 20165 19425 gene locus_tag LOCUS_05730 20165 19425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 20884 20162 gene locus_tag LOCUS_05740 20884 20162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 21021 21914 gene locus_tag LOCUS_05750 21021 21914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 23146 21944 gene locus_tag LOCUS_05760 23146 21944 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977377.1 protein_id gnl|my_center|LOCUS_05760 23247 23876 gene locus_tag LOCUS_05770 23247 23876 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227638.1 protein_id gnl|my_center|LOCUS_05770 24041 24322 gene locus_tag LOCUS_05780 24041 24322 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228661.1 protein_id gnl|my_center|LOCUS_05780 24358 24570 gene locus_tag LOCUS_05790 24358 24570 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730261.1 protein_id gnl|my_center|LOCUS_05790 24567 25511 gene locus_tag LOCUS_05800 24567 25511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225367.1 protein_id gnl|my_center|LOCUS_05800 25538 27787 gene locus_tag LOCUS_05810 25538 27787 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027542.1 protein_id gnl|my_center|LOCUS_05810 27995 28417 gene locus_tag LOCUS_05820 27995 28417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 28554 29309 gene locus_tag LOCUS_05830 28554 29309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 30048 29419 gene locus_tag LOCUS_05840 30048 29419 CDS product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228615.1 protein_id gnl|my_center|LOCUS_05840 30945 30151 gene locus_tag LOCUS_05850 30945 30151 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921445.1 protein_id gnl|my_center|LOCUS_05850 31702 31007 gene locus_tag LOCUS_05860 31702 31007 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969543.1 protein_id gnl|my_center|LOCUS_05860 31835 32785 gene locus_tag LOCUS_05870 31835 32785 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029308.1 protein_id gnl|my_center|LOCUS_05870 33027 33608 gene locus_tag LOCUS_05880 33027 33608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805165.1 protein_id gnl|my_center|LOCUS_05880 33726 33947 gene locus_tag LOCUS_05890 33726 33947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 34109 34588 gene locus_tag LOCUS_05900 34109 34588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 34781 34662 gene locus_tag LOCUS_05910 34781 34662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 35173 34841 gene locus_tag LOCUS_05920 35173 34841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 36569 35418 gene locus_tag LOCUS_05930 36569 35418 CDS product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405501.1 protein_id gnl|my_center|LOCUS_05930 39256 36638 gene locus_tag LOCUS_05940 gene clpB 39256 36638 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869824.1 protein_id gnl|my_center|LOCUS_05940 39558 39238 gene locus_tag LOCUS_05950 39558 39238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 40538 39555 gene locus_tag LOCUS_05960 40538 39555 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_05960 41191 40538 gene locus_tag LOCUS_05970 41191 40538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 43078 41195 gene locus_tag LOCUS_05980 gene dnaK 43078 41195 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144248.1 protein_id gnl|my_center|LOCUS_05980 43486 44592 gene locus_tag LOCUS_05990 43486 44592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 45715 44639 gene locus_tag LOCUS_06000 45715 44639 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227047.1 protein_id gnl|my_center|LOCUS_06000 47124 45733 gene locus_tag LOCUS_06010 47124 45733 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031531.1 protein_id gnl|my_center|LOCUS_06010 48661 47213 gene locus_tag LOCUS_06020 48661 47213 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230065.1 protein_id gnl|my_center|LOCUS_06020 48707 49594 gene locus_tag LOCUS_06030 48707 49594 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257188.1 protein_id gnl|my_center|LOCUS_06030 50414 49653 gene locus_tag LOCUS_06040 50414 49653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 51282 50401 gene locus_tag LOCUS_06050 51282 50401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 51327 52004 gene locus_tag LOCUS_06060 51327 52004 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225212.1 protein_id gnl|my_center|LOCUS_06060 52682 52044 gene locus_tag LOCUS_06070 52682 52044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 54066 52852 gene locus_tag LOCUS_06080 54066 52852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 54732 54127 gene locus_tag LOCUS_06090 54732 54127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 55048 57534 gene locus_tag LOCUS_06100 55048 57534 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029396.1 protein_id gnl|my_center|LOCUS_06100 57531 58424 gene locus_tag LOCUS_06110 57531 58424 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029395.1 protein_id gnl|my_center|LOCUS_06110 58483 58950 gene locus_tag LOCUS_06120 58483 58950 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973682.1 protein_id gnl|my_center|LOCUS_06120 59144 59476 gene locus_tag LOCUS_06130 59144 59476 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978605.1 protein_id gnl|my_center|LOCUS_06130 59629 59955 gene locus_tag LOCUS_06140 59629 59955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 60276 59983 gene locus_tag LOCUS_06150 60276 59983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 66105 60502 gene locus_tag LOCUS_06160 66105 60502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 67257 66301 gene locus_tag LOCUS_06170 67257 66301 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_06170 67358 68353 gene locus_tag LOCUS_06180 67358 68353 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 protein_id gnl|my_center|LOCUS_06180 68583 68831 gene locus_tag LOCUS_06190 68583 68831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 69052 70599 gene locus_tag LOCUS_06200 gene gguA 69052 70599 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976401.1 protein_id gnl|my_center|LOCUS_06200 70596 71894 gene locus_tag LOCUS_06210 gene gguB 70596 71894 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976400.1 protein_id gnl|my_center|LOCUS_06210 71965 73080 gene locus_tag LOCUS_06220 gene chvE 71965 73080 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226248.1 protein_id gnl|my_center|LOCUS_06220 73238 74425 gene locus_tag LOCUS_06230 73238 74425 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224456.1 protein_id gnl|my_center|LOCUS_06230 74532 74867 gene locus_tag LOCUS_06240 74532 74867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 75040 75498 gene locus_tag LOCUS_06250 75040 75498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 76756 75536 gene locus_tag LOCUS_06260 76756 75536 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_06260 77445 76753 gene locus_tag LOCUS_06270 77445 76753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 protein_id gnl|my_center|LOCUS_06270 78521 77442 gene locus_tag LOCUS_06280 78521 77442 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306837.1 protein_id gnl|my_center|LOCUS_06280 79048 78518 gene locus_tag LOCUS_06290 79048 78518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230193.1 protein_id gnl|my_center|LOCUS_06290 79784 79251 gene locus_tag LOCUS_06300 79784 79251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230193.1 protein_id gnl|my_center|LOCUS_06300 79909 80559 gene locus_tag LOCUS_06310 79909 80559 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230194.1 protein_id gnl|my_center|LOCUS_06310 80556 81782 gene locus_tag LOCUS_06320 80556 81782 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 protein_id gnl|my_center|LOCUS_06320 82317 82099 gene locus_tag LOCUS_06330 82317 82099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 83255 82440 gene locus_tag LOCUS_06340 83255 82440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 83926 83261 gene locus_tag LOCUS_06350 83926 83261 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225195.1 protein_id gnl|my_center|LOCUS_06350 84080 84715 gene locus_tag LOCUS_06360 84080 84715 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242591.1 protein_id gnl|my_center|LOCUS_06360 84782 85336 gene locus_tag LOCUS_06370 84782 85336 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153437081.1 protein_id gnl|my_center|LOCUS_06370 85390 85902 gene locus_tag LOCUS_06380 85390 85902 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186534941.1 protein_id gnl|my_center|LOCUS_06380 87916 86018 gene locus_tag LOCUS_06390 87916 86018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 88086 89075 gene locus_tag LOCUS_06400 88086 89075 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223629.1 protein_id gnl|my_center|LOCUS_06400 90133 89117 gene locus_tag LOCUS_06410 90133 89117 CDS product DUF3616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141362.1 protein_id gnl|my_center|LOCUS_06410 90233 91150 gene locus_tag LOCUS_06420 90233 91150 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_06420 91147 92163 gene locus_tag LOCUS_06430 91147 92163 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487139.1 protein_id gnl|my_center|LOCUS_06430 93092 92340 gene locus_tag LOCUS_06440 93092 92340 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976327.1 protein_id gnl|my_center|LOCUS_06440 93849 93235 gene locus_tag LOCUS_06450 93849 93235 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978722.1 protein_id gnl|my_center|LOCUS_06450 94121 95080 gene locus_tag LOCUS_06460 94121 95080 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_06460 95488 95156 gene locus_tag LOCUS_06470 95488 95156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 96331 95657 gene locus_tag LOCUS_06480 96331 95657 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179719124.1 protein_id gnl|my_center|LOCUS_06480 96417 97175 gene locus_tag LOCUS_06490 96417 97175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 98462 97215 gene locus_tag LOCUS_06500 98462 97215 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027428.1 protein_id gnl|my_center|LOCUS_06500 98585 99541 gene locus_tag LOCUS_06510 98585 99541 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971541.1 protein_id gnl|my_center|LOCUS_06510 99797 100036 gene locus_tag LOCUS_06520 99797 100036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 100002 100430 gene locus_tag LOCUS_06530 100002 100430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 100504 101046 gene locus_tag LOCUS_06540 100504 101046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 101931 101122 gene locus_tag LOCUS_06550 101931 101122 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_06550 103108 102050 gene locus_tag LOCUS_06560 103108 102050 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107451924.1 protein_id gnl|my_center|LOCUS_06560 103164 106496 gene locus_tag LOCUS_06570 103164 106496 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224805.1 protein_id gnl|my_center|LOCUS_06570 106675 107196 gene locus_tag LOCUS_06580 106675 107196 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224856.1 protein_id gnl|my_center|LOCUS_06580 107193 107675 gene locus_tag LOCUS_06590 107193 107675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 108372 107731 gene locus_tag LOCUS_06600 gene yqaB 108372 107731 CDS product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273283.1 protein_id gnl|my_center|LOCUS_06600 109236 108526 gene locus_tag LOCUS_06610 109236 108526 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729362.1 protein_id gnl|my_center|LOCUS_06610 109320 109517 gene locus_tag LOCUS_06620 109320 109517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 109814 112726 gene locus_tag LOCUS_06630 109814 112726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 114341 112893 gene locus_tag LOCUS_06640 gene argG 114341 112893 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972108.1 protein_id gnl|my_center|LOCUS_06640 114865 114632 gene locus_tag LOCUS_06650 114865 114632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 115208 115864 gene locus_tag LOCUS_06660 115208 115864 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06660 116225 118360 gene locus_tag LOCUS_06670 gene kdpB 116225 118360 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730505.1 protein_id gnl|my_center|LOCUS_06670 118363 119235 gene locus_tag LOCUS_06680 118363 119235 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730506.1 protein_id gnl|my_center|LOCUS_06680 119238 120890 gene locus_tag LOCUS_06690 gene kdpA 119238 120890 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029188.1 protein_id gnl|my_center|LOCUS_06690 121599 120967 gene locus_tag LOCUS_06700 121599 120967 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028311.1 protein_id gnl|my_center|LOCUS_06700 121691 122857 gene locus_tag LOCUS_06710 121691 122857 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088644318.1 protein_id gnl|my_center|LOCUS_06710 123084 124919 gene locus_tag LOCUS_06720 123084 124919 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_06720 124948 126231 gene locus_tag LOCUS_06730 124948 126231 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230529.1 protein_id gnl|my_center|LOCUS_06730 126234 127967 gene locus_tag LOCUS_06740 126234 127967 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971902.1 protein_id gnl|my_center|LOCUS_06740 128026 128961 gene locus_tag LOCUS_06750 128026 128961 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230532.1 protein_id gnl|my_center|LOCUS_06750 128958 130247 gene locus_tag LOCUS_06760 128958 130247 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385218.1 protein_id gnl|my_center|LOCUS_06760 130226 131194 gene locus_tag LOCUS_06770 130226 131194 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385217.1 protein_id gnl|my_center|LOCUS_06770 131191 132021 gene locus_tag LOCUS_06780 131191 132021 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 protein_id gnl|my_center|LOCUS_06780 132076 132975 gene locus_tag LOCUS_06790 132076 132975 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_06790 133246 134664 gene locus_tag LOCUS_06800 133246 134664 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031772.1 protein_id gnl|my_center|LOCUS_06800 135082 134714 gene locus_tag LOCUS_06810 135082 134714 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 protein_id gnl|my_center|LOCUS_06810 135097 135333 gene locus_tag LOCUS_06820 135097 135333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 135999 135451 gene locus_tag LOCUS_06830 135999 135451 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031866.1 protein_id gnl|my_center|LOCUS_06830 136657 136070 gene locus_tag LOCUS_06840 136657 136070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 137081 136716 gene locus_tag LOCUS_06850 137081 136716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 137264 137929 gene locus_tag LOCUS_06860 137264 137929 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_06860 137904 139997 gene locus_tag LOCUS_06870 137904 139997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 140292 140005 gene locus_tag LOCUS_06880 140292 140005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223725.1 protein_id gnl|my_center|LOCUS_06880 140299 141084 gene locus_tag LOCUS_06890 140299 141084 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223724.1 protein_id gnl|my_center|LOCUS_06890 141381 146888 gene locus_tag LOCUS_06900 141381 146888 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226015.1 protein_id gnl|my_center|LOCUS_06900 147791 146931 gene locus_tag LOCUS_06910 147791 146931 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229415.1 protein_id gnl|my_center|LOCUS_06910 147969 149702 gene locus_tag LOCUS_06920 147969 149702 CDS product MOSC and FAD-binding oxidoreductase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225744.1 protein_id gnl|my_center|LOCUS_06920 150189 149758 gene locus_tag LOCUS_06930 150189 149758 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971972.1 protein_id gnl|my_center|LOCUS_06930 150476 151339 gene locus_tag LOCUS_06940 150476 151339 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530494.1 protein_id gnl|my_center|LOCUS_06940 151438 152154 gene locus_tag LOCUS_06950 151438 152154 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229414.1 protein_id gnl|my_center|LOCUS_06950 152705 152229 gene locus_tag LOCUS_06960 152705 152229 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970935.1 protein_id gnl|my_center|LOCUS_06960 152805 153542 gene locus_tag LOCUS_06970 152805 153542 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978487.1 protein_id gnl|my_center|LOCUS_06970 153993 153628 gene locus_tag LOCUS_06980 153993 153628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 154349 153921 gene locus_tag LOCUS_06990 154349 153921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06990 155549 154593 gene locus_tag LOCUS_07000 155549 154593 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053126304.1 protein_id gnl|my_center|LOCUS_07000 157384 155549 gene locus_tag LOCUS_07010 157384 155549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 157691 157461 gene locus_tag LOCUS_07020 157691 157461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 158253 157816 gene locus_tag LOCUS_07030 158253 157816 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727828.1 protein_id gnl|my_center|LOCUS_07030 159058 158303 gene locus_tag LOCUS_07040 159058 158303 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031436.1 protein_id gnl|my_center|LOCUS_07040 160681 159461 gene locus_tag LOCUS_07050 160681 159461 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326457.1 protein_id gnl|my_center|LOCUS_07050 161062 161889 gene locus_tag LOCUS_07060 161062 161889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 161931 162584 gene locus_tag LOCUS_07070 161931 162584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 162750 163598 gene locus_tag LOCUS_07080 162750 163598 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029139.1 protein_id gnl|my_center|LOCUS_07080 163612 164799 gene locus_tag LOCUS_07090 gene kynU 163612 164799 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029138.1 protein_id gnl|my_center|LOCUS_07090 164844 165734 gene locus_tag LOCUS_07100 164844 165734 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975294.1 protein_id gnl|my_center|LOCUS_07100 166306 165785 gene locus_tag LOCUS_07110 166306 165785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 166396 167088 gene locus_tag LOCUS_07120 166396 167088 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 protein_id gnl|my_center|LOCUS_07120 167222 167395 gene locus_tag LOCUS_07130 167222 167395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 167513 168649 gene locus_tag LOCUS_07140 167513 168649 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976857.1 protein_id gnl|my_center|LOCUS_07140 169584 168646 gene locus_tag LOCUS_07150 169584 168646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 170092 169577 gene locus_tag LOCUS_07160 170092 169577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 170220 170687 gene locus_tag LOCUS_07170 170220 170687 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115912.1 protein_id gnl|my_center|LOCUS_07170 171477 170755 gene locus_tag LOCUS_07180 171477 170755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 172457 171474 gene locus_tag LOCUS_07190 172457 171474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_07190 173909 172677 gene locus_tag LOCUS_07200 173909 172677 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228768.1 protein_id gnl|my_center|LOCUS_07200 174229 173906 gene locus_tag LOCUS_07210 174229 173906 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228769.1 protein_id gnl|my_center|LOCUS_07210 174837 174436 gene locus_tag LOCUS_07220 174837 174436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 175066 174932 gene locus_tag LOCUS_07230 175066 174932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 175733 175071 gene locus_tag LOCUS_07240 175733 175071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 175868 176209 gene locus_tag LOCUS_07250 175868 176209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 176560 176348 gene locus_tag LOCUS_07260 176560 176348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 176469 176885 gene locus_tag LOCUS_07270 176469 176885 CDS product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111041.1 protein_id gnl|my_center|LOCUS_07270 177027 177836 gene locus_tag LOCUS_07280 177027 177836 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230091.1 protein_id gnl|my_center|LOCUS_07280 178283 177864 gene locus_tag LOCUS_07290 178283 177864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 180655 178280 gene locus_tag LOCUS_07300 180655 178280 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230093.1 protein_id gnl|my_center|LOCUS_07300 182325 180667 gene locus_tag LOCUS_07310 182325 180667 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225218.1 protein_id gnl|my_center|LOCUS_07310 183263 182337 gene locus_tag LOCUS_07320 gene tesB 183263 182337 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067256.1 protein_id gnl|my_center|LOCUS_07320 183700 183260 gene locus_tag LOCUS_07330 183700 183260 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061809.1 protein_id gnl|my_center|LOCUS_07330 184257 183757 gene locus_tag LOCUS_07340 184257 183757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07340 184357 184665 gene locus_tag LOCUS_07350 184357 184665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 184711 185130 gene locus_tag LOCUS_07360 184711 185130 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230092.1 protein_id gnl|my_center|LOCUS_07360 186333 185482 gene locus_tag LOCUS_07370 186333 185482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 186799 186473 gene locus_tag LOCUS_07380 186799 186473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 187842 186799 gene locus_tag LOCUS_07390 187842 186799 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256300.1 protein_id gnl|my_center|LOCUS_07390 188070 190052 gene locus_tag LOCUS_07400 188070 190052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 190003 190269 gene locus_tag LOCUS_07410 190003 190269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 191074 190448 gene locus_tag LOCUS_07420 191074 190448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 191209 191823 gene locus_tag LOCUS_07430 191209 191823 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111807.1 protein_id gnl|my_center|LOCUS_07430 192884 192057 gene locus_tag LOCUS_07440 192884 192057 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731010.1 protein_id gnl|my_center|LOCUS_07440 193939 192881 gene locus_tag LOCUS_07450 193939 192881 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897464.1 protein_id gnl|my_center|LOCUS_07450 194997 193957 gene locus_tag LOCUS_07460 194997 193957 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731011.1 protein_id gnl|my_center|LOCUS_07460 196134 195346 gene locus_tag LOCUS_07470 196134 195346 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_07470 196846 196271 gene locus_tag LOCUS_07480 196846 196271 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223840.1 protein_id gnl|my_center|LOCUS_07480 196978 197106 gene locus_tag LOCUS_07490 196978 197106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 197103 198203 gene locus_tag LOCUS_07500 197103 198203 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223454.1 protein_id gnl|my_center|LOCUS_07500 199081 198251 gene locus_tag LOCUS_07510 199081 198251 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532089.1 protein_id gnl|my_center|LOCUS_07510 199319 200296 gene locus_tag LOCUS_07520 199319 200296 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974078.1 protein_id gnl|my_center|LOCUS_07520 200569 200210 gene locus_tag LOCUS_07530 200569 200210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 202156 200897 gene locus_tag LOCUS_07540 202156 200897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 202616 202287 gene locus_tag LOCUS_07550 202616 202287 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887019.1 protein_id gnl|my_center|LOCUS_07550 204337 202721 gene locus_tag LOCUS_07560 204337 202721 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226313.1 protein_id gnl|my_center|LOCUS_07560 205485 204361 gene locus_tag LOCUS_07570 gene menC 205485 204361 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_07570 206252 205485 gene locus_tag LOCUS_07580 206252 205485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 protein_id gnl|my_center|LOCUS_07580 207355 206249 gene locus_tag LOCUS_07590 207355 206249 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225315.1 protein_id gnl|my_center|LOCUS_07590 208743 207358 gene locus_tag LOCUS_07600 208743 207358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 209483 208740 gene locus_tag LOCUS_07610 209483 208740 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225323.1 protein_id gnl|my_center|LOCUS_07610 211312 209480 gene locus_tag LOCUS_07620 211312 209480 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225322.1 protein_id gnl|my_center|LOCUS_07620 212276 211314 gene locus_tag LOCUS_07630 212276 211314 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225321.1 protein_id gnl|my_center|LOCUS_07630 213874 212279 gene locus_tag LOCUS_07640 213874 212279 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225320.1 protein_id gnl|my_center|LOCUS_07640 214963 214004 gene locus_tag LOCUS_07650 214963 214004 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533002.1 protein_id gnl|my_center|LOCUS_07650 215849 214983 gene locus_tag LOCUS_07660 215849 214983 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229860.1 protein_id gnl|my_center|LOCUS_07660 215967 216581 gene locus_tag LOCUS_07670 215967 216581 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029378.1 protein_id gnl|my_center|LOCUS_07670 217102 217437 gene locus_tag LOCUS_07680 217102 217437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897725.1 protein_id gnl|my_center|LOCUS_07680 218246 218389 gene locus_tag LOCUS_07690 218246 218389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 219038 218427 gene locus_tag LOCUS_07700 219038 218427 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224147.1 protein_id gnl|my_center|LOCUS_07700 219092 220264 gene locus_tag LOCUS_07710 219092 220264 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304720.1 protein_id gnl|my_center|LOCUS_07710 220346 220945 gene locus_tag LOCUS_07720 220346 220945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 221370 220960 gene locus_tag LOCUS_07730 221370 220960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 221956 223368 gene locus_tag LOCUS_07740 221956 223368 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976914.1 protein_id gnl|my_center|LOCUS_07740 226092 223534 gene locus_tag LOCUS_07750 226092 223534 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_07750 226616 227911 gene locus_tag LOCUS_07760 226616 227911 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226539.1 protein_id gnl|my_center|LOCUS_07760 229156 227978 gene locus_tag LOCUS_07770 229156 227978 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726945.1 protein_id gnl|my_center|LOCUS_07770 229311 229156 gene locus_tag LOCUS_07780 229311 229156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 230818 229460 gene locus_tag LOCUS_07790 230818 229460 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_07790 231652 230951 gene locus_tag LOCUS_07800 231652 230951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 232907 231843 gene locus_tag LOCUS_07810 232907 231843 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974461.1 protein_id gnl|my_center|LOCUS_07810 234030 232912 gene locus_tag LOCUS_07820 234030 232912 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974460.1 protein_id gnl|my_center|LOCUS_07820 235442 234030 gene locus_tag LOCUS_07830 235442 234030 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728948.1 protein_id gnl|my_center|LOCUS_07830 236979 235564 gene locus_tag LOCUS_07840 236979 235564 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970549.1 protein_id gnl|my_center|LOCUS_07840 237245 237547 gene locus_tag LOCUS_07850 237245 237547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 237484 237711 gene locus_tag LOCUS_07860 237484 237711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 238771 237725 gene locus_tag LOCUS_07870 238771 237725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486834.1 protein_id gnl|my_center|LOCUS_07870 240789 238783 gene locus_tag LOCUS_07880 240789 238783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 241062 240880 gene locus_tag LOCUS_07890 241062 240880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 242717 241176 gene locus_tag LOCUS_07900 gene paaP 242717 241176 CDS product aminopeptidase PaaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101464.1 protein_id gnl|my_center|LOCUS_07900 242617 242940 gene locus_tag LOCUS_07910 242617 242940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 244488 242983 gene locus_tag LOCUS_07920 244488 242983 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969731.1 protein_id gnl|my_center|LOCUS_07920 244970 244509 gene locus_tag LOCUS_07930 244970 244509 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529606.1 protein_id gnl|my_center|LOCUS_07930 246008 244971 gene locus_tag LOCUS_07940 246008 244971 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529607.1 protein_id gnl|my_center|LOCUS_07940 246184 246867 gene locus_tag LOCUS_07950 246184 246867 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973245.1 protein_id gnl|my_center|LOCUS_07950 246874 248364 gene locus_tag LOCUS_07960 246874 248364 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_07960 249369 248410 gene locus_tag LOCUS_07970 249369 248410 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_07970 251505 249451 gene locus_tag LOCUS_07980 251505 249451 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027426.1 protein_id gnl|my_center|LOCUS_07980 251573 252442 gene locus_tag LOCUS_07990 251573 252442 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027427.1 protein_id gnl|my_center|LOCUS_07990 252482 252982 gene locus_tag LOCUS_08000 252482 252982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 253449 253288 gene locus_tag LOCUS_08010 253449 253288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 253403 254680 gene locus_tag LOCUS_08020 253403 254680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 255541 254732 gene locus_tag LOCUS_08030 255541 254732 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083971.1 protein_id gnl|my_center|LOCUS_08030 256377 255538 gene locus_tag LOCUS_08040 256377 255538 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225865.1 protein_id gnl|my_center|LOCUS_08040 257238 256414 gene locus_tag LOCUS_08050 257238 256414 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037318.1 protein_id gnl|my_center|LOCUS_08050 260086 257342 gene locus_tag LOCUS_08060 260086 257342 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234708047.1 protein_id gnl|my_center|LOCUS_08060 260203 261084 gene locus_tag LOCUS_08070 260203 261084 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972011.1 protein_id gnl|my_center|LOCUS_08070 262408 261437 gene locus_tag LOCUS_08080 262408 261437 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742245.1 protein_id gnl|my_center|LOCUS_08080 262663 263457 gene locus_tag LOCUS_08090 262663 263457 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485495.1 protein_id gnl|my_center|LOCUS_08090 263895 266204 gene locus_tag LOCUS_08100 263895 266204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 267258 266281 gene locus_tag LOCUS_08110 267258 266281 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009927050.1 protein_id gnl|my_center|LOCUS_08110 267512 267868 gene locus_tag LOCUS_08120 267512 267868 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_08120 267975 268580 gene locus_tag LOCUS_08130 267975 268580 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949009.1 protein_id gnl|my_center|LOCUS_08130 271406 268659 gene locus_tag LOCUS_08140 271406 268659 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223297.1 protein_id gnl|my_center|LOCUS_08140 272766 271411 gene locus_tag LOCUS_08150 272766 271411 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223296.1 protein_id gnl|my_center|LOCUS_08150 273734 272766 gene locus_tag LOCUS_08160 273734 272766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223295.1 protein_id gnl|my_center|LOCUS_08160 274155 274757 gene locus_tag LOCUS_08170 274155 274757 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110057.1 protein_id gnl|my_center|LOCUS_08170 275171 274827 gene locus_tag LOCUS_08180 275171 274827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 275325 275756 gene locus_tag LOCUS_08190 275325 275756 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_08190 277054 275828 gene locus_tag LOCUS_08200 277054 275828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 280850 277371 gene locus_tag LOCUS_08210 280850 277371 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228485.1 protein_id gnl|my_center|LOCUS_08210 281474 281097 gene locus_tag LOCUS_08220 281474 281097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 282094 281591 gene locus_tag LOCUS_08230 282094 281591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 283216 282167 gene locus_tag LOCUS_08240 283216 282167 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755440.1 protein_id gnl|my_center|LOCUS_08240 283146 283430 gene locus_tag LOCUS_08250 283146 283430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 283750 284298 gene locus_tag LOCUS_08260 283750 284298 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104389.1 protein_id gnl|my_center|LOCUS_08260 284333 286507 gene locus_tag LOCUS_08270 284333 286507 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019547503.1 protein_id gnl|my_center|LOCUS_08270 287176 286604 gene locus_tag LOCUS_08280 287176 286604 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228370.1 protein_id gnl|my_center|LOCUS_08280 287978 287358 gene locus_tag LOCUS_08290 287978 287358 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973613.1 protein_id gnl|my_center|LOCUS_08290 288100 289551 gene locus_tag LOCUS_08300 288100 289551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 289619 290770 gene locus_tag LOCUS_08310 289619 290770 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226955.1 protein_id gnl|my_center|LOCUS_08310 291439 290912 gene locus_tag LOCUS_08320 291439 290912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 292393 292481 gene locus_tag LOCUS_t00070 292393 292481 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 292690 292508 gene locus_tag LOCUS_08330 292690 292508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 292754 293239 gene locus_tag LOCUS_08340 292754 293239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 293494 294189 gene locus_tag LOCUS_08350 293494 294189 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729087.1 protein_id gnl|my_center|LOCUS_08350 294245 295123 gene locus_tag LOCUS_08360 294245 295123 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029194.1 protein_id gnl|my_center|LOCUS_08360 295120 296064 gene locus_tag LOCUS_08370 295120 296064 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032541.1 protein_id gnl|my_center|LOCUS_08370 296061 297275 gene locus_tag LOCUS_08380 296061 297275 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026800.1 protein_id gnl|my_center|LOCUS_08380 297279 297770 gene locus_tag LOCUS_08390 297279 297770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026801.1 protein_id gnl|my_center|LOCUS_08390 297767 298690 gene locus_tag LOCUS_08400 297767 298690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026802.1 protein_id gnl|my_center|LOCUS_08400 300361 298706 gene locus_tag LOCUS_08410 300361 298706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729789.1 protein_id gnl|my_center|LOCUS_08410 301212 300358 gene locus_tag LOCUS_08420 301212 300358 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537723.1 protein_id gnl|my_center|LOCUS_08420 302189 301209 gene locus_tag LOCUS_08430 302189 301209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384277.1 protein_id gnl|my_center|LOCUS_08430 303823 302186 gene locus_tag LOCUS_08440 303823 302186 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495702.1 protein_id gnl|my_center|LOCUS_08440 304418 303912 gene locus_tag LOCUS_08450 304418 303912 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977747.1 protein_id gnl|my_center|LOCUS_08450 306226 304829 gene locus_tag LOCUS_08460 306226 304829 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130606586.1 protein_id gnl|my_center|LOCUS_08460 306476 307696 gene locus_tag LOCUS_08470 306476 307696 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107493.1 protein_id gnl|my_center|LOCUS_08470 307705 308862 gene locus_tag LOCUS_08480 307705 308862 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728503.1 protein_id gnl|my_center|LOCUS_08480 308877 310058 gene locus_tag LOCUS_08490 308877 310058 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729543.1 protein_id gnl|my_center|LOCUS_08490 310808 310275 gene locus_tag LOCUS_08500 310808 310275 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326320.1 protein_id gnl|my_center|LOCUS_08500 310920 311222 gene locus_tag LOCUS_08510 310920 311222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 311263 312288 gene locus_tag LOCUS_08520 311263 312288 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766899.1 protein_id gnl|my_center|LOCUS_08520 312396 313163 gene locus_tag LOCUS_08530 312396 313163 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226695.1 protein_id gnl|my_center|LOCUS_08530 313157 313885 gene locus_tag LOCUS_08540 313157 313885 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466913.1 protein_id gnl|my_center|LOCUS_08540 314167 314724 gene locus_tag LOCUS_08550 314167 314724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 314881 315690 gene locus_tag LOCUS_08560 314881 315690 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_08560 315675 317549 gene locus_tag LOCUS_08570 315675 317549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 317644 318456 gene locus_tag LOCUS_08580 317644 318456 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977932.1 protein_id gnl|my_center|LOCUS_08580 319229 318453 gene locus_tag LOCUS_08590 319229 318453 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086767.1 protein_id gnl|my_center|LOCUS_08590 319317 319535 gene locus_tag LOCUS_08600 319317 319535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 319532 320341 gene locus_tag LOCUS_08610 319532 320341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 322693 320372 gene locus_tag LOCUS_08620 322693 320372 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_08620 322991 322836 gene locus_tag LOCUS_08630 322991 322836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 323730 323338 gene locus_tag LOCUS_08640 323730 323338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 323919 326291 gene locus_tag LOCUS_08650 323919 326291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 327304 326303 gene locus_tag LOCUS_08660 327304 326303 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224028.1 protein_id gnl|my_center|LOCUS_08660 328223 327384 gene locus_tag LOCUS_08670 328223 327384 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226695.1 protein_id gnl|my_center|LOCUS_08670 328328 329230 gene locus_tag LOCUS_08680 328328 329230 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226696.1 protein_id gnl|my_center|LOCUS_08680 329368 329832 gene locus_tag LOCUS_08690 329368 329832 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112995.1 protein_id gnl|my_center|LOCUS_08690 330017 329739 gene locus_tag LOCUS_08700 330017 329739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 331052 330204 gene locus_tag LOCUS_08710 331052 330204 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727008.1 protein_id gnl|my_center|LOCUS_08710 331195 332724 gene locus_tag LOCUS_08720 331195 332724 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029563.1 protein_id gnl|my_center|LOCUS_08720 334093 332774 gene locus_tag LOCUS_08730 334093 332774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 335623 334508 gene locus_tag LOCUS_08740 335623 334508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 335643 336083 gene locus_tag LOCUS_08750 335643 336083 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876564.1 protein_id gnl|my_center|LOCUS_08750 336322 336972 gene locus_tag LOCUS_08760 336322 336972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 337078 338256 gene locus_tag LOCUS_08770 337078 338256 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031767.1 protein_id gnl|my_center|LOCUS_08770 338735 341605 gene locus_tag LOCUS_08780 338735 341605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 342698 341739 gene locus_tag LOCUS_08790 342698 341739 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087852.1 protein_id gnl|my_center|LOCUS_08790 342821 343720 gene locus_tag LOCUS_08800 342821 343720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 344677 343769 gene locus_tag LOCUS_08810 344677 343769 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230013.1 protein_id gnl|my_center|LOCUS_08810 345553 344939 gene locus_tag LOCUS_08820 345553 344939 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003133652.1 protein_id gnl|my_center|LOCUS_08820 345903 346682 gene locus_tag LOCUS_08830 345903 346682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 346628 346867 gene locus_tag LOCUS_08840 346628 346867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 347124 349487 gene locus_tag LOCUS_08850 347124 349487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 349941 350819 gene locus_tag LOCUS_08860 349941 350819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 351093 354635 gene locus_tag LOCUS_08870 gene dnaE 351093 354635 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486830.1 protein_id gnl|my_center|LOCUS_08870 354906 354652 gene locus_tag LOCUS_08880 354906 354652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 355059 355454 gene locus_tag LOCUS_08890 355059 355454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 355477 355806 gene locus_tag LOCUS_08900 355477 355806 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429484.1 protein_id gnl|my_center|LOCUS_08900 355809 356201 gene locus_tag LOCUS_08910 355809 356201 CDS product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379381.1 protein_id gnl|my_center|LOCUS_08910 356221 357072 gene locus_tag LOCUS_08920 356221 357072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017474.1 protein_id gnl|my_center|LOCUS_08920 357082 357843 gene locus_tag LOCUS_08930 gene lieB 357082 357843 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_08930 357951 358346 gene locus_tag LOCUS_08940 357951 358346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 358355 358606 gene locus_tag LOCUS_08950 358355 358606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 359046 358627 gene locus_tag LOCUS_08960 359046 358627 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973252.1 protein_id gnl|my_center|LOCUS_08960 359170 360150 gene locus_tag LOCUS_08970 359170 360150 CDS product DUF4232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485280.1 protein_id gnl|my_center|LOCUS_08970 360253 361197 gene locus_tag LOCUS_08980 360253 361197 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 protein_id gnl|my_center|LOCUS_08980 364327 361274 gene locus_tag LOCUS_08990 364327 361274 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230443.1 protein_id gnl|my_center|LOCUS_08990 364399 364545 gene locus_tag LOCUS_09000 364399 364545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 365011 364580 gene locus_tag LOCUS_09010 365011 364580 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973901.1 protein_id gnl|my_center|LOCUS_09010 365475 365086 gene locus_tag LOCUS_09020 365475 365086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 365549 365788 gene locus_tag LOCUS_09030 365549 365788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 366305 365823 gene locus_tag LOCUS_09040 366305 365823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 367570 366410 gene locus_tag LOCUS_09050 367570 366410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 368289 368444 gene locus_tag LOCUS_09060 368289 368444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 369283 368882 gene locus_tag LOCUS_09070 369283 368882 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227633.1 protein_id gnl|my_center|LOCUS_09070 369502 371337 gene locus_tag LOCUS_09080 369502 371337 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030938.1 protein_id gnl|my_center|LOCUS_09080 372461 371469 gene locus_tag LOCUS_09090 372461 371469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 373234 372569 gene locus_tag LOCUS_09100 373234 372569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 373398 373574 gene locus_tag LOCUS_09110 373398 373574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 374106 374438 gene locus_tag LOCUS_09120 374106 374438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 374431 375429 gene locus_tag LOCUS_09130 374431 375429 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_09130 376100 375465 gene locus_tag LOCUS_09140 376100 375465 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 protein_id gnl|my_center|LOCUS_09140 376768 376097 gene locus_tag LOCUS_09150 376768 376097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 376951 377313 gene locus_tag LOCUS_09160 376951 377313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 377310 378257 gene locus_tag LOCUS_09170 377310 378257 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409298.1 protein_id gnl|my_center|LOCUS_09170 378877 378263 gene locus_tag LOCUS_09180 378877 378263 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284846.1 protein_id gnl|my_center|LOCUS_09180 379097 380074 gene locus_tag LOCUS_09190 379097 380074 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222043.1 protein_id gnl|my_center|LOCUS_09190 381751 380249 gene locus_tag LOCUS_09200 381751 380249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919016.1 protein_id gnl|my_center|LOCUS_09200 383157 381910 gene locus_tag LOCUS_09210 383157 381910 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132388.1 protein_id gnl|my_center|LOCUS_09210 384239 383154 gene locus_tag LOCUS_09220 384239 383154 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088561.1 protein_id gnl|my_center|LOCUS_09220 384566 384973 gene locus_tag LOCUS_09230 384566 384973 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172803.1 protein_id gnl|my_center|LOCUS_09230 385072 385284 gene locus_tag LOCUS_09240 385072 385284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 385314 386183 gene locus_tag LOCUS_09250 385314 386183 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_09250 386249 387175 gene locus_tag LOCUS_09260 386249 387175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 387202 387849 gene locus_tag LOCUS_09270 387202 387849 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808094.1 protein_id gnl|my_center|LOCUS_09270 387846 388646 gene locus_tag LOCUS_09280 387846 388646 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808095.1 protein_id gnl|my_center|LOCUS_09280 389608 388724 gene locus_tag LOCUS_09290 389608 388724 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978631.1 protein_id gnl|my_center|LOCUS_09290 389768 390529 gene locus_tag LOCUS_09300 389768 390529 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978630.1 protein_id gnl|my_center|LOCUS_09300 390584 391363 gene locus_tag LOCUS_09310 390584 391363 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226940.1 protein_id gnl|my_center|LOCUS_09310 392550 391681 gene locus_tag LOCUS_09320 392550 391681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 393272 392661 gene locus_tag LOCUS_09330 393272 392661 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027066.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence03 <1 644 gene locus_tag LOCUS_09340 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225685.1:HNH endonuclease signature motif containing protein 2549 771 gene locus_tag LOCUS_09350 2549 771 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226513.1 protein_id gnl|my_center|LOCUS_09350 3303 2638 gene locus_tag LOCUS_09360 3303 2638 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226512.1 protein_id gnl|my_center|LOCUS_09360 3499 4452 gene locus_tag LOCUS_09370 3499 4452 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_09370 4677 5552 gene locus_tag LOCUS_09380 4677 5552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727461.1 protein_id gnl|my_center|LOCUS_09380 5549 6385 gene locus_tag LOCUS_09390 gene tauC 5549 6385 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095795.1 protein_id gnl|my_center|LOCUS_09390 6487 7578 gene locus_tag LOCUS_09400 6487 7578 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223440.1 protein_id gnl|my_center|LOCUS_09400 7581 8765 gene locus_tag LOCUS_09410 7581 8765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459457.1 protein_id gnl|my_center|LOCUS_09410 9382 8927 gene locus_tag LOCUS_09420 9382 8927 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224858.1 protein_id gnl|my_center|LOCUS_09420 11643 9394 gene locus_tag LOCUS_09430 11643 9394 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224857.1 protein_id gnl|my_center|LOCUS_09430 12700 11774 gene locus_tag LOCUS_09440 12700 11774 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_09440 12927 13148 gene locus_tag LOCUS_09450 12927 13148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 13145 13399 gene locus_tag LOCUS_09460 13145 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 15131 13488 gene locus_tag LOCUS_09470 15131 13488 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229262.1 protein_id gnl|my_center|LOCUS_09470 15744 15244 gene locus_tag LOCUS_09480 15744 15244 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229261.1 protein_id gnl|my_center|LOCUS_09480 16820 15741 gene locus_tag LOCUS_09490 16820 15741 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229260.1 protein_id gnl|my_center|LOCUS_09490 18045 16885 gene locus_tag LOCUS_09500 18045 16885 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_09500 18673 18056 gene locus_tag LOCUS_09510 18673 18056 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064806.1 protein_id gnl|my_center|LOCUS_09510 19462 18689 gene locus_tag LOCUS_09520 19462 18689 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_09520 19561 20412 gene locus_tag LOCUS_09530 19561 20412 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 protein_id gnl|my_center|LOCUS_09530 20402 21529 gene locus_tag LOCUS_09540 20402 21529 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_09540 21533 22513 gene locus_tag LOCUS_09550 21533 22513 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113158.1 protein_id gnl|my_center|LOCUS_09550 22651 24072 gene locus_tag LOCUS_09560 22651 24072 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028568.1 protein_id gnl|my_center|LOCUS_09560 25195 24134 gene locus_tag LOCUS_09570 25195 24134 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419324.1 protein_id gnl|my_center|LOCUS_09570 25953 25192 gene locus_tag LOCUS_09580 25953 25192 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_09580 26834 25950 gene locus_tag LOCUS_09590 26834 25950 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_09590 27583 26834 gene locus_tag LOCUS_09600 27583 26834 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 protein_id gnl|my_center|LOCUS_09600 27662 28636 gene locus_tag LOCUS_09610 27662 28636 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_09610 29638 28643 gene locus_tag LOCUS_09620 29638 28643 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284397.1 protein_id gnl|my_center|LOCUS_09620 29703 30683 gene locus_tag LOCUS_09630 29703 30683 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_09630 32282 30702 gene locus_tag LOCUS_09640 32282 30702 CDS product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113161.1 protein_id gnl|my_center|LOCUS_09640 32419 33186 gene locus_tag LOCUS_09650 32419 33186 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 protein_id gnl|my_center|LOCUS_09650 33992 33165 gene locus_tag LOCUS_09660 33992 33165 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871467.1 protein_id gnl|my_center|LOCUS_09660 35143 33989 gene locus_tag LOCUS_09670 35143 33989 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 protein_id gnl|my_center|LOCUS_09670 36306 35143 gene locus_tag LOCUS_09680 36306 35143 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_09680 37977 36337 gene locus_tag LOCUS_09690 37977 36337 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088410.1 protein_id gnl|my_center|LOCUS_09690 38865 38104 gene locus_tag LOCUS_09700 38865 38104 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_09700 39012 40682 gene locus_tag LOCUS_09710 39012 40682 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_09710 40679 41581 gene locus_tag LOCUS_09720 40679 41581 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224297.1 protein_id gnl|my_center|LOCUS_09720 42194 41583 gene locus_tag LOCUS_09730 42194 41583 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085817.1 protein_id gnl|my_center|LOCUS_09730 43524 42313 gene locus_tag LOCUS_09740 43524 42313 CDS product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 protein_id gnl|my_center|LOCUS_09740 43646 44797 gene locus_tag LOCUS_09750 43646 44797 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728642.1 protein_id gnl|my_center|LOCUS_09750 44794 45066 gene locus_tag LOCUS_09760 44794 45066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894233.1 protein_id gnl|my_center|LOCUS_09760 45925 45176 gene locus_tag LOCUS_09770 45925 45176 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326803.1 protein_id gnl|my_center|LOCUS_09770 47612 46134 gene locus_tag LOCUS_09780 47612 46134 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079346.1 protein_id gnl|my_center|LOCUS_09780 48529 47615 gene locus_tag LOCUS_09790 gene bphC 48529 47615 CDS product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087449.1 protein_id gnl|my_center|LOCUS_09790 49763 48660 gene locus_tag LOCUS_09800 49763 48660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 51037 49853 gene locus_tag LOCUS_09810 51037 49853 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112840.1 protein_id gnl|my_center|LOCUS_09810 52068 51046 gene locus_tag LOCUS_09820 gene dmpG 52068 51046 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419250.1 protein_id gnl|my_center|LOCUS_09820 52989 52105 gene locus_tag LOCUS_09830 52989 52105 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064835.1 protein_id gnl|my_center|LOCUS_09830 53788 53003 gene locus_tag LOCUS_09840 53788 53003 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419252.1 protein_id gnl|my_center|LOCUS_09840 54931 53897 gene locus_tag LOCUS_09850 54931 53897 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730993.1 protein_id gnl|my_center|LOCUS_09850 56610 54961 gene locus_tag LOCUS_09860 56610 54961 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730144.1 protein_id gnl|my_center|LOCUS_09860 57476 56607 gene locus_tag LOCUS_09870 57476 56607 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728670.1 protein_id gnl|my_center|LOCUS_09870 57708 58283 gene locus_tag LOCUS_09880 gene hsaB 57708 58283 CDS product flavin-dependent monooxygenase reductase subunit HsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900713.1 protein_id gnl|my_center|LOCUS_09880 59203 58316 gene locus_tag LOCUS_09890 59203 58316 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030616714.1 protein_id gnl|my_center|LOCUS_09890 60440 59277 gene locus_tag LOCUS_09900 60440 59277 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225242.1 protein_id gnl|my_center|LOCUS_09900 60491 61564 gene locus_tag LOCUS_09910 60491 61564 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_09910 61806 61943 gene locus_tag LOCUS_09920 61806 61943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 62972 62013 gene locus_tag LOCUS_09930 62972 62013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 65522 63240 gene locus_tag LOCUS_09940 65522 63240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 66083 66826 gene locus_tag LOCUS_09950 66083 66826 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227640.1 protein_id gnl|my_center|LOCUS_09950 66865 67926 gene locus_tag LOCUS_09960 66865 67926 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804036.1 protein_id gnl|my_center|LOCUS_09960 69065 67947 gene locus_tag LOCUS_09970 69065 67947 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030660.1 protein_id gnl|my_center|LOCUS_09970 69194 69922 gene locus_tag LOCUS_09980 69194 69922 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466810.1 protein_id gnl|my_center|LOCUS_09980 70068 69916 gene locus_tag LOCUS_09990 70068 69916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 70037 70864 gene locus_tag LOCUS_10000 70037 70864 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776972.1 protein_id gnl|my_center|LOCUS_10000 70864 71508 gene locus_tag LOCUS_10010 70864 71508 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973248.1 protein_id gnl|my_center|LOCUS_10010 71505 72314 gene locus_tag LOCUS_10020 71505 72314 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776970.1 protein_id gnl|my_center|LOCUS_10020 72307 73284 gene locus_tag LOCUS_10030 72307 73284 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_10030 73281 74027 gene locus_tag LOCUS_10040 73281 74027 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172331.1 protein_id gnl|my_center|LOCUS_10040 74606 74094 gene locus_tag LOCUS_10050 74606 74094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 74780 75376 gene locus_tag LOCUS_10060 74780 75376 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495312.1 protein_id gnl|my_center|LOCUS_10060 75418 75768 gene locus_tag LOCUS_10070 75418 75768 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226523.1 protein_id gnl|my_center|LOCUS_10070 76358 75801 gene locus_tag LOCUS_10080 76358 75801 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228475.1 protein_id gnl|my_center|LOCUS_10080 76442 77218 gene locus_tag LOCUS_10090 76442 77218 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804932.1 protein_id gnl|my_center|LOCUS_10090 77273 78151 gene locus_tag LOCUS_10100 77273 78151 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029243.1 protein_id gnl|my_center|LOCUS_10100 78246 79640 gene locus_tag LOCUS_10110 78246 79640 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229277.1 protein_id gnl|my_center|LOCUS_10110 82158 79705 gene locus_tag LOCUS_10120 82158 79705 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203995958.1 protein_id gnl|my_center|LOCUS_10120 82392 82934 gene locus_tag LOCUS_10130 82392 82934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 82931 83305 gene locus_tag LOCUS_10140 82931 83305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 83880 83323 gene locus_tag LOCUS_10150 83880 83323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 84024 84197 gene locus_tag LOCUS_10160 84024 84197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 85231 84323 gene locus_tag LOCUS_10170 85231 84323 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029194.1 protein_id gnl|my_center|LOCUS_10170 85327 85992 gene locus_tag LOCUS_10180 85327 85992 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121717242.1 protein_id gnl|my_center|LOCUS_10180 86674 85982 gene locus_tag LOCUS_10190 86674 85982 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031073.1 protein_id gnl|my_center|LOCUS_10190 86836 87822 gene locus_tag LOCUS_10200 86836 87822 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 protein_id gnl|my_center|LOCUS_10200 87835 88233 gene locus_tag LOCUS_10210 87835 88233 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 protein_id gnl|my_center|LOCUS_10210 88230 89318 gene locus_tag LOCUS_10220 88230 89318 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 protein_id gnl|my_center|LOCUS_10220 89315 90175 gene locus_tag LOCUS_10230 89315 90175 CDS product trans-aconitate methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230076.1 protein_id gnl|my_center|LOCUS_10230 90172 91158 gene locus_tag LOCUS_10240 90172 91158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 92698 91211 gene locus_tag LOCUS_10250 92698 91211 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227506.1 protein_id gnl|my_center|LOCUS_10250 93930 92782 gene locus_tag LOCUS_10260 93930 92782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 94825 93950 gene locus_tag LOCUS_10270 94825 93950 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973040.1 protein_id gnl|my_center|LOCUS_10270 97264 95057 gene locus_tag LOCUS_10280 97264 95057 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_10280 97662 98957 gene locus_tag LOCUS_10290 97662 98957 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228504.1 protein_id gnl|my_center|LOCUS_10290 98957 99085 gene locus_tag LOCUS_10300 98957 99085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 99219 99956 gene locus_tag LOCUS_10310 99219 99956 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084048.1 protein_id gnl|my_center|LOCUS_10310 100117 100314 gene locus_tag LOCUS_10320 100117 100314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 100357 101424 gene locus_tag LOCUS_10330 100357 101424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 101438 102271 gene locus_tag LOCUS_10340 101438 102271 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226328.1 protein_id gnl|my_center|LOCUS_10340 103102 102284 gene locus_tag LOCUS_10350 103102 102284 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_10350 103524 106394 gene locus_tag LOCUS_10360 103524 106394 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226639.1 protein_id gnl|my_center|LOCUS_10360 106572 106417 gene locus_tag LOCUS_10370 106572 106417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 106875 107795 gene locus_tag LOCUS_10380 106875 107795 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728156.1 protein_id gnl|my_center|LOCUS_10380 108210 107821 gene locus_tag LOCUS_10390 108210 107821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 108324 109493 gene locus_tag LOCUS_10400 108324 109493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 109568 109837 gene locus_tag LOCUS_10410 109568 109837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 110259 109867 gene locus_tag LOCUS_10420 110259 109867 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728758.1 protein_id gnl|my_center|LOCUS_10420 110424 112106 gene locus_tag LOCUS_10430 110424 112106 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028251.1 protein_id gnl|my_center|LOCUS_10430 112373 112134 gene locus_tag LOCUS_10440 112373 112134 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225378.1 protein_id gnl|my_center|LOCUS_10440 113065 112370 gene locus_tag LOCUS_10450 113065 112370 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949117.1 protein_id gnl|my_center|LOCUS_10450 113208 114491 gene locus_tag LOCUS_10460 gene egtA 113208 114491 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027438.1 protein_id gnl|my_center|LOCUS_10460 114488 115798 gene locus_tag LOCUS_10470 gene egtB 114488 115798 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 protein_id gnl|my_center|LOCUS_10470 115798 116556 gene locus_tag LOCUS_10480 gene egtC 115798 116556 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027440.1 protein_id gnl|my_center|LOCUS_10480 116553 117524 gene locus_tag LOCUS_10490 gene egtD 116553 117524 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027441.1 protein_id gnl|my_center|LOCUS_10490 117842 120145 gene locus_tag LOCUS_10500 117842 120145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 120379 121407 gene locus_tag LOCUS_10510 120379 121407 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862198.1 protein_id gnl|my_center|LOCUS_10510 123384 121453 gene locus_tag LOCUS_10520 123384 121453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 123266 123559 gene locus_tag LOCUS_10530 123266 123559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 123823 124251 gene locus_tag LOCUS_10540 123823 124251 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222322.1 protein_id gnl|my_center|LOCUS_10540 126244 124274 gene locus_tag LOCUS_10550 126244 124274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 126543 127646 gene locus_tag LOCUS_10560 126543 127646 CDS product F420-dependent hydroxymycolic acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899826.1 protein_id gnl|my_center|LOCUS_10560 129153 127663 gene locus_tag LOCUS_10570 129153 127663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 130112 129150 gene locus_tag LOCUS_10580 130112 129150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 130542 130730 gene locus_tag LOCUS_10590 130542 130730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 130815 132227 gene locus_tag LOCUS_10600 130815 132227 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_10600 132443 132228 gene locus_tag LOCUS_10610 132443 132228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 132766 134613 gene locus_tag LOCUS_10620 132766 134613 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229431.1 protein_id gnl|my_center|LOCUS_10620 136355 134715 gene locus_tag LOCUS_10630 gene pgm 136355 134715 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_10630 135346 135262 gene locus_tag LOCUS_t00080 135346 135262 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 136584 137543 gene locus_tag LOCUS_10640 136584 137543 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222332.1 protein_id gnl|my_center|LOCUS_10640 138368 137559 gene locus_tag LOCUS_10650 138368 137559 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_10650 139673 138471 gene locus_tag LOCUS_10660 139673 138471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 139964 140929 gene locus_tag LOCUS_10670 139964 140929 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030715.1 protein_id gnl|my_center|LOCUS_10670 141006 141473 gene locus_tag LOCUS_10680 141006 141473 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224896.1 protein_id gnl|my_center|LOCUS_10680 141470 142276 gene locus_tag LOCUS_10690 141470 142276 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897923.1 protein_id gnl|my_center|LOCUS_10690 142236 143066 gene locus_tag LOCUS_10700 142236 143066 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224893.1 protein_id gnl|my_center|LOCUS_10700 143479 144384 gene locus_tag LOCUS_10710 143479 144384 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027243.1 protein_id gnl|my_center|LOCUS_10710 145420 144338 gene locus_tag LOCUS_10720 145420 144338 CDS product galactosyldiacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484813.1 protein_id gnl|my_center|LOCUS_10720 145453 146166 gene locus_tag LOCUS_10730 145453 146166 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484635.1 protein_id gnl|my_center|LOCUS_10730 146452 147390 gene locus_tag LOCUS_10740 gene hpnC 146452 147390 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 protein_id gnl|my_center|LOCUS_10740 147395 148243 gene locus_tag LOCUS_10750 gene hpnD 147395 148243 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_10750 148240 149571 gene locus_tag LOCUS_10760 gene hpnE 148240 149571 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_10760 149568 150581 gene locus_tag LOCUS_10770 gene idsA1 149568 150581 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417957.1 protein_id gnl|my_center|LOCUS_10770 150583 152541 gene locus_tag LOCUS_10780 gene shc 150583 152541 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_10780 152538 153446 gene locus_tag LOCUS_10790 152538 153446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 153446 154450 gene locus_tag LOCUS_10800 gene hpnH 153446 154450 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_10800 155234 154416 gene locus_tag LOCUS_10810 155234 154416 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325650.1 protein_id gnl|my_center|LOCUS_10810 156117 155296 gene locus_tag LOCUS_10820 156117 155296 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_10820 157079 156114 gene locus_tag LOCUS_10830 157079 156114 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_10830 158458 157076 gene locus_tag LOCUS_10840 158458 157076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 159520 158486 gene locus_tag LOCUS_10850 159520 158486 CDS product endo-alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108998.1 protein_id gnl|my_center|LOCUS_10850 159435 159749 gene locus_tag LOCUS_10860 159435 159749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 161548 159737 gene locus_tag LOCUS_10870 161548 159737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 162484 161597 gene locus_tag LOCUS_10880 162484 161597 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530304.1 protein_id gnl|my_center|LOCUS_10880 163593 162823 gene locus_tag LOCUS_10890 163593 162823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 164990 163911 gene locus_tag LOCUS_10900 164990 163911 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_10900 166165 164987 gene locus_tag LOCUS_10910 166165 164987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 167085 166162 gene locus_tag LOCUS_10920 167085 166162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157210040.1 protein_id gnl|my_center|LOCUS_10920 167362 168561 gene locus_tag LOCUS_10930 167362 168561 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809685.1 protein_id gnl|my_center|LOCUS_10930 168574 169452 gene locus_tag LOCUS_10940 168574 169452 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_10940 169461 171356 gene locus_tag LOCUS_10950 169461 171356 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971602.1 protein_id gnl|my_center|LOCUS_10950 171358 172128 gene locus_tag LOCUS_10960 171358 172128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243768.1 protein_id gnl|my_center|LOCUS_10960 173730 172162 gene locus_tag LOCUS_10970 173730 172162 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092532455.1 protein_id gnl|my_center|LOCUS_10970 173839 174897 gene locus_tag LOCUS_10980 173839 174897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 175080 175985 gene locus_tag LOCUS_10990 175080 175985 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728195.1 protein_id gnl|my_center|LOCUS_10990 175982 177226 gene locus_tag LOCUS_11000 175982 177226 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_11000 177253 178713 gene locus_tag LOCUS_11010 177253 178713 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939726.1 protein_id gnl|my_center|LOCUS_11010 178909 180039 gene locus_tag LOCUS_11020 178909 180039 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227983.1 protein_id gnl|my_center|LOCUS_11020 180036 180686 gene locus_tag LOCUS_11030 180036 180686 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227982.1 protein_id gnl|my_center|LOCUS_11030 181387 180683 gene locus_tag LOCUS_11040 181387 180683 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227981.1 protein_id gnl|my_center|LOCUS_11040 181572 182558 gene locus_tag LOCUS_11050 181572 182558 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229250.1 protein_id gnl|my_center|LOCUS_11050 182679 183398 gene locus_tag LOCUS_11060 182679 183398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 183413 183784 gene locus_tag LOCUS_11070 183413 183784 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596149.1 protein_id gnl|my_center|LOCUS_11070 183774 184526 gene locus_tag LOCUS_11080 183774 184526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 185067 184552 gene locus_tag LOCUS_11090 gene slyA 185067 184552 CDS product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688303.1 protein_id gnl|my_center|LOCUS_11090 185273 185695 gene locus_tag LOCUS_11100 185273 185695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 186857 185697 gene locus_tag LOCUS_11110 186857 185697 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226999.1 protein_id gnl|my_center|LOCUS_11110 190035 186910 gene locus_tag LOCUS_11120 190035 186910 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226159.1 protein_id gnl|my_center|LOCUS_11120 190094 190642 gene locus_tag LOCUS_11130 190094 190642 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230285.1 protein_id gnl|my_center|LOCUS_11130 190696 191922 gene locus_tag LOCUS_11140 190696 191922 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230284.1 protein_id gnl|my_center|LOCUS_11140 192285 191905 gene locus_tag LOCUS_11150 192285 191905 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 protein_id gnl|my_center|LOCUS_11150 192485 192282 gene locus_tag LOCUS_11160 192485 192282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 194782 192650 gene locus_tag LOCUS_11170 194782 192650 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088788.1 protein_id gnl|my_center|LOCUS_11170 195273 194779 gene locus_tag LOCUS_11180 195273 194779 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088787.1 protein_id gnl|my_center|LOCUS_11180 195962 195270 gene locus_tag LOCUS_11190 195962 195270 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_11190 196528 195998 gene locus_tag LOCUS_11200 196528 195998 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527976.1 protein_id gnl|my_center|LOCUS_11200 196672 198852 gene locus_tag LOCUS_11210 196672 198852 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528128.1 protein_id gnl|my_center|LOCUS_11210 198864 200213 gene locus_tag LOCUS_11220 198864 200213 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_11220 200350 201213 gene locus_tag LOCUS_11230 200350 201213 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_11230 203093 201312 gene locus_tag LOCUS_11240 gene glpD 203093 201312 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_11240 204677 203169 gene locus_tag LOCUS_11250 gene glpK 204677 203169 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226257.1 protein_id gnl|my_center|LOCUS_11250 205575 204736 gene locus_tag LOCUS_11260 205575 204736 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109004014.1 protein_id gnl|my_center|LOCUS_11260 205885 206652 gene locus_tag LOCUS_11270 205885 206652 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226255.1 protein_id gnl|my_center|LOCUS_11270 206671 208224 gene locus_tag LOCUS_11280 gene glpK 206671 208224 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226254.1 protein_id gnl|my_center|LOCUS_11280 208227 209189 gene locus_tag LOCUS_11290 208227 209189 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618875.1 protein_id gnl|my_center|LOCUS_11290 209662 209216 gene locus_tag LOCUS_11300 209662 209216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 209903 210766 gene locus_tag LOCUS_11310 209903 210766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 210753 211901 gene locus_tag LOCUS_11320 210753 211901 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236073048.1 protein_id gnl|my_center|LOCUS_11320 211986 212405 gene locus_tag LOCUS_11330 211986 212405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 213158 212586 gene locus_tag LOCUS_11340 213158 212586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 213920 213162 gene locus_tag LOCUS_11350 213920 213162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 214198 216081 gene locus_tag LOCUS_11360 gene cotA 214198 216081 CDS product outer spore coat copper-dependent laccase CotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243170.1 protein_id gnl|my_center|LOCUS_11360 216103 216765 gene locus_tag LOCUS_11370 216103 216765 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222032.1 protein_id gnl|my_center|LOCUS_11370 219694 216815 gene locus_tag LOCUS_11380 219694 216815 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229885.1 protein_id gnl|my_center|LOCUS_11380 219911 221422 gene locus_tag LOCUS_11390 219911 221422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 221569 221916 gene locus_tag LOCUS_11400 221569 221916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 222517 222092 gene locus_tag LOCUS_11410 222517 222092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 223938 222517 gene locus_tag LOCUS_11420 223938 222517 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_11420 224312 224662 gene locus_tag LOCUS_11430 224312 224662 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229731.1 protein_id gnl|my_center|LOCUS_11430 224670 225839 gene locus_tag LOCUS_11440 224670 225839 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229319.1 protein_id gnl|my_center|LOCUS_11440 225912 227042 gene locus_tag LOCUS_11450 225912 227042 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 protein_id gnl|my_center|LOCUS_11450 227942 227097 gene locus_tag LOCUS_11460 227942 227097 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_11460 227984 229618 gene locus_tag LOCUS_11470 gene betA 227984 229618 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 protein_id gnl|my_center|LOCUS_11470 229615 231090 gene locus_tag LOCUS_11480 229615 231090 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224487.1 protein_id gnl|my_center|LOCUS_11480 231346 232725 gene locus_tag LOCUS_11490 231346 232725 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977756.1 protein_id gnl|my_center|LOCUS_11490 233018 235432 gene locus_tag LOCUS_11500 233018 235432 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_11500 235472 236758 gene locus_tag LOCUS_11510 235472 236758 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973528.1 protein_id gnl|my_center|LOCUS_11510 236755 237972 gene locus_tag LOCUS_11520 236755 237972 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229309.1 protein_id gnl|my_center|LOCUS_11520 238000 238257 gene locus_tag LOCUS_11530 238000 238257 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229308.1 protein_id gnl|my_center|LOCUS_11530 238254 241022 gene locus_tag LOCUS_11540 238254 241022 CDS product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202495.1 protein_id gnl|my_center|LOCUS_11540 241015 241587 gene locus_tag LOCUS_11550 241015 241587 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205601.1 protein_id gnl|my_center|LOCUS_11550 242005 241574 gene locus_tag LOCUS_11560 242005 241574 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226516.1 protein_id gnl|my_center|LOCUS_11560 242348 241995 gene locus_tag LOCUS_11570 242348 241995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 242467 243177 gene locus_tag LOCUS_11580 242467 243177 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974001.1 protein_id gnl|my_center|LOCUS_11580 244200 243187 gene locus_tag LOCUS_11590 244200 243187 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_11590 245546 244200 gene locus_tag LOCUS_11600 245546 244200 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730651.1 protein_id gnl|my_center|LOCUS_11600 245706 246224 gene locus_tag LOCUS_11610 245706 246224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 246276 246674 gene locus_tag LOCUS_11620 246276 246674 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028904.1 protein_id gnl|my_center|LOCUS_11620 246778 246900 gene locus_tag LOCUS_11630 246778 246900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 246969 247508 gene locus_tag LOCUS_11640 246969 247508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 247652 248650 gene locus_tag LOCUS_11650 247652 248650 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228674.1 protein_id gnl|my_center|LOCUS_11650 249696 248737 gene locus_tag LOCUS_11660 gene egtD 249696 248737 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731156.1 protein_id gnl|my_center|LOCUS_11660 250414 249707 gene locus_tag LOCUS_11670 gene egtC 250414 249707 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731157.1 protein_id gnl|my_center|LOCUS_11670 251719 250415 gene locus_tag LOCUS_11680 gene egtB 251719 250415 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 protein_id gnl|my_center|LOCUS_11680 252840 251716 gene locus_tag LOCUS_11690 gene egtA 252840 251716 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027438.1 protein_id gnl|my_center|LOCUS_11690 253065 254024 gene locus_tag LOCUS_11700 gene dapD 253065 254024 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222940.1 protein_id gnl|my_center|LOCUS_11700 254106 254285 gene locus_tag LOCUS_11710 254106 254285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 254396 254767 gene locus_tag LOCUS_11720 254396 254767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11720 254760 255776 gene locus_tag LOCUS_11730 254760 255776 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_11730 255917 256906 gene locus_tag LOCUS_11740 255917 256906 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_11740 256980 257384 gene locus_tag LOCUS_11750 256980 257384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 259333 257645 gene locus_tag LOCUS_11760 259333 257645 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338607.1 protein_id gnl|my_center|LOCUS_11760 259671 259468 gene locus_tag LOCUS_11770 259671 259468 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_11770 260784 259876 gene locus_tag LOCUS_11780 260784 259876 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031333.1 protein_id gnl|my_center|LOCUS_11780 262234 260792 gene locus_tag LOCUS_11790 262234 260792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 262499 262759 gene locus_tag LOCUS_11800 262499 262759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 263489 262773 gene locus_tag LOCUS_11810 263489 262773 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878120.1 protein_id gnl|my_center|LOCUS_11810 263657 264976 gene locus_tag LOCUS_11820 gene cysS 263657 264976 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113149.1 protein_id gnl|my_center|LOCUS_11820 265031 265957 gene locus_tag LOCUS_11830 265031 265957 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113476.1 protein_id gnl|my_center|LOCUS_11830 266595 265978 gene locus_tag LOCUS_11840 266595 265978 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 protein_id gnl|my_center|LOCUS_11840 266753 268300 gene locus_tag LOCUS_11850 266753 268300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 268311 268877 gene locus_tag LOCUS_11860 268311 268877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 269009 269578 gene locus_tag LOCUS_11870 269009 269578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 271354 270221 gene locus_tag LOCUS_11880 271354 270221 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_11880 271505 272302 gene locus_tag LOCUS_11890 271505 272302 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_11890 272388 273461 gene locus_tag LOCUS_11900 272388 273461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 273639 276971 gene locus_tag LOCUS_11910 273639 276971 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728047.1 protein_id gnl|my_center|LOCUS_11910 277958 277350 gene locus_tag LOCUS_11920 277958 277350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 278107 278604 gene locus_tag LOCUS_11930 278107 278604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 278951 278661 gene locus_tag LOCUS_11940 278951 278661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 278869 279600 gene locus_tag LOCUS_11950 278869 279600 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029243.1 protein_id gnl|my_center|LOCUS_11950 280529 279672 gene locus_tag LOCUS_11960 280529 279672 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067135926.1 protein_id gnl|my_center|LOCUS_11960 281062 280565 gene locus_tag LOCUS_11970 281062 280565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 281234 283099 gene locus_tag LOCUS_11980 281234 283099 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113135.1 protein_id gnl|my_center|LOCUS_11980 283312 284871 gene locus_tag LOCUS_11990 283312 284871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 285200 284997 gene locus_tag LOCUS_12000 285200 284997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 285112 285654 gene locus_tag LOCUS_12010 285112 285654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 287045 285651 gene locus_tag LOCUS_12020 287045 285651 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223637.1 protein_id gnl|my_center|LOCUS_12020 287114 287752 gene locus_tag LOCUS_12030 287114 287752 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223636.1 protein_id gnl|my_center|LOCUS_12030 287838 288761 gene locus_tag LOCUS_12040 287838 288761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 288903 290621 gene locus_tag LOCUS_12050 288903 290621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 290663 292069 gene locus_tag LOCUS_12060 290663 292069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 292079 293077 gene locus_tag LOCUS_12070 292079 293077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 293099 293695 gene locus_tag LOCUS_12080 gene orn 293099 293695 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_12080 293780 293855 gene locus_tag LOCUS_t00090 293780 293855 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 294046 294267 gene locus_tag LOCUS_12090 294046 294267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 295608 294322 gene locus_tag LOCUS_12100 gene lat 295608 294322 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080767.1 protein_id gnl|my_center|LOCUS_12100 296400 295741 gene locus_tag LOCUS_12110 296400 295741 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_12110 298063 296459 gene locus_tag LOCUS_12120 298063 296459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 298091 298963 gene locus_tag LOCUS_12130 298091 298963 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878192.1 protein_id gnl|my_center|LOCUS_12130 299239 298982 gene locus_tag LOCUS_12140 299239 298982 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229777.1 protein_id gnl|my_center|LOCUS_12140 300194 299295 gene locus_tag LOCUS_12150 300194 299295 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776379.1 protein_id gnl|my_center|LOCUS_12150 301132 300197 gene locus_tag LOCUS_12160 301132 300197 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030592.1 protein_id gnl|my_center|LOCUS_12160 302534 301137 gene locus_tag LOCUS_12170 gene ngcE 302534 301137 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_12170 302860 303486 gene locus_tag LOCUS_12180 302860 303486 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230414.1 protein_id gnl|my_center|LOCUS_12180 305183 303606 gene locus_tag LOCUS_12190 305183 303606 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141209.1 protein_id gnl|my_center|LOCUS_12190 305239 306483 gene locus_tag LOCUS_12200 305239 306483 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_12200 306970 306455 gene locus_tag LOCUS_12210 306970 306455 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392718.1 protein_id gnl|my_center|LOCUS_12210 307256 307627 gene locus_tag LOCUS_12220 307256 307627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229623.1 protein_id gnl|my_center|LOCUS_12220 307631 308455 gene locus_tag LOCUS_12230 307631 308455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978179.1 protein_id gnl|my_center|LOCUS_12230 308455 308868 gene locus_tag LOCUS_12240 308455 308868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 308900 309271 gene locus_tag LOCUS_12250 308900 309271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_12250 309600 310742 gene locus_tag LOCUS_12260 309600 310742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 310811 311560 gene locus_tag LOCUS_12270 310811 311560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 311557 313059 gene locus_tag LOCUS_12280 311557 313059 CDS product NADH-quinone oxidoreductase subunit NuoF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326195.1 protein_id gnl|my_center|LOCUS_12280 313957 313094 gene locus_tag LOCUS_12290 313957 313094 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_12290 314064 315482 gene locus_tag LOCUS_12300 314064 315482 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190031345.1 protein_id gnl|my_center|LOCUS_12300 315479 315958 gene locus_tag LOCUS_12310 315479 315958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 316615 316145 gene locus_tag LOCUS_12320 316615 316145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 317144 316671 gene locus_tag LOCUS_12330 317144 316671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 317317 317838 gene locus_tag LOCUS_12340 317317 317838 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977779.1 protein_id gnl|my_center|LOCUS_12340 318881 317883 gene locus_tag LOCUS_12350 318881 317883 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_12350 320958 318955 gene locus_tag LOCUS_12360 320958 318955 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225090.1 protein_id gnl|my_center|LOCUS_12360 320942 321535 gene locus_tag LOCUS_12370 320942 321535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 322279 321545 gene locus_tag LOCUS_12380 322279 321545 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993682.1 protein_id gnl|my_center|LOCUS_12380 322528 323298 gene locus_tag LOCUS_12390 322528 323298 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028770.1 protein_id gnl|my_center|LOCUS_12390 324325 323387 gene locus_tag LOCUS_12400 324325 323387 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204065824.1 protein_id gnl|my_center|LOCUS_12400 324968 324438 gene locus_tag LOCUS_12410 324968 324438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 325556 325113 gene locus_tag LOCUS_12420 325556 325113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 325731 326381 gene locus_tag LOCUS_12430 325731 326381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 327005 327496 gene locus_tag LOCUS_12440 327005 327496 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976464.1 protein_id gnl|my_center|LOCUS_12440 327760 330939 gene locus_tag LOCUS_12450 327760 330939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 332118 330964 gene locus_tag LOCUS_12460 332118 330964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 332334 332930 gene locus_tag LOCUS_12470 332334 332930 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466502.1 protein_id gnl|my_center|LOCUS_12470 332927 334129 gene locus_tag LOCUS_12480 332927 334129 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230887.1 protein_id gnl|my_center|LOCUS_12480 334272 334871 gene locus_tag LOCUS_12490 334272 334871 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053546291.1 protein_id gnl|my_center|LOCUS_12490 335879 334938 gene locus_tag LOCUS_12500 335879 334938 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296290.1 protein_id gnl|my_center|LOCUS_12500 336767 336270 gene locus_tag LOCUS_12510 336767 336270 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226865.1 protein_id gnl|my_center|LOCUS_12510 337442 336975 gene locus_tag LOCUS_12520 337442 336975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224277.1 protein_id gnl|my_center|LOCUS_12520 337759 338934 gene locus_tag LOCUS_12530 337759 338934 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_12530 338931 339653 gene locus_tag LOCUS_12540 338931 339653 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_12540 340681 339836 gene locus_tag LOCUS_12550 340681 339836 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 protein_id gnl|my_center|LOCUS_12550 341700 340678 gene locus_tag LOCUS_12560 341700 340678 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 protein_id gnl|my_center|LOCUS_12560 342300 341716 gene locus_tag LOCUS_12570 342300 341716 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976326.1 protein_id gnl|my_center|LOCUS_12570 343271 342408 gene locus_tag LOCUS_12580 343271 342408 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974354.1 protein_id gnl|my_center|LOCUS_12580 343388 343810 gene locus_tag LOCUS_12590 343388 343810 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029382.1 protein_id gnl|my_center|LOCUS_12590 343890 344849 gene locus_tag LOCUS_12600 343890 344849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 345071 344871 gene locus_tag LOCUS_12610 345071 344871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 345248 345172 gene locus_tag LOCUS_t00100 345248 345172 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 345334 346182 gene locus_tag LOCUS_12620 345334 346182 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084944.1 protein_id gnl|my_center|LOCUS_12620 346214 347593 gene locus_tag LOCUS_12630 346214 347593 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224866.1 protein_id gnl|my_center|LOCUS_12630 348476 347706 gene locus_tag LOCUS_12640 348476 347706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 348657 349271 gene locus_tag LOCUS_12650 348657 349271 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868049.1 protein_id gnl|my_center|LOCUS_12650 350403 349264 gene locus_tag LOCUS_12660 350403 349264 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225001.1 protein_id gnl|my_center|LOCUS_12660 351572 350400 gene locus_tag LOCUS_12670 351572 350400 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_12670 352794 351589 gene locus_tag LOCUS_12680 352794 351589 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_12680 353745 352795 gene locus_tag LOCUS_12690 353745 352795 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_12690 354403 353837 gene locus_tag LOCUS_12700 354403 353837 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977488.1 protein_id gnl|my_center|LOCUS_12700 354485 355621 gene locus_tag LOCUS_12710 354485 355621 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_12710 356600 355662 gene locus_tag LOCUS_12720 356600 355662 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728549.1 protein_id gnl|my_center|LOCUS_12720 357065 356706 gene locus_tag LOCUS_12730 357065 356706 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226395.1 protein_id gnl|my_center|LOCUS_12730 357203 359491 gene locus_tag LOCUS_12740 gene secA2 357203 359491 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223120.1 protein_id gnl|my_center|LOCUS_12740 360145 359510 gene locus_tag LOCUS_12750 360145 359510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 360806 361678 gene locus_tag LOCUS_12760 360806 361678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 363066 361741 gene locus_tag LOCUS_12770 363066 361741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_12770 363636 363241 gene locus_tag LOCUS_12780 363636 363241 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977738.1 protein_id gnl|my_center|LOCUS_12780 363905 364366 gene locus_tag LOCUS_12790 363905 364366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 364377 365459 gene locus_tag LOCUS_12800 364377 365459 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476103.1 protein_id gnl|my_center|LOCUS_12800 365926 365456 gene locus_tag LOCUS_12810 365926 365456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 366592 365963 gene locus_tag LOCUS_12820 366592 365963 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978707.1 protein_id gnl|my_center|LOCUS_12820 366561 366755 gene locus_tag LOCUS_12830 366561 366755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 366760 368430 gene locus_tag LOCUS_12840 366760 368430 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223371.1 protein_id gnl|my_center|LOCUS_12840 368427 369851 gene locus_tag LOCUS_12850 368427 369851 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031573.1 protein_id gnl|my_center|LOCUS_12850 369944 370813 gene locus_tag LOCUS_12860 369944 370813 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226333.1 protein_id gnl|my_center|LOCUS_12860 371212 370937 gene locus_tag LOCUS_12870 371212 370937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 372299 371301 gene locus_tag LOCUS_12880 gene mgrA 372299 371301 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_12880 373130 372501 gene locus_tag LOCUS_12890 373130 372501 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971839.1 protein_id gnl|my_center|LOCUS_12890 374393 373218 gene locus_tag LOCUS_12900 374393 373218 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043778558.1 protein_id gnl|my_center|LOCUS_12900 374860 374468 gene locus_tag LOCUS_12910 374860 374468 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978131.1 protein_id gnl|my_center|LOCUS_12910 377028 374872 gene locus_tag LOCUS_12920 377028 374872 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_12920 377271 378320 gene locus_tag LOCUS_12930 377271 378320 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 protein_id gnl|my_center|LOCUS_12930 378377 379642 gene locus_tag LOCUS_12940 378377 379642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 379728 380852 gene locus_tag LOCUS_12950 379728 380852 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032532.1 protein_id gnl|my_center|LOCUS_12950 380854 381735 gene locus_tag LOCUS_12960 380854 381735 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031710.1 protein_id gnl|my_center|LOCUS_12960 382108 383556 gene locus_tag LOCUS_12970 382108 383556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence04 <1 841 gene locus_tag LOCUS_12980 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083452859.1:HNH endonuclease signature motif containing protein 1044 3407 gene locus_tag LOCUS_12990 gene metE 1044 3407 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878709.1 protein_id gnl|my_center|LOCUS_12990 4606 3416 gene locus_tag LOCUS_13000 4606 3416 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104427.1 protein_id gnl|my_center|LOCUS_13000 6969 4714 gene locus_tag LOCUS_13010 6969 4714 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030648.1 protein_id gnl|my_center|LOCUS_13010 7164 7631 gene locus_tag LOCUS_13020 7164 7631 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184978408.1 protein_id gnl|my_center|LOCUS_13020 7648 8031 gene locus_tag LOCUS_13030 7648 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 8090 8338 gene locus_tag LOCUS_13040 8090 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 8443 9855 gene locus_tag LOCUS_13050 8443 9855 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868284.1 protein_id gnl|my_center|LOCUS_13050 11280 9862 gene locus_tag LOCUS_13060 11280 9862 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978046.1 protein_id gnl|my_center|LOCUS_13060 12326 11277 gene locus_tag LOCUS_13070 12326 11277 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229172.1 protein_id gnl|my_center|LOCUS_13070 12550 14091 gene locus_tag LOCUS_13080 12550 14091 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_13080 14088 15110 gene locus_tag LOCUS_13090 14088 15110 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226379.1 protein_id gnl|my_center|LOCUS_13090 15100 16125 gene locus_tag LOCUS_13100 15100 16125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978051.1 protein_id gnl|my_center|LOCUS_13100 16135 17217 gene locus_tag LOCUS_13110 gene rhaS 16135 17217 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226381.1 protein_id gnl|my_center|LOCUS_13110 17312 17629 gene locus_tag LOCUS_13120 17312 17629 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978053.1 protein_id gnl|my_center|LOCUS_13120 17687 18838 gene locus_tag LOCUS_13130 gene rhaI 17687 18838 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027369.1 protein_id gnl|my_center|LOCUS_13130 18872 20920 gene locus_tag LOCUS_13140 18872 20920 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027370.1 protein_id gnl|my_center|LOCUS_13140 23719 21383 gene locus_tag LOCUS_13150 23719 21383 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_13150 23928 26192 gene locus_tag LOCUS_13160 23928 26192 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_13160 26637 26149 gene locus_tag LOCUS_13170 26637 26149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 26894 26700 gene locus_tag LOCUS_13180 26894 26700 CDS product DUF5999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977451.1 protein_id gnl|my_center|LOCUS_13180 27116 27610 gene locus_tag LOCUS_13190 27116 27610 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_13190 27737 28948 gene locus_tag LOCUS_13200 27737 28948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 28945 29823 gene locus_tag LOCUS_13210 28945 29823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 30022 31278 gene locus_tag LOCUS_13220 30022 31278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 31945 31247 gene locus_tag LOCUS_13230 31945 31247 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223180.1 protein_id gnl|my_center|LOCUS_13230 32122 31958 gene locus_tag LOCUS_13240 32122 31958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13240 33164 32076 gene locus_tag LOCUS_13250 33164 32076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13250 33299 33922 gene locus_tag LOCUS_13260 33299 33922 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222383.1 protein_id gnl|my_center|LOCUS_13260 34839 33919 gene locus_tag LOCUS_13270 34839 33919 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978149.1 protein_id gnl|my_center|LOCUS_13270 37792 35036 gene locus_tag LOCUS_13280 37792 35036 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027310.1 protein_id gnl|my_center|LOCUS_13280 38290 37853 gene locus_tag LOCUS_13290 38290 37853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 38354 39178 gene locus_tag LOCUS_13300 38354 39178 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229849.1 protein_id gnl|my_center|LOCUS_13300 39902 39198 gene locus_tag LOCUS_13310 39902 39198 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015034.1 protein_id gnl|my_center|LOCUS_13310 40036 40836 gene locus_tag LOCUS_13320 40036 40836 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902971.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13320 40850 42136 gene locus_tag LOCUS_13330 40850 42136 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_13330 42146 42547 gene locus_tag LOCUS_13340 42146 42547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 42586 45357 gene locus_tag LOCUS_13350 42586 45357 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228786.1 protein_id gnl|my_center|LOCUS_13350 46363 45368 gene locus_tag LOCUS_13360 46363 45368 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 protein_id gnl|my_center|LOCUS_13360 48765 46390 gene locus_tag LOCUS_13370 48765 46390 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_13370 50007 49282 gene locus_tag LOCUS_13380 50007 49282 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090334.1 protein_id gnl|my_center|LOCUS_13380 50361 51323 gene locus_tag LOCUS_13390 50361 51323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 51441 52307 gene locus_tag LOCUS_13400 51441 52307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 52843 52436 gene locus_tag LOCUS_13410 52843 52436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 53723 52824 gene locus_tag LOCUS_13420 53723 52824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 54015 54974 gene locus_tag LOCUS_13430 54015 54974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 55482 55237 gene locus_tag LOCUS_13440 55482 55237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 55580 55786 gene locus_tag LOCUS_13450 55580 55786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 55843 56394 gene locus_tag LOCUS_13460 55843 56394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 56765 57004 gene locus_tag LOCUS_13470 56765 57004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 59525 57423 gene locus_tag LOCUS_13480 59525 57423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 60538 59669 gene locus_tag LOCUS_13490 60538 59669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 60657 62132 gene locus_tag LOCUS_13500 60657 62132 CDS product plasmid replication initiator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108990145.1 protein_id gnl|my_center|LOCUS_13500 62129 62338 gene locus_tag LOCUS_13510 62129 62338 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027941643.1 protein_id gnl|my_center|LOCUS_13510 62335 63492 gene locus_tag LOCUS_13520 62335 63492 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230505.1 protein_id gnl|my_center|LOCUS_13520 63644 64321 gene locus_tag LOCUS_13530 63644 64321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 64494 64419 gene locus_tag LOCUS_t00110 64494 64419 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 65435 64557 gene locus_tag LOCUS_13540 65435 64557 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731114.1 protein_id gnl|my_center|LOCUS_13540 65541 65996 gene locus_tag LOCUS_13550 65541 65996 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_13550 68325 66118 gene locus_tag LOCUS_13560 68325 66118 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_13560 68584 68880 gene locus_tag LOCUS_13570 gene wblA 68584 68880 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_13570 70232 69078 gene locus_tag LOCUS_13580 70232 69078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 71301 70273 gene locus_tag LOCUS_13590 71301 70273 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_13590 71533 72486 gene locus_tag LOCUS_13600 71533 72486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 72507 72659 gene locus_tag LOCUS_13610 72507 72659 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855791.1 protein_id gnl|my_center|LOCUS_13610 72659 73123 gene locus_tag LOCUS_13620 72659 73123 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_13620 73359 74204 gene locus_tag LOCUS_13630 73359 74204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_13630 74201 74992 gene locus_tag LOCUS_13640 74201 74992 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_13640 75669 74989 gene locus_tag LOCUS_13650 75669 74989 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_13650 75755 76474 gene locus_tag LOCUS_13660 gene nth 75755 76474 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078343767.1 protein_id gnl|my_center|LOCUS_13660 76612 77259 gene locus_tag LOCUS_13670 76612 77259 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_13670 77829 77206 gene locus_tag LOCUS_13680 77829 77206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 77901 79085 gene locus_tag LOCUS_13690 77901 79085 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_13690 79867 79394 gene locus_tag LOCUS_13700 79867 79394 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730327.1 protein_id gnl|my_center|LOCUS_13700 80997 80077 gene locus_tag LOCUS_13710 80997 80077 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_13710 81478 80987 gene locus_tag LOCUS_13720 81478 80987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 82701 81499 gene locus_tag LOCUS_13730 gene nhaA 82701 81499 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230542.1 protein_id gnl|my_center|LOCUS_13730 84808 82832 gene locus_tag LOCUS_13740 gene acs 84808 82832 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_13740 85090 85866 gene locus_tag LOCUS_13750 85090 85866 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_13750 86733 87767 gene locus_tag LOCUS_13760 86733 87767 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029084.1 protein_id gnl|my_center|LOCUS_13760 87782 88930 gene locus_tag LOCUS_13770 87782 88930 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_13770 88918 89679 gene locus_tag LOCUS_13780 88918 89679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 89676 90413 gene locus_tag LOCUS_13790 89676 90413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 90699 91346 gene locus_tag LOCUS_13800 90699 91346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 91392 91982 gene locus_tag LOCUS_13810 91392 91982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 92024 92344 gene locus_tag LOCUS_13820 92024 92344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 92680 92489 gene locus_tag LOCUS_13830 92680 92489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 92607 94085 gene locus_tag LOCUS_13840 92607 94085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 96553 94196 gene locus_tag LOCUS_13850 96553 94196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 96572 96763 gene locus_tag LOCUS_13860 96572 96763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 96961 97311 gene locus_tag LOCUS_13870 gene bldG 96961 97311 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_13870 97328 97759 gene locus_tag LOCUS_13880 97328 97759 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975387.1 protein_id gnl|my_center|LOCUS_13880 98737 98573 gene locus_tag LOCUS_13890 98737 98573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 98720 100894 gene locus_tag LOCUS_13900 98720 100894 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_13900 101166 101621 gene locus_tag LOCUS_13910 101166 101621 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_13910 101712 103790 gene locus_tag LOCUS_13920 101712 103790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 105054 103831 gene locus_tag LOCUS_13930 gene serB 105054 103831 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_13930 105195 105911 gene locus_tag LOCUS_13940 105195 105911 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977938.1 protein_id gnl|my_center|LOCUS_13940 105983 106810 gene locus_tag LOCUS_13950 105983 106810 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027447.1 protein_id gnl|my_center|LOCUS_13950 107831 106824 gene locus_tag LOCUS_13960 107831 106824 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 protein_id gnl|my_center|LOCUS_13960 108514 107828 gene locus_tag LOCUS_13970 108514 107828 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466681.1 protein_id gnl|my_center|LOCUS_13970 108637 109782 gene locus_tag LOCUS_13980 108637 109782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 109779 110396 gene locus_tag LOCUS_13990 109779 110396 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_13990 111138 110398 gene locus_tag LOCUS_14000 111138 110398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 111193 111981 gene locus_tag LOCUS_14010 111193 111981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_14010 112072 113016 gene locus_tag LOCUS_14020 112072 113016 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_14020 113093 113848 gene locus_tag LOCUS_14030 113093 113848 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943926.1 protein_id gnl|my_center|LOCUS_14030 113855 114100 gene locus_tag LOCUS_14040 113855 114100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 114955 114137 gene locus_tag LOCUS_14050 114955 114137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 115744 115145 gene locus_tag LOCUS_14060 115744 115145 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_14060 117982 115814 gene locus_tag LOCUS_14070 117982 115814 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027934.1 protein_id gnl|my_center|LOCUS_14070 118350 118144 gene locus_tag LOCUS_14080 118350 118144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 118821 119678 gene locus_tag LOCUS_14090 118821 119678 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_14090 119740 119946 gene locus_tag LOCUS_14100 119740 119946 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_14100 121523 120078 gene locus_tag LOCUS_14110 121523 120078 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971553.1 protein_id gnl|my_center|LOCUS_14110 122022 121579 gene locus_tag LOCUS_14120 122022 121579 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978301.1 protein_id gnl|my_center|LOCUS_14120 122219 123205 gene locus_tag LOCUS_14130 122219 123205 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854514.1 protein_id gnl|my_center|LOCUS_14130 123404 123967 gene locus_tag LOCUS_14140 123404 123967 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_14140 124386 123928 gene locus_tag LOCUS_14150 124386 123928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 124548 125084 gene locus_tag LOCUS_14160 124548 125084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 126305 125247 gene locus_tag LOCUS_14170 126305 125247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 129009 126424 gene locus_tag LOCUS_14180 gene clpB 129009 126424 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_14180 129385 129038 gene locus_tag LOCUS_14190 129385 129038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 130580 129390 gene locus_tag LOCUS_14200 gene dnaJ 130580 129390 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_14200 131319 130660 gene locus_tag LOCUS_14210 gene grpE 131319 130660 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975269.1 protein_id gnl|my_center|LOCUS_14210 133184 131316 gene locus_tag LOCUS_14220 gene dnaK 133184 131316 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_14220 133861 133400 gene locus_tag LOCUS_14230 133861 133400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 133980 134708 gene locus_tag LOCUS_14240 133980 134708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229141.1 protein_id gnl|my_center|LOCUS_14240 134705 135439 gene locus_tag LOCUS_14250 134705 135439 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229140.1 protein_id gnl|my_center|LOCUS_14250 136258 135464 gene locus_tag LOCUS_14260 gene proC 136258 135464 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_14260 137563 136304 gene locus_tag LOCUS_14270 137563 136304 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031193.1 protein_id gnl|my_center|LOCUS_14270 137804 139192 gene locus_tag LOCUS_14280 137804 139192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 139189 139938 gene locus_tag LOCUS_14290 139189 139938 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583200.1 protein_id gnl|my_center|LOCUS_14290 139935 141119 gene locus_tag LOCUS_14300 139935 141119 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_14300 141164 142327 gene locus_tag LOCUS_14310 141164 142327 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_14310 142389 143186 gene locus_tag LOCUS_14320 142389 143186 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 protein_id gnl|my_center|LOCUS_14320 143498 143701 gene locus_tag LOCUS_14330 143498 143701 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_14330 144031 145053 gene locus_tag LOCUS_14340 144031 145053 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_14340 145050 146006 gene locus_tag LOCUS_14350 145050 146006 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 protein_id gnl|my_center|LOCUS_14350 146909 146055 gene locus_tag LOCUS_14360 146909 146055 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878084.1 protein_id gnl|my_center|LOCUS_14360 147688 146987 gene locus_tag LOCUS_14370 147688 146987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 148294 147755 gene locus_tag LOCUS_14380 148294 147755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 148561 150117 gene locus_tag LOCUS_14390 148561 150117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 150436 150188 gene locus_tag LOCUS_14400 150436 150188 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030145241.1 protein_id gnl|my_center|LOCUS_14400 150617 151345 gene locus_tag LOCUS_14410 150617 151345 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_14410 151342 152700 gene locus_tag LOCUS_14420 151342 152700 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061882.1 protein_id gnl|my_center|LOCUS_14420 152697 153608 gene locus_tag LOCUS_14430 gene hemC 152697 153608 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975518.1 protein_id gnl|my_center|LOCUS_14430 153605 155194 gene locus_tag LOCUS_14440 153605 155194 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_14440 155291 156313 gene locus_tag LOCUS_14450 gene hemB 155291 156313 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028903.1 protein_id gnl|my_center|LOCUS_14450 156466 157041 gene locus_tag LOCUS_14460 156466 157041 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976534.1 protein_id gnl|my_center|LOCUS_14460 157085 158374 gene locus_tag LOCUS_14470 gene hemL 157085 158374 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_14470 159013 158378 gene locus_tag LOCUS_14480 159013 158378 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 protein_id gnl|my_center|LOCUS_14480 160047 159076 gene locus_tag LOCUS_14490 160047 159076 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976044.1 protein_id gnl|my_center|LOCUS_14490 159976 160275 gene locus_tag LOCUS_14500 159976 160275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 160286 161194 gene locus_tag LOCUS_14510 160286 161194 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027744.1 protein_id gnl|my_center|LOCUS_14510 161207 161845 gene locus_tag LOCUS_14520 161207 161845 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974480.1 protein_id gnl|my_center|LOCUS_14520 161921 162484 gene locus_tag LOCUS_14530 161921 162484 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029677.1 protein_id gnl|my_center|LOCUS_14530 162477 163208 gene locus_tag LOCUS_14540 162477 163208 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_14540 163208 164851 gene locus_tag LOCUS_14550 163208 164851 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_14550 164854 165816 gene locus_tag LOCUS_14560 gene ccsB 164854 165816 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222434.1 protein_id gnl|my_center|LOCUS_14560 166113 166325 gene locus_tag LOCUS_14570 166113 166325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 166556 166221 gene locus_tag LOCUS_14580 166556 166221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 166687 167628 gene locus_tag LOCUS_14590 166687 167628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 167639 167875 gene locus_tag LOCUS_14600 167639 167875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 168209 167970 gene locus_tag LOCUS_14610 168209 167970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 168452 168661 gene locus_tag LOCUS_14620 168452 168661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 169893 168658 gene locus_tag LOCUS_14630 169893 168658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 169995 170732 gene locus_tag LOCUS_14640 169995 170732 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_14640 170862 172133 gene locus_tag LOCUS_14650 170862 172133 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_14650 172282 172641 gene locus_tag LOCUS_14660 172282 172641 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_14660 172644 173195 gene locus_tag LOCUS_14670 172644 173195 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061196.1 protein_id gnl|my_center|LOCUS_14670 173192 173872 gene locus_tag LOCUS_14680 173192 173872 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_14680 173928 175247 gene locus_tag LOCUS_14690 173928 175247 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_14690 175244 175924 gene locus_tag LOCUS_14700 gene nuoE 175244 175924 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 protein_id gnl|my_center|LOCUS_14700 175921 177207 gene locus_tag LOCUS_14710 gene nuoF 175921 177207 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080146.1 protein_id gnl|my_center|LOCUS_14710 177204 179612 gene locus_tag LOCUS_14720 177204 179612 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899937.1 protein_id gnl|my_center|LOCUS_14720 179609 180967 gene locus_tag LOCUS_14730 gene nuoH 179609 180967 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_14730 180954 181469 gene locus_tag LOCUS_14740 gene nuoI 180954 181469 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222460.1 protein_id gnl|my_center|LOCUS_14740 181462 182268 gene locus_tag LOCUS_14750 181462 182268 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893423.1 protein_id gnl|my_center|LOCUS_14750 182265 182561 gene locus_tag LOCUS_14760 gene nuoK 182265 182561 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_14760 182571 184469 gene locus_tag LOCUS_14770 gene nuoL 182571 184469 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_14770 184469 185974 gene locus_tag LOCUS_14780 184469 185974 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974372.1 protein_id gnl|my_center|LOCUS_14780 185971 187524 gene locus_tag LOCUS_14790 gene nuoN 185971 187524 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_14790 187537 188532 gene locus_tag LOCUS_14800 187537 188532 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_14800 189383 188547 gene locus_tag LOCUS_14810 189383 188547 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227668.1 protein_id gnl|my_center|LOCUS_14810 190373 189462 gene locus_tag LOCUS_14820 gene rarD 190373 189462 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_14820 190506 191168 gene locus_tag LOCUS_14830 gene msrA 190506 191168 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_14830 191918 191481 gene locus_tag LOCUS_14840 191918 191481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 192906 192172 gene locus_tag LOCUS_14850 192906 192172 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_14850 192984 193793 gene locus_tag LOCUS_14860 192984 193793 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_14860 194291 194488 gene locus_tag LOCUS_14870 194291 194488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 195266 194847 gene locus_tag LOCUS_14880 195266 194847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 195223 195489 gene locus_tag LOCUS_14890 195223 195489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 196665 196339 gene locus_tag LOCUS_14900 196665 196339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 196813 197400 gene locus_tag LOCUS_14910 196813 197400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 198084 197431 gene locus_tag LOCUS_14920 gene absA2 198084 197431 CDS product two component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028838.1 protein_id gnl|my_center|LOCUS_14920 199070 198081 gene locus_tag LOCUS_14930 199070 198081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 198952 199245 gene locus_tag LOCUS_14940 198952 199245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 200676 199192 gene locus_tag LOCUS_14950 200676 199192 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026469007.1 protein_id gnl|my_center|LOCUS_14950 200561 200794 gene locus_tag LOCUS_14960 200561 200794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 200987 200820 gene locus_tag LOCUS_14970 200987 200820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 201938 201432 gene locus_tag LOCUS_14980 201938 201432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 202196 202369 gene locus_tag LOCUS_14990 202196 202369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 203390 202527 gene locus_tag LOCUS_15000 203390 202527 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976615.1 protein_id gnl|my_center|LOCUS_15000 203487 203906 gene locus_tag LOCUS_15010 203487 203906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 204074 205312 gene locus_tag LOCUS_15020 204074 205312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 205423 206340 gene locus_tag LOCUS_15030 gene lgt 205423 206340 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971316.1 protein_id gnl|my_center|LOCUS_15030 206337 206636 gene locus_tag LOCUS_15040 206337 206636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 206926 207891 gene locus_tag LOCUS_15050 206926 207891 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 protein_id gnl|my_center|LOCUS_15050 208308 208688 gene locus_tag LOCUS_15060 208308 208688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 209286 208873 gene locus_tag LOCUS_15070 209286 208873 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_15070 209549 209283 gene locus_tag LOCUS_15080 209549 209283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 209737 210198 gene locus_tag LOCUS_15090 209737 210198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 210199 210453 gene locus_tag LOCUS_15100 210199 210453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 211561 210671 gene locus_tag LOCUS_15110 211561 210671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 211695 214013 gene locus_tag LOCUS_15120 211695 214013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 214088 214858 gene locus_tag LOCUS_15130 214088 214858 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_15130 214968 215855 gene locus_tag LOCUS_15140 gene sigJ 214968 215855 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 protein_id gnl|my_center|LOCUS_15140 215936 216574 gene locus_tag LOCUS_15150 215936 216574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 216709 217398 gene locus_tag LOCUS_15160 216709 217398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 217424 219472 gene locus_tag LOCUS_15170 217424 219472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 219469 220119 gene locus_tag LOCUS_15180 219469 220119 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_15180 220661 220164 gene locus_tag LOCUS_15190 220661 220164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 221023 220658 gene locus_tag LOCUS_15200 221023 220658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 221146 221862 gene locus_tag LOCUS_15210 221146 221862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 223530 221947 gene locus_tag LOCUS_15220 223530 221947 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222854.1 protein_id gnl|my_center|LOCUS_15220 223709 223637 gene locus_tag LOCUS_t00120 223709 223637 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 224798 224229 gene locus_tag LOCUS_15230 224798 224229 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_15230 224868 225443 gene locus_tag LOCUS_15240 224868 225443 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029568.1 protein_id gnl|my_center|LOCUS_15240 225905 225486 gene locus_tag LOCUS_15250 225905 225486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 226755 225922 gene locus_tag LOCUS_15260 226755 225922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 226927 227511 gene locus_tag LOCUS_15270 226927 227511 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921763.1 protein_id gnl|my_center|LOCUS_15270 228587 227913 gene locus_tag LOCUS_15280 228587 227913 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878023.1 protein_id gnl|my_center|LOCUS_15280 229377 228595 gene locus_tag LOCUS_15290 229377 228595 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898123.1 protein_id gnl|my_center|LOCUS_15290 229546 230667 gene locus_tag LOCUS_15300 229546 230667 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813122.1 protein_id gnl|my_center|LOCUS_15300 232467 230713 gene locus_tag LOCUS_15310 232467 230713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 233173 232601 gene locus_tag LOCUS_15320 233173 232601 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230395.1 protein_id gnl|my_center|LOCUS_15320 233243 234781 gene locus_tag LOCUS_15330 233243 234781 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230396.1 protein_id gnl|my_center|LOCUS_15330 234889 236370 gene locus_tag LOCUS_15340 234889 236370 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485352.1 protein_id gnl|my_center|LOCUS_15340 236467 236778 gene locus_tag LOCUS_15350 236467 236778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 236754 237170 gene locus_tag LOCUS_15360 236754 237170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028878.1 protein_id gnl|my_center|LOCUS_15360 237528 237911 gene locus_tag LOCUS_15370 237528 237911 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 protein_id gnl|my_center|LOCUS_15370 237904 238383 gene locus_tag LOCUS_15380 237904 238383 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 protein_id gnl|my_center|LOCUS_15380 239100 238519 gene locus_tag LOCUS_15390 239100 238519 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200072.1 protein_id gnl|my_center|LOCUS_15390 239143 240324 gene locus_tag LOCUS_15400 239143 240324 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230887.1 protein_id gnl|my_center|LOCUS_15400 240560 240345 gene locus_tag LOCUS_15410 240560 240345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15410 241539 240808 gene locus_tag LOCUS_15420 241539 240808 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742118.1 protein_id gnl|my_center|LOCUS_15420 242632 241592 gene locus_tag LOCUS_15430 242632 241592 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229677.1 protein_id gnl|my_center|LOCUS_15430 242826 243182 gene locus_tag LOCUS_15440 242826 243182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 243259 243663 gene locus_tag LOCUS_15450 243259 243663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 244032 243679 gene locus_tag LOCUS_15460 244032 243679 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_15460 246161 244029 gene locus_tag LOCUS_15470 246161 244029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15470 246477 247442 gene locus_tag LOCUS_15480 246477 247442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 247439 248053 gene locus_tag LOCUS_15490 247439 248053 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971974.1 protein_id gnl|my_center|LOCUS_15490 248097 248459 gene locus_tag LOCUS_15500 248097 248459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 249236 248472 gene locus_tag LOCUS_15510 249236 248472 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403433.1 protein_id gnl|my_center|LOCUS_15510 249689 251086 gene locus_tag LOCUS_15520 249689 251086 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978484.1 protein_id gnl|my_center|LOCUS_15520 251088 252152 gene locus_tag LOCUS_15530 251088 252152 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_15530 253068 252166 gene locus_tag LOCUS_15540 253068 252166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 254739 253165 gene locus_tag LOCUS_15550 254739 253165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 255006 255977 gene locus_tag LOCUS_15560 gene rfbB 255006 255977 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_15560 256033 256875 gene locus_tag LOCUS_15570 gene rfbD 256033 256875 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_15570 257532 256915 gene locus_tag LOCUS_15580 257532 256915 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727714.1 protein_id gnl|my_center|LOCUS_15580 257645 258901 gene locus_tag LOCUS_15590 257645 258901 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027081.1 protein_id gnl|my_center|LOCUS_15590 258898 259674 gene locus_tag LOCUS_15600 258898 259674 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222499.1 protein_id gnl|my_center|LOCUS_15600 259671 260321 gene locus_tag LOCUS_15610 259671 260321 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222498.1 protein_id gnl|my_center|LOCUS_15610 260322 261341 gene locus_tag LOCUS_15620 260322 261341 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222497.1 protein_id gnl|my_center|LOCUS_15620 261353 262594 gene locus_tag LOCUS_15630 261353 262594 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 protein_id gnl|my_center|LOCUS_15630 262600 263616 gene locus_tag LOCUS_15640 262600 263616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 263632 265146 gene locus_tag LOCUS_15650 263632 265146 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973533.1 protein_id gnl|my_center|LOCUS_15650 265171 266064 gene locus_tag LOCUS_15660 265171 266064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 266302 267255 gene locus_tag LOCUS_15670 266302 267255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 268144 267275 gene locus_tag LOCUS_15680 268144 267275 CDS product DUF6492 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061722.1 protein_id gnl|my_center|LOCUS_15680 268329 269081 gene locus_tag LOCUS_15690 268329 269081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730923.1 protein_id gnl|my_center|LOCUS_15690 269105 270442 gene locus_tag LOCUS_15700 269105 270442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 271522 270515 gene locus_tag LOCUS_15710 271522 270515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 272205 271510 gene locus_tag LOCUS_15720 272205 271510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 272984 272436 gene locus_tag LOCUS_15730 gene rfbC 272984 272436 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730941.1 protein_id gnl|my_center|LOCUS_15730 273833 272997 gene locus_tag LOCUS_15740 273833 272997 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043607342.1 protein_id gnl|my_center|LOCUS_15740 275008 273830 gene locus_tag LOCUS_15750 275008 273830 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466568.1 protein_id gnl|my_center|LOCUS_15750 276314 274998 gene locus_tag LOCUS_15760 276314 274998 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222478.1 protein_id gnl|my_center|LOCUS_15760 276609 277580 gene locus_tag LOCUS_15770 276609 277580 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107852.1 protein_id gnl|my_center|LOCUS_15770 278462 277548 gene locus_tag LOCUS_15780 278462 277548 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730926.1 protein_id gnl|my_center|LOCUS_15780 278654 278806 gene locus_tag LOCUS_15790 278654 278806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 278812 279690 gene locus_tag LOCUS_15800 278812 279690 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535503.1 protein_id gnl|my_center|LOCUS_15800 280798 279737 gene locus_tag LOCUS_15810 280798 279737 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_15810 282635 280791 gene locus_tag LOCUS_15820 282635 280791 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_15820 283486 284712 gene locus_tag LOCUS_15830 283486 284712 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730935.1 protein_id gnl|my_center|LOCUS_15830 284748 285128 gene locus_tag LOCUS_15840 284748 285128 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974348.1 protein_id gnl|my_center|LOCUS_15840 285154 285672 gene locus_tag LOCUS_15850 285154 285672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 285669 286250 gene locus_tag LOCUS_15860 285669 286250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15860 286243 287196 gene locus_tag LOCUS_15870 286243 287196 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 protein_id gnl|my_center|LOCUS_15870 287193 288197 gene locus_tag LOCUS_15880 287193 288197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 288989 288892 gene locus_tag LOCUS_t00130 288989 288892 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 289201 289740 gene locus_tag LOCUS_15890 289201 289740 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_15890 289774 290166 gene locus_tag LOCUS_15900 gene nuoK 289774 290166 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029757.1 protein_id gnl|my_center|LOCUS_15900 290163 292058 gene locus_tag LOCUS_15910 290163 292058 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029758.1 protein_id gnl|my_center|LOCUS_15910 292055 293683 gene locus_tag LOCUS_15920 292055 293683 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_15920 293680 295158 gene locus_tag LOCUS_15930 293680 295158 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029760.1 protein_id gnl|my_center|LOCUS_15930 295244 296092 gene locus_tag LOCUS_15940 gene htpX 295244 296092 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_15940 296673 296080 gene locus_tag LOCUS_15950 296673 296080 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_15950 297172 296705 gene locus_tag LOCUS_15960 297172 296705 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225436.1 protein_id gnl|my_center|LOCUS_15960 297240 298646 gene locus_tag LOCUS_15970 297240 298646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 299383 298643 gene locus_tag LOCUS_15980 299383 298643 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_15980 300129 299380 gene locus_tag LOCUS_15990 300129 299380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 301090 300209 gene locus_tag LOCUS_16000 301090 300209 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583414.1 protein_id gnl|my_center|LOCUS_16000 301482 301294 gene locus_tag LOCUS_16010 301482 301294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 301501 302085 gene locus_tag LOCUS_16020 301501 302085 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230397.1 protein_id gnl|my_center|LOCUS_16020 302078 303283 gene locus_tag LOCUS_16030 302078 303283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 303759 303235 gene locus_tag LOCUS_16040 303759 303235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 304475 303882 gene locus_tag LOCUS_16050 304475 303882 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338540.1 protein_id gnl|my_center|LOCUS_16050 304608 305525 gene locus_tag LOCUS_16060 304608 305525 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228034.1 protein_id gnl|my_center|LOCUS_16060 306708 305497 gene locus_tag LOCUS_16070 306708 305497 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224376.1 protein_id gnl|my_center|LOCUS_16070 307640 307152 gene locus_tag LOCUS_16080 307640 307152 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_16080 308173 307694 gene locus_tag LOCUS_16090 308173 307694 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229593.1 protein_id gnl|my_center|LOCUS_16090 308312 308394 gene locus_tag LOCUS_t00140 308312 308394 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 308684 308818 gene locus_tag LOCUS_16100 308684 308818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 309094 309438 gene locus_tag LOCUS_16110 309094 309438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 309999 309736 gene locus_tag LOCUS_16120 309999 309736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 310589 310242 gene locus_tag LOCUS_16130 310589 310242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 310720 311493 gene locus_tag LOCUS_16140 310720 311493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 311807 312553 gene locus_tag LOCUS_16150 311807 312553 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469478.1 protein_id gnl|my_center|LOCUS_16150 312891 313337 gene locus_tag LOCUS_16160 312891 313337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 313454 314275 gene locus_tag LOCUS_16170 313454 314275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 314593 314859 gene locus_tag LOCUS_16180 314593 314859 CDS product CPCC family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877836.1 protein_id gnl|my_center|LOCUS_16180 315223 316080 gene locus_tag LOCUS_16190 315223 316080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 316637 316155 gene locus_tag LOCUS_16200 316637 316155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 317085 316618 gene locus_tag LOCUS_16210 317085 316618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 317859 317290 gene locus_tag LOCUS_16220 317859 317290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 319431 318310 gene locus_tag LOCUS_16230 319431 318310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 320373 319549 gene locus_tag LOCUS_16240 320373 319549 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230165.1 protein_id gnl|my_center|LOCUS_16240 320421 320837 gene locus_tag LOCUS_16250 320421 320837 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199881.1 protein_id gnl|my_center|LOCUS_16250 321298 320888 gene locus_tag LOCUS_16260 321298 320888 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 protein_id gnl|my_center|LOCUS_16260 321425 322135 gene locus_tag LOCUS_16270 321425 322135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 323251 322238 gene locus_tag LOCUS_16280 323251 322238 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728688.1 protein_id gnl|my_center|LOCUS_16280 323380 323985 gene locus_tag LOCUS_16290 323380 323985 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228785.1 protein_id gnl|my_center|LOCUS_16290 324077 325063 gene locus_tag LOCUS_16300 324077 325063 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089460.1 protein_id gnl|my_center|LOCUS_16300 325603 325118 gene locus_tag LOCUS_16310 325603 325118 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228154.1 protein_id gnl|my_center|LOCUS_16310 325699 326001 gene locus_tag LOCUS_16320 325699 326001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 325998 326843 gene locus_tag LOCUS_16330 325998 326843 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228291.1 protein_id gnl|my_center|LOCUS_16330 327288 326893 gene locus_tag LOCUS_16340 327288 326893 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029240.1 protein_id gnl|my_center|LOCUS_16340 327341 328354 gene locus_tag LOCUS_16350 327341 328354 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029241.1 protein_id gnl|my_center|LOCUS_16350 329171 328371 gene locus_tag LOCUS_16360 329171 328371 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484409.1 protein_id gnl|my_center|LOCUS_16360 329274 330116 gene locus_tag LOCUS_16370 329274 330116 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727008.1 protein_id gnl|my_center|LOCUS_16370 330543 330142 gene locus_tag LOCUS_16380 330543 330142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 331979 330750 gene locus_tag LOCUS_16390 331979 330750 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_16390 332746 332138 gene locus_tag LOCUS_16400 332746 332138 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031285.1 protein_id gnl|my_center|LOCUS_16400 332928 333656 gene locus_tag LOCUS_16410 332928 333656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 335562 333763 gene locus_tag LOCUS_16420 335562 333763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 335942 336583 gene locus_tag LOCUS_16430 gene pnuC 335942 336583 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_16430 336580 337701 gene locus_tag LOCUS_16440 336580 337701 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_16440 337848 338057 gene locus_tag LOCUS_16450 337848 338057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 338119 338595 gene locus_tag LOCUS_16460 338119 338595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 338701 338774 gene locus_tag LOCUS_t00150 338701 338774 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 339315 338851 gene locus_tag LOCUS_16470 339315 338851 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097940908.1 protein_id gnl|my_center|LOCUS_16470 339559 340020 gene locus_tag LOCUS_16480 339559 340020 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027141.1 protein_id gnl|my_center|LOCUS_16480 340952 340035 gene locus_tag LOCUS_16490 340952 340035 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729840.1 protein_id gnl|my_center|LOCUS_16490 341333 341407 gene locus_tag LOCUS_t00160 341333 341407 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 341486 341650 gene locus_tag LOCUS_16500 gene rpmG 341486 341650 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005152047.1 protein_id gnl|my_center|LOCUS_16500 342118 342567 gene locus_tag LOCUS_16510 342118 342567 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_16510 342570 342998 gene locus_tag LOCUS_16520 342570 342998 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_16520 343138 344187 gene locus_tag LOCUS_16530 343138 344187 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_16530 344434 345003 gene locus_tag LOCUS_16540 344434 345003 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_16540 347908 345029 gene locus_tag LOCUS_16550 347908 345029 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 protein_id gnl|my_center|LOCUS_16550 348181 348020 gene locus_tag LOCUS_16560 348181 348020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 348428 349375 gene locus_tag LOCUS_16570 gene deoC 348428 349375 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_16570 349388 350815 gene locus_tag LOCUS_16580 349388 350815 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_16580 350805 351014 gene locus_tag LOCUS_16590 350805 351014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 351007 351873 gene locus_tag LOCUS_16600 351007 351873 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_16600 352548 352261 gene locus_tag LOCUS_16610 352548 352261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 353647 352589 gene locus_tag LOCUS_16620 353647 352589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 353604 354011 gene locus_tag LOCUS_16630 353604 354011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 354867 354289 gene locus_tag LOCUS_16640 354867 354289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 355502 354906 gene locus_tag LOCUS_16650 355502 354906 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_16650 355577 356533 gene locus_tag LOCUS_16660 355577 356533 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031515.1 protein_id gnl|my_center|LOCUS_16660 356785 357807 gene locus_tag LOCUS_16670 356785 357807 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726777.1 protein_id gnl|my_center|LOCUS_16670 357918 358109 gene locus_tag LOCUS_16680 357918 358109 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222993.1 protein_id gnl|my_center|LOCUS_16680 358198 358833 gene locus_tag LOCUS_16690 gene lipB 358198 358833 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618236.1 protein_id gnl|my_center|LOCUS_16690 358884 359306 gene locus_tag LOCUS_16700 358884 359306 CDS product DUF6157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_16700 359450 359965 gene locus_tag LOCUS_16710 359450 359965 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065742.1 protein_id gnl|my_center|LOCUS_16710 360223 360528 gene locus_tag LOCUS_16720 360223 360528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 360779 360507 gene locus_tag LOCUS_16730 360779 360507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16730 361421 360783 gene locus_tag LOCUS_16740 361421 360783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16740 361744 361418 gene locus_tag LOCUS_16750 361744 361418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16750 361794 362885 gene locus_tag LOCUS_16760 361794 362885 CDS product IS701 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209648948.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence05 471 1 gene locus_tag LOCUS_16770 471 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1639 617 gene locus_tag LOCUS_16780 1639 617 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204071685.1 protein_id gnl|my_center|LOCUS_16780 2446 1703 gene locus_tag LOCUS_16790 2446 1703 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028373.1 protein_id gnl|my_center|LOCUS_16790 3586 2516 gene locus_tag LOCUS_16800 3586 2516 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727584.1 protein_id gnl|my_center|LOCUS_16800 3705 4538 gene locus_tag LOCUS_16810 3705 4538 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727583.1 protein_id gnl|my_center|LOCUS_16810 5798 4806 gene locus_tag LOCUS_16820 5798 4806 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989852.1 protein_id gnl|my_center|LOCUS_16820 7126 5795 gene locus_tag LOCUS_16830 7126 5795 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_16830 7222 8415 gene locus_tag LOCUS_16840 7222 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 9396 8479 gene locus_tag LOCUS_16850 9396 8479 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_16850 10547 9393 gene locus_tag LOCUS_16860 10547 9393 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_16860 11512 10544 gene locus_tag LOCUS_16870 11512 10544 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530866.1 protein_id gnl|my_center|LOCUS_16870 12483 11509 gene locus_tag LOCUS_16880 12483 11509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037436677.1 protein_id gnl|my_center|LOCUS_16880 13966 12485 gene locus_tag LOCUS_16890 13966 12485 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140810.1 protein_id gnl|my_center|LOCUS_16890 15033 13966 gene locus_tag LOCUS_16900 15033 13966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 15886 15095 gene locus_tag LOCUS_16910 15886 15095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 15975 16727 gene locus_tag LOCUS_16920 gene nagR 15975 16727 CDS product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 protein_id gnl|my_center|LOCUS_16920 17745 16822 gene locus_tag LOCUS_16930 17745 16822 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_16930 18434 17742 gene locus_tag LOCUS_16940 gene deoC 18434 17742 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458726.1 protein_id gnl|my_center|LOCUS_16940 19188 18454 gene locus_tag LOCUS_16950 19188 18454 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109031481.1 protein_id gnl|my_center|LOCUS_16950 20316 19711 gene locus_tag LOCUS_16960 20316 19711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 20502 21221 gene locus_tag LOCUS_16970 20502 21221 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 protein_id gnl|my_center|LOCUS_16970 21797 21426 gene locus_tag LOCUS_16980 21797 21426 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974466.1 protein_id gnl|my_center|LOCUS_16980 22350 21841 gene locus_tag LOCUS_16990 22350 21841 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486482.1 protein_id gnl|my_center|LOCUS_16990 22431 23306 gene locus_tag LOCUS_17000 22431 23306 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974468.1 protein_id gnl|my_center|LOCUS_17000 24386 23484 gene locus_tag LOCUS_17010 24386 23484 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974977.1 protein_id gnl|my_center|LOCUS_17010 25206 24454 gene locus_tag LOCUS_17020 25206 24454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 27022 25223 gene locus_tag LOCUS_17030 27022 25223 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029406.1 protein_id gnl|my_center|LOCUS_17030 28777 27299 gene locus_tag LOCUS_17040 28777 27299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228691.1 protein_id gnl|my_center|LOCUS_17040 28659 29006 gene locus_tag LOCUS_17050 28659 29006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 29970 29014 gene locus_tag LOCUS_17060 29970 29014 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228899.1 protein_id gnl|my_center|LOCUS_17060 31803 30079 gene locus_tag LOCUS_17070 31803 30079 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803883.1 protein_id gnl|my_center|LOCUS_17070 32144 31800 gene locus_tag LOCUS_17080 32144 31800 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_17080 32341 32141 gene locus_tag LOCUS_17090 32341 32141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 32532 32936 gene locus_tag LOCUS_17100 32532 32936 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110060.1 protein_id gnl|my_center|LOCUS_17100 33536 33979 gene locus_tag LOCUS_17110 33536 33979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 34078 34224 gene locus_tag LOCUS_17120 34078 34224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 34785 39521 gene locus_tag LOCUS_17130 34785 39521 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170068736.1 protein_id gnl|my_center|LOCUS_17130 39613 42777 gene locus_tag LOCUS_17140 39613 42777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 42817 43449 gene locus_tag LOCUS_17150 42817 43449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803765.1 protein_id gnl|my_center|LOCUS_17150 43465 44559 gene locus_tag LOCUS_17160 43465 44559 CDS product DUF916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803766.1 protein_id gnl|my_center|LOCUS_17160 45190 44630 gene locus_tag LOCUS_17170 45190 44630 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225840.1 protein_id gnl|my_center|LOCUS_17170 45436 46044 gene locus_tag LOCUS_17180 45436 46044 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225839.1 protein_id gnl|my_center|LOCUS_17180 46613 46233 gene locus_tag LOCUS_17190 46613 46233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 46494 48605 gene locus_tag LOCUS_17200 46494 48605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 48719 49333 gene locus_tag LOCUS_17210 48719 49333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 49500 50048 gene locus_tag LOCUS_17220 49500 50048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 51674 50250 gene locus_tag LOCUS_17230 51674 50250 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031786.1 protein_id gnl|my_center|LOCUS_17230 51902 52129 gene locus_tag LOCUS_17240 51902 52129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 52396 53712 gene locus_tag LOCUS_17250 52396 53712 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974451.1 protein_id gnl|my_center|LOCUS_17250 53967 54836 gene locus_tag LOCUS_17260 53967 54836 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067118245.1 protein_id gnl|my_center|LOCUS_17260 54907 55965 gene locus_tag LOCUS_17270 54907 55965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 56477 55995 gene locus_tag LOCUS_17280 56477 55995 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891579.1 protein_id gnl|my_center|LOCUS_17280 57811 56474 gene locus_tag LOCUS_17290 57811 56474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 59054 57831 gene locus_tag LOCUS_17300 59054 57831 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929590.1 protein_id gnl|my_center|LOCUS_17300 59139 59687 gene locus_tag LOCUS_17310 59139 59687 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 protein_id gnl|my_center|LOCUS_17310 59790 60938 gene locus_tag LOCUS_17320 59790 60938 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064836.1 protein_id gnl|my_center|LOCUS_17320 61202 62176 gene locus_tag LOCUS_17330 61202 62176 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068221.1 protein_id gnl|my_center|LOCUS_17330 62220 63320 gene locus_tag LOCUS_17340 62220 63320 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082323.1 protein_id gnl|my_center|LOCUS_17340 63372 64031 gene locus_tag LOCUS_17350 63372 64031 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057738.1 protein_id gnl|my_center|LOCUS_17350 64553 65533 gene locus_tag LOCUS_17360 64553 65533 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225347.1 protein_id gnl|my_center|LOCUS_17360 65530 66306 gene locus_tag LOCUS_17370 65530 66306 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226152.1 protein_id gnl|my_center|LOCUS_17370 66326 67204 gene locus_tag LOCUS_17380 66326 67204 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230260.1 protein_id gnl|my_center|LOCUS_17380 67216 67989 gene locus_tag LOCUS_17390 67216 67989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230261.1 protein_id gnl|my_center|LOCUS_17390 68076 69338 gene locus_tag LOCUS_17400 68076 69338 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 protein_id gnl|my_center|LOCUS_17400 70094 69393 gene locus_tag LOCUS_17410 70094 69393 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_17410 71266 70301 gene locus_tag LOCUS_17420 71266 70301 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228674.1 protein_id gnl|my_center|LOCUS_17420 71634 71320 gene locus_tag LOCUS_17430 71634 71320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 71823 72707 gene locus_tag LOCUS_17440 71823 72707 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229445.1 protein_id gnl|my_center|LOCUS_17440 73133 74551 gene locus_tag LOCUS_17450 73133 74551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 74702 75112 gene locus_tag LOCUS_17460 74702 75112 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971536.1 protein_id gnl|my_center|LOCUS_17460 76861 75176 gene locus_tag LOCUS_17470 76861 75176 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730685.1 protein_id gnl|my_center|LOCUS_17470 79700 76920 gene locus_tag LOCUS_17480 79700 76920 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225365.1 protein_id gnl|my_center|LOCUS_17480 79858 80511 gene locus_tag LOCUS_17490 79858 80511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 81512 81156 gene locus_tag LOCUS_17500 81512 81156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 81532 83778 gene locus_tag LOCUS_17510 81532 83778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 84027 85409 gene locus_tag LOCUS_17520 84027 85409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 87264 85489 gene locus_tag LOCUS_17530 87264 85489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 88244 87363 gene locus_tag LOCUS_17540 88244 87363 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_17540 88770 90017 gene locus_tag LOCUS_17550 88770 90017 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225610.1 protein_id gnl|my_center|LOCUS_17550 91073 90072 gene locus_tag LOCUS_17560 91073 90072 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227277.1 protein_id gnl|my_center|LOCUS_17560 91777 91115 gene locus_tag LOCUS_17570 91777 91115 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978707.1 protein_id gnl|my_center|LOCUS_17570 92838 91978 gene locus_tag LOCUS_17580 92838 91978 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 protein_id gnl|my_center|LOCUS_17580 93131 92946 gene locus_tag LOCUS_17590 93131 92946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 93395 96052 gene locus_tag LOCUS_17600 93395 96052 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879008.1 protein_id gnl|my_center|LOCUS_17600 96081 96779 gene locus_tag LOCUS_17610 96081 96779 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_17610 97451 96894 gene locus_tag LOCUS_17620 97451 96894 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 protein_id gnl|my_center|LOCUS_17620 97578 99317 gene locus_tag LOCUS_17630 97578 99317 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_17630 99670 99314 gene locus_tag LOCUS_17640 99670 99314 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730338.1 protein_id gnl|my_center|LOCUS_17640 100456 99863 gene locus_tag LOCUS_17650 100456 99863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 100862 100617 gene locus_tag LOCUS_17660 100862 100617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 100743 101651 gene locus_tag LOCUS_17670 100743 101651 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868678.1 protein_id gnl|my_center|LOCUS_17670 101648 102610 gene locus_tag LOCUS_17680 101648 102610 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_17680 105109 102731 gene locus_tag LOCUS_17690 105109 102731 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190946.1 protein_id gnl|my_center|LOCUS_17690 106474 105272 gene locus_tag LOCUS_17700 106474 105272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 107187 106471 gene locus_tag LOCUS_17710 107187 106471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_17710 109237 107180 gene locus_tag LOCUS_17720 109237 107180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 110103 109234 gene locus_tag LOCUS_17730 110103 109234 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_17730 111516 110266 gene locus_tag LOCUS_17740 111516 110266 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240446.1 protein_id gnl|my_center|LOCUS_17740 113260 111560 gene locus_tag LOCUS_17750 113260 111560 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095410.1 protein_id gnl|my_center|LOCUS_17750 114270 113923 gene locus_tag LOCUS_17760 114270 113923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 114196 115023 gene locus_tag LOCUS_17770 114196 115023 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226682.1 protein_id gnl|my_center|LOCUS_17770 115915 115049 gene locus_tag LOCUS_17780 115915 115049 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_17780 117306 115930 gene locus_tag LOCUS_17790 117306 115930 CDS product NADP-dependent succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912534.1 protein_id gnl|my_center|LOCUS_17790 118490 117612 gene locus_tag LOCUS_17800 118490 117612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 119188 118676 gene locus_tag LOCUS_17810 119188 118676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 119309 119686 gene locus_tag LOCUS_17820 119309 119686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 119974 120315 gene locus_tag LOCUS_17830 119974 120315 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068923899.1 protein_id gnl|my_center|LOCUS_17830 120319 120825 gene locus_tag LOCUS_17840 120319 120825 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993326.1 protein_id gnl|my_center|LOCUS_17840 120825 121445 gene locus_tag LOCUS_17850 120825 121445 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258321.1 protein_id gnl|my_center|LOCUS_17850 122113 121652 gene locus_tag LOCUS_17860 122113 121652 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_17860 122697 122110 gene locus_tag LOCUS_17870 122697 122110 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222694.1 protein_id gnl|my_center|LOCUS_17870 122760 123755 gene locus_tag LOCUS_17880 122760 123755 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727621.1 protein_id gnl|my_center|LOCUS_17880 124546 123782 gene locus_tag LOCUS_17890 gene fabG 124546 123782 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_17890 126141 124588 gene locus_tag LOCUS_17900 126141 124588 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083814.1 protein_id gnl|my_center|LOCUS_17900 127471 126182 gene locus_tag LOCUS_17910 127471 126182 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966145.1 protein_id gnl|my_center|LOCUS_17910 127557 128030 gene locus_tag LOCUS_17920 127557 128030 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_17920 128063 129253 gene locus_tag LOCUS_17930 128063 129253 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_17930 129250 130350 gene locus_tag LOCUS_17940 129250 130350 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225001.1 protein_id gnl|my_center|LOCUS_17940 131205 130387 gene locus_tag LOCUS_17950 131205 130387 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_17950 131864 131208 gene locus_tag LOCUS_17960 131864 131208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 132979 131861 gene locus_tag LOCUS_17970 132979 131861 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259474.1 protein_id gnl|my_center|LOCUS_17970 133889 132987 gene locus_tag LOCUS_17980 133889 132987 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382800.1 protein_id gnl|my_center|LOCUS_17980 134617 133886 gene locus_tag LOCUS_17990 134617 133886 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259472.1 protein_id gnl|my_center|LOCUS_17990 135378 134614 gene locus_tag LOCUS_18000 135378 134614 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 protein_id gnl|my_center|LOCUS_18000 136597 135380 gene locus_tag LOCUS_18010 136597 135380 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965179.1 protein_id gnl|my_center|LOCUS_18010 136908 137912 gene locus_tag LOCUS_18020 136908 137912 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228493.1 protein_id gnl|my_center|LOCUS_18020 138744 138061 gene locus_tag LOCUS_18030 138744 138061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 138954 139754 gene locus_tag LOCUS_18040 138954 139754 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 protein_id gnl|my_center|LOCUS_18040 139761 140558 gene locus_tag LOCUS_18050 139761 140558 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_18050 140555 141574 gene locus_tag LOCUS_18060 140555 141574 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_18060 141584 142810 gene locus_tag LOCUS_18070 141584 142810 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_18070 142807 143589 gene locus_tag LOCUS_18080 142807 143589 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224990.1 protein_id gnl|my_center|LOCUS_18080 143618 144331 gene locus_tag LOCUS_18090 143618 144331 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029480.1 protein_id gnl|my_center|LOCUS_18090 145048 144386 gene locus_tag LOCUS_18100 145048 144386 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222882.1 protein_id gnl|my_center|LOCUS_18100 146172 145045 gene locus_tag LOCUS_18110 146172 145045 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222881.1 protein_id gnl|my_center|LOCUS_18110 146388 146819 gene locus_tag LOCUS_18120 146388 146819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 148639 146816 gene locus_tag LOCUS_18130 148639 146816 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948579.1 protein_id gnl|my_center|LOCUS_18130 148972 150030 gene locus_tag LOCUS_18140 148972 150030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 150538 151989 gene locus_tag LOCUS_18150 150538 151989 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028539.1 protein_id gnl|my_center|LOCUS_18150 152935 152087 gene locus_tag LOCUS_18160 152935 152087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 153965 153303 gene locus_tag LOCUS_18170 153965 153303 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223207.1 protein_id gnl|my_center|LOCUS_18170 154099 155535 gene locus_tag LOCUS_18180 154099 155535 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223303.1 protein_id gnl|my_center|LOCUS_18180 155553 156575 gene locus_tag LOCUS_18190 155553 156575 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_18190 156638 157051 gene locus_tag LOCUS_18200 156638 157051 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975062.1 protein_id gnl|my_center|LOCUS_18200 157793 157299 gene locus_tag LOCUS_18210 157793 157299 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261973.1 protein_id gnl|my_center|LOCUS_18210 159158 157986 gene locus_tag LOCUS_18220 159158 157986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 159464 160414 gene locus_tag LOCUS_18230 159464 160414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 160748 161695 gene locus_tag LOCUS_18240 160748 161695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 161745 162788 gene locus_tag LOCUS_18250 gene hisC 161745 162788 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_18250 162788 164032 gene locus_tag LOCUS_18260 162788 164032 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080561929.1 protein_id gnl|my_center|LOCUS_18260 164964 164029 gene locus_tag LOCUS_18270 164964 164029 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_18270 165209 166549 gene locus_tag LOCUS_18280 165209 166549 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224282.1 protein_id gnl|my_center|LOCUS_18280 167661 166561 gene locus_tag LOCUS_18290 167661 166561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 protein_id gnl|my_center|LOCUS_18290 168791 167664 gene locus_tag LOCUS_18300 168791 167664 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728110.1 protein_id gnl|my_center|LOCUS_18300 169402 169563 gene locus_tag LOCUS_18310 169402 169563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18310 170477 169578 gene locus_tag LOCUS_18320 gene sigJ 170477 169578 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978451.1 protein_id gnl|my_center|LOCUS_18320 170722 171801 gene locus_tag LOCUS_18330 170722 171801 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 protein_id gnl|my_center|LOCUS_18330 172434 171844 gene locus_tag LOCUS_18340 172434 171844 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 protein_id gnl|my_center|LOCUS_18340 172589 173608 gene locus_tag LOCUS_18350 172589 173608 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_18350 174281 173928 gene locus_tag LOCUS_18360 174281 173928 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074955.1 protein_id gnl|my_center|LOCUS_18360 174724 174278 gene locus_tag LOCUS_18370 174724 174278 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029408.1 protein_id gnl|my_center|LOCUS_18370 175847 174822 gene locus_tag LOCUS_18380 175847 174822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037665946.1 protein_id gnl|my_center|LOCUS_18380 175965 176585 gene locus_tag LOCUS_18390 175965 176585 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225203.1 protein_id gnl|my_center|LOCUS_18390 177492 176596 gene locus_tag LOCUS_18400 177492 176596 CDS product hydroxyquinol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731481.1 protein_id gnl|my_center|LOCUS_18400 178547 177639 gene locus_tag LOCUS_18410 178547 177639 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223526.1 protein_id gnl|my_center|LOCUS_18410 178619 179605 gene locus_tag LOCUS_18420 178619 179605 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 protein_id gnl|my_center|LOCUS_18420 180557 179607 gene locus_tag LOCUS_18430 180557 179607 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030530.1 protein_id gnl|my_center|LOCUS_18430 180669 181922 gene locus_tag LOCUS_18440 180669 181922 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027368.1 protein_id gnl|my_center|LOCUS_18440 182122 184356 gene locus_tag LOCUS_18450 182122 184356 CDS product M64 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227863.1 protein_id gnl|my_center|LOCUS_18450 185259 184585 gene locus_tag LOCUS_18460 185259 184585 CDS product TioE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230388.1 protein_id gnl|my_center|LOCUS_18460 185335 186516 gene locus_tag LOCUS_18470 185335 186516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 186723 187430 gene locus_tag LOCUS_18480 186723 187430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028451.1 protein_id gnl|my_center|LOCUS_18480 188062 187391 gene locus_tag LOCUS_18490 188062 187391 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973620.1 protein_id gnl|my_center|LOCUS_18490 189285 188059 gene locus_tag LOCUS_18500 189285 188059 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030212.1 protein_id gnl|my_center|LOCUS_18500 189408 189962 gene locus_tag LOCUS_18510 189408 189962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030213.1 protein_id gnl|my_center|LOCUS_18510 190085 190504 gene locus_tag LOCUS_18520 190085 190504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 192208 190577 gene locus_tag LOCUS_18530 192208 190577 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031038.1 protein_id gnl|my_center|LOCUS_18530 192764 192354 gene locus_tag LOCUS_18540 192764 192354 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031354.1 protein_id gnl|my_center|LOCUS_18540 193159 194652 gene locus_tag LOCUS_18550 193159 194652 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029898.1 protein_id gnl|my_center|LOCUS_18550 195517 194642 gene locus_tag LOCUS_18560 195517 194642 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689435.1 protein_id gnl|my_center|LOCUS_18560 196065 195529 gene locus_tag LOCUS_18570 196065 195529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 196116 196859 gene locus_tag LOCUS_18580 196116 196859 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228695.1 protein_id gnl|my_center|LOCUS_18580 197721 196822 gene locus_tag LOCUS_18590 197721 196822 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729258.1 protein_id gnl|my_center|LOCUS_18590 198277 197708 gene locus_tag LOCUS_18600 198277 197708 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731396.1 protein_id gnl|my_center|LOCUS_18600 198364 198786 gene locus_tag LOCUS_18610 198364 198786 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225300.1 protein_id gnl|my_center|LOCUS_18610 200206 198806 gene locus_tag LOCUS_18620 200206 198806 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926802.1 protein_id gnl|my_center|LOCUS_18620 201196 200309 gene locus_tag LOCUS_18630 gene dapA 201196 200309 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225337.1 protein_id gnl|my_center|LOCUS_18630 201268 202167 gene locus_tag LOCUS_18640 201268 202167 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226795.1 protein_id gnl|my_center|LOCUS_18640 202681 202187 gene locus_tag LOCUS_18650 202681 202187 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973501.1 protein_id gnl|my_center|LOCUS_18650 203093 202722 gene locus_tag LOCUS_18660 203093 202722 CDS product DUF4267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030280.1 protein_id gnl|my_center|LOCUS_18660 203180 203752 gene locus_tag LOCUS_18670 203180 203752 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227794.1 protein_id gnl|my_center|LOCUS_18670 203964 204965 gene locus_tag LOCUS_18680 203964 204965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228828.1 protein_id gnl|my_center|LOCUS_18680 204962 205813 gene locus_tag LOCUS_18690 204962 205813 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228829.1 protein_id gnl|my_center|LOCUS_18690 205874 206263 gene locus_tag LOCUS_18700 205874 206263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 208372 206282 gene locus_tag LOCUS_18710 208372 206282 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922509.1 protein_id gnl|my_center|LOCUS_18710 209392 208715 gene locus_tag LOCUS_18720 209392 208715 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_18720 210265 209603 gene locus_tag LOCUS_18730 210265 209603 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225902.1 protein_id gnl|my_center|LOCUS_18730 211416 210268 gene locus_tag LOCUS_18740 211416 210268 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225901.1 protein_id gnl|my_center|LOCUS_18740 211563 212522 gene locus_tag LOCUS_18750 211563 212522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18750 212519 214093 gene locus_tag LOCUS_18760 212519 214093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103962448.1 protein_id gnl|my_center|LOCUS_18760 214090 214866 gene locus_tag LOCUS_18770 214090 214866 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 protein_id gnl|my_center|LOCUS_18770 216018 214870 gene locus_tag LOCUS_18780 216018 214870 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_18780 217131 216037 gene locus_tag LOCUS_18790 217131 216037 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969965.1 protein_id gnl|my_center|LOCUS_18790 218134 217181 gene locus_tag LOCUS_18800 218134 217181 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971447.1 protein_id gnl|my_center|LOCUS_18800 218787 218200 gene locus_tag LOCUS_18810 218787 218200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 220256 218784 gene locus_tag LOCUS_18820 220256 218784 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027916.1 protein_id gnl|my_center|LOCUS_18820 221421 220735 gene locus_tag LOCUS_18830 221421 220735 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971520.1 protein_id gnl|my_center|LOCUS_18830 221495 223081 gene locus_tag LOCUS_18840 221495 223081 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226069.1 protein_id gnl|my_center|LOCUS_18840 223232 224647 gene locus_tag LOCUS_18850 223232 224647 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029563.1 protein_id gnl|my_center|LOCUS_18850 225492 224680 gene locus_tag LOCUS_18860 225492 224680 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031408.1 protein_id gnl|my_center|LOCUS_18860 225835 225530 gene locus_tag LOCUS_18870 225835 225530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 225834 226640 gene locus_tag LOCUS_18880 225834 226640 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_18880 227526 226648 gene locus_tag LOCUS_18890 227526 226648 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027366.1 protein_id gnl|my_center|LOCUS_18890 229138 227657 gene locus_tag LOCUS_18900 gene araA 229138 227657 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226247.1 protein_id gnl|my_center|LOCUS_18900 229794 229135 gene locus_tag LOCUS_18910 229794 229135 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893113.1 protein_id gnl|my_center|LOCUS_18910 231440 229791 gene locus_tag LOCUS_18920 gene araB 231440 229791 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226245.1 protein_id gnl|my_center|LOCUS_18920 232517 231525 gene locus_tag LOCUS_18930 232517 231525 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226230.1 protein_id gnl|my_center|LOCUS_18930 232832 233962 gene locus_tag LOCUS_18940 gene chvE 232832 233962 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226248.1 protein_id gnl|my_center|LOCUS_18940 234037 235566 gene locus_tag LOCUS_18950 gene gguA 234037 235566 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226249.1 protein_id gnl|my_center|LOCUS_18950 235572 236834 gene locus_tag LOCUS_18960 gene gguB 235572 236834 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226250.1 protein_id gnl|my_center|LOCUS_18960 237372 236920 gene locus_tag LOCUS_18970 237372 236920 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929224.1 protein_id gnl|my_center|LOCUS_18970 238076 237456 gene locus_tag LOCUS_18980 238076 237456 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112465.1 protein_id gnl|my_center|LOCUS_18980 239243 238119 gene locus_tag LOCUS_18990 239243 238119 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226537.1 protein_id gnl|my_center|LOCUS_18990 239620 239282 gene locus_tag LOCUS_19000 239620 239282 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_19000 241005 239743 gene locus_tag LOCUS_19010 gene clpX 241005 239743 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_19010 241172 242245 gene locus_tag LOCUS_19020 241172 242245 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226538.1 protein_id gnl|my_center|LOCUS_19020 243013 242264 gene locus_tag LOCUS_19030 243013 242264 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 protein_id gnl|my_center|LOCUS_19030 244016 243051 gene locus_tag LOCUS_19040 244016 243051 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461138.1 protein_id gnl|my_center|LOCUS_19040 244441 244776 gene locus_tag LOCUS_19050 244441 244776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 244698 245378 gene locus_tag LOCUS_19060 244698 245378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19060 248049 245350 gene locus_tag LOCUS_19070 248049 245350 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031458.1 protein_id gnl|my_center|LOCUS_19070 248219 248659 gene locus_tag LOCUS_19080 248219 248659 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228553.1 protein_id gnl|my_center|LOCUS_19080 248656 249543 gene locus_tag LOCUS_19090 248656 249543 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812933.1 protein_id gnl|my_center|LOCUS_19090 249536 249928 gene locus_tag LOCUS_19100 249536 249928 CDS product DUF4180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 protein_id gnl|my_center|LOCUS_19100 250618 250052 gene locus_tag LOCUS_19110 250618 250052 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030768.1 protein_id gnl|my_center|LOCUS_19110 250791 251255 gene locus_tag LOCUS_19120 250791 251255 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227147.1 protein_id gnl|my_center|LOCUS_19120 251726 251286 gene locus_tag LOCUS_19130 gene soxR 251726 251286 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476095.1 protein_id gnl|my_center|LOCUS_19130 251847 252713 gene locus_tag LOCUS_19140 251847 252713 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230668.1 protein_id gnl|my_center|LOCUS_19140 253818 252745 gene locus_tag LOCUS_19150 253818 252745 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467826.1 protein_id gnl|my_center|LOCUS_19150 254814 253945 gene locus_tag LOCUS_19160 254814 253945 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229423.1 protein_id gnl|my_center|LOCUS_19160 254932 255513 gene locus_tag LOCUS_19170 254932 255513 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974101.1 protein_id gnl|my_center|LOCUS_19170 256134 255607 gene locus_tag LOCUS_19180 256134 255607 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226547.1 protein_id gnl|my_center|LOCUS_19180 257449 256397 gene locus_tag LOCUS_19190 257449 256397 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226059.1 protein_id gnl|my_center|LOCUS_19190 258045 258578 gene locus_tag LOCUS_19200 258045 258578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223938.1 protein_id gnl|my_center|LOCUS_19200 258653 259489 gene locus_tag LOCUS_19210 258653 259489 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223937.1 protein_id gnl|my_center|LOCUS_19210 259589 260575 gene locus_tag LOCUS_19220 259589 260575 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221977.1 protein_id gnl|my_center|LOCUS_19220 260572 261363 gene locus_tag LOCUS_19230 260572 261363 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_19230 261495 262406 gene locus_tag LOCUS_19240 261495 262406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 263004 262582 gene locus_tag LOCUS_19250 263004 262582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 263273 263016 gene locus_tag LOCUS_19260 263273 263016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 263635 263273 gene locus_tag LOCUS_19270 263635 263273 CDS product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583104.1 protein_id gnl|my_center|LOCUS_19270 265337 264105 gene locus_tag LOCUS_19280 265337 264105 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226428.1 protein_id gnl|my_center|LOCUS_19280 267009 265471 gene locus_tag LOCUS_19290 267009 265471 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067284407.1 protein_id gnl|my_center|LOCUS_19290 268745 267021 gene locus_tag LOCUS_19300 gene gcl 268745 267021 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125316584.1 protein_id gnl|my_center|LOCUS_19300 269679 268810 gene locus_tag LOCUS_19310 269679 268810 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226420.1 protein_id gnl|my_center|LOCUS_19310 270461 269676 gene locus_tag LOCUS_19320 270461 269676 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972721.1 protein_id gnl|my_center|LOCUS_19320 271435 270551 gene locus_tag LOCUS_19330 gene sucD 271435 270551 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031023.1 protein_id gnl|my_center|LOCUS_19330 272669 271512 gene locus_tag LOCUS_19340 gene sucC 272669 271512 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222715.1 protein_id gnl|my_center|LOCUS_19340 272862 274070 gene locus_tag LOCUS_19350 272862 274070 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226405.1 protein_id gnl|my_center|LOCUS_19350 273082 273178 gene locus_tag LOCUS_t00170 273082 273178 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 274192 274929 gene locus_tag LOCUS_19360 274192 274929 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972414.1 protein_id gnl|my_center|LOCUS_19360 275326 275508 gene locus_tag LOCUS_19370 275326 275508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 276551 275565 gene locus_tag LOCUS_19380 276551 275565 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_19380 277087 276548 gene locus_tag LOCUS_19390 277087 276548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 278592 277087 gene locus_tag LOCUS_19400 278592 277087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 280815 278668 gene locus_tag LOCUS_19410 280815 278668 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226412.1 protein_id gnl|my_center|LOCUS_19410 282041 280815 gene locus_tag LOCUS_19420 gene frc 282041 280815 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972395.1 protein_id gnl|my_center|LOCUS_19420 283737 282052 gene locus_tag LOCUS_19430 283737 282052 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226410.1 protein_id gnl|my_center|LOCUS_19430 285099 283858 gene locus_tag LOCUS_19440 285099 283858 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 protein_id gnl|my_center|LOCUS_19440 285171 286172 gene locus_tag LOCUS_19450 285171 286172 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031008.1 protein_id gnl|my_center|LOCUS_19450 286235 287143 gene locus_tag LOCUS_19460 gene fdhD 286235 287143 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_19460 287176 287508 gene locus_tag LOCUS_19470 287176 287508 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224339.1 protein_id gnl|my_center|LOCUS_19470 287508 288032 gene locus_tag LOCUS_19480 287508 288032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 290011 288083 gene locus_tag LOCUS_19490 290011 288083 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972490.1 protein_id gnl|my_center|LOCUS_19490 290259 291725 gene locus_tag LOCUS_19500 290259 291725 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_19500 292017 294536 gene locus_tag LOCUS_19510 292017 294536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 295544 294585 gene locus_tag LOCUS_19520 295544 294585 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225042.1 protein_id gnl|my_center|LOCUS_19520 295607 296734 gene locus_tag LOCUS_19530 295607 296734 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030728.1 protein_id gnl|my_center|LOCUS_19530 297665 296778 gene locus_tag LOCUS_19540 297665 296778 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029307.1 protein_id gnl|my_center|LOCUS_19540 298418 297708 gene locus_tag LOCUS_19550 298418 297708 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_19550 299563 298397 gene locus_tag LOCUS_19560 299563 298397 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_19560 299741 299971 gene locus_tag LOCUS_19570 299741 299971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 300475 299966 gene locus_tag LOCUS_19580 300475 299966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 300560 301807 gene locus_tag LOCUS_19590 300560 301807 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093954241.1 protein_id gnl|my_center|LOCUS_19590 302660 301767 gene locus_tag LOCUS_19600 302660 301767 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082939.1 protein_id gnl|my_center|LOCUS_19600 302812 303396 gene locus_tag LOCUS_19610 302812 303396 CDS product ABATE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228032.1 protein_id gnl|my_center|LOCUS_19610 304402 303425 gene locus_tag LOCUS_19620 304402 303425 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_19620 304473 305237 gene locus_tag LOCUS_19630 304473 305237 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286332.1 protein_id gnl|my_center|LOCUS_19630 305421 306686 gene locus_tag LOCUS_19640 305421 306686 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227636.1 protein_id gnl|my_center|LOCUS_19640 307429 306668 gene locus_tag LOCUS_19650 307429 306668 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082824.1 protein_id gnl|my_center|LOCUS_19650 308267 307512 gene locus_tag LOCUS_19660 308267 307512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 308635 309684 gene locus_tag LOCUS_19670 308635 309684 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_19670 309692 310615 gene locus_tag LOCUS_19680 309692 310615 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 protein_id gnl|my_center|LOCUS_19680 310612 311559 gene locus_tag LOCUS_19690 310612 311559 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_19690 311645 312244 gene locus_tag LOCUS_19700 311645 312244 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804681.1 protein_id gnl|my_center|LOCUS_19700 312241 312795 gene locus_tag LOCUS_19710 312241 312795 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_19710 312855 313652 gene locus_tag LOCUS_19720 312855 313652 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_19720 313671 315092 gene locus_tag LOCUS_19730 313671 315092 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027778.1 protein_id gnl|my_center|LOCUS_19730 315218 315562 gene locus_tag LOCUS_19740 315218 315562 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977404.1 protein_id gnl|my_center|LOCUS_19740 316348 315836 gene locus_tag LOCUS_19750 316348 315836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 317200 316454 gene locus_tag LOCUS_19760 317200 316454 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_19760 318762 317200 gene locus_tag LOCUS_19770 gene lnt 318762 317200 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_19770 321746 319500 gene locus_tag LOCUS_19780 321746 319500 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_19780 322243 323523 gene locus_tag LOCUS_19790 322243 323523 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_19790 323553 324878 gene locus_tag LOCUS_19800 323553 324878 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028490.1 protein_id gnl|my_center|LOCUS_19800 324882 325847 gene locus_tag LOCUS_19810 324882 325847 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976142.1 protein_id gnl|my_center|LOCUS_19810 325844 326728 gene locus_tag LOCUS_19820 325844 326728 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028491.1 protein_id gnl|my_center|LOCUS_19820 326841 328103 gene locus_tag LOCUS_19830 326841 328103 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028492.1 protein_id gnl|my_center|LOCUS_19830 328100 329164 gene locus_tag LOCUS_19840 328100 329164 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866323.1 protein_id gnl|my_center|LOCUS_19840 329663 329190 gene locus_tag LOCUS_19850 329663 329190 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_19850 329828 330505 gene locus_tag LOCUS_19860 329828 330505 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970319.1 protein_id gnl|my_center|LOCUS_19860 331693 330542 gene locus_tag LOCUS_19870 331693 330542 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027782.1 protein_id gnl|my_center|LOCUS_19870 332945 331839 gene locus_tag LOCUS_19880 332945 331839 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_19880 333204 333022 gene locus_tag LOCUS_19890 333204 333022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 333248 334669 gene locus_tag LOCUS_19900 333248 334669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 334711 335613 gene locus_tag LOCUS_19910 334711 335613 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_19910 335659 337101 gene locus_tag LOCUS_19920 335659 337101 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_19920 337213 337082 gene locus_tag LOCUS_19930 337213 337082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 339924 337210 gene locus_tag LOCUS_19940 339924 337210 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_19940 341297 340329 gene locus_tag LOCUS_19950 341297 340329 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_19950 342257 341382 gene locus_tag LOCUS_19960 gene tatC 342257 341382 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729395.1 protein_id gnl|my_center|LOCUS_19960 342635 342306 gene locus_tag LOCUS_19970 gene tatA 342635 342306 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977193.1 protein_id gnl|my_center|LOCUS_19970 342906 342742 gene locus_tag LOCUS_19980 342906 342742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 343982 343029 gene locus_tag LOCUS_19990 343982 343029 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_19990 344958 343990 gene locus_tag LOCUS_20000 344958 343990 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226715.1 protein_id gnl|my_center|LOCUS_20000 345055 346071 gene locus_tag LOCUS_20010 345055 346071 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805204.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence06 1562 300 gene locus_tag LOCUS_20020 1562 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 2232 1636 gene locus_tag LOCUS_20030 2232 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2277 3041 gene locus_tag LOCUS_20040 2277 3041 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190909.1 protein_id gnl|my_center|LOCUS_20040 3196 6444 gene locus_tag LOCUS_20050 3196 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 6488 7585 gene locus_tag LOCUS_20060 6488 7585 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973053.1 protein_id gnl|my_center|LOCUS_20060 7676 9007 gene locus_tag LOCUS_20070 7676 9007 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226624.1 protein_id gnl|my_center|LOCUS_20070 9004 9942 gene locus_tag LOCUS_20080 9004 9942 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947166.1 protein_id gnl|my_center|LOCUS_20080 9939 10844 gene locus_tag LOCUS_20090 9939 10844 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226621.1 protein_id gnl|my_center|LOCUS_20090 11894 10929 gene locus_tag LOCUS_20100 11894 10929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 12116 13060 gene locus_tag LOCUS_20110 12116 13060 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031130.1 protein_id gnl|my_center|LOCUS_20110 13642 13070 gene locus_tag LOCUS_20120 13642 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 13751 14830 gene locus_tag LOCUS_20130 13751 14830 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030012.1 protein_id gnl|my_center|LOCUS_20130 14943 16010 gene locus_tag LOCUS_20140 14943 16010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978628.1 protein_id gnl|my_center|LOCUS_20140 17598 16042 gene locus_tag LOCUS_20150 17598 16042 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211366446.1 protein_id gnl|my_center|LOCUS_20150 18662 17595 gene locus_tag LOCUS_20160 18662 17595 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_20160 19770 18667 gene locus_tag LOCUS_20170 19770 18667 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_20170 20855 19767 gene locus_tag LOCUS_20180 20855 19767 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_20180 22404 20848 gene locus_tag LOCUS_20190 22404 20848 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972706.1 protein_id gnl|my_center|LOCUS_20190 23762 22416 gene locus_tag LOCUS_20200 23762 22416 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484443.1 protein_id gnl|my_center|LOCUS_20200 23765 24079 gene locus_tag LOCUS_20210 23765 24079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 25048 24089 gene locus_tag LOCUS_20220 25048 24089 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225890812.1 protein_id gnl|my_center|LOCUS_20220 25850 25251 gene locus_tag LOCUS_20230 25850 25251 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031836.1 protein_id gnl|my_center|LOCUS_20230 26007 29264 gene locus_tag LOCUS_20240 26007 29264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 30378 29398 gene locus_tag LOCUS_20250 gene axeA 30378 29398 CDS product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 protein_id gnl|my_center|LOCUS_20250 30745 30413 gene locus_tag LOCUS_20260 30745 30413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 30735 32447 gene locus_tag LOCUS_20270 30735 32447 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223609.1 protein_id gnl|my_center|LOCUS_20270 32457 33611 gene locus_tag LOCUS_20280 32457 33611 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223610.1 protein_id gnl|my_center|LOCUS_20280 33611 36049 gene locus_tag LOCUS_20290 33611 36049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 36046 37026 gene locus_tag LOCUS_20300 36046 37026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223613.1 protein_id gnl|my_center|LOCUS_20300 37157 38668 gene locus_tag LOCUS_20310 37157 38668 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_20310 38665 39648 gene locus_tag LOCUS_20320 38665 39648 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401263.1 protein_id gnl|my_center|LOCUS_20320 39687 41357 gene locus_tag LOCUS_20330 39687 41357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 41978 41580 gene locus_tag LOCUS_20340 41978 41580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 43190 42855 gene locus_tag LOCUS_20350 43190 42855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 43882 46416 gene locus_tag LOCUS_20360 43882 46416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 46470 47729 gene locus_tag LOCUS_20370 46470 47729 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_20370 47726 48655 gene locus_tag LOCUS_20380 47726 48655 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804268.1 protein_id gnl|my_center|LOCUS_20380 48648 49511 gene locus_tag LOCUS_20390 48648 49511 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929855.1 protein_id gnl|my_center|LOCUS_20390 49508 51673 gene locus_tag LOCUS_20400 49508 51673 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639906.1 protein_id gnl|my_center|LOCUS_20400 52577 51720 gene locus_tag LOCUS_20410 52577 51720 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729459.1 protein_id gnl|my_center|LOCUS_20410 52705 53493 gene locus_tag LOCUS_20420 52705 53493 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230777.1 protein_id gnl|my_center|LOCUS_20420 53541 54368 gene locus_tag LOCUS_20430 53541 54368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 55735 54395 gene locus_tag LOCUS_20440 55735 54395 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804375.1 protein_id gnl|my_center|LOCUS_20440 56626 55751 gene locus_tag LOCUS_20450 56626 55751 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026977.1 protein_id gnl|my_center|LOCUS_20450 57568 56636 gene locus_tag LOCUS_20460 57568 56636 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026976.1 protein_id gnl|my_center|LOCUS_20460 58410 57568 gene locus_tag LOCUS_20470 58410 57568 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225769.1 protein_id gnl|my_center|LOCUS_20470 58502 60079 gene locus_tag LOCUS_20480 58502 60079 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202403.1 protein_id gnl|my_center|LOCUS_20480 60808 60125 gene locus_tag LOCUS_20490 60808 60125 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_20490 62793 60805 gene locus_tag LOCUS_20500 62793 60805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 63526 62834 gene locus_tag LOCUS_20510 63526 62834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 65631 63721 gene locus_tag LOCUS_20520 65631 63721 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_20520 66503 65841 gene locus_tag LOCUS_20530 66503 65841 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977123.1 protein_id gnl|my_center|LOCUS_20530 66560 68515 gene locus_tag LOCUS_20540 66560 68515 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_20540 68547 70469 gene locus_tag LOCUS_20550 gene ggt 68547 70469 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_20550 71645 70473 gene locus_tag LOCUS_20560 71645 70473 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027721.1 protein_id gnl|my_center|LOCUS_20560 73081 71642 gene locus_tag LOCUS_20570 73081 71642 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226023.1 protein_id gnl|my_center|LOCUS_20570 73139 73642 gene locus_tag LOCUS_20580 73139 73642 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112386.1 protein_id gnl|my_center|LOCUS_20580 74718 73636 gene locus_tag LOCUS_20590 74718 73636 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229444.1 protein_id gnl|my_center|LOCUS_20590 75714 74890 gene locus_tag LOCUS_20600 75714 74890 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_20600 76353 75970 gene locus_tag LOCUS_20610 76353 75970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 76670 76948 gene locus_tag LOCUS_20620 76670 76948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 77255 76911 gene locus_tag LOCUS_20630 77255 76911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897820.1 protein_id gnl|my_center|LOCUS_20630 79574 77394 gene locus_tag LOCUS_20640 79574 77394 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031089.1 protein_id gnl|my_center|LOCUS_20640 80435 79803 gene locus_tag LOCUS_20650 80435 79803 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_20650 81334 80681 gene locus_tag LOCUS_20660 81334 80681 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978436.1 protein_id gnl|my_center|LOCUS_20660 81604 83037 gene locus_tag LOCUS_20670 81604 83037 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527615.1 protein_id gnl|my_center|LOCUS_20670 83281 83898 gene locus_tag LOCUS_20680 83281 83898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 84896 83919 gene locus_tag LOCUS_20690 84896 83919 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228718.1 protein_id gnl|my_center|LOCUS_20690 86397 84922 gene locus_tag LOCUS_20700 86397 84922 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 protein_id gnl|my_center|LOCUS_20700 86499 87419 gene locus_tag LOCUS_20710 86499 87419 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086676092.1 protein_id gnl|my_center|LOCUS_20710 88174 87542 gene locus_tag LOCUS_20720 88174 87542 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978024.1 protein_id gnl|my_center|LOCUS_20720 88273 88872 gene locus_tag LOCUS_20730 88273 88872 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027648.1 protein_id gnl|my_center|LOCUS_20730 89197 89835 gene locus_tag LOCUS_20740 89197 89835 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897986.1 protein_id gnl|my_center|LOCUS_20740 89887 91059 gene locus_tag LOCUS_20750 89887 91059 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976445.1 protein_id gnl|my_center|LOCUS_20750 91050 91694 gene locus_tag LOCUS_20760 91050 91694 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326115.1 protein_id gnl|my_center|LOCUS_20760 92880 91804 gene locus_tag LOCUS_20770 92880 91804 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_20770 94409 93237 gene locus_tag LOCUS_20780 94409 93237 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256649.1 protein_id gnl|my_center|LOCUS_20780 97676 94569 gene locus_tag LOCUS_20790 97676 94569 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_20790 99023 97683 gene locus_tag LOCUS_20800 99023 97683 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031093.1 protein_id gnl|my_center|LOCUS_20800 99793 99020 gene locus_tag LOCUS_20810 99793 99020 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891901.1 protein_id gnl|my_center|LOCUS_20810 99938 100885 gene locus_tag LOCUS_20820 99938 100885 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223243.1 protein_id gnl|my_center|LOCUS_20820 100887 102158 gene locus_tag LOCUS_20830 100887 102158 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775953.1 protein_id gnl|my_center|LOCUS_20830 102160 103131 gene locus_tag LOCUS_20840 102160 103131 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 protein_id gnl|my_center|LOCUS_20840 103131 103958 gene locus_tag LOCUS_20850 103131 103958 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775955.1 protein_id gnl|my_center|LOCUS_20850 103951 106959 gene locus_tag LOCUS_20860 103951 106959 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084830245.1 protein_id gnl|my_center|LOCUS_20860 106974 107846 gene locus_tag LOCUS_20870 106974 107846 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729986.1 protein_id gnl|my_center|LOCUS_20870 107843 108937 gene locus_tag LOCUS_20880 107843 108937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 110400 109522 gene locus_tag LOCUS_20890 110400 109522 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726677.1 protein_id gnl|my_center|LOCUS_20890 110483 111004 gene locus_tag LOCUS_20900 110483 111004 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027132.1 protein_id gnl|my_center|LOCUS_20900 111067 112041 gene locus_tag LOCUS_20910 111067 112041 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729488.1 protein_id gnl|my_center|LOCUS_20910 112202 112720 gene locus_tag LOCUS_20920 112202 112720 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729811.1 protein_id gnl|my_center|LOCUS_20920 112830 113495 gene locus_tag LOCUS_20930 112830 113495 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226486.1 protein_id gnl|my_center|LOCUS_20930 114579 113548 gene locus_tag LOCUS_20940 114579 113548 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728201.1 protein_id gnl|my_center|LOCUS_20940 115334 114714 gene locus_tag LOCUS_20950 115334 114714 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_20950 115825 115331 gene locus_tag LOCUS_20960 115825 115331 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226079.1 protein_id gnl|my_center|LOCUS_20960 116375 115875 gene locus_tag LOCUS_20970 116375 115875 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 protein_id gnl|my_center|LOCUS_20970 117126 116545 gene locus_tag LOCUS_20980 117126 116545 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_20980 119009 117162 gene locus_tag LOCUS_20990 119009 117162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 119625 119035 gene locus_tag LOCUS_21000 119625 119035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 119822 120772 gene locus_tag LOCUS_21010 119822 120772 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417461.1 protein_id gnl|my_center|LOCUS_21010 120789 121406 gene locus_tag LOCUS_21020 120789 121406 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698597.1 protein_id gnl|my_center|LOCUS_21020 122557 121580 gene locus_tag LOCUS_21030 122557 121580 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227649.1 protein_id gnl|my_center|LOCUS_21030 123438 122554 gene locus_tag LOCUS_21040 123438 122554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227650.1 protein_id gnl|my_center|LOCUS_21040 123842 123435 gene locus_tag LOCUS_21050 123842 123435 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227651.1 protein_id gnl|my_center|LOCUS_21050 124045 125040 gene locus_tag LOCUS_21060 124045 125040 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_21060 125565 126737 gene locus_tag LOCUS_21070 125565 126737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 126763 128016 gene locus_tag LOCUS_21080 126763 128016 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722711.1 protein_id gnl|my_center|LOCUS_21080 128060 129121 gene locus_tag LOCUS_21090 128060 129121 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_21090 129105 129983 gene locus_tag LOCUS_21100 129105 129983 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_21100 129980 131791 gene locus_tag LOCUS_21110 129980 131791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 131788 133566 gene locus_tag LOCUS_21120 131788 133566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 134301 133600 gene locus_tag LOCUS_21130 134301 133600 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027419.1 protein_id gnl|my_center|LOCUS_21130 134432 135349 gene locus_tag LOCUS_21140 134432 135349 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_21140 135884 135306 gene locus_tag LOCUS_21150 135884 135306 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225956933.1 protein_id gnl|my_center|LOCUS_21150 136074 136919 gene locus_tag LOCUS_21160 136074 136919 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088051.1 protein_id gnl|my_center|LOCUS_21160 138476 136923 gene locus_tag LOCUS_21170 138476 136923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228767.1 protein_id gnl|my_center|LOCUS_21170 139561 138548 gene locus_tag LOCUS_21180 139561 138548 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972087.1 protein_id gnl|my_center|LOCUS_21180 142008 139558 gene locus_tag LOCUS_21190 142008 139558 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_21190 143278 142094 gene locus_tag LOCUS_21200 143278 142094 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_21200 145569 143278 gene locus_tag LOCUS_21210 145569 143278 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226456.1 protein_id gnl|my_center|LOCUS_21210 146860 145694 gene locus_tag LOCUS_21220 146860 145694 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091306554.1 protein_id gnl|my_center|LOCUS_21220 146981 149071 gene locus_tag LOCUS_21230 146981 149071 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226869.1 protein_id gnl|my_center|LOCUS_21230 149116 150423 gene locus_tag LOCUS_21240 149116 150423 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 protein_id gnl|my_center|LOCUS_21240 150428 151390 gene locus_tag LOCUS_21250 150428 151390 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967845.1 protein_id gnl|my_center|LOCUS_21250 151390 152277 gene locus_tag LOCUS_21260 151390 152277 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445531.1 protein_id gnl|my_center|LOCUS_21260 152817 152311 gene locus_tag LOCUS_21270 152817 152311 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225292.1 protein_id gnl|my_center|LOCUS_21270 152949 153794 gene locus_tag LOCUS_21280 152949 153794 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730790.1 protein_id gnl|my_center|LOCUS_21280 153833 154048 gene locus_tag LOCUS_21290 153833 154048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 155045 154053 gene locus_tag LOCUS_21300 155045 154053 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090797.1 protein_id gnl|my_center|LOCUS_21300 155907 155239 gene locus_tag LOCUS_21310 155907 155239 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533133.1 protein_id gnl|my_center|LOCUS_21310 156100 157185 gene locus_tag LOCUS_21320 156100 157185 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061884.1 protein_id gnl|my_center|LOCUS_21320 157335 158090 gene locus_tag LOCUS_21330 157335 158090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 158869 158108 gene locus_tag LOCUS_21340 158869 158108 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142852.1 protein_id gnl|my_center|LOCUS_21340 158973 159572 gene locus_tag LOCUS_21350 158973 159572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 159664 160236 gene locus_tag LOCUS_21360 159664 160236 CDS product nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015392.1 protein_id gnl|my_center|LOCUS_21360 160331 161293 gene locus_tag LOCUS_21370 160331 161293 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731436.1 protein_id gnl|my_center|LOCUS_21370 162530 161604 gene locus_tag LOCUS_21380 162530 161604 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467673.1 protein_id gnl|my_center|LOCUS_21380 162629 163864 gene locus_tag LOCUS_21390 162629 163864 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031193.1 protein_id gnl|my_center|LOCUS_21390 164638 163883 gene locus_tag LOCUS_21400 164638 163883 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730379.1 protein_id gnl|my_center|LOCUS_21400 164741 165373 gene locus_tag LOCUS_21410 164741 165373 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226186.1 protein_id gnl|my_center|LOCUS_21410 166528 165794 gene locus_tag LOCUS_21420 166528 165794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727625.1 protein_id gnl|my_center|LOCUS_21420 170877 166669 gene locus_tag LOCUS_21430 170877 166669 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190068351.1 protein_id gnl|my_center|LOCUS_21430 173390 170946 gene locus_tag LOCUS_21440 173390 170946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 174671 173484 gene locus_tag LOCUS_21450 174671 173484 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027463.1 protein_id gnl|my_center|LOCUS_21450 175824 174793 gene locus_tag LOCUS_21460 175824 174793 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027465.1 protein_id gnl|my_center|LOCUS_21460 176103 177386 gene locus_tag LOCUS_21470 176103 177386 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977908.1 protein_id gnl|my_center|LOCUS_21470 177457 178329 gene locus_tag LOCUS_21480 177457 178329 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804717.1 protein_id gnl|my_center|LOCUS_21480 178332 179183 gene locus_tag LOCUS_21490 178332 179183 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027464.1 protein_id gnl|my_center|LOCUS_21490 179953 179309 gene locus_tag LOCUS_21500 179953 179309 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 protein_id gnl|my_center|LOCUS_21500 180020 180421 gene locus_tag LOCUS_21510 180020 180421 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222198.1 protein_id gnl|my_center|LOCUS_21510 180536 180895 gene locus_tag LOCUS_21520 180536 180895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 182046 180886 gene locus_tag LOCUS_21530 182046 180886 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259167.1 protein_id gnl|my_center|LOCUS_21530 182256 182432 gene locus_tag LOCUS_21540 182256 182432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 183255 182581 gene locus_tag LOCUS_21550 183255 182581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 183478 183939 gene locus_tag LOCUS_21560 183478 183939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 184141 185202 gene locus_tag LOCUS_21570 184141 185202 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014164.1 protein_id gnl|my_center|LOCUS_21570 185879 185412 gene locus_tag LOCUS_21580 185879 185412 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082660.1 protein_id gnl|my_center|LOCUS_21580 186599 185931 gene locus_tag LOCUS_21590 186599 185931 CDS product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228615.1 protein_id gnl|my_center|LOCUS_21590 186696 187157 gene locus_tag LOCUS_21600 186696 187157 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230339.1 protein_id gnl|my_center|LOCUS_21600 187398 188288 gene locus_tag LOCUS_21610 187398 188288 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_21610 188469 189389 gene locus_tag LOCUS_21620 188469 189389 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729840.1 protein_id gnl|my_center|LOCUS_21620 189405 189869 gene locus_tag LOCUS_21630 189405 189869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 190917 190000 gene locus_tag LOCUS_21640 190917 190000 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730772.1 protein_id gnl|my_center|LOCUS_21640 191413 193197 gene locus_tag LOCUS_21650 191413 193197 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226167.1 protein_id gnl|my_center|LOCUS_21650 193511 194926 gene locus_tag LOCUS_21660 193511 194926 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_21660 196034 195567 gene locus_tag LOCUS_21670 196034 195567 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028826.1 protein_id gnl|my_center|LOCUS_21670 196165 196476 gene locus_tag LOCUS_21680 196165 196476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 196479 196838 gene locus_tag LOCUS_21690 196479 196838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 196917 197504 gene locus_tag LOCUS_21700 196917 197504 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080700.1 protein_id gnl|my_center|LOCUS_21700 197921 197670 gene locus_tag LOCUS_21710 197921 197670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 198514 197918 gene locus_tag LOCUS_21720 198514 197918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 199567 198518 gene locus_tag LOCUS_21730 199567 198518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_21730 199764 200714 gene locus_tag LOCUS_21740 199764 200714 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029934.1 protein_id gnl|my_center|LOCUS_21740 200698 201483 gene locus_tag LOCUS_21750 200698 201483 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031119.1 protein_id gnl|my_center|LOCUS_21750 201480 202106 gene locus_tag LOCUS_21760 201480 202106 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727992.1 protein_id gnl|my_center|LOCUS_21760 202247 203026 gene locus_tag LOCUS_21770 202247 203026 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030363.1 protein_id gnl|my_center|LOCUS_21770 203677 203300 gene locus_tag LOCUS_21780 203677 203300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 203737 204219 gene locus_tag LOCUS_21790 203737 204219 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224025.1 protein_id gnl|my_center|LOCUS_21790 204497 204285 gene locus_tag LOCUS_21800 204497 204285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21800 205162 206280 gene locus_tag LOCUS_21810 205162 206280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 206861 209029 gene locus_tag LOCUS_21820 206861 209029 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223431.1 protein_id gnl|my_center|LOCUS_21820 210474 209149 gene locus_tag LOCUS_21830 210474 209149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 211301 210471 gene locus_tag LOCUS_21840 211301 210471 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226872.1 protein_id gnl|my_center|LOCUS_21840 212242 211298 gene locus_tag LOCUS_21850 212242 211298 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226871.1 protein_id gnl|my_center|LOCUS_21850 212203 212120 gene locus_tag LOCUS_t00180 212203 212120 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 213538 212246 gene locus_tag LOCUS_21860 213538 212246 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226870.1 protein_id gnl|my_center|LOCUS_21860 214644 213535 gene locus_tag LOCUS_21870 214644 213535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 215784 214723 gene locus_tag LOCUS_21880 215784 214723 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947192.1 protein_id gnl|my_center|LOCUS_21880 216075 218318 gene locus_tag LOCUS_21890 216075 218318 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223431.1 protein_id gnl|my_center|LOCUS_21890 219261 218362 gene locus_tag LOCUS_21900 219261 218362 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655931.1 protein_id gnl|my_center|LOCUS_21900 219370 221148 gene locus_tag LOCUS_21910 gene boxC 219370 221148 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230334.1 protein_id gnl|my_center|LOCUS_21910 221145 222572 gene locus_tag LOCUS_21920 gene boxB 221145 222572 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230333.1 protein_id gnl|my_center|LOCUS_21920 222589 224169 gene locus_tag LOCUS_21930 222589 224169 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230332.1 protein_id gnl|my_center|LOCUS_21930 224213 225073 gene locus_tag LOCUS_21940 224213 225073 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230331.1 protein_id gnl|my_center|LOCUS_21940 225897 225385 gene locus_tag LOCUS_21950 225897 225385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 226239 227447 gene locus_tag LOCUS_21960 226239 227447 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223986.1 protein_id gnl|my_center|LOCUS_21960 227476 228171 gene locus_tag LOCUS_21970 227476 228171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 228802 228191 gene locus_tag LOCUS_21980 228802 228191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 228976 229797 gene locus_tag LOCUS_21990 228976 229797 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030363.1 protein_id gnl|my_center|LOCUS_21990 230141 229794 gene locus_tag LOCUS_22000 230141 229794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227944.1 protein_id gnl|my_center|LOCUS_22000 230273 230854 gene locus_tag LOCUS_22010 230273 230854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 231525 230821 gene locus_tag LOCUS_22020 231525 230821 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_22020 232397 231582 gene locus_tag LOCUS_22030 gene fmt 232397 231582 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255944.1 protein_id gnl|my_center|LOCUS_22030 232692 234644 gene locus_tag LOCUS_22040 232692 234644 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971555.1 protein_id gnl|my_center|LOCUS_22040 234647 236404 gene locus_tag LOCUS_22050 234647 236404 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929086.1 protein_id gnl|my_center|LOCUS_22050 236401 238224 gene locus_tag LOCUS_22060 236401 238224 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142714.1 protein_id gnl|my_center|LOCUS_22060 238468 239073 gene locus_tag LOCUS_22070 238468 239073 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225197.1 protein_id gnl|my_center|LOCUS_22070 239066 240205 gene locus_tag LOCUS_22080 239066 240205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 240397 240930 gene locus_tag LOCUS_22090 240397 240930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 241019 241453 gene locus_tag LOCUS_22100 241019 241453 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229412.1 protein_id gnl|my_center|LOCUS_22100 241744 241520 gene locus_tag LOCUS_22110 241744 241520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 242870 241866 gene locus_tag LOCUS_22120 242870 241866 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228156.1 protein_id gnl|my_center|LOCUS_22120 243083 243499 gene locus_tag LOCUS_22130 243083 243499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22130 243496 243870 gene locus_tag LOCUS_22140 243496 243870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22140 244881 244060 gene locus_tag LOCUS_22150 244881 244060 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229849.1 protein_id gnl|my_center|LOCUS_22150 245559 245038 gene locus_tag LOCUS_22160 245559 245038 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943975.1 protein_id gnl|my_center|LOCUS_22160 246418 245603 gene locus_tag LOCUS_22170 246418 245603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 247458 246511 gene locus_tag LOCUS_22180 247458 246511 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804290.1 protein_id gnl|my_center|LOCUS_22180 247919 249034 gene locus_tag LOCUS_22190 247919 249034 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 protein_id gnl|my_center|LOCUS_22190 249256 249831 gene locus_tag LOCUS_22200 249256 249831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 249834 251597 gene locus_tag LOCUS_22210 249834 251597 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027630.1 protein_id gnl|my_center|LOCUS_22210 251712 252620 gene locus_tag LOCUS_22220 251712 252620 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227980.1 protein_id gnl|my_center|LOCUS_22220 252617 254137 gene locus_tag LOCUS_22230 252617 254137 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028022.1 protein_id gnl|my_center|LOCUS_22230 254198 255199 gene locus_tag LOCUS_22240 254198 255199 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230695.1 protein_id gnl|my_center|LOCUS_22240 255335 256207 gene locus_tag LOCUS_22250 255335 256207 CDS product TIGR03560 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225208.1 protein_id gnl|my_center|LOCUS_22250 258644 256290 gene locus_tag LOCUS_22260 258644 256290 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226349.1 protein_id gnl|my_center|LOCUS_22260 259693 258698 gene locus_tag LOCUS_22270 259693 258698 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027041.1 protein_id gnl|my_center|LOCUS_22270 260603 259695 gene locus_tag LOCUS_22280 260603 259695 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028354.1 protein_id gnl|my_center|LOCUS_22280 261619 260600 gene locus_tag LOCUS_22290 261619 260600 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_22290 262028 261663 gene locus_tag LOCUS_22300 262028 261663 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231200.1 protein_id gnl|my_center|LOCUS_22300 263659 262565 gene locus_tag LOCUS_22310 263659 262565 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 protein_id gnl|my_center|LOCUS_22310 264268 265644 gene locus_tag LOCUS_22320 264268 265644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 265688 266638 gene locus_tag LOCUS_22330 265688 266638 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_22330 266631 267419 gene locus_tag LOCUS_22340 266631 267419 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726998.1 protein_id gnl|my_center|LOCUS_22340 267482 268867 gene locus_tag LOCUS_22350 267482 268867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 269769 268963 gene locus_tag LOCUS_22360 269769 268963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 270384 269857 gene locus_tag LOCUS_22370 270384 269857 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_22370 271517 270642 gene locus_tag LOCUS_22380 271517 270642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 271750 272664 gene locus_tag LOCUS_22390 271750 272664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 273545 272679 gene locus_tag LOCUS_22400 273545 272679 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225947.1 protein_id gnl|my_center|LOCUS_22400 273701 274570 gene locus_tag LOCUS_22410 273701 274570 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226458.1 protein_id gnl|my_center|LOCUS_22410 274904 274608 gene locus_tag LOCUS_22420 274904 274608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 274885 276969 gene locus_tag LOCUS_22430 gene ligA 274885 276969 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485959.1 protein_id gnl|my_center|LOCUS_22430 277637 277134 gene locus_tag LOCUS_22440 277637 277134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 279891 277618 gene locus_tag LOCUS_22450 279891 277618 CDS product NACHT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204072091.1 protein_id gnl|my_center|LOCUS_22450 281615 280017 gene locus_tag LOCUS_22460 281615 280017 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727011.1 protein_id gnl|my_center|LOCUS_22460 281986 281687 gene locus_tag LOCUS_22470 281986 281687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 283386 281944 gene locus_tag LOCUS_22480 283386 281944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 283860 284864 gene locus_tag LOCUS_22490 gene ltaE 283860 284864 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529784.1 protein_id gnl|my_center|LOCUS_22490 285204 284902 gene locus_tag LOCUS_22500 285204 284902 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225986.1 protein_id gnl|my_center|LOCUS_22500 285415 286950 gene locus_tag LOCUS_22510 285415 286950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 287141 287587 gene locus_tag LOCUS_22520 287141 287587 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027124.1 protein_id gnl|my_center|LOCUS_22520 287580 288998 gene locus_tag LOCUS_22530 287580 288998 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228500.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence07 1731 139 gene locus_tag LOCUS_22540 1731 139 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143814.1 protein_id gnl|my_center|LOCUS_22540 2302 1793 gene locus_tag LOCUS_22550 2302 1793 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083032.1 protein_id gnl|my_center|LOCUS_22550 2344 3444 gene locus_tag LOCUS_22560 2344 3444 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966651.1 protein_id gnl|my_center|LOCUS_22560 3572 4996 gene locus_tag LOCUS_22570 3572 4996 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704269.1 protein_id gnl|my_center|LOCUS_22570 4993 6003 gene locus_tag LOCUS_22580 4993 6003 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_22580 7009 6101 gene locus_tag LOCUS_22590 7009 6101 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455728.1 protein_id gnl|my_center|LOCUS_22590 8066 7137 gene locus_tag LOCUS_22600 8066 7137 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_22600 8418 8080 gene locus_tag LOCUS_22610 8418 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 8536 9234 gene locus_tag LOCUS_22620 8536 9234 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839199.1 protein_id gnl|my_center|LOCUS_22620 11566 9842 gene locus_tag LOCUS_22630 gene leuA 11566 9842 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_22630 11647 11880 gene locus_tag LOCUS_22640 11647 11880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 11902 12147 gene locus_tag LOCUS_22650 11902 12147 CDS product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897080.1 protein_id gnl|my_center|LOCUS_22650 12231 13226 gene locus_tag LOCUS_22660 12231 13226 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804257.1 protein_id gnl|my_center|LOCUS_22660 14130 13438 gene locus_tag LOCUS_22670 gene urtE 14130 13438 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112317.1 protein_id gnl|my_center|LOCUS_22670 14742 15044 gene locus_tag LOCUS_22680 14742 15044 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409305.1 protein_id gnl|my_center|LOCUS_22680 15056 15463 gene locus_tag LOCUS_22690 15056 15463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 15456 17180 gene locus_tag LOCUS_22700 15456 17180 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895080.1 protein_id gnl|my_center|LOCUS_22700 17225 18151 gene locus_tag LOCUS_22710 17225 18151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 18222 18926 gene locus_tag LOCUS_22720 gene ureG 18222 18926 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230173.1 protein_id gnl|my_center|LOCUS_22720 18977 19726 gene locus_tag LOCUS_22730 18977 19726 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027661.1 protein_id gnl|my_center|LOCUS_22730 19797 20276 gene locus_tag LOCUS_22740 19797 20276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 23062 20459 gene locus_tag LOCUS_22750 23062 20459 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184834092.1 protein_id gnl|my_center|LOCUS_22750 22980 23324 gene locus_tag LOCUS_22760 22980 23324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 24611 23700 gene locus_tag LOCUS_22770 gene era 24611 23700 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228396.1 protein_id gnl|my_center|LOCUS_22770 24939 24604 gene locus_tag LOCUS_22780 24939 24604 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456125.1 protein_id gnl|my_center|LOCUS_22780 25589 24936 gene locus_tag LOCUS_22790 25589 24936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 27198 25903 gene locus_tag LOCUS_22800 27198 25903 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_22800 27671 27195 gene locus_tag LOCUS_22810 gene ybeY 27671 27195 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976270.1 protein_id gnl|my_center|LOCUS_22810 28716 27697 gene locus_tag LOCUS_22820 28716 27697 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_22820 29139 28771 gene locus_tag LOCUS_22830 29139 28771 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_22830 29296 29841 gene locus_tag LOCUS_22840 29296 29841 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975326.1 protein_id gnl|my_center|LOCUS_22840 29838 30464 gene locus_tag LOCUS_22850 29838 30464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 31218 30487 gene locus_tag LOCUS_22860 31218 30487 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_22860 32370 31237 gene locus_tag LOCUS_22870 gene dnaJ 32370 31237 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_22870 33384 32371 gene locus_tag LOCUS_22880 gene hrcA 33384 32371 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_22880 33659 34471 gene locus_tag LOCUS_22890 33659 34471 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_22890 35866 34646 gene locus_tag LOCUS_22900 gene hemW 35866 34646 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_22900 36056 37327 gene locus_tag LOCUS_22910 36056 37327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 38060 37428 gene locus_tag LOCUS_22920 38060 37428 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284363.1 protein_id gnl|my_center|LOCUS_22920 38205 38687 gene locus_tag LOCUS_22930 38205 38687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 38684 39754 gene locus_tag LOCUS_22940 38684 39754 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030479.1 protein_id gnl|my_center|LOCUS_22940 41689 39863 gene locus_tag LOCUS_22950 gene lepA 41689 39863 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083190386.1 protein_id gnl|my_center|LOCUS_22950 41828 42841 gene locus_tag LOCUS_22960 41828 42841 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030060.1 protein_id gnl|my_center|LOCUS_22960 43124 43396 gene locus_tag LOCUS_22970 gene rpsT 43124 43396 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_22970 43672 46302 gene locus_tag LOCUS_22980 43672 46302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 46299 48791 gene locus_tag LOCUS_22990 46299 48791 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484980.1 protein_id gnl|my_center|LOCUS_22990 48769 49722 gene locus_tag LOCUS_23000 48769 49722 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_23000 49715 50413 gene locus_tag LOCUS_23010 49715 50413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_23010 51722 50451 gene locus_tag LOCUS_23020 51722 50451 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229610.1 protein_id gnl|my_center|LOCUS_23020 51789 52301 gene locus_tag LOCUS_23030 gene tamR 51789 52301 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_23030 53316 52402 gene locus_tag LOCUS_23040 gene holA 53316 52402 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485035.1 protein_id gnl|my_center|LOCUS_23040 55885 53423 gene locus_tag LOCUS_23050 55885 53423 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028431.1 protein_id gnl|my_center|LOCUS_23050 56790 55882 gene locus_tag LOCUS_23060 56790 55882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 57676 56840 gene locus_tag LOCUS_23070 57676 56840 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_23070 58957 57749 gene locus_tag LOCUS_23080 gene hutI 58957 57749 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068174090.1 protein_id gnl|my_center|LOCUS_23080 60830 59427 gene locus_tag LOCUS_23090 gene hflX 60830 59427 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_23090 61628 60948 gene locus_tag LOCUS_23100 61628 60948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 61798 63384 gene locus_tag LOCUS_23110 gene aceB 61798 63384 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030763.1 protein_id gnl|my_center|LOCUS_23110 63494 64573 gene locus_tag LOCUS_23120 63494 64573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 64620 66071 gene locus_tag LOCUS_23130 64620 66071 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057464.1 protein_id gnl|my_center|LOCUS_23130 66121 67341 gene locus_tag LOCUS_23140 66121 67341 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_23140 67391 68650 gene locus_tag LOCUS_23150 67391 68650 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_23150 68647 69381 gene locus_tag LOCUS_23160 gene allR 68647 69381 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_23160 69422 69658 gene locus_tag LOCUS_23170 69422 69658 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028299.1 protein_id gnl|my_center|LOCUS_23170 69766 70419 gene locus_tag LOCUS_23180 69766 70419 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_23180 70416 71465 gene locus_tag LOCUS_23190 70416 71465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 73024 71648 gene locus_tag LOCUS_23200 73024 71648 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973562.1 protein_id gnl|my_center|LOCUS_23200 73121 74242 gene locus_tag LOCUS_23210 73121 74242 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028668.1 protein_id gnl|my_center|LOCUS_23210 74395 75984 gene locus_tag LOCUS_23220 74395 75984 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227865.1 protein_id gnl|my_center|LOCUS_23220 75981 76652 gene locus_tag LOCUS_23230 75981 76652 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227864.1 protein_id gnl|my_center|LOCUS_23230 77453 76656 gene locus_tag LOCUS_23240 77453 76656 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028771.1 protein_id gnl|my_center|LOCUS_23240 77824 78056 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgaacctgtgcatgatcac 79043 78099 gene locus_tag LOCUS_23250 79043 78099 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 protein_id gnl|my_center|LOCUS_23250 80155 79175 gene locus_tag LOCUS_23260 80155 79175 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 protein_id gnl|my_center|LOCUS_23260 82077 80152 gene locus_tag LOCUS_23270 82077 80152 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029894.1 protein_id gnl|my_center|LOCUS_23270 83153 82077 gene locus_tag LOCUS_23280 83153 82077 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029893.1 protein_id gnl|my_center|LOCUS_23280 84464 83703 gene locus_tag LOCUS_23290 84464 83703 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731410.1 protein_id gnl|my_center|LOCUS_23290 86825 84543 gene locus_tag LOCUS_23300 86825 84543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036366.1 protein_id gnl|my_center|LOCUS_23300 87682 86915 gene locus_tag LOCUS_23310 87682 86915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222298.1 protein_id gnl|my_center|LOCUS_23310 88598 87786 gene locus_tag LOCUS_23320 gene dapF 88598 87786 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_23320 89547 88657 gene locus_tag LOCUS_23330 gene miaA 89547 88657 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_23330 90122 89592 gene locus_tag LOCUS_23340 90122 89592 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_23340 90896 90189 gene locus_tag LOCUS_23350 90896 90189 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225405.1 protein_id gnl|my_center|LOCUS_23350 91014 91718 gene locus_tag LOCUS_23360 91014 91718 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089437.1 protein_id gnl|my_center|LOCUS_23360 91920 91783 gene locus_tag LOCUS_23370 91920 91783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 92620 92093 gene locus_tag LOCUS_23380 92620 92093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 93858 92956 gene locus_tag LOCUS_23390 93858 92956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 94796 94497 gene locus_tag LOCUS_23400 94796 94497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 94683 97214 gene locus_tag LOCUS_23410 94683 97214 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229885.1 protein_id gnl|my_center|LOCUS_23410 97728 97435 gene locus_tag LOCUS_23420 97728 97435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 98369 97716 gene locus_tag LOCUS_23430 98369 97716 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973613.1 protein_id gnl|my_center|LOCUS_23430 98955 99800 gene locus_tag LOCUS_23440 98955 99800 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223370.1 protein_id gnl|my_center|LOCUS_23440 100816 99803 gene locus_tag LOCUS_23450 100816 99803 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227102.1 protein_id gnl|my_center|LOCUS_23450 100914 101321 gene locus_tag LOCUS_23460 100914 101321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 102053 101334 gene locus_tag LOCUS_23470 102053 101334 CDS product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 protein_id gnl|my_center|LOCUS_23470 105082 103571 gene locus_tag LOCUS_23480 gene miaB 105082 103571 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_23480 105418 106128 gene locus_tag LOCUS_23490 gene gluA 105418 106128 CDS product glutamate ABC transporter ATP-binding protein GluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081846.1 protein_id gnl|my_center|LOCUS_23490 106183 107055 gene locus_tag LOCUS_23500 106183 107055 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363315.1 protein_id gnl|my_center|LOCUS_23500 107121 107789 gene locus_tag LOCUS_23510 107121 107789 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894110.1 protein_id gnl|my_center|LOCUS_23510 107786 108679 gene locus_tag LOCUS_23520 107786 108679 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030446.1 protein_id gnl|my_center|LOCUS_23520 108768 109532 gene locus_tag LOCUS_23530 108768 109532 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894111.1 protein_id gnl|my_center|LOCUS_23530 109572 111494 gene locus_tag LOCUS_23540 109572 111494 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972490.1 protein_id gnl|my_center|LOCUS_23540 113259 111634 gene locus_tag LOCUS_23550 gene rny 113259 111634 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_23550 114402 113548 gene locus_tag LOCUS_23560 114402 113548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 115508 114411 gene locus_tag LOCUS_23570 gene recA 115508 114411 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_23570 116779 115697 gene locus_tag LOCUS_23580 116779 115697 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 protein_id gnl|my_center|LOCUS_23580 117654 116776 gene locus_tag LOCUS_23590 117654 116776 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 protein_id gnl|my_center|LOCUS_23590 117955 117647 gene locus_tag LOCUS_23600 117955 117647 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921216.1 protein_id gnl|my_center|LOCUS_23600 118386 117952 gene locus_tag LOCUS_23610 118386 117952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 118681 118487 gene locus_tag LOCUS_23620 118681 118487 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224216.1 protein_id gnl|my_center|LOCUS_23620 119243 118755 gene locus_tag LOCUS_23630 119243 118755 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467800.1 protein_id gnl|my_center|LOCUS_23630 119379 124271 gene locus_tag LOCUS_23640 119379 124271 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030438.1 protein_id gnl|my_center|LOCUS_23640 125645 124299 gene locus_tag LOCUS_23650 125645 124299 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027682.1 protein_id gnl|my_center|LOCUS_23650 126633 125638 gene locus_tag LOCUS_23660 126633 125638 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027683.1 protein_id gnl|my_center|LOCUS_23660 127550 126630 gene locus_tag LOCUS_23670 127550 126630 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027684.1 protein_id gnl|my_center|LOCUS_23670 <128529 127547 gene locus_tag LOCUS_23680 <128529 127547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205578.1:hybrid non-ribosomal peptide synthetase/type I polyketide synthase >Feature sequence08 1991 576 gene locus_tag LOCUS_23690 1991 576 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031537.1 protein_id gnl|my_center|LOCUS_23690 2529 2765 gene locus_tag LOCUS_23700 2529 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2762 4036 gene locus_tag LOCUS_23710 2762 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 4033 6003 gene locus_tag LOCUS_23720 4033 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 6696 6013 gene locus_tag LOCUS_23730 6696 6013 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031090.1 protein_id gnl|my_center|LOCUS_23730 7937 6693 gene locus_tag LOCUS_23740 7937 6693 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031091.1 protein_id gnl|my_center|LOCUS_23740 8058 8648 gene locus_tag LOCUS_23750 8058 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 9436 8753 gene locus_tag LOCUS_23760 9436 8753 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976477.1 protein_id gnl|my_center|LOCUS_23760 10616 9453 gene locus_tag LOCUS_23770 10616 9453 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013003532.1 protein_id gnl|my_center|LOCUS_23770 10830 12155 gene locus_tag LOCUS_23780 10830 12155 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226207.1 protein_id gnl|my_center|LOCUS_23780 12162 13178 gene locus_tag LOCUS_23790 12162 13178 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776529.1 protein_id gnl|my_center|LOCUS_23790 13175 14026 gene locus_tag LOCUS_23800 13175 14026 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028676.1 protein_id gnl|my_center|LOCUS_23800 14128 15621 gene locus_tag LOCUS_23810 14128 15621 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031132272.1 protein_id gnl|my_center|LOCUS_23810 16882 15704 gene locus_tag LOCUS_23820 16882 15704 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_23820 18520 17039 gene locus_tag LOCUS_23830 18520 17039 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484182.1 protein_id gnl|my_center|LOCUS_23830 18616 19080 gene locus_tag LOCUS_23840 18616 19080 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975952.1 protein_id gnl|my_center|LOCUS_23840 19137 19922 gene locus_tag LOCUS_23850 19137 19922 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_23850 20284 19919 gene locus_tag LOCUS_23860 20284 19919 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973269.1 protein_id gnl|my_center|LOCUS_23860 21032 20538 gene locus_tag LOCUS_23870 21032 20538 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_23870 21691 21029 gene locus_tag LOCUS_23880 gene pgsA 21691 21029 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_23880 23103 21688 gene locus_tag LOCUS_23890 gene rimO 23103 21688 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_23890 23864 23133 gene locus_tag LOCUS_23900 23864 23133 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973273.1 protein_id gnl|my_center|LOCUS_23900 26377 23993 gene locus_tag LOCUS_23910 26377 23993 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113701643.1 protein_id gnl|my_center|LOCUS_23910 26629 27552 gene locus_tag LOCUS_23920 26629 27552 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728676.1 protein_id gnl|my_center|LOCUS_23920 28900 27533 gene locus_tag LOCUS_23930 28900 27533 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728732.1 protein_id gnl|my_center|LOCUS_23930 29844 28897 gene locus_tag LOCUS_23940 29844 28897 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224764.1 protein_id gnl|my_center|LOCUS_23940 30365 29907 gene locus_tag LOCUS_23950 30365 29907 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224765.1 protein_id gnl|my_center|LOCUS_23950 31331 30558 gene locus_tag LOCUS_23960 31331 30558 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976948.1 protein_id gnl|my_center|LOCUS_23960 32525 31362 gene locus_tag LOCUS_23970 32525 31362 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973053.1 protein_id gnl|my_center|LOCUS_23970 33902 32610 gene locus_tag LOCUS_23980 33902 32610 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325939.1 protein_id gnl|my_center|LOCUS_23980 34820 33933 gene locus_tag LOCUS_23990 34820 33933 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976934.1 protein_id gnl|my_center|LOCUS_23990 35712 34846 gene locus_tag LOCUS_24000 35712 34846 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976933.1 protein_id gnl|my_center|LOCUS_24000 35942 36859 gene locus_tag LOCUS_24010 35942 36859 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976924.1 protein_id gnl|my_center|LOCUS_24010 36917 38215 gene locus_tag LOCUS_24020 36917 38215 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226279.1 protein_id gnl|my_center|LOCUS_24020 38803 42837 gene locus_tag LOCUS_24030 38803 42837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 44325 42898 gene locus_tag LOCUS_24040 44325 42898 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028022.1 protein_id gnl|my_center|LOCUS_24040 45127 44327 gene locus_tag LOCUS_24050 45127 44327 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878779.1 protein_id gnl|my_center|LOCUS_24050 45379 46266 gene locus_tag LOCUS_24060 45379 46266 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731064.1 protein_id gnl|my_center|LOCUS_24060 46260 47519 gene locus_tag LOCUS_24070 46260 47519 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_24070 47516 48646 gene locus_tag LOCUS_24080 47516 48646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731583.1 protein_id gnl|my_center|LOCUS_24080 48662 51904 gene locus_tag LOCUS_24090 48662 51904 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222149.1 protein_id gnl|my_center|LOCUS_24090 51935 53470 gene locus_tag LOCUS_24100 51935 53470 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977257.1 protein_id gnl|my_center|LOCUS_24100 53975 53463 gene locus_tag LOCUS_24110 53975 53463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 55744 54059 gene locus_tag LOCUS_24120 55744 54059 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_24120 56877 55960 gene locus_tag LOCUS_24130 gene dapA 56877 55960 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_24130 57548 57132 gene locus_tag LOCUS_24140 57548 57132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 57724 58461 gene locus_tag LOCUS_24150 57724 58461 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028876.1 protein_id gnl|my_center|LOCUS_24150 58514 59197 gene locus_tag LOCUS_24160 gene radC 58514 59197 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_24160 59285 59767 gene locus_tag LOCUS_24170 59285 59767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 60466 59843 gene locus_tag LOCUS_24180 60466 59843 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_24180 61443 60400 gene locus_tag LOCUS_24190 61443 60400 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_24190 62539 61517 gene locus_tag LOCUS_24200 62539 61517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980499.1 protein_id gnl|my_center|LOCUS_24200 63712 62633 gene locus_tag LOCUS_24210 63712 62633 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113278.1 protein_id gnl|my_center|LOCUS_24210 63669 64997 gene locus_tag LOCUS_24220 63669 64997 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535091.1 protein_id gnl|my_center|LOCUS_24220 65228 65806 gene locus_tag LOCUS_24230 65228 65806 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222357.1 protein_id gnl|my_center|LOCUS_24230 65812 66396 gene locus_tag LOCUS_24240 65812 66396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 66599 67468 gene locus_tag LOCUS_24250 66599 67468 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776415.1 protein_id gnl|my_center|LOCUS_24250 68204 67527 gene locus_tag LOCUS_24260 gene dapB 68204 67527 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081787.1 protein_id gnl|my_center|LOCUS_24260 69674 68364 gene locus_tag LOCUS_24270 69674 68364 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_24270 71983 69671 gene locus_tag LOCUS_24280 71983 69671 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_24280 72628 72359 gene locus_tag LOCUS_24290 gene rpsO 72628 72359 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_24290 73798 72836 gene locus_tag LOCUS_24300 73798 72836 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_24300 74828 73929 gene locus_tag LOCUS_24310 gene truB 74828 73929 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 protein_id gnl|my_center|LOCUS_24310 76005 75007 gene locus_tag LOCUS_24320 76005 75007 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228112.1 protein_id gnl|my_center|LOCUS_24320 76490 76008 gene locus_tag LOCUS_24330 gene rbfA 76490 76008 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_24330 76838 76539 gene locus_tag LOCUS_24340 76838 76539 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228120.1 protein_id gnl|my_center|LOCUS_24340 80019 76900 gene locus_tag LOCUS_24350 80019 76900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 81494 80493 gene locus_tag LOCUS_24360 gene nusA 81494 80493 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_24360 82026 81505 gene locus_tag LOCUS_24370 gene rimP 82026 81505 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973323.1 protein_id gnl|my_center|LOCUS_24370 82160 82681 gene locus_tag LOCUS_24380 82160 82681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 82674 83237 gene locus_tag LOCUS_24390 82674 83237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 85001 83259 gene locus_tag LOCUS_24400 85001 83259 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223963.1 protein_id gnl|my_center|LOCUS_24400 85638 85150 gene locus_tag LOCUS_24410 85638 85150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 85711 85914 gene locus_tag LOCUS_24420 85711 85914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 86046 87524 gene locus_tag LOCUS_24430 gene dnaK 86046 87524 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_24430 87630 88967 gene locus_tag LOCUS_24440 87630 88967 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_24440 88997 90175 gene locus_tag LOCUS_24450 88997 90175 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_24450 90966 90244 gene locus_tag LOCUS_24460 90966 90244 CDS product copper homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230268.1 protein_id gnl|my_center|LOCUS_24460 91567 90977 gene locus_tag LOCUS_24470 91567 90977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 92506 91754 gene locus_tag LOCUS_24480 92506 91754 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029507.1 protein_id gnl|my_center|LOCUS_24480 92644 92940 gene locus_tag LOCUS_24490 92644 92940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 93136 93897 gene locus_tag LOCUS_24500 93136 93897 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726679.1 protein_id gnl|my_center|LOCUS_24500 93949 94419 gene locus_tag LOCUS_24510 93949 94419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 95303 94479 gene locus_tag LOCUS_24520 95303 94479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_24520 96858 95371 gene locus_tag LOCUS_24530 96858 95371 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030606.1 protein_id gnl|my_center|LOCUS_24530 97227 97910 gene locus_tag LOCUS_24540 97227 97910 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064806.1 protein_id gnl|my_center|LOCUS_24540 97907 98590 gene locus_tag LOCUS_24550 97907 98590 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227842.1 protein_id gnl|my_center|LOCUS_24550 100105 98690 gene locus_tag LOCUS_24560 100105 98690 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027188.1 protein_id gnl|my_center|LOCUS_24560 101468 100182 gene locus_tag LOCUS_24570 101468 100182 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_24570 102365 101541 gene locus_tag LOCUS_24580 102365 101541 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027186.1 protein_id gnl|my_center|LOCUS_24580 103450 102362 gene locus_tag LOCUS_24590 103450 102362 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978331.1 protein_id gnl|my_center|LOCUS_24590 104820 103546 gene locus_tag LOCUS_24600 104820 103546 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027184.1 protein_id gnl|my_center|LOCUS_24600 104955 105689 gene locus_tag LOCUS_24610 104955 105689 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225174.1 protein_id gnl|my_center|LOCUS_24610 107110 105713 gene locus_tag LOCUS_24620 107110 105713 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030374.1 protein_id gnl|my_center|LOCUS_24620 108384 107107 gene locus_tag LOCUS_24630 108384 107107 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528942.1 protein_id gnl|my_center|LOCUS_24630 108488 109111 gene locus_tag LOCUS_24640 108488 109111 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730474.1 protein_id gnl|my_center|LOCUS_24640 109199 110284 gene locus_tag LOCUS_24650 109199 110284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 110303 111250 gene locus_tag LOCUS_24660 110303 111250 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896728.1 protein_id gnl|my_center|LOCUS_24660 111536 111303 gene locus_tag LOCUS_24670 111536 111303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 111715 112347 gene locus_tag LOCUS_24680 111715 112347 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973445.1 protein_id gnl|my_center|LOCUS_24680 112929 112351 gene locus_tag LOCUS_24690 112929 112351 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222250.1 protein_id gnl|my_center|LOCUS_24690 113016 113651 gene locus_tag LOCUS_24700 113016 113651 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_24700 113784 115706 gene locus_tag LOCUS_24710 113784 115706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 116426 115731 gene locus_tag LOCUS_24720 116426 115731 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 protein_id gnl|my_center|LOCUS_24720 116580 118112 gene locus_tag LOCUS_24730 116580 118112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 119350 118232 gene locus_tag LOCUS_24740 119350 118232 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228921.1 protein_id gnl|my_center|LOCUS_24740 119541 119954 gene locus_tag LOCUS_24750 119541 119954 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975825.1 protein_id gnl|my_center|LOCUS_24750 120072 122678 gene locus_tag LOCUS_24760 120072 122678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 122736 124058 gene locus_tag LOCUS_24770 122736 124058 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123282.1 protein_id gnl|my_center|LOCUS_24770 124605 125429 gene locus_tag LOCUS_24780 124605 125429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_24780 125426 125812 gene locus_tag LOCUS_24790 125426 125812 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_24790 126611 125793 gene locus_tag LOCUS_24800 126611 125793 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_24800 128345 126726 gene locus_tag LOCUS_24810 128345 126726 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030952.1 protein_id gnl|my_center|LOCUS_24810 129496 128456 gene locus_tag LOCUS_24820 gene ispG 129496 128456 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031167.1 protein_id gnl|my_center|LOCUS_24820 130555 129950 gene locus_tag LOCUS_24830 130555 129950 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400591.1 protein_id gnl|my_center|LOCUS_24830 130665 131630 gene locus_tag LOCUS_24840 130665 131630 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899798.1 protein_id gnl|my_center|LOCUS_24840 132858 131650 gene locus_tag LOCUS_24850 gene dxr 132858 131650 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_24850 133019 134440 gene locus_tag LOCUS_24860 133019 134440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 135391 134462 gene locus_tag LOCUS_24870 gene ppk2 135391 134462 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062218.1 protein_id gnl|my_center|LOCUS_24870 135707 135477 gene locus_tag LOCUS_24880 135707 135477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 136849 135704 gene locus_tag LOCUS_24890 136849 135704 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402904.1 protein_id gnl|my_center|LOCUS_24890 138389 136944 gene locus_tag LOCUS_24900 138389 136944 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030384.1 protein_id gnl|my_center|LOCUS_24900 138605 139231 gene locus_tag LOCUS_24910 138605 139231 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227915.1 protein_id gnl|my_center|LOCUS_24910 140719 139250 gene locus_tag LOCUS_24920 140719 139250 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223101.1 protein_id gnl|my_center|LOCUS_24920 140787 142148 gene locus_tag LOCUS_24930 gene gabT 140787 142148 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973349.1 protein_id gnl|my_center|LOCUS_24930 142320 142568 gene locus_tag LOCUS_24940 142320 142568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 142609 143130 gene locus_tag LOCUS_24950 142609 143130 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031523.1 protein_id gnl|my_center|LOCUS_24950 144160 143051 gene locus_tag LOCUS_24960 144160 143051 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878137.1 protein_id gnl|my_center|LOCUS_24960 145815 144322 gene locus_tag LOCUS_24970 145815 144322 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 protein_id gnl|my_center|LOCUS_24970 147130 145802 gene locus_tag LOCUS_24980 147130 145802 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_24980 148740 147238 gene locus_tag LOCUS_24990 148740 147238 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029391.1 protein_id gnl|my_center|LOCUS_24990 148719 149528 gene locus_tag LOCUS_25000 148719 149528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 149567 151177 gene locus_tag LOCUS_25010 149567 151177 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228411.1 protein_id gnl|my_center|LOCUS_25010 151332 151538 gene locus_tag LOCUS_25020 151332 151538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 151667 153229 gene locus_tag LOCUS_25030 151667 153229 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031038.1 protein_id gnl|my_center|LOCUS_25030 154144 153260 gene locus_tag LOCUS_25040 154144 153260 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404797.1 protein_id gnl|my_center|LOCUS_25040 154217 154747 gene locus_tag LOCUS_25050 154217 154747 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229828.1 protein_id gnl|my_center|LOCUS_25050 155284 154889 gene locus_tag LOCUS_25060 155284 154889 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224578.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence09 78 1010 gene locus_tag LOCUS_25070 78 1010 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730506.1 protein_id gnl|my_center|LOCUS_25070 1290 1087 gene locus_tag LOCUS_25080 1290 1087 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978336.1 protein_id gnl|my_center|LOCUS_25080 1671 2453 gene locus_tag LOCUS_25090 1671 2453 CDS product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776254.1 protein_id gnl|my_center|LOCUS_25090 3753 2593 gene locus_tag LOCUS_25100 3753 2593 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224293.1 protein_id gnl|my_center|LOCUS_25100 3924 4412 gene locus_tag LOCUS_25110 3924 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 4510 4983 gene locus_tag LOCUS_25120 4510 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 7233 5107 gene locus_tag LOCUS_25130 gene fusA 7233 5107 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031026.1 protein_id gnl|my_center|LOCUS_25130 8211 7627 gene locus_tag LOCUS_25140 8211 7627 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030960.1 protein_id gnl|my_center|LOCUS_25140 8417 10495 gene locus_tag LOCUS_25150 8417 10495 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191603.1 protein_id gnl|my_center|LOCUS_25150 10800 10594 gene locus_tag LOCUS_25160 10800 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 12196 10925 gene locus_tag LOCUS_25170 12196 10925 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410039.1 protein_id gnl|my_center|LOCUS_25170 12430 13110 gene locus_tag LOCUS_25180 12430 13110 CDS product pyridoxal 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112028.1 protein_id gnl|my_center|LOCUS_25180 13338 15485 gene locus_tag LOCUS_25190 gene helR 13338 15485 CDS product RNA polymerase recycling motor ATPase HelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728199.1 protein_id gnl|my_center|LOCUS_25190 16147 15509 gene locus_tag LOCUS_25200 16147 15509 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_25200 16656 16237 gene locus_tag LOCUS_25210 16656 16237 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027912.1 protein_id gnl|my_center|LOCUS_25210 18285 16741 gene locus_tag LOCUS_25220 18285 16741 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973724.1 protein_id gnl|my_center|LOCUS_25220 18588 19292 gene locus_tag LOCUS_25230 18588 19292 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971433.1 protein_id gnl|my_center|LOCUS_25230 21345 19327 gene locus_tag LOCUS_25240 21345 19327 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486780.1 protein_id gnl|my_center|LOCUS_25240 22342 21461 gene locus_tag LOCUS_25250 22342 21461 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972532.1 protein_id gnl|my_center|LOCUS_25250 22627 24291 gene locus_tag LOCUS_25260 gene mdcA 22627 24291 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112666.1 protein_id gnl|my_center|LOCUS_25260 24299 25177 gene locus_tag LOCUS_25270 24299 25177 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190298.1 protein_id gnl|my_center|LOCUS_25270 25165 25458 gene locus_tag LOCUS_25280 gene mdcC 25165 25458 CDS product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898055.1 protein_id gnl|my_center|LOCUS_25280 25455 26378 gene locus_tag LOCUS_25290 25455 26378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25290 26375 27181 gene locus_tag LOCUS_25300 26375 27181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25300 27172 27804 gene locus_tag LOCUS_25310 27172 27804 CDS product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031628460.1 protein_id gnl|my_center|LOCUS_25310 27801 28748 gene locus_tag LOCUS_25320 gene mdcH 27801 28748 CDS product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112670.1 protein_id gnl|my_center|LOCUS_25320 29217 28768 gene locus_tag LOCUS_25330 29217 28768 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230140.1 protein_id gnl|my_center|LOCUS_25330 29301 30185 gene locus_tag LOCUS_25340 29301 30185 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230141.1 protein_id gnl|my_center|LOCUS_25340 30695 30396 gene locus_tag LOCUS_25350 30695 30396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 30601 33204 gene locus_tag LOCUS_25360 30601 33204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 33900 35570 gene locus_tag LOCUS_25370 33900 35570 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_25370 35671 36621 gene locus_tag LOCUS_25380 35671 36621 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_25380 36788 37453 gene locus_tag LOCUS_25390 36788 37453 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228758.1 protein_id gnl|my_center|LOCUS_25390 38198 37476 gene locus_tag LOCUS_25400 38198 37476 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640172.1 protein_id gnl|my_center|LOCUS_25400 38959 38552 gene locus_tag LOCUS_25410 38959 38552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 38865 40652 gene locus_tag LOCUS_25420 38865 40652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 40861 41850 gene locus_tag LOCUS_25430 gene hemC 40861 41850 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971798.1 protein_id gnl|my_center|LOCUS_25430 43068 41884 gene locus_tag LOCUS_25440 43068 41884 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_25440 43328 44932 gene locus_tag LOCUS_25450 43328 44932 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140493.1 protein_id gnl|my_center|LOCUS_25450 45067 46155 gene locus_tag LOCUS_25460 45067 46155 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029660.1 protein_id gnl|my_center|LOCUS_25460 47337 46258 gene locus_tag LOCUS_25470 47337 46258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 47411 50077 gene locus_tag LOCUS_25480 47411 50077 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728171.1 protein_id gnl|my_center|LOCUS_25480 54158 50166 gene locus_tag LOCUS_25490 54158 50166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 55659 54445 gene locus_tag LOCUS_25500 55659 54445 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223912.1 protein_id gnl|my_center|LOCUS_25500 55902 59252 gene locus_tag LOCUS_25510 55902 59252 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_25510 59415 61211 gene locus_tag LOCUS_25520 59415 61211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 61388 62317 gene locus_tag LOCUS_25530 61388 62317 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226358.1 protein_id gnl|my_center|LOCUS_25530 62625 63602 gene locus_tag LOCUS_25540 62625 63602 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930069.1 protein_id gnl|my_center|LOCUS_25540 64862 63633 gene locus_tag LOCUS_25550 64862 63633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161162.1 protein_id gnl|my_center|LOCUS_25550 65032 65841 gene locus_tag LOCUS_25560 65032 65841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 67028 65850 gene locus_tag LOCUS_25570 67028 65850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 67179 68369 gene locus_tag LOCUS_25580 67179 68369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 68366 69010 gene locus_tag LOCUS_25590 68366 69010 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230978.1 protein_id gnl|my_center|LOCUS_25590 70515 69022 gene locus_tag LOCUS_25600 70515 69022 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_25600 71059 70856 gene locus_tag LOCUS_25610 71059 70856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 71001 72767 gene locus_tag LOCUS_25620 71001 72767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 protein_id gnl|my_center|LOCUS_25620 73364 74437 gene locus_tag LOCUS_25630 73364 74437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 74448 75614 gene locus_tag LOCUS_25640 74448 75614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 75619 75918 gene locus_tag LOCUS_25650 75619 75918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 75915 78050 gene locus_tag LOCUS_25660 75915 78050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 78031 78750 gene locus_tag LOCUS_25670 78031 78750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 79308 78841 gene locus_tag LOCUS_25680 79308 78841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031366.1 protein_id gnl|my_center|LOCUS_25680 79903 79301 gene locus_tag LOCUS_25690 79903 79301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 81237 79924 gene locus_tag LOCUS_25700 81237 79924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 81342 84011 gene locus_tag LOCUS_25710 81342 84011 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223261.1 protein_id gnl|my_center|LOCUS_25710 84023 85543 gene locus_tag LOCUS_25720 84023 85543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 protein_id gnl|my_center|LOCUS_25720 85540 87294 gene locus_tag LOCUS_25730 85540 87294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030252.1 protein_id gnl|my_center|LOCUS_25730 88115 87345 gene locus_tag LOCUS_25740 88115 87345 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223914.1 protein_id gnl|my_center|LOCUS_25740 89189 88290 gene locus_tag LOCUS_25750 89189 88290 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091306902.1 protein_id gnl|my_center|LOCUS_25750 90035 89283 gene locus_tag LOCUS_25760 90035 89283 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891449.1 protein_id gnl|my_center|LOCUS_25760 90660 90289 gene locus_tag LOCUS_25770 90660 90289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 90542 92308 gene locus_tag LOCUS_25780 90542 92308 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224280.1 protein_id gnl|my_center|LOCUS_25780 93182 92436 gene locus_tag LOCUS_25790 93182 92436 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728668.1 protein_id gnl|my_center|LOCUS_25790 94181 93372 gene locus_tag LOCUS_25800 94181 93372 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 protein_id gnl|my_center|LOCUS_25800 94587 95498 gene locus_tag LOCUS_25810 94587 95498 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225528.1 protein_id gnl|my_center|LOCUS_25810 96093 95572 gene locus_tag LOCUS_25820 96093 95572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 96445 97227 gene locus_tag LOCUS_25830 96445 97227 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122195341.1 protein_id gnl|my_center|LOCUS_25830 97525 98577 gene locus_tag LOCUS_25840 gene hemE 97525 98577 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391363.1 protein_id gnl|my_center|LOCUS_25840 99682 98708 gene locus_tag LOCUS_25850 gene pip 99682 98708 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226797.1 protein_id gnl|my_center|LOCUS_25850 99799 100338 gene locus_tag LOCUS_25860 99799 100338 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864582.1 protein_id gnl|my_center|LOCUS_25860 101044 100670 gene locus_tag LOCUS_25870 101044 100670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 101104 101550 gene locus_tag LOCUS_25880 101104 101550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 101618 102454 gene locus_tag LOCUS_25890 101618 102454 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_25890 103427 102594 gene locus_tag LOCUS_25900 103427 102594 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728098.1 protein_id gnl|my_center|LOCUS_25900 104640 103555 gene locus_tag LOCUS_25910 104640 103555 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 protein_id gnl|my_center|LOCUS_25910 107084 104898 gene locus_tag LOCUS_25920 107084 104898 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225090.1 protein_id gnl|my_center|LOCUS_25920 107573 107271 gene locus_tag LOCUS_25930 107573 107271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 107723 109123 gene locus_tag LOCUS_25940 107723 109123 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089659.1 protein_id gnl|my_center|LOCUS_25940 109120 110106 gene locus_tag LOCUS_25950 109120 110106 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037062758.1 protein_id gnl|my_center|LOCUS_25950 110135 110497 gene locus_tag LOCUS_25960 110135 110497 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727669.1 protein_id gnl|my_center|LOCUS_25960 112357 110498 gene locus_tag LOCUS_25970 112357 110498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 113109 112363 gene locus_tag LOCUS_25980 113109 112363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 protein_id gnl|my_center|LOCUS_25980 113633 113106 gene locus_tag LOCUS_25990 113633 113106 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_25990 114443 113751 gene locus_tag LOCUS_26000 114443 113751 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819086.1 protein_id gnl|my_center|LOCUS_26000 115117 114440 gene locus_tag LOCUS_26010 115117 114440 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 protein_id gnl|my_center|LOCUS_26010 116301 115114 gene locus_tag LOCUS_26020 116301 115114 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223752.1 protein_id gnl|my_center|LOCUS_26020 117225 116422 gene locus_tag LOCUS_26030 117225 116422 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109028630.1 protein_id gnl|my_center|LOCUS_26030 118035 117262 gene locus_tag LOCUS_26040 118035 117262 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230260.1 protein_id gnl|my_center|LOCUS_26040 118880 118032 gene locus_tag LOCUS_26050 118880 118032 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 protein_id gnl|my_center|LOCUS_26050 119842 118877 gene locus_tag LOCUS_26060 119842 118877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 120183 120968 gene locus_tag LOCUS_26070 120183 120968 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_26070 121769 121014 gene locus_tag LOCUS_26080 121769 121014 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893955.1 protein_id gnl|my_center|LOCUS_26080 121967 123511 gene locus_tag LOCUS_26090 121967 123511 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229234.1 protein_id gnl|my_center|LOCUS_26090 126697 123557 gene locus_tag LOCUS_26100 126697 123557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 128555 126738 gene locus_tag LOCUS_26110 128555 126738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 130320 128656 gene locus_tag LOCUS_26120 130320 128656 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_26120 131282 130344 gene locus_tag LOCUS_26130 131282 130344 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_26130 132304 131279 gene locus_tag LOCUS_26140 132304 131279 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_26140 132507 132304 gene locus_tag LOCUS_26150 132507 132304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 133168 132968 gene locus_tag LOCUS_26160 133168 132968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 133666 133169 gene locus_tag LOCUS_26170 133666 133169 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728757.1 protein_id gnl|my_center|LOCUS_26170 134265 133684 gene locus_tag LOCUS_26180 134265 133684 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729581.1 protein_id gnl|my_center|LOCUS_26180 135103 134348 gene locus_tag LOCUS_26190 135103 134348 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090295.1 protein_id gnl|my_center|LOCUS_26190 135234 135668 gene locus_tag LOCUS_26200 135234 135668 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028484.1 protein_id gnl|my_center|LOCUS_26200 136658 135732 gene locus_tag LOCUS_26210 gene sigJ 136658 135732 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229999.1 protein_id gnl|my_center|LOCUS_26210 136832 137230 gene locus_tag LOCUS_26220 136832 137230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027097.1 protein_id gnl|my_center|LOCUS_26220 137256 137612 gene locus_tag LOCUS_26230 137256 137612 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975921.1 protein_id gnl|my_center|LOCUS_26230 139055 137649 gene locus_tag LOCUS_26240 gene murD 139055 137649 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228039.1 protein_id gnl|my_center|LOCUS_26240 139393 140508 gene locus_tag LOCUS_26250 139393 140508 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030291.1 protein_id gnl|my_center|LOCUS_26250 140586 142019 gene locus_tag LOCUS_26260 gene murC 140586 142019 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030625.1 protein_id gnl|my_center|LOCUS_26260 142106 143104 gene locus_tag LOCUS_26270 142106 143104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 143772 143131 gene locus_tag LOCUS_26280 143772 143131 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222235.1 protein_id gnl|my_center|LOCUS_26280 144089 143838 gene locus_tag LOCUS_26290 144089 143838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 144311 144940 gene locus_tag LOCUS_26300 144311 144940 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976456.1 protein_id gnl|my_center|LOCUS_26300 145170 145697 gene locus_tag LOCUS_26310 145170 145697 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762680.1 protein_id gnl|my_center|LOCUS_26310 147405 146092 gene locus_tag LOCUS_26320 147405 146092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 147520 147885 gene locus_tag LOCUS_26330 gene zntR 147520 147885 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486335.1 protein_id gnl|my_center|LOCUS_26330 148398 147949 gene locus_tag LOCUS_26340 148398 147949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 148456 148863 gene locus_tag LOCUS_26350 148456 148863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 148906 149331 gene locus_tag LOCUS_26360 148906 149331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466698.1 protein_id gnl|my_center|LOCUS_26360 153695 149595 gene locus_tag LOCUS_26370 153695 149595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 154731 154453 gene locus_tag LOCUS_26380 154731 154453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 154768 155208 gene locus_tag LOCUS_26390 154768 155208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 155565 155251 gene locus_tag LOCUS_26400 155565 155251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 156574 155738 gene locus_tag LOCUS_26410 156574 155738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 157962 156574 gene locus_tag LOCUS_26420 157962 156574 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038047495.1 protein_id gnl|my_center|LOCUS_26420 158229 158465 gene locus_tag LOCUS_26430 158229 158465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 159343 158513 gene locus_tag LOCUS_26440 159343 158513 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223184.1 protein_id gnl|my_center|LOCUS_26440 160278 159340 gene locus_tag LOCUS_26450 160278 159340 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975592.1 protein_id gnl|my_center|LOCUS_26450 160450 161703 gene locus_tag LOCUS_26460 160450 161703 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222861.1 protein_id gnl|my_center|LOCUS_26460 161700 162401 gene locus_tag LOCUS_26470 161700 162401 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222860.1 protein_id gnl|my_center|LOCUS_26470 162599 163552 gene locus_tag LOCUS_26480 162599 163552 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_26480 163579 164373 gene locus_tag LOCUS_26490 163579 164373 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_26490 164406 165209 gene locus_tag LOCUS_26500 164406 165209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_26500 165419 165865 gene locus_tag LOCUS_26510 165419 165865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 166270 167874 gene locus_tag LOCUS_26520 166270 167874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 169868 167904 gene locus_tag LOCUS_26530 169868 167904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 169996 171009 gene locus_tag LOCUS_26540 169996 171009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 171166 172929 gene locus_tag LOCUS_26550 171166 172929 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_26550 174819 173074 gene locus_tag LOCUS_26560 174819 173074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 175062 175451 gene locus_tag LOCUS_26570 175062 175451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 175707 175495 gene locus_tag LOCUS_26580 175707 175495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 176797 175808 gene locus_tag LOCUS_26590 176797 175808 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_26590 177625 176858 gene locus_tag LOCUS_26600 177625 176858 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230770.1 protein_id gnl|my_center|LOCUS_26600 178412 177630 gene locus_tag LOCUS_26610 178412 177630 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230771.1 protein_id gnl|my_center|LOCUS_26610 179328 178423 gene locus_tag LOCUS_26620 179328 178423 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642439.1 protein_id gnl|my_center|LOCUS_26620 180227 179382 gene locus_tag LOCUS_26630 180227 179382 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 protein_id gnl|my_center|LOCUS_26630 180995 180297 gene locus_tag LOCUS_26640 180995 180297 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086706.1 protein_id gnl|my_center|LOCUS_26640 181894 181274 gene locus_tag LOCUS_26650 181894 181274 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093953615.1 protein_id gnl|my_center|LOCUS_26650 182046 182930 gene locus_tag LOCUS_26660 182046 182930 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523300.1 protein_id gnl|my_center|LOCUS_26660 183523 184560 gene locus_tag LOCUS_26670 183523 184560 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976856.1 protein_id gnl|my_center|LOCUS_26670 184653 185438 gene locus_tag LOCUS_26680 184653 185438 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222750.1 protein_id gnl|my_center|LOCUS_26680 185756 186859 gene locus_tag LOCUS_26690 185756 186859 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082015379.1 protein_id gnl|my_center|LOCUS_26690 187114 186743 gene locus_tag LOCUS_26700 187114 186743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 190842 187438 gene locus_tag LOCUS_26710 190842 187438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 191219 191473 gene locus_tag LOCUS_26720 191219 191473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 192170 191529 gene locus_tag LOCUS_26730 192170 191529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 192359 192793 gene locus_tag LOCUS_26740 192359 192793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 193485 192940 gene locus_tag LOCUS_26750 193485 192940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 194831 193566 gene locus_tag LOCUS_26760 194831 193566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 195346 194831 gene locus_tag LOCUS_26770 195346 194831 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_26770 195690 195505 gene locus_tag LOCUS_26780 195690 195505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 195732 195887 gene locus_tag LOCUS_26790 195732 195887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 195892 196911 gene locus_tag LOCUS_26800 195892 196911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 197098 197430 gene locus_tag LOCUS_26810 197098 197430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 197842 197381 gene locus_tag LOCUS_26820 197842 197381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 198015 198164 gene locus_tag LOCUS_26830 198015 198164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 198161 198367 gene locus_tag LOCUS_26840 198161 198367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 198677 198360 gene locus_tag LOCUS_26850 198677 198360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 199094 198840 gene locus_tag LOCUS_26860 199094 198840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 199266 199679 gene locus_tag LOCUS_26870 199266 199679 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230489.1 protein_id gnl|my_center|LOCUS_26870 201742 199853 gene locus_tag LOCUS_26880 201742 199853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 204581 201936 gene locus_tag LOCUS_26890 204581 201936 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661056.1 protein_id gnl|my_center|LOCUS_26890 205202 205870 gene locus_tag LOCUS_26900 205202 205870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 205917 206234 gene locus_tag LOCUS_26910 205917 206234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 206623 207054 gene locus_tag LOCUS_26920 206623 207054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 208054 207221 gene locus_tag LOCUS_26930 208054 207221 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971637.1 protein_id gnl|my_center|LOCUS_26930 211321 208709 gene locus_tag LOCUS_26940 211321 208709 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661056.1 protein_id gnl|my_center|LOCUS_26940 212883 211321 gene locus_tag LOCUS_26950 212883 211321 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226892.1 protein_id gnl|my_center|LOCUS_26950 213101 214126 gene locus_tag LOCUS_26960 213101 214126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 215286 214216 gene locus_tag LOCUS_26970 215286 214216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 216885 216205 gene locus_tag LOCUS_26980 216885 216205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 217554 217018 gene locus_tag LOCUS_26990 217554 217018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 217851 218027 gene locus_tag LOCUS_27000 217851 218027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 218237 218028 gene locus_tag LOCUS_27010 218237 218028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 218498 219244 gene locus_tag LOCUS_27020 218498 219244 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 protein_id gnl|my_center|LOCUS_27020 219370 219492 gene locus_tag LOCUS_27030 219370 219492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 221578 220283 gene locus_tag LOCUS_27040 221578 220283 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026832.1 protein_id gnl|my_center|LOCUS_27040 222256 221951 gene locus_tag LOCUS_27050 222256 221951 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_27050 223787 224341 gene locus_tag LOCUS_27060 223787 224341 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056876.1 protein_id gnl|my_center|LOCUS_27060 224398 224808 gene locus_tag LOCUS_27070 224398 224808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 224888 225715 gene locus_tag LOCUS_27080 224888 225715 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098657.1 protein_id gnl|my_center|LOCUS_27080 225776 226423 gene locus_tag LOCUS_27090 225776 226423 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056877.1 protein_id gnl|my_center|LOCUS_27090 227045 227614 gene locus_tag LOCUS_27100 227045 227614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 228627 228082 gene locus_tag LOCUS_27110 228627 228082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 228626 229309 gene locus_tag LOCUS_27120 228626 229309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 229824 229438 gene locus_tag LOCUS_27130 229824 229438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 229974 230330 gene locus_tag LOCUS_27140 229974 230330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 230282 230500 gene locus_tag LOCUS_27150 230282 230500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 230980 230753 gene locus_tag LOCUS_27160 230980 230753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 230912 231460 gene locus_tag LOCUS_27170 230912 231460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 231822 232253 gene locus_tag LOCUS_27180 231822 232253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 232933 232451 gene locus_tag LOCUS_27190 232933 232451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 233173 234027 gene locus_tag LOCUS_27200 233173 234027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 235110 234406 gene locus_tag LOCUS_27210 235110 234406 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109943.1 protein_id gnl|my_center|LOCUS_27210 235538 236098 gene locus_tag LOCUS_27220 235538 236098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 236358 236095 gene locus_tag LOCUS_27230 236358 236095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 237016 237723 gene locus_tag LOCUS_27240 237016 237723 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_27240 238347 238547 gene locus_tag LOCUS_27250 238347 238547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 239428 239201 gene locus_tag LOCUS_27260 239428 239201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 239654 239391 gene locus_tag LOCUS_27270 239654 239391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 240198 239911 gene locus_tag LOCUS_27280 240198 239911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 240400 240633 gene locus_tag LOCUS_27290 240400 240633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 240997 240716 gene locus_tag LOCUS_27300 240997 240716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 241035 241256 gene locus_tag LOCUS_27310 241035 241256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 241797 241291 gene locus_tag LOCUS_27320 241797 241291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 242249 241806 gene locus_tag LOCUS_27330 242249 241806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 242338 242673 gene locus_tag LOCUS_27340 242338 242673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 243492 244556 gene locus_tag LOCUS_27350 243492 244556 CDS product EfeM/EfeO family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847669.1 protein_id gnl|my_center|LOCUS_27350 244553 245839 gene locus_tag LOCUS_27360 244553 245839 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229345.1 protein_id gnl|my_center|LOCUS_27360 245890 247533 gene locus_tag LOCUS_27370 245890 247533 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229346.1 protein_id gnl|my_center|LOCUS_27370 247695 248240 gene locus_tag LOCUS_27380 247695 248240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 248609 248773 gene locus_tag LOCUS_27390 248609 248773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 248839 249177 gene locus_tag LOCUS_27400 248839 249177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 249307 249768 gene locus_tag LOCUS_27410 249307 249768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 253823 250305 gene locus_tag LOCUS_27420 253823 250305 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221463383.1 protein_id gnl|my_center|LOCUS_27420 254787 253954 gene locus_tag LOCUS_27430 254787 253954 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_27430 256001 254784 gene locus_tag LOCUS_27440 256001 254784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 256977 256048 gene locus_tag LOCUS_27450 256977 256048 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970002.1 protein_id gnl|my_center|LOCUS_27450 257975 256974 gene locus_tag LOCUS_27460 257975 256974 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067334.1 protein_id gnl|my_center|LOCUS_27460 259405 257972 gene locus_tag LOCUS_27470 259405 257972 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973344.1 protein_id gnl|my_center|LOCUS_27470 260534 260055 gene locus_tag LOCUS_27480 260534 260055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27480 261769 260711 gene locus_tag LOCUS_27490 261769 260711 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727875.1 protein_id gnl|my_center|LOCUS_27490 261845 262387 gene locus_tag LOCUS_27500 261845 262387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 263039 263992 gene locus_tag LOCUS_27510 263039 263992 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226103.1 protein_id gnl|my_center|LOCUS_27510 264649 264254 gene locus_tag LOCUS_27520 264649 264254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27520 264894 264703 gene locus_tag LOCUS_27530 264894 264703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 265183 264851 gene locus_tag LOCUS_27540 265183 264851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 265264 265836 gene locus_tag LOCUS_27550 265264 265836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 266333 267250 gene locus_tag LOCUS_27560 266333 267250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 267261 268430 gene locus_tag LOCUS_27570 267261 268430 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_27570 268454 269329 gene locus_tag LOCUS_27580 268454 269329 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030936.1 protein_id gnl|my_center|LOCUS_27580 269697 269398 gene locus_tag LOCUS_27590 269697 269398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 <270269 269732 gene locus_tag LOCUS_27600 <270269 269732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229184.1:SpoIIE family protein phosphatase note possible pseudo, frameshifted >Feature sequence10 2888 4420 gene locus_tag LOCUS_27610 2888 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 4413 5279 gene locus_tag LOCUS_27620 4413 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 5416 7782 gene locus_tag LOCUS_27630 5416 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 8115 9344 gene locus_tag LOCUS_27640 8115 9344 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_27640 9332 11248 gene locus_tag LOCUS_27650 gene asnB 9332 11248 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_27650 11227 12522 gene locus_tag LOCUS_27660 11227 12522 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868291.1 protein_id gnl|my_center|LOCUS_27660 13338 13730 gene locus_tag LOCUS_27670 13338 13730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 14596 15903 gene locus_tag LOCUS_27680 14596 15903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 17248 16205 gene locus_tag LOCUS_27690 17248 16205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 18109 17801 gene locus_tag LOCUS_27700 18109 17801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 17996 18913 gene locus_tag LOCUS_27710 17996 18913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 18910 19884 gene locus_tag LOCUS_27720 18910 19884 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_27720 19962 20954 gene locus_tag LOCUS_27730 19962 20954 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_27730 20951 21991 gene locus_tag LOCUS_27740 20951 21991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 21996 23351 gene locus_tag LOCUS_27750 21996 23351 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_27750 23910 23329 gene locus_tag LOCUS_27760 23910 23329 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068381.1 protein_id gnl|my_center|LOCUS_27760 25508 23925 gene locus_tag LOCUS_27770 25508 23925 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053633.1 protein_id gnl|my_center|LOCUS_27770 26422 25985 gene locus_tag LOCUS_27780 26422 25985 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226716.1 protein_id gnl|my_center|LOCUS_27780 26564 27436 gene locus_tag LOCUS_27790 26564 27436 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978567.1 protein_id gnl|my_center|LOCUS_27790 27677 28996 gene locus_tag LOCUS_27800 27677 28996 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068319765.1 protein_id gnl|my_center|LOCUS_27800 29085 29507 gene locus_tag LOCUS_27810 29085 29507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 31038 29815 gene locus_tag LOCUS_27820 31038 29815 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 protein_id gnl|my_center|LOCUS_27820 31161 32147 gene locus_tag LOCUS_27830 31161 32147 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_27830 32625 32137 gene locus_tag LOCUS_27840 32625 32137 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730834.1 protein_id gnl|my_center|LOCUS_27840 32835 33479 gene locus_tag LOCUS_27850 32835 33479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 34178 33534 gene locus_tag LOCUS_27860 34178 33534 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225212.1 protein_id gnl|my_center|LOCUS_27860 34269 35387 gene locus_tag LOCUS_27870 34269 35387 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_27870 35716 35405 gene locus_tag LOCUS_27880 35716 35405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 36048 35713 gene locus_tag LOCUS_27890 36048 35713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 36460 36092 gene locus_tag LOCUS_27900 36460 36092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 36510 36767 gene locus_tag LOCUS_27910 36510 36767 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144139.1 protein_id gnl|my_center|LOCUS_27910 38366 36780 gene locus_tag LOCUS_27920 38366 36780 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973724.1 protein_id gnl|my_center|LOCUS_27920 39576 38422 gene locus_tag LOCUS_27930 39576 38422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 39790 41760 gene locus_tag LOCUS_27940 39790 41760 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_27940 43348 41783 gene locus_tag LOCUS_27950 43348 41783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 44320 43502 gene locus_tag LOCUS_27960 44320 43502 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027526.1 protein_id gnl|my_center|LOCUS_27960 45147 44365 gene locus_tag LOCUS_27970 45147 44365 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972223.1 protein_id gnl|my_center|LOCUS_27970 45603 45178 gene locus_tag LOCUS_27980 gene aroQ 45603 45178 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052141.1 protein_id gnl|my_center|LOCUS_27980 46685 45609 gene locus_tag LOCUS_27990 gene aroB 46685 45609 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_27990 47194 46682 gene locus_tag LOCUS_28000 47194 46682 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742170.1 protein_id gnl|my_center|LOCUS_28000 48387 47209 gene locus_tag LOCUS_28010 gene aroC 48387 47209 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_28010 49082 48408 gene locus_tag LOCUS_28020 49082 48408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 49652 49092 gene locus_tag LOCUS_28030 49652 49092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 50780 49674 gene locus_tag LOCUS_28040 50780 49674 CDS product ring-opening amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393610.1 protein_id gnl|my_center|LOCUS_28040 51719 50781 gene locus_tag LOCUS_28050 gene arcC 51719 50781 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_28050 51824 52192 gene locus_tag LOCUS_28060 51824 52192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 53057 52200 gene locus_tag LOCUS_28070 53057 52200 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973040.1 protein_id gnl|my_center|LOCUS_28070 54299 53136 gene locus_tag LOCUS_28080 54299 53136 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222355.1 protein_id gnl|my_center|LOCUS_28080 54514 56202 gene locus_tag LOCUS_28090 54514 56202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 56234 57220 gene locus_tag LOCUS_28100 56234 57220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 57150 57941 gene locus_tag LOCUS_28110 57150 57941 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224126.1 protein_id gnl|my_center|LOCUS_28110 57979 58410 gene locus_tag LOCUS_28120 57979 58410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 58407 58838 gene locus_tag LOCUS_28130 58407 58838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 60307 58817 gene locus_tag LOCUS_28140 60307 58817 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728196.1 protein_id gnl|my_center|LOCUS_28140 61476 60304 gene locus_tag LOCUS_28150 61476 60304 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728197.1 protein_id gnl|my_center|LOCUS_28150 61833 61666 gene locus_tag LOCUS_28160 61833 61666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 63802 61967 gene locus_tag LOCUS_28170 63802 61967 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258126.1 protein_id gnl|my_center|LOCUS_28170 65841 63799 gene locus_tag LOCUS_28180 65841 63799 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067631220.1 protein_id gnl|my_center|LOCUS_28180 66606 65941 gene locus_tag LOCUS_28190 66606 65941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 66968 68401 gene locus_tag LOCUS_28200 66968 68401 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_28200 68413 69357 gene locus_tag LOCUS_28210 gene cydB 68413 69357 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 protein_id gnl|my_center|LOCUS_28210 71792 69315 gene locus_tag LOCUS_28220 71792 69315 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929962.1 protein_id gnl|my_center|LOCUS_28220 71966 71876 gene locus_tag LOCUS_t00190 71966 71876 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 73098 72214 gene locus_tag LOCUS_28230 73098 72214 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_28230 74487 73117 gene locus_tag LOCUS_28240 74487 73117 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977375.1 protein_id gnl|my_center|LOCUS_28240 75019 74801 gene locus_tag LOCUS_28250 75019 74801 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189709.1 protein_id gnl|my_center|LOCUS_28250 76636 75035 gene locus_tag LOCUS_28260 76636 75035 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393615.1 protein_id gnl|my_center|LOCUS_28260 76801 77718 gene locus_tag LOCUS_28270 76801 77718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 77719 79083 gene locus_tag LOCUS_28280 77719 79083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28280 79080 80465 gene locus_tag LOCUS_28290 79080 80465 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_28290 80584 82653 gene locus_tag LOCUS_28300 80584 82653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 84280 82682 gene locus_tag LOCUS_28310 84280 82682 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 protein_id gnl|my_center|LOCUS_28310 85827 84322 gene locus_tag LOCUS_28320 85827 84322 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971785.1 protein_id gnl|my_center|LOCUS_28320 87459 85861 gene locus_tag LOCUS_28330 87459 85861 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484466.1 protein_id gnl|my_center|LOCUS_28330 87516 89066 gene locus_tag LOCUS_28340 87516 89066 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027283.1 protein_id gnl|my_center|LOCUS_28340 89112 90017 gene locus_tag LOCUS_28350 89112 90017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 90133 90447 gene locus_tag LOCUS_28360 90133 90447 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974205.1 protein_id gnl|my_center|LOCUS_28360 91193 90534 gene locus_tag LOCUS_28370 91193 90534 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444597.1 protein_id gnl|my_center|LOCUS_28370 92327 91230 gene locus_tag LOCUS_28380 gene rsgA 92327 91230 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_28380 92390 92617 gene locus_tag LOCUS_28390 92390 92617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 93944 92685 gene locus_tag LOCUS_28400 93944 92685 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_28400 95567 94101 gene locus_tag LOCUS_28410 95567 94101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 96587 95637 gene locus_tag LOCUS_28420 96587 95637 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972813.1 protein_id gnl|my_center|LOCUS_28420 97548 96748 gene locus_tag LOCUS_28430 97548 96748 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110556.1 protein_id gnl|my_center|LOCUS_28430 98101 99783 gene locus_tag LOCUS_28440 gene sirA 98101 99783 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_28440 99780 99932 gene locus_tag LOCUS_28450 99780 99932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228432.1 protein_id gnl|my_center|LOCUS_28450 99978 100706 gene locus_tag LOCUS_28460 99978 100706 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_28460 100854 101612 gene locus_tag LOCUS_28470 100854 101612 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030650.1 protein_id gnl|my_center|LOCUS_28470 102320 101670 gene locus_tag LOCUS_28480 102320 101670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 103324 102413 gene locus_tag LOCUS_28490 103324 102413 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028650.1 protein_id gnl|my_center|LOCUS_28490 103515 105119 gene locus_tag LOCUS_28500 103515 105119 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_28500 105733 106161 gene locus_tag LOCUS_28510 105733 106161 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_28510 106424 108544 gene locus_tag LOCUS_28520 gene glgX 106424 108544 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224925.1 protein_id gnl|my_center|LOCUS_28520 108639 109568 gene locus_tag LOCUS_28530 108639 109568 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115566.1 protein_id gnl|my_center|LOCUS_28530 109565 110308 gene locus_tag LOCUS_28540 109565 110308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 110305 110610 gene locus_tag LOCUS_28550 110305 110610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 111690 110614 gene locus_tag LOCUS_28560 111690 110614 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031122.1 protein_id gnl|my_center|LOCUS_28560 112411 111674 gene locus_tag LOCUS_28570 112411 111674 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030623.1 protein_id gnl|my_center|LOCUS_28570 112551 112952 gene locus_tag LOCUS_28580 112551 112952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 113011 115080 gene locus_tag LOCUS_28590 113011 115080 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089385.1 protein_id gnl|my_center|LOCUS_28590 115199 115435 gene locus_tag LOCUS_28600 115199 115435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 116524 115511 gene locus_tag LOCUS_28610 gene ligD 116524 115511 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_28610 116957 117358 gene locus_tag LOCUS_28620 gene msrB 116957 117358 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224520.1 protein_id gnl|my_center|LOCUS_28620 117883 117416 gene locus_tag LOCUS_28630 117883 117416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 118774 118073 gene locus_tag LOCUS_28640 118774 118073 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_28640 120232 118793 gene locus_tag LOCUS_28650 gene hemG 120232 118793 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_28650 120338 121513 gene locus_tag LOCUS_28660 120338 121513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 122554 121517 gene locus_tag LOCUS_28670 gene hemE 122554 121517 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_28670 122678 123037 gene locus_tag LOCUS_28680 122678 123037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 123047 123703 gene locus_tag LOCUS_28690 123047 123703 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_28690 123721 124944 gene locus_tag LOCUS_28700 123721 124944 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_28700 125022 126167 gene locus_tag LOCUS_28710 125022 126167 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456192.1 protein_id gnl|my_center|LOCUS_28710 126164 127339 gene locus_tag LOCUS_28720 126164 127339 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894021.1 protein_id gnl|my_center|LOCUS_28720 127808 128599 gene locus_tag LOCUS_28730 127808 128599 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728493.1 protein_id gnl|my_center|LOCUS_28730 129572 128583 gene locus_tag LOCUS_28740 129572 128583 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228701.1 protein_id gnl|my_center|LOCUS_28740 129705 130889 gene locus_tag LOCUS_28750 129705 130889 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030603.1 protein_id gnl|my_center|LOCUS_28750 130886 132994 gene locus_tag LOCUS_28760 130886 132994 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030602.1 protein_id gnl|my_center|LOCUS_28760 135882 133030 gene locus_tag LOCUS_28770 135882 133030 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104583.1 protein_id gnl|my_center|LOCUS_28770 136107 137507 gene locus_tag LOCUS_28780 136107 137507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 137575 138189 gene locus_tag LOCUS_28790 137575 138189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 139636 138161 gene locus_tag LOCUS_28800 139636 138161 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972907.1 protein_id gnl|my_center|LOCUS_28800 141663 139759 gene locus_tag LOCUS_28810 gene dxs 141663 139759 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031168.1 protein_id gnl|my_center|LOCUS_28810 143136 141928 gene locus_tag LOCUS_28820 143136 141928 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224456.1 protein_id gnl|my_center|LOCUS_28820 144465 143215 gene locus_tag LOCUS_28830 144465 143215 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 protein_id gnl|my_center|LOCUS_28830 145238 144462 gene locus_tag LOCUS_28840 145238 144462 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224454.1 protein_id gnl|my_center|LOCUS_28840 146418 145303 gene locus_tag LOCUS_28850 146418 145303 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897421.1 protein_id gnl|my_center|LOCUS_28850 147399 146662 gene locus_tag LOCUS_28860 147399 146662 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731052.1 protein_id gnl|my_center|LOCUS_28860 147556 147879 gene locus_tag LOCUS_28870 147556 147879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 147845 148183 gene locus_tag LOCUS_28880 147845 148183 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_28880 151007 148233 gene locus_tag LOCUS_28890 gene acnA 151007 148233 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_28890 151891 151172 gene locus_tag LOCUS_28900 151891 151172 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804305.1 protein_id gnl|my_center|LOCUS_28900 152274 152071 gene locus_tag LOCUS_28910 152274 152071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 152739 153470 gene locus_tag LOCUS_28920 152739 153470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 153476 154030 gene locus_tag LOCUS_28930 153476 154030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 154182 155276 gene locus_tag LOCUS_28940 154182 155276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 155303 155515 gene locus_tag LOCUS_28950 155303 155515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 155623 156237 gene locus_tag LOCUS_28960 155623 156237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204026379.1 protein_id gnl|my_center|LOCUS_28960 156809 156180 gene locus_tag LOCUS_28970 gene mug 156809 156180 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_28970 159347 156867 gene locus_tag LOCUS_28980 159347 156867 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030575.1 protein_id gnl|my_center|LOCUS_28980 160914 159409 gene locus_tag LOCUS_28990 160914 159409 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172865.1 protein_id gnl|my_center|LOCUS_28990 161919 161002 gene locus_tag LOCUS_29000 161919 161002 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_29000 162067 163086 gene locus_tag LOCUS_29010 162067 163086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 163296 163601 gene locus_tag LOCUS_29020 163296 163601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 164990 163755 gene locus_tag LOCUS_29030 164990 163755 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_29030 167057 165021 gene locus_tag LOCUS_29040 167057 165021 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973119.1 protein_id gnl|my_center|LOCUS_29040 167174 167842 gene locus_tag LOCUS_29050 167174 167842 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_29050 167842 168501 gene locus_tag LOCUS_29060 167842 168501 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_29060 169221 168547 gene locus_tag LOCUS_29070 169221 168547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 169630 169238 gene locus_tag LOCUS_29080 169630 169238 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_29080 170443 169778 gene locus_tag LOCUS_29090 170443 169778 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 protein_id gnl|my_center|LOCUS_29090 170925 170488 gene locus_tag LOCUS_29100 gene dut 170925 170488 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_29100 172091 170937 gene locus_tag LOCUS_29110 172091 170937 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_29110 172181 172501 gene locus_tag LOCUS_29120 172181 172501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 172857 173150 gene locus_tag LOCUS_29130 172857 173150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 174523 173147 gene locus_tag LOCUS_29140 174523 173147 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230392.1 protein_id gnl|my_center|LOCUS_29140 175487 174735 gene locus_tag LOCUS_29150 175487 174735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 175808 175509 gene locus_tag LOCUS_29160 175808 175509 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_29160 177502 176069 gene locus_tag LOCUS_29170 177502 176069 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_29170 178185 177532 gene locus_tag LOCUS_29180 178185 177532 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_29180 178427 178591 gene locus_tag LOCUS_29190 178427 178591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 179435 178659 gene locus_tag LOCUS_29200 179435 178659 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 protein_id gnl|my_center|LOCUS_29200 181814 179844 gene locus_tag LOCUS_29210 181814 179844 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729974.1 protein_id gnl|my_center|LOCUS_29210 181915 182877 gene locus_tag LOCUS_29220 181915 182877 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226767.1 protein_id gnl|my_center|LOCUS_29220 184020 182881 gene locus_tag LOCUS_29230 184020 182881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 184284 185474 gene locus_tag LOCUS_29240 184284 185474 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_29240 185577 186902 gene locus_tag LOCUS_29250 185577 186902 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_29250 187446 189617 gene locus_tag LOCUS_29260 187446 189617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 191355 189724 gene locus_tag LOCUS_29270 191355 189724 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206015115.1 protein_id gnl|my_center|LOCUS_29270 191966 191484 gene locus_tag LOCUS_29280 191966 191484 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_29280 192121 193086 gene locus_tag LOCUS_29290 192121 193086 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 protein_id gnl|my_center|LOCUS_29290 193172 193984 gene locus_tag LOCUS_29300 193172 193984 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 protein_id gnl|my_center|LOCUS_29300 197286 193999 gene locus_tag LOCUS_29310 197286 193999 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 protein_id gnl|my_center|LOCUS_29310 197474 198016 gene locus_tag LOCUS_29320 197474 198016 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_29320 198200 200248 gene locus_tag LOCUS_29330 198200 200248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 200406 202577 gene locus_tag LOCUS_29340 200406 202577 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224095.1 protein_id gnl|my_center|LOCUS_29340 202663 203679 gene locus_tag LOCUS_29350 202663 203679 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167468068.1 protein_id gnl|my_center|LOCUS_29350 204377 203682 gene locus_tag LOCUS_29360 204377 203682 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971520.1 protein_id gnl|my_center|LOCUS_29360 204577 205368 gene locus_tag LOCUS_29370 gene atpB 204577 205368 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030208.1 protein_id gnl|my_center|LOCUS_29370 206860 205391 gene locus_tag LOCUS_29380 206860 205391 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_29380 208472 207060 gene locus_tag LOCUS_29390 208472 207060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 208962 208459 gene locus_tag LOCUS_29400 208962 208459 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225162.1 protein_id gnl|my_center|LOCUS_29400 209792 209145 gene locus_tag LOCUS_29410 209792 209145 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227659.1 protein_id gnl|my_center|LOCUS_29410 209878 210342 gene locus_tag LOCUS_29420 209878 210342 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227660.1 protein_id gnl|my_center|LOCUS_29420 210412 210990 gene locus_tag LOCUS_29430 210412 210990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 211406 211068 gene locus_tag LOCUS_29440 211406 211068 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085555.1 protein_id gnl|my_center|LOCUS_29440 212312 211677 gene locus_tag LOCUS_29450 212312 211677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 212518 212760 gene locus_tag LOCUS_29460 212518 212760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 213195 212881 gene locus_tag LOCUS_29470 213195 212881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 213803 213303 gene locus_tag LOCUS_29480 213803 213303 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486294.1 protein_id gnl|my_center|LOCUS_29480 214050 215555 gene locus_tag LOCUS_29490 214050 215555 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_29490 215580 215969 gene locus_tag LOCUS_29500 215580 215969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 216084 216545 gene locus_tag LOCUS_29510 216084 216545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 217451 216732 gene locus_tag LOCUS_29520 217451 216732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 217723 218196 gene locus_tag LOCUS_29530 217723 218196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 219063 218716 gene locus_tag LOCUS_29540 219063 218716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 219297 219620 gene locus_tag LOCUS_29550 219297 219620 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110060.1 protein_id gnl|my_center|LOCUS_29550 222194 220929 gene locus_tag LOCUS_29560 222194 220929 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223079.1 protein_id gnl|my_center|LOCUS_29560 222931 222191 gene locus_tag LOCUS_29570 222931 222191 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_29570 223764 222928 gene locus_tag LOCUS_29580 223764 222928 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_29580 223838 224887 gene locus_tag LOCUS_29590 223838 224887 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 protein_id gnl|my_center|LOCUS_29590 224884 226002 gene locus_tag LOCUS_29600 224884 226002 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225315.1 protein_id gnl|my_center|LOCUS_29600 225999 226808 gene locus_tag LOCUS_29610 225999 226808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 protein_id gnl|my_center|LOCUS_29610 226805 227908 gene locus_tag LOCUS_29620 gene menC 226805 227908 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_29620 228049 229356 gene locus_tag LOCUS_29630 228049 229356 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_29630 230444 229404 gene locus_tag LOCUS_29640 230444 229404 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104003.1 protein_id gnl|my_center|LOCUS_29640 231173 231913 gene locus_tag LOCUS_29650 231173 231913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 232048 233745 gene locus_tag LOCUS_29660 232048 233745 CDS product SCO2524 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028405.1 protein_id gnl|my_center|LOCUS_29660 233745 234662 gene locus_tag LOCUS_29670 233745 234662 CDS product SCO2523 family variant P-loop protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976280.1 protein_id gnl|my_center|LOCUS_29670 234659 235615 gene locus_tag LOCUS_29680 234659 235615 CDS product SCO2522 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485045.1 protein_id gnl|my_center|LOCUS_29680 235630 236556 gene locus_tag LOCUS_29690 235630 236556 CDS product SCO2521 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028403.1 protein_id gnl|my_center|LOCUS_29690 236556 237503 gene locus_tag LOCUS_29700 236556 237503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 238671 237466 gene locus_tag LOCUS_29710 gene thiO 238671 237466 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_29710 238971 239762 gene locus_tag LOCUS_29720 238971 239762 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_29720 240415 241407 gene locus_tag LOCUS_29730 240415 241407 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_29730 241732 244065 gene locus_tag LOCUS_29740 241732 244065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 244780 245355 gene locus_tag LOCUS_29750 244780 245355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 245352 246389 gene locus_tag LOCUS_29760 245352 246389 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222043.1 protein_id gnl|my_center|LOCUS_29760 247917 246502 gene locus_tag LOCUS_29770 247917 246502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 248000 250618 gene locus_tag LOCUS_29780 248000 250618 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227899.1 protein_id gnl|my_center|LOCUS_29780 250615 251496 gene locus_tag LOCUS_29790 250615 251496 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 protein_id gnl|my_center|LOCUS_29790 251703 251536 gene locus_tag LOCUS_29800 251703 251536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 251921 254035 gene locus_tag LOCUS_29810 251921 254035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325800.1 protein_id gnl|my_center|LOCUS_29810 255016 254042 gene locus_tag LOCUS_29820 255016 254042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 255483 255088 gene locus_tag LOCUS_29830 255483 255088 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_29830 255583 256488 gene locus_tag LOCUS_29840 255583 256488 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_29840 256512 257576 gene locus_tag LOCUS_29850 256512 257576 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_29850 258457 257660 gene locus_tag LOCUS_29860 258457 257660 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972225.1 protein_id gnl|my_center|LOCUS_29860 259837 258521 gene locus_tag LOCUS_29870 259837 258521 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877707.1 protein_id gnl|my_center|LOCUS_29870 262578 260035 gene locus_tag LOCUS_29880 262578 260035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 263184 262795 gene locus_tag LOCUS_29890 263184 262795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 263102 264127 gene locus_tag LOCUS_29900 263102 264127 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_29900 264165 265733 gene locus_tag LOCUS_29910 264165 265733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 266411 265767 gene locus_tag LOCUS_29920 266411 265767 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775255.1 protein_id gnl|my_center|LOCUS_29920 266510 268048 gene locus_tag LOCUS_29930 266510 268048 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479846.1 protein_id gnl|my_center|LOCUS_29930 268238 268597 gene locus_tag LOCUS_29940 268238 268597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence11 1278 1 gene locus_tag LOCUS_29950 1278 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 1835 1302 gene locus_tag LOCUS_29960 1835 1302 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_29960 1942 3159 gene locus_tag LOCUS_29970 1942 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 4227 3184 gene locus_tag LOCUS_29980 4227 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 4407 5684 gene locus_tag LOCUS_29990 4407 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 5681 6937 gene locus_tag LOCUS_30000 5681 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 6934 7929 gene locus_tag LOCUS_30010 6934 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 7938 8783 gene locus_tag LOCUS_30020 7938 8783 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836183.1 protein_id gnl|my_center|LOCUS_30020 8780 10105 gene locus_tag LOCUS_30030 8780 10105 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902371.1 protein_id gnl|my_center|LOCUS_30030 10102 11025 gene locus_tag LOCUS_30040 10102 11025 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122763.1 protein_id gnl|my_center|LOCUS_30040 12167 11346 gene locus_tag LOCUS_30050 12167 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 13084 12167 gene locus_tag LOCUS_30060 13084 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 14010 13099 gene locus_tag LOCUS_30070 14010 13099 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331969.1 protein_id gnl|my_center|LOCUS_30070 15356 14094 gene locus_tag LOCUS_30080 15356 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 16392 15478 gene locus_tag LOCUS_30090 gene cysD 16392 15478 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086386.1 protein_id gnl|my_center|LOCUS_30090 17173 16412 gene locus_tag LOCUS_30100 17173 16412 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_30100 18634 17174 gene locus_tag LOCUS_30110 18634 17174 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978484.1 protein_id gnl|my_center|LOCUS_30110 18734 19384 gene locus_tag LOCUS_30120 18734 19384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195773.1 protein_id gnl|my_center|LOCUS_30120 19924 19304 gene locus_tag LOCUS_30130 gene pth 19924 19304 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_30130 20608 19991 gene locus_tag LOCUS_30140 20608 19991 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975690.1 protein_id gnl|my_center|LOCUS_30140 21723 20746 gene locus_tag LOCUS_30150 21723 20746 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_30150 23442 21982 gene locus_tag LOCUS_30160 gene glmU 23442 21982 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_30160 23677 23605 gene locus_tag LOCUS_t00200 23677 23605 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 24047 24985 gene locus_tag LOCUS_30170 24047 24985 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229961.1 protein_id gnl|my_center|LOCUS_30170 24978 26315 gene locus_tag LOCUS_30180 24978 26315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 26374 28476 gene locus_tag LOCUS_30190 26374 28476 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_30190 28486 29391 gene locus_tag LOCUS_30200 28486 29391 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223623.1 protein_id gnl|my_center|LOCUS_30200 30879 29410 gene locus_tag LOCUS_30210 30879 29410 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978319.1 protein_id gnl|my_center|LOCUS_30210 31693 30935 gene locus_tag LOCUS_30220 31693 30935 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028784.1 protein_id gnl|my_center|LOCUS_30220 31781 32305 gene locus_tag LOCUS_30230 gene tamR 31781 32305 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_30230 32572 33366 gene locus_tag LOCUS_30240 32572 33366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 35460 33652 gene locus_tag LOCUS_30250 35460 33652 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_30250 36390 35473 gene locus_tag LOCUS_30260 36390 35473 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028794.1 protein_id gnl|my_center|LOCUS_30260 36572 37966 gene locus_tag LOCUS_30270 36572 37966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 37963 39552 gene locus_tag LOCUS_30280 37963 39552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 40451 39597 gene locus_tag LOCUS_30290 gene rsmA 40451 39597 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_30290 40581 42269 gene locus_tag LOCUS_30300 40581 42269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 42266 43699 gene locus_tag LOCUS_30310 42266 43699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 44537 43701 gene locus_tag LOCUS_30320 44537 43701 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_30320 46919 45060 gene locus_tag LOCUS_30330 gene metG 46919 45060 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467759.1 protein_id gnl|my_center|LOCUS_30330 48211 46991 gene locus_tag LOCUS_30340 48211 46991 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_30340 48442 49998 gene locus_tag LOCUS_30350 48442 49998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 50837 50016 gene locus_tag LOCUS_30360 gene rsmI 50837 50016 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_30360 50945 52555 gene locus_tag LOCUS_30370 50945 52555 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_30370 52641 53939 gene locus_tag LOCUS_30380 52641 53939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 54014 54532 gene locus_tag LOCUS_30390 54014 54532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 54598 55644 gene locus_tag LOCUS_30400 54598 55644 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229391.1 protein_id gnl|my_center|LOCUS_30400 56531 55653 gene locus_tag LOCUS_30410 56531 55653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 56848 56528 gene locus_tag LOCUS_30420 56848 56528 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078066.1 protein_id gnl|my_center|LOCUS_30420 56964 57905 gene locus_tag LOCUS_30430 56964 57905 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029384.1 protein_id gnl|my_center|LOCUS_30430 57964 58560 gene locus_tag LOCUS_30440 57964 58560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 58791 59432 gene locus_tag LOCUS_30450 58791 59432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 59762 60535 gene locus_tag LOCUS_30460 59762 60535 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031612.1 protein_id gnl|my_center|LOCUS_30460 61354 60653 gene locus_tag LOCUS_30470 61354 60653 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390275.1 protein_id gnl|my_center|LOCUS_30470 61310 61765 gene locus_tag LOCUS_30480 61310 61765 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228135.1 protein_id gnl|my_center|LOCUS_30480 61973 62905 gene locus_tag LOCUS_30490 61973 62905 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223330.1 protein_id gnl|my_center|LOCUS_30490 63121 63717 gene locus_tag LOCUS_30500 63121 63717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 64140 63739 gene locus_tag LOCUS_30510 64140 63739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 64049 64312 gene locus_tag LOCUS_30520 64049 64312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 64889 64425 gene locus_tag LOCUS_30530 64889 64425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 65472 64891 gene locus_tag LOCUS_30540 65472 64891 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222749.1 protein_id gnl|my_center|LOCUS_30540 66298 65465 gene locus_tag LOCUS_30550 66298 65465 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_30550 67128 66379 gene locus_tag LOCUS_30560 67128 66379 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229418.1 protein_id gnl|my_center|LOCUS_30560 67253 68182 gene locus_tag LOCUS_30570 67253 68182 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_30570 68208 68993 gene locus_tag LOCUS_30580 gene lieB 68208 68993 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_30580 69686 69126 gene locus_tag LOCUS_30590 69686 69126 CDS product DUF1062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973073.1 protein_id gnl|my_center|LOCUS_30590 70017 70526 gene locus_tag LOCUS_30600 70017 70526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 70869 70561 gene locus_tag LOCUS_30610 70869 70561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 72016 71006 gene locus_tag LOCUS_30620 72016 71006 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974578.1 protein_id gnl|my_center|LOCUS_30620 72108 72656 gene locus_tag LOCUS_30630 72108 72656 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223589.1 protein_id gnl|my_center|LOCUS_30630 73139 72720 gene locus_tag LOCUS_30640 73139 72720 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027669.1 protein_id gnl|my_center|LOCUS_30640 73841 74095 gene locus_tag LOCUS_30650 73841 74095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 74674 74468 gene locus_tag LOCUS_30660 74674 74468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 75378 74734 gene locus_tag LOCUS_30670 75378 74734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 75878 75375 gene locus_tag LOCUS_30680 75878 75375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 76164 76088 gene locus_tag LOCUS_t00210 76164 76088 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 76880 76215 gene locus_tag LOCUS_30690 76880 76215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 77706 77062 gene locus_tag LOCUS_30700 77706 77062 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_30700 78237 77761 gene locus_tag LOCUS_30710 78237 77761 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_30710 78731 78261 gene locus_tag LOCUS_30720 gene moaC 78731 78261 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_30720 79912 78728 gene locus_tag LOCUS_30730 79912 78728 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_30730 80822 79917 gene locus_tag LOCUS_30740 gene galU 80822 79917 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_30740 80847 81422 gene locus_tag LOCUS_30750 80847 81422 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_30750 81455 82960 gene locus_tag LOCUS_30760 81455 82960 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029115.1 protein_id gnl|my_center|LOCUS_30760 83233 83586 gene locus_tag LOCUS_30770 83233 83586 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975630.1 protein_id gnl|my_center|LOCUS_30770 83672 84478 gene locus_tag LOCUS_30780 83672 84478 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_30780 84514 85116 gene locus_tag LOCUS_30790 84514 85116 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896877.1 protein_id gnl|my_center|LOCUS_30790 86309 85167 gene locus_tag LOCUS_30800 86309 85167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 87263 86550 gene locus_tag LOCUS_30810 87263 86550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 87514 87587 gene locus_tag LOCUS_t00220 87514 87587 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 88277 89248 gene locus_tag LOCUS_30820 88277 89248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 90001 91392 gene locus_tag LOCUS_30830 90001 91392 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207706.1 protein_id gnl|my_center|LOCUS_30830 91389 92102 gene locus_tag LOCUS_30840 91389 92102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 92104 93942 gene locus_tag LOCUS_30850 92104 93942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 95670 94300 gene locus_tag LOCUS_30860 95670 94300 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030198.1 protein_id gnl|my_center|LOCUS_30860 95858 95667 gene locus_tag LOCUS_30870 95858 95667 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031039432.1 protein_id gnl|my_center|LOCUS_30870 96004 95855 gene locus_tag LOCUS_30880 96004 95855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 96394 96227 gene locus_tag LOCUS_30890 96394 96227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 96962 98233 gene locus_tag LOCUS_30900 96962 98233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 98392 99945 gene locus_tag LOCUS_30910 98392 99945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 99942 100880 gene locus_tag LOCUS_30920 99942 100880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 100877 102631 gene locus_tag LOCUS_30930 100877 102631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 103242 102610 gene locus_tag LOCUS_30940 103242 102610 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775785.1 protein_id gnl|my_center|LOCUS_30940 103989 103255 gene locus_tag LOCUS_30950 103989 103255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 104097 106466 gene locus_tag LOCUS_30960 104097 106466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 106463 107320 gene locus_tag LOCUS_30970 106463 107320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 107317 108597 gene locus_tag LOCUS_30980 107317 108597 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749584.1 protein_id gnl|my_center|LOCUS_30980 108701 108612 gene locus_tag LOCUS_t00230 108701 108612 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 108773 109126 gene locus_tag LOCUS_30990 108773 109126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 109803 109312 gene locus_tag LOCUS_31000 109803 109312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 110689 112431 gene locus_tag LOCUS_31010 110689 112431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 112428 112841 gene locus_tag LOCUS_31020 112428 112841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 114155 113118 gene locus_tag LOCUS_31030 114155 113118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 114817 114254 gene locus_tag LOCUS_31040 114817 114254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 115187 114879 gene locus_tag LOCUS_31050 115187 114879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 115774 115184 gene locus_tag LOCUS_31060 115774 115184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 116844 115780 gene locus_tag LOCUS_31070 116844 115780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 117203 116904 gene locus_tag LOCUS_31080 117203 116904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 117729 117304 gene locus_tag LOCUS_31090 117729 117304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 118172 117771 gene locus_tag LOCUS_31100 118172 117771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 119429 118623 gene locus_tag LOCUS_31110 119429 118623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 120763 120455 gene locus_tag LOCUS_31120 120763 120455 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972439.1 protein_id gnl|my_center|LOCUS_31120 122007 120781 gene locus_tag LOCUS_31130 122007 120781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 122190 122402 gene locus_tag LOCUS_31140 122190 122402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 123506 122922 gene locus_tag LOCUS_31150 123506 122922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 >Feature sequence12 2602 119 gene locus_tag LOCUS_31160 2602 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 5841 3172 gene locus_tag LOCUS_31170 5841 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 6260 5838 gene locus_tag LOCUS_31180 6260 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749555.1 protein_id gnl|my_center|LOCUS_31180 6688 6257 gene locus_tag LOCUS_31190 6688 6257 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749557.1 protein_id gnl|my_center|LOCUS_31190 7059 6685 gene locus_tag LOCUS_31200 7059 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228855.1 protein_id gnl|my_center|LOCUS_31200 7271 7056 gene locus_tag LOCUS_31210 7271 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 8156 7287 gene locus_tag LOCUS_31220 8156 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 8989 8153 gene locus_tag LOCUS_31230 8989 8153 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228858.1 protein_id gnl|my_center|LOCUS_31230 10299 8986 gene locus_tag LOCUS_31240 10299 8986 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029708.1 protein_id gnl|my_center|LOCUS_31240 11039 10296 gene locus_tag LOCUS_31250 11039 10296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749563.1 protein_id gnl|my_center|LOCUS_31250 11622 11044 gene locus_tag LOCUS_31260 11622 11044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 12355 11705 gene locus_tag LOCUS_31270 12355 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 13029 12502 gene locus_tag LOCUS_31280 13029 12502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 13676 13350 gene locus_tag LOCUS_31290 13676 13350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 14029 13673 gene locus_tag LOCUS_31300 14029 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 14071 15333 gene locus_tag LOCUS_31310 14071 15333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 15308 15823 gene locus_tag LOCUS_31320 15308 15823 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201788935.1 protein_id gnl|my_center|LOCUS_31320 16611 15847 gene locus_tag LOCUS_31330 16611 15847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 16883 18118 gene locus_tag LOCUS_31340 16883 18118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 18750 18268 gene locus_tag LOCUS_31350 18750 18268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 21097 19088 gene locus_tag LOCUS_31360 21097 19088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 21973 21254 gene locus_tag LOCUS_31370 21973 21254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 24087 22201 gene locus_tag LOCUS_31380 24087 22201 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230933.1 protein_id gnl|my_center|LOCUS_31380 25499 24087 gene locus_tag LOCUS_31390 25499 24087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 26656 25589 gene locus_tag LOCUS_31400 26656 25589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 28268 26991 gene locus_tag LOCUS_31410 28268 26991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 28487 28287 gene locus_tag LOCUS_31420 28487 28287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 28383 29072 gene locus_tag LOCUS_31430 28383 29072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 29097 30395 gene locus_tag LOCUS_31440 29097 30395 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169733975.1 protein_id gnl|my_center|LOCUS_31440 31992 30460 gene locus_tag LOCUS_31450 31992 30460 CDS product ISL3-like element IS466 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029008.1 protein_id gnl|my_center|LOCUS_31450 35219 32094 gene locus_tag LOCUS_31460 35219 32094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 38286 35212 gene locus_tag LOCUS_31470 38286 35212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 38689 39768 gene locus_tag LOCUS_31480 38689 39768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 40646 40488 gene locus_tag LOCUS_31490 40646 40488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 41303 40740 gene locus_tag LOCUS_31500 41303 40740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 43662 41404 gene locus_tag LOCUS_31510 43662 41404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 45831 43738 gene locus_tag LOCUS_31520 45831 43738 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_31520 47392 45833 gene locus_tag LOCUS_31530 gene pkaE 47392 45833 CDS product serine/threonine protein kinase PkaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028766.1 protein_id gnl|my_center|LOCUS_31530 47677 47531 gene locus_tag LOCUS_31540 47677 47531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 47950 47690 gene locus_tag LOCUS_31550 47950 47690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 47949 48791 gene locus_tag LOCUS_31560 47949 48791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 50626 48788 gene locus_tag LOCUS_31570 50626 48788 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028768.1 protein_id gnl|my_center|LOCUS_31570 51293 50661 gene locus_tag LOCUS_31580 51293 50661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 51177 51407 gene locus_tag LOCUS_31590 51177 51407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 53317 51422 gene locus_tag LOCUS_31600 53317 51422 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 protein_id gnl|my_center|LOCUS_31600 57108 53317 gene locus_tag LOCUS_31610 gene drmA 57108 53317 CDS product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204892.1 protein_id gnl|my_center|LOCUS_31610 57386 57105 gene locus_tag LOCUS_31620 57386 57105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 61444 57386 gene locus_tag LOCUS_31630 61444 57386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204891.1 protein_id gnl|my_center|LOCUS_31630 64554 61441 gene locus_tag LOCUS_31640 gene drmD 64554 61441 CDS product DISARM system SNF2-like helicase DrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204890.1 protein_id gnl|my_center|LOCUS_31640 64891 65523 gene locus_tag LOCUS_31650 64891 65523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 65584 67545 gene locus_tag LOCUS_31660 65584 67545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 67845 70727 gene locus_tag LOCUS_31670 67845 70727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 70774 74589 gene locus_tag LOCUS_31680 70774 74589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 74592 76205 gene locus_tag LOCUS_31690 74592 76205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 77766 76582 gene locus_tag LOCUS_31700 77766 76582 CDS product McrBC 5-methylcytosine restriction system component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804187.1 protein_id gnl|my_center|LOCUS_31700 79943 77763 gene locus_tag LOCUS_31710 79943 77763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 82909 80249 gene locus_tag LOCUS_31720 82909 80249 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518812.1 protein_id gnl|my_center|LOCUS_31720 83068 86496 gene locus_tag LOCUS_31730 83068 86496 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_31730 87510 87181 gene locus_tag LOCUS_31740 87510 87181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 87608 87760 gene locus_tag LOCUS_31750 87608 87760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 88166 88402 gene locus_tag LOCUS_31760 88166 88402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 88576 88779 gene locus_tag LOCUS_31770 88576 88779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 89438 88734 gene locus_tag LOCUS_31780 89438 88734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 89487 90500 gene locus_tag LOCUS_31790 89487 90500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 91976 90684 gene locus_tag LOCUS_31800 91976 90684 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527508.1 protein_id gnl|my_center|LOCUS_31800 92538 92215 gene locus_tag LOCUS_31810 92538 92215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 92747 93055 gene locus_tag LOCUS_31820 92747 93055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 93052 94998 gene locus_tag LOCUS_31830 93052 94998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 95461 95003 gene locus_tag LOCUS_31840 95461 95003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 96195 95842 gene locus_tag LOCUS_31850 gene frdD 96195 95842 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407771.1 protein_id gnl|my_center|LOCUS_31850 96609 96199 gene locus_tag LOCUS_31860 96609 96199 CDS product fumarate reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916859.1 protein_id gnl|my_center|LOCUS_31860 97349 96606 gene locus_tag LOCUS_31870 gene sdhB 97349 96606 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407767.1 protein_id gnl|my_center|LOCUS_31870 99106 97355 gene locus_tag LOCUS_31880 gene frdA 99106 97355 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898925.1 protein_id gnl|my_center|LOCUS_31880 99403 99170 gene locus_tag LOCUS_31890 99403 99170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 100021 100779 gene locus_tag LOCUS_31900 100021 100779 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729515.1 protein_id gnl|my_center|LOCUS_31900 101469 100867 gene locus_tag LOCUS_31910 101469 100867 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965307.1 protein_id gnl|my_center|LOCUS_31910 101630 102952 gene locus_tag LOCUS_31920 101630 102952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 105207 103066 gene locus_tag LOCUS_31930 105207 103066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 105235 105420 gene locus_tag LOCUS_31940 105235 105420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 105655 105383 gene locus_tag LOCUS_31950 105655 105383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 105807 106562 gene locus_tag LOCUS_31960 105807 106562 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776969.1 protein_id gnl|my_center|LOCUS_31960 108376 106649 gene locus_tag LOCUS_31970 108376 106649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 108777 110282 gene locus_tag LOCUS_31980 108777 110282 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803913.1 protein_id gnl|my_center|LOCUS_31980 110707 110468 gene locus_tag LOCUS_31990 110707 110468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 110627 110836 gene locus_tag LOCUS_32000 110627 110836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 110826 112196 gene locus_tag LOCUS_32010 110826 112196 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229319.1 protein_id gnl|my_center|LOCUS_32010 112233 113435 gene locus_tag LOCUS_32020 112233 113435 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_32020 115209 113599 gene locus_tag LOCUS_32030 115209 113599 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225958.1 protein_id gnl|my_center|LOCUS_32030 116410 115898 gene locus_tag LOCUS_32040 116410 115898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 117112 116441 gene locus_tag LOCUS_32050 gene prfH 117112 116441 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114116.1 protein_id gnl|my_center|LOCUS_32050 118308 117109 gene locus_tag LOCUS_32060 118308 117109 CDS product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114117.1 protein_id gnl|my_center|LOCUS_32060 118550 119077 gene locus_tag LOCUS_32070 118550 119077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 119096 119338 gene locus_tag LOCUS_32080 119096 119338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 120221 119553 gene locus_tag LOCUS_32090 120221 119553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 120172 120609 gene locus_tag LOCUS_32100 120172 120609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 121034 120840 gene locus_tag LOCUS_32110 121034 120840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 122470 121754 gene locus_tag LOCUS_32120 122470 121754 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230073.1 protein_id gnl|my_center|LOCUS_32120 123762 122461 gene locus_tag LOCUS_32130 123762 122461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 124168 123932 gene locus_tag LOCUS_32140 124168 123932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 124071 124865 gene locus_tag LOCUS_32150 124071 124865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 124858 128754 gene locus_tag LOCUS_32160 124858 128754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 128751 131063 gene locus_tag LOCUS_32170 128751 131063 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_32170 131060 132421 gene locus_tag LOCUS_32180 131060 132421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32180 132805 134331 gene locus_tag LOCUS_32190 132805 134331 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 protein_id gnl|my_center|LOCUS_32190 134328 135584 gene locus_tag LOCUS_32200 134328 135584 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104331.1 protein_id gnl|my_center|LOCUS_32200 135761 136099 gene locus_tag LOCUS_32210 135761 136099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 136282 137037 gene locus_tag LOCUS_32220 136282 137037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029192.1 protein_id gnl|my_center|LOCUS_32220 137705 137073 gene locus_tag LOCUS_32230 gene wrbA 137705 137073 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228078.1 protein_id gnl|my_center|LOCUS_32230 140601 137893 gene locus_tag LOCUS_32240 140601 137893 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031458.1 protein_id gnl|my_center|LOCUS_32240 <143367 141098 gene locus_tag LOCUS_32250 <143367 141098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165448192.1:calcium-binding protein >Feature sequence13 444 845 gene locus_tag LOCUS_32260 444 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 2510 915 gene locus_tag LOCUS_32270 2510 915 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096544.1 protein_id gnl|my_center|LOCUS_32270 2749 4704 gene locus_tag LOCUS_32280 2749 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 4701 5075 gene locus_tag LOCUS_32290 4701 5075 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_32290 6885 5167 gene locus_tag LOCUS_32300 6885 5167 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385682.1 protein_id gnl|my_center|LOCUS_32300 8894 6882 gene locus_tag LOCUS_32310 8894 6882 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067510.1 protein_id gnl|my_center|LOCUS_32310 10347 8929 gene locus_tag LOCUS_32320 10347 8929 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211366446.1 protein_id gnl|my_center|LOCUS_32320 11296 10331 gene locus_tag LOCUS_32330 11296 10331 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086017.1 protein_id gnl|my_center|LOCUS_32330 12081 11293 gene locus_tag LOCUS_32340 12081 11293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32340 12956 12078 gene locus_tag LOCUS_32350 12956 12078 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385673.1 protein_id gnl|my_center|LOCUS_32350 13969 12953 gene locus_tag LOCUS_32360 13969 12953 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385674.1 protein_id gnl|my_center|LOCUS_32360 15589 13973 gene locus_tag LOCUS_32370 15589 13973 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096544.1 protein_id gnl|my_center|LOCUS_32370 17172 15619 gene locus_tag LOCUS_32380 17172 15619 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387598.1 protein_id gnl|my_center|LOCUS_32380 18257 17169 gene locus_tag LOCUS_32390 18257 17169 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_32390 18463 18389 gene locus_tag LOCUS_t00240 18463 18389 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18694 18620 gene locus_tag LOCUS_t00250 18694 18620 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21698 18744 gene locus_tag LOCUS_32400 21698 18744 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_32400 22835 21789 gene locus_tag LOCUS_32410 22835 21789 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 protein_id gnl|my_center|LOCUS_32410 23289 22864 gene locus_tag LOCUS_32420 23289 22864 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_32420 24574 23618 gene locus_tag LOCUS_32430 24574 23618 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_32430 23782 23876 gene locus_tag LOCUS_t00260 23782 23876 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24464 24709 gene locus_tag LOCUS_32440 24464 24709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 24771 26072 gene locus_tag LOCUS_32450 24771 26072 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_32450 26165 26710 gene locus_tag LOCUS_32460 26165 26710 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973778.1 protein_id gnl|my_center|LOCUS_32460 26781 27785 gene locus_tag LOCUS_32470 26781 27785 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230440.1 protein_id gnl|my_center|LOCUS_32470 28353 27778 gene locus_tag LOCUS_32480 28353 27778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 28994 28350 gene locus_tag LOCUS_32490 28994 28350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 29077 30129 gene locus_tag LOCUS_32500 29077 30129 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486346.1 protein_id gnl|my_center|LOCUS_32500 30126 31469 gene locus_tag LOCUS_32510 30126 31469 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_32510 31788 31606 gene locus_tag LOCUS_32520 31788 31606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 32097 31834 gene locus_tag LOCUS_32530 32097 31834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 32592 32218 gene locus_tag LOCUS_32540 32592 32218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 33529 32645 gene locus_tag LOCUS_32550 33529 32645 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028576.1 protein_id gnl|my_center|LOCUS_32550 35553 33556 gene locus_tag LOCUS_32560 35553 33556 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_32560 35491 35676 gene locus_tag LOCUS_32570 35491 35676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 35718 36689 gene locus_tag LOCUS_32580 35718 36689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 36789 37028 gene locus_tag LOCUS_32590 36789 37028 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_32590 37934 37032 gene locus_tag LOCUS_32600 gene nudC 37934 37032 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_32600 38058 39239 gene locus_tag LOCUS_32610 38058 39239 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054234.1 protein_id gnl|my_center|LOCUS_32610 39236 40921 gene locus_tag LOCUS_32620 39236 40921 CDS product siderophore biosynthesis protein PsvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477461.1 protein_id gnl|my_center|LOCUS_32620 41069 42694 gene locus_tag LOCUS_32630 41069 42694 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030750.1 protein_id gnl|my_center|LOCUS_32630 43749 42676 gene locus_tag LOCUS_32640 43749 42676 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038170.1 protein_id gnl|my_center|LOCUS_32640 43918 44628 gene locus_tag LOCUS_32650 43918 44628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 47900 44637 gene locus_tag LOCUS_32660 47900 44637 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223039.1 protein_id gnl|my_center|LOCUS_32660 51084 47920 gene locus_tag LOCUS_32670 51084 47920 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_32670 51947 51627 gene locus_tag LOCUS_32680 51947 51627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 52306 51935 gene locus_tag LOCUS_32690 52306 51935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 53564 52386 gene locus_tag LOCUS_32700 gene mycP 53564 52386 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977220.1 protein_id gnl|my_center|LOCUS_32700 54433 53558 gene locus_tag LOCUS_32710 54433 53558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 55693 54443 gene locus_tag LOCUS_32720 gene mycP 55693 54443 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977220.1 protein_id gnl|my_center|LOCUS_32720 56406 55687 gene locus_tag LOCUS_32730 56406 55687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 56567 57034 gene locus_tag LOCUS_32740 56567 57034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 57034 57336 gene locus_tag LOCUS_32750 57034 57336 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174185.1 protein_id gnl|my_center|LOCUS_32750 58591 57413 gene locus_tag LOCUS_32760 gene moeZ 58591 57413 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_32760 59670 58690 gene locus_tag LOCUS_32770 59670 58690 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030094.1 protein_id gnl|my_center|LOCUS_32770 59986 60384 gene locus_tag LOCUS_32780 59986 60384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 60680 61060 gene locus_tag LOCUS_32790 60680 61060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 61355 61747 gene locus_tag LOCUS_32800 61355 61747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 62355 62594 gene locus_tag LOCUS_32810 62355 62594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 63281 63601 gene locus_tag LOCUS_32820 63281 63601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 64844 63915 gene locus_tag LOCUS_32830 64844 63915 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227088.1 protein_id gnl|my_center|LOCUS_32830 65002 65883 gene locus_tag LOCUS_32840 65002 65883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 65880 66767 gene locus_tag LOCUS_32850 65880 66767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 66813 67031 gene locus_tag LOCUS_32860 66813 67031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 67098 67718 gene locus_tag LOCUS_32870 67098 67718 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_32870 67814 68044 gene locus_tag LOCUS_32880 67814 68044 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221492514.1 protein_id gnl|my_center|LOCUS_32880 68599 68096 gene locus_tag LOCUS_32890 68599 68096 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224554.1 protein_id gnl|my_center|LOCUS_32890 69154 68816 gene locus_tag LOCUS_32900 69154 68816 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224553.1 protein_id gnl|my_center|LOCUS_32900 69514 69167 gene locus_tag LOCUS_32910 69514 69167 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928433.1 protein_id gnl|my_center|LOCUS_32910 70204 69584 gene locus_tag LOCUS_32920 70204 69584 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_32920 70590 72518 gene locus_tag LOCUS_32930 70590 72518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 72741 73619 gene locus_tag LOCUS_32940 72741 73619 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_32940 73632 74534 gene locus_tag LOCUS_32950 73632 74534 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 protein_id gnl|my_center|LOCUS_32950 75571 74591 gene locus_tag LOCUS_32960 75571 74591 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286316.1 protein_id gnl|my_center|LOCUS_32960 76288 75578 gene locus_tag LOCUS_32970 76288 75578 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229801.1 protein_id gnl|my_center|LOCUS_32970 76972 76328 gene locus_tag LOCUS_32980 76972 76328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973817.1 protein_id gnl|my_center|LOCUS_32980 77076 77450 gene locus_tag LOCUS_32990 77076 77450 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223006.1 protein_id gnl|my_center|LOCUS_32990 80898 77431 gene locus_tag LOCUS_33000 80898 77431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 82026 81046 gene locus_tag LOCUS_33010 82026 81046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 82160 82849 gene locus_tag LOCUS_33020 82160 82849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226052.1 protein_id gnl|my_center|LOCUS_33020 82938 83489 gene locus_tag LOCUS_33030 82938 83489 CDS product DUF6529 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226053.1 protein_id gnl|my_center|LOCUS_33030 84441 83500 gene locus_tag LOCUS_33040 84441 83500 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_33040 84715 85281 gene locus_tag LOCUS_33050 84715 85281 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229469.1 protein_id gnl|my_center|LOCUS_33050 85291 85641 gene locus_tag LOCUS_33060 85291 85641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 86611 85673 gene locus_tag LOCUS_33070 86611 85673 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027748.1 protein_id gnl|my_center|LOCUS_33070 86713 87906 gene locus_tag LOCUS_33080 86713 87906 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_33080 87912 88373 gene locus_tag LOCUS_33090 87912 88373 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 protein_id gnl|my_center|LOCUS_33090 89149 88343 gene locus_tag LOCUS_33100 89149 88343 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461579.1 protein_id gnl|my_center|LOCUS_33100 89054 89257 gene locus_tag LOCUS_33110 89054 89257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 89267 90406 gene locus_tag LOCUS_33120 89267 90406 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_33120 90763 90416 gene locus_tag LOCUS_33130 90763 90416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 92152 90833 gene locus_tag LOCUS_33140 92152 90833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 92772 92212 gene locus_tag LOCUS_33150 92772 92212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 93371 92769 gene locus_tag LOCUS_33160 gene sigE 93371 92769 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_33160 93564 94196 gene locus_tag LOCUS_33170 93564 94196 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222974.1 protein_id gnl|my_center|LOCUS_33170 95608 94193 gene locus_tag LOCUS_33180 95608 94193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 95855 95688 gene locus_tag LOCUS_33190 95855 95688 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 protein_id gnl|my_center|LOCUS_33190 96036 96809 gene locus_tag LOCUS_33200 96036 96809 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230091.1 protein_id gnl|my_center|LOCUS_33200 96811 97590 gene locus_tag LOCUS_33210 96811 97590 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_33210 98131 97556 gene locus_tag LOCUS_33220 gene tag 98131 97556 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896489.1 protein_id gnl|my_center|LOCUS_33220 98616 98125 gene locus_tag LOCUS_33230 98616 98125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 98661 98933 gene locus_tag LOCUS_33240 98661 98933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 99513 98935 gene locus_tag LOCUS_33250 99513 98935 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730304.1 protein_id gnl|my_center|LOCUS_33250 100225 99518 gene locus_tag LOCUS_33260 100225 99518 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_33260 100401 100823 gene locus_tag LOCUS_33270 100401 100823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 100820 102979 gene locus_tag LOCUS_33280 100820 102979 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028686.1 protein_id gnl|my_center|LOCUS_33280 104050 102989 gene locus_tag LOCUS_33290 gene dapE 104050 102989 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_33290 104865 104062 gene locus_tag LOCUS_33300 104865 104062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 105531 104887 gene locus_tag LOCUS_33310 105531 104887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 106622 105543 gene locus_tag LOCUS_33320 gene dapC 106622 105543 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222936.1 protein_id gnl|my_center|LOCUS_33320 106981 106655 gene locus_tag LOCUS_33330 106981 106655 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_33330 106968 107324 gene locus_tag LOCUS_33340 106968 107324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 107442 108434 gene locus_tag LOCUS_33350 107442 108434 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_33350 108510 109286 gene locus_tag LOCUS_33360 108510 109286 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_33360 109353 110990 gene locus_tag LOCUS_33370 109353 110990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 110995 113055 gene locus_tag LOCUS_33380 110995 113055 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_33380 113105 114946 gene locus_tag LOCUS_33390 113105 114946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 114957 116171 gene locus_tag LOCUS_33400 114957 116171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 116635 116153 gene locus_tag LOCUS_33410 gene rraA 116635 116153 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731282.1 protein_id gnl|my_center|LOCUS_33410 117041 116616 gene locus_tag LOCUS_33420 117041 116616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 117481 117113 gene locus_tag LOCUS_33430 117481 117113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 118406 117501 gene locus_tag LOCUS_33440 gene mshB 118406 117501 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_33440 118464 120536 gene locus_tag LOCUS_33450 118464 120536 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_33450 122358 120610 gene locus_tag LOCUS_33460 122358 120610 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027610.1 protein_id gnl|my_center|LOCUS_33460 124052 122361 gene locus_tag LOCUS_33470 124052 122361 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 protein_id gnl|my_center|LOCUS_33470 124161 124394 gene locus_tag LOCUS_33480 124161 124394 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 protein_id gnl|my_center|LOCUS_33480 124398 124970 gene locus_tag LOCUS_33490 124398 124970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 125820 125062 gene locus_tag LOCUS_33500 125820 125062 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225083.1 protein_id gnl|my_center|LOCUS_33500 127765 125834 gene locus_tag LOCUS_33510 127765 125834 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225082.1 protein_id gnl|my_center|LOCUS_33510 128391 127762 gene locus_tag LOCUS_33520 128391 127762 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 protein_id gnl|my_center|LOCUS_33520 128658 129602 gene locus_tag LOCUS_33530 128658 129602 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 protein_id gnl|my_center|LOCUS_33530 129652 130827 gene locus_tag LOCUS_33540 129652 130827 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487464.1 protein_id gnl|my_center|LOCUS_33540 130824 132398 gene locus_tag LOCUS_33550 130824 132398 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229350.1 protein_id gnl|my_center|LOCUS_33550 132391 132828 gene locus_tag LOCUS_33560 132391 132828 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_33560 132931 133731 gene locus_tag LOCUS_33570 132931 133731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_33570 133743 135629 gene locus_tag LOCUS_33580 133743 135629 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_33580 135629 136384 gene locus_tag LOCUS_33590 135629 136384 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_33590 137468 136452 gene locus_tag LOCUS_33600 137468 136452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 137970 137575 gene locus_tag LOCUS_33610 137970 137575 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896546.1 protein_id gnl|my_center|LOCUS_33610 139119 137977 gene locus_tag LOCUS_33620 139119 137977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 139763 139116 gene locus_tag LOCUS_33630 139763 139116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 142101 139774 gene locus_tag LOCUS_33640 142101 139774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 144578 142098 gene locus_tag LOCUS_33650 144578 142098 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860761.1 protein_id gnl|my_center|LOCUS_33650 147586 144698 gene locus_tag LOCUS_33660 147586 144698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 147895 147608 gene locus_tag LOCUS_33670 147895 147608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 148965 147946 gene locus_tag LOCUS_33680 148965 147946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 149367 150116 gene locus_tag LOCUS_33690 149367 150116 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028485.1 protein_id gnl|my_center|LOCUS_33690 150283 151512 gene locus_tag LOCUS_33700 150283 151512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 151943 151737 gene locus_tag LOCUS_33710 151943 151737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 152196 152390 gene locus_tag LOCUS_33720 152196 152390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 153723 152635 gene locus_tag LOCUS_33730 gene ychF 153723 152635 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_33730 153855 155159 gene locus_tag LOCUS_33740 153855 155159 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_33740 155169 155666 gene locus_tag LOCUS_33750 155169 155666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 156698 155733 gene locus_tag LOCUS_33760 156698 155733 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 protein_id gnl|my_center|LOCUS_33760 156787 157659 gene locus_tag LOCUS_33770 156787 157659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 157668 158870 gene locus_tag LOCUS_33780 gene xseA 157668 158870 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 protein_id gnl|my_center|LOCUS_33780 160719 158875 gene locus_tag LOCUS_33790 gene asnB 160719 158875 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223784.1 protein_id gnl|my_center|LOCUS_33790 160824 161084 gene locus_tag LOCUS_33800 160824 161084 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030026.1 protein_id gnl|my_center|LOCUS_33800 161714 161175 gene locus_tag LOCUS_33810 161714 161175 CDS product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973929.1 protein_id gnl|my_center|LOCUS_33810 162316 161726 gene locus_tag LOCUS_33820 162316 161726 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255052.1 protein_id gnl|my_center|LOCUS_33820 162456 163484 gene locus_tag LOCUS_33830 gene glpX 162456 163484 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_33830 164270 163554 gene locus_tag LOCUS_33840 164270 163554 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030020.1 protein_id gnl|my_center|LOCUS_33840 164304 165503 gene locus_tag LOCUS_33850 164304 165503 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028914.1 protein_id gnl|my_center|LOCUS_33850 166962 165595 gene locus_tag LOCUS_33860 166962 165595 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283916.1 protein_id gnl|my_center|LOCUS_33860 167030 167995 gene locus_tag LOCUS_33870 167030 167995 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877118.1 protein_id gnl|my_center|LOCUS_33870 168184 169836 gene locus_tag LOCUS_33880 168184 169836 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_33880 169935 171113 gene locus_tag LOCUS_33890 169935 171113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 171156 172745 gene locus_tag LOCUS_33900 171156 172745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 172759 174150 gene locus_tag LOCUS_33910 172759 174150 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_33910 174218 174979 gene locus_tag LOCUS_33920 174218 174979 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227748.1 protein_id gnl|my_center|LOCUS_33920 174981 176834 gene locus_tag LOCUS_33930 174981 176834 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027517.1 protein_id gnl|my_center|LOCUS_33930 176913 178259 gene locus_tag LOCUS_33940 176913 178259 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484585.1 protein_id gnl|my_center|LOCUS_33940 178259 179596 gene locus_tag LOCUS_33950 178259 179596 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227742.1 protein_id gnl|my_center|LOCUS_33950 179593 180612 gene locus_tag LOCUS_33960 179593 180612 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_33960 182519 180594 gene locus_tag LOCUS_33970 182519 180594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 182718 183353 gene locus_tag LOCUS_33980 182718 183353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 183976 183350 gene locus_tag LOCUS_33990 183976 183350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 184325 184999 gene locus_tag LOCUS_34000 gene afsQ1 184325 184999 CDS product two-component system response regulator AfsQ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974066.1 protein_id gnl|my_center|LOCUS_34000 184996 186426 gene locus_tag LOCUS_34010 184996 186426 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224878.1 protein_id gnl|my_center|LOCUS_34010 186423 186971 gene locus_tag LOCUS_34020 186423 186971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 188291 186981 gene locus_tag LOCUS_34030 188291 186981 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_34030 189316 188555 gene locus_tag LOCUS_34040 189316 188555 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_34040 189742 189371 gene locus_tag LOCUS_34050 189742 189371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34050 190595 189753 gene locus_tag LOCUS_34060 190595 189753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34060 191562 190570 gene locus_tag LOCUS_34070 191562 190570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 192679 191726 gene locus_tag LOCUS_34080 192679 191726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 194602 192806 gene locus_tag LOCUS_34090 194602 192806 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_34090 195403 194885 gene locus_tag LOCUS_34100 195403 194885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229818.1 protein_id gnl|my_center|LOCUS_34100 195480 196979 gene locus_tag LOCUS_34110 195480 196979 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091320726.1 protein_id gnl|my_center|LOCUS_34110 197005 197589 gene locus_tag LOCUS_34120 197005 197589 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487124.1 protein_id gnl|my_center|LOCUS_34120 198895 197594 gene locus_tag LOCUS_34130 198895 197594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 199489 198989 gene locus_tag LOCUS_34140 gene greA 199489 198989 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_34140 200002 199565 gene locus_tag LOCUS_34150 200002 199565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 200152 201033 gene locus_tag LOCUS_34160 gene mca 200152 201033 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444314.1 protein_id gnl|my_center|LOCUS_34160 201043 201216 gene locus_tag LOCUS_34170 201043 201216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 201213 201530 gene locus_tag LOCUS_34180 201213 201530 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087485.1 protein_id gnl|my_center|LOCUS_34180 202733 201591 gene locus_tag LOCUS_34190 202733 201591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 202978 205032 gene locus_tag LOCUS_34200 202978 205032 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_34200 207178 205040 gene locus_tag LOCUS_34210 207178 205040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 207867 207400 gene locus_tag LOCUS_34220 207867 207400 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028667.1 protein_id gnl|my_center|LOCUS_34220 207964 209067 gene locus_tag LOCUS_34230 gene hppD 207964 209067 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975883.1 protein_id gnl|my_center|LOCUS_34230 209155 210621 gene locus_tag LOCUS_34240 209155 210621 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_34240 211849 210626 gene locus_tag LOCUS_34250 gene ilvA 211849 210626 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_34250 212515 211868 gene locus_tag LOCUS_34260 212515 211868 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090854.1 protein_id gnl|my_center|LOCUS_34260 213520 212555 gene locus_tag LOCUS_34270 213520 212555 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_34270 214710 213523 gene locus_tag LOCUS_34280 214710 213523 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_34280 214867 216276 gene locus_tag LOCUS_34290 214867 216276 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 protein_id gnl|my_center|LOCUS_34290 216328 218277 gene locus_tag LOCUS_34300 216328 218277 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_34300 218887 218483 gene locus_tag LOCUS_34310 218887 218483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 219632 219000 gene locus_tag LOCUS_34320 219632 219000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 220365 219604 gene locus_tag LOCUS_34330 220365 219604 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973878.1 protein_id gnl|my_center|LOCUS_34330 220534 220788 gene locus_tag LOCUS_34340 220534 220788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 220899 221330 gene locus_tag LOCUS_34350 220899 221330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 221346 222575 gene locus_tag LOCUS_34360 221346 222575 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228549.1 protein_id gnl|my_center|LOCUS_34360 223739 222600 gene locus_tag LOCUS_34370 223739 222600 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_34370 225135 223765 gene locus_tag LOCUS_34380 225135 223765 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_34380 225240 226235 gene locus_tag LOCUS_34390 225240 226235 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975733.1 protein_id gnl|my_center|LOCUS_34390 226283 227653 gene locus_tag LOCUS_34400 226283 227653 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084957161.1 protein_id gnl|my_center|LOCUS_34400 227804 229024 gene locus_tag LOCUS_34410 227804 229024 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_34410 229478 229095 gene locus_tag LOCUS_34420 229478 229095 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_34420 229796 229566 gene locus_tag LOCUS_34430 229796 229566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 230758 229973 gene locus_tag LOCUS_34440 230758 229973 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975728.1 protein_id gnl|my_center|LOCUS_34440 231225 232880 gene locus_tag LOCUS_34450 231225 232880 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_34450 234468 233674 gene locus_tag LOCUS_34460 234468 233674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 234531 235397 gene locus_tag LOCUS_34470 234531 235397 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228034.1 protein_id gnl|my_center|LOCUS_34470 235560 235487 gene locus_tag LOCUS_t00270 235560 235487 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 236140 235607 gene locus_tag LOCUS_34480 gene def 236140 235607 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_34480 236715 236140 gene locus_tag LOCUS_34490 236715 236140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 238170 236842 gene locus_tag LOCUS_34500 238170 236842 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 protein_id gnl|my_center|LOCUS_34500 239201 238362 gene locus_tag LOCUS_34510 239201 238362 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406360.1 protein_id gnl|my_center|LOCUS_34510 239297 240520 gene locus_tag LOCUS_34520 239297 240520 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845481.1 protein_id gnl|my_center|LOCUS_34520 241564 240494 gene locus_tag LOCUS_34530 241564 240494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 241896 241561 gene locus_tag LOCUS_34540 241896 241561 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223697.1 protein_id gnl|my_center|LOCUS_34540 242882 241956 gene locus_tag LOCUS_34550 242882 241956 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_34550 243391 242879 gene locus_tag LOCUS_34560 243391 242879 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_34560 243825 243409 gene locus_tag LOCUS_34570 gene divIC 243825 243409 CDS product cell division protein DivIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975716.1 protein_id gnl|my_center|LOCUS_34570 245166 243886 gene locus_tag LOCUS_34580 gene eno 245166 243886 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_34580 246228 245272 gene locus_tag LOCUS_34590 246228 245272 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975711.1 protein_id gnl|my_center|LOCUS_34590 246475 246652 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgaacctgtgcatgatcac 247299 246664 gene locus_tag LOCUS_34600 247299 246664 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975710.1 protein_id gnl|my_center|LOCUS_34600 250892 247395 gene locus_tag LOCUS_34610 gene mfd 250892 247395 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_34610 251064 251795 gene locus_tag LOCUS_34620 251064 251795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 >Feature sequence14 589 1962 gene locus_tag LOCUS_34630 589 1962 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486252.1 protein_id gnl|my_center|LOCUS_34630 1937 2863 gene locus_tag LOCUS_34640 1937 2863 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030240.1 protein_id gnl|my_center|LOCUS_34640 2860 3678 gene locus_tag LOCUS_34650 2860 3678 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805140.1 protein_id gnl|my_center|LOCUS_34650 3678 4748 gene locus_tag LOCUS_34660 3678 4748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727033.1 protein_id gnl|my_center|LOCUS_34660 4745 5938 gene locus_tag LOCUS_34670 4745 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 6009 8690 gene locus_tag LOCUS_34680 6009 8690 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102268.1 protein_id gnl|my_center|LOCUS_34680 8866 9042 gene locus_tag LOCUS_34690 8866 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 9059 9544 gene locus_tag LOCUS_34700 9059 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 9534 10271 gene locus_tag LOCUS_34710 9534 10271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 10461 11306 gene locus_tag LOCUS_34720 10461 11306 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225260.1 protein_id gnl|my_center|LOCUS_34720 11803 11423 gene locus_tag LOCUS_34730 11803 11423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 11802 13184 gene locus_tag LOCUS_34740 11802 13184 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_34740 13245 14546 gene locus_tag LOCUS_34750 13245 14546 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270060.1 protein_id gnl|my_center|LOCUS_34750 14579 16084 gene locus_tag LOCUS_34760 14579 16084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 16983 16198 gene locus_tag LOCUS_34770 16983 16198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 17090 17950 gene locus_tag LOCUS_34780 17090 17950 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226695.1 protein_id gnl|my_center|LOCUS_34780 17978 18505 gene locus_tag LOCUS_34790 17978 18505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 19039 18563 gene locus_tag LOCUS_34800 gene pcaC 19039 18563 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462297.1 protein_id gnl|my_center|LOCUS_34800 19779 19024 gene locus_tag LOCUS_34810 19779 19024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 20325 19834 gene locus_tag LOCUS_34820 gene pcaG 20325 19834 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031115.1 protein_id gnl|my_center|LOCUS_34820 20990 20322 gene locus_tag LOCUS_34830 gene pcaH 20990 20322 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728462.1 protein_id gnl|my_center|LOCUS_34830 22165 20987 gene locus_tag LOCUS_34840 22165 20987 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441295.1 protein_id gnl|my_center|LOCUS_34840 22253 23044 gene locus_tag LOCUS_34850 22253 23044 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731472.1 protein_id gnl|my_center|LOCUS_34850 23935 23243 gene locus_tag LOCUS_34860 23935 23243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 24562 24945 gene locus_tag LOCUS_34870 24562 24945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046584027.1 protein_id gnl|my_center|LOCUS_34870 25215 26081 gene locus_tag LOCUS_34880 25215 26081 CDS product DUF3626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226733.1 protein_id gnl|my_center|LOCUS_34880 26211 26522 gene locus_tag LOCUS_34890 26211 26522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 26853 26647 gene locus_tag LOCUS_34900 26853 26647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029508.1 protein_id gnl|my_center|LOCUS_34900 27326 27931 gene locus_tag LOCUS_34910 27326 27931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 27944 28339 gene locus_tag LOCUS_34920 27944 28339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 28351 28662 gene locus_tag LOCUS_34930 28351 28662 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217738.1 protein_id gnl|my_center|LOCUS_34930 28936 29292 gene locus_tag LOCUS_34940 28936 29292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 29545 29934 gene locus_tag LOCUS_34950 29545 29934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 29989 30351 gene locus_tag LOCUS_34960 29989 30351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 30661 31398 gene locus_tag LOCUS_34970 30661 31398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 31635 31976 gene locus_tag LOCUS_34980 31635 31976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 32507 32211 gene locus_tag LOCUS_34990 32507 32211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 32842 32615 gene locus_tag LOCUS_35000 32842 32615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 34674 32800 gene locus_tag LOCUS_35010 34674 32800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 35301 34756 gene locus_tag LOCUS_35020 35301 34756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 35925 35311 gene locus_tag LOCUS_35030 35925 35311 CDS product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_35030 36062 37471 gene locus_tag LOCUS_35040 36062 37471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 38040 37468 gene locus_tag LOCUS_35050 gene xdhR 38040 37468 CDS product purine salvage operon transcriptional regulator XdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977696.1 protein_id gnl|my_center|LOCUS_35050 38182 38595 gene locus_tag LOCUS_35060 38182 38595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 38571 38759 gene locus_tag LOCUS_35070 38571 38759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 38842 39858 gene locus_tag LOCUS_35080 38842 39858 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224028.1 protein_id gnl|my_center|LOCUS_35080 40138 42534 gene locus_tag LOCUS_35090 40138 42534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 42712 43467 gene locus_tag LOCUS_35100 42712 43467 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_35100 43452 45290 gene locus_tag LOCUS_35110 43452 45290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 46239 45298 gene locus_tag LOCUS_35120 46239 45298 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225425.1 protein_id gnl|my_center|LOCUS_35120 46336 47337 gene locus_tag LOCUS_35130 46336 47337 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397659.1 protein_id gnl|my_center|LOCUS_35130 48390 47404 gene locus_tag LOCUS_35140 48390 47404 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079769.1 protein_id gnl|my_center|LOCUS_35140 48622 50373 gene locus_tag LOCUS_35150 48622 50373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027306.1 protein_id gnl|my_center|LOCUS_35150 50894 50340 gene locus_tag LOCUS_35160 50894 50340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886848.1 protein_id gnl|my_center|LOCUS_35160 51068 52591 gene locus_tag LOCUS_35170 51068 52591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 54325 52802 gene locus_tag LOCUS_35180 54325 52802 CDS product S8/S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972149.1 protein_id gnl|my_center|LOCUS_35180 54453 57065 gene locus_tag LOCUS_35190 54453 57065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35190 57515 57096 gene locus_tag LOCUS_35200 gene hrp1 57515 57096 CDS product hypoxic response protein Hrp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413598.1 protein_id gnl|my_center|LOCUS_35200 58777 57671 gene locus_tag LOCUS_35210 58777 57671 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_35210 59243 59980 gene locus_tag LOCUS_35220 59243 59980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 59977 60174 gene locus_tag LOCUS_35230 59977 60174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 60165 61412 gene locus_tag LOCUS_35240 60165 61412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 61428 62147 gene locus_tag LOCUS_35250 61428 62147 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226429.1 protein_id gnl|my_center|LOCUS_35250 62823 62194 gene locus_tag LOCUS_35260 62823 62194 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 protein_id gnl|my_center|LOCUS_35260 63948 62842 gene locus_tag LOCUS_35270 63948 62842 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 protein_id gnl|my_center|LOCUS_35270 64116 64760 gene locus_tag LOCUS_35280 64116 64760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 64941 65711 gene locus_tag LOCUS_35290 64941 65711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080524.1 protein_id gnl|my_center|LOCUS_35290 66510 65701 gene locus_tag LOCUS_35300 66510 65701 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742172.1 protein_id gnl|my_center|LOCUS_35300 67391 66507 gene locus_tag LOCUS_35310 67391 66507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 68596 67388 gene locus_tag LOCUS_35320 68596 67388 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337305.1 protein_id gnl|my_center|LOCUS_35320 68730 69953 gene locus_tag LOCUS_35330 68730 69953 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404744.1 protein_id gnl|my_center|LOCUS_35330 69969 71483 gene locus_tag LOCUS_35340 69969 71483 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404742.1 protein_id gnl|my_center|LOCUS_35340 71504 72520 gene locus_tag LOCUS_35350 71504 72520 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897017.1 protein_id gnl|my_center|LOCUS_35350 74554 72623 gene locus_tag LOCUS_35360 74554 72623 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189868312.1 protein_id gnl|my_center|LOCUS_35360 76345 74744 gene locus_tag LOCUS_35370 76345 74744 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_35370 77478 76342 gene locus_tag LOCUS_35380 77478 76342 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727034.1 protein_id gnl|my_center|LOCUS_35380 78224 77475 gene locus_tag LOCUS_35390 78224 77475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 78961 78221 gene locus_tag LOCUS_35400 78961 78221 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640464.1 protein_id gnl|my_center|LOCUS_35400 79491 78961 gene locus_tag LOCUS_35410 79491 78961 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919683.1 protein_id gnl|my_center|LOCUS_35410 79796 81472 gene locus_tag LOCUS_35420 79796 81472 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228720.1 protein_id gnl|my_center|LOCUS_35420 81502 81897 gene locus_tag LOCUS_35430 81502 81897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 82004 82570 gene locus_tag LOCUS_35440 82004 82570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 82825 83598 gene locus_tag LOCUS_35450 82825 83598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225294.1 protein_id gnl|my_center|LOCUS_35450 83595 85697 gene locus_tag LOCUS_35460 83595 85697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 85705 86493 gene locus_tag LOCUS_35470 85705 86493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 86636 86803 gene locus_tag LOCUS_35480 86636 86803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 86787 87557 gene locus_tag LOCUS_35490 86787 87557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 88038 87571 gene locus_tag LOCUS_35500 88038 87571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031366.1 protein_id gnl|my_center|LOCUS_35500 88627 88067 gene locus_tag LOCUS_35510 88627 88067 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854968.1 protein_id gnl|my_center|LOCUS_35510 89001 88663 gene locus_tag LOCUS_35520 89001 88663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 88888 89502 gene locus_tag LOCUS_35530 88888 89502 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_35530 89495 90547 gene locus_tag LOCUS_35540 89495 90547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 92518 90563 gene locus_tag LOCUS_35550 92518 90563 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031364.1 protein_id gnl|my_center|LOCUS_35550 92718 95384 gene locus_tag LOCUS_35560 92718 95384 CDS product exo 1,3/1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229330.1 protein_id gnl|my_center|LOCUS_35560 96438 95464 gene locus_tag LOCUS_35570 96438 95464 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486386.1 protein_id gnl|my_center|LOCUS_35570 96533 97180 gene locus_tag LOCUS_35580 96533 97180 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230929.1 protein_id gnl|my_center|LOCUS_35580 97227 98120 gene locus_tag LOCUS_35590 97227 98120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 98670 98149 gene locus_tag LOCUS_35600 98670 98149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029910.1 protein_id gnl|my_center|LOCUS_35600 99177 98740 gene locus_tag LOCUS_35610 99177 98740 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528917.1 protein_id gnl|my_center|LOCUS_35610 99276 100211 gene locus_tag LOCUS_35620 99276 100211 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222418.1 protein_id gnl|my_center|LOCUS_35620 101128 100175 gene locus_tag LOCUS_35630 101128 100175 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230703.1 protein_id gnl|my_center|LOCUS_35630 102150 101125 gene locus_tag LOCUS_35640 102150 101125 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230702.1 protein_id gnl|my_center|LOCUS_35640 102854 102153 gene locus_tag LOCUS_35650 102854 102153 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530802.1 protein_id gnl|my_center|LOCUS_35650 103432 102869 gene locus_tag LOCUS_35660 103432 102869 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230705.1 protein_id gnl|my_center|LOCUS_35660 104928 103429 gene locus_tag LOCUS_35670 104928 103429 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230704.1 protein_id gnl|my_center|LOCUS_35670 105189 106913 gene locus_tag LOCUS_35680 gene malS 105189 106913 CDS product oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195357.1 protein_id gnl|my_center|LOCUS_35680 106916 108391 gene locus_tag LOCUS_35690 gene fumC 106916 108391 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990844.1 protein_id gnl|my_center|LOCUS_35690 108566 110242 gene locus_tag LOCUS_35700 108566 110242 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_35700 111114 110647 gene locus_tag LOCUS_35710 111114 110647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 111463 112869 gene locus_tag LOCUS_35720 111463 112869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_35720 115567 112904 gene locus_tag LOCUS_35730 115567 112904 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486544.1 protein_id gnl|my_center|LOCUS_35730 115993 115766 gene locus_tag LOCUS_35740 115993 115766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 116228 115980 gene locus_tag LOCUS_35750 116228 115980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 116370 116915 gene locus_tag LOCUS_35760 116370 116915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 116912 117910 gene locus_tag LOCUS_35770 116912 117910 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027599.1 protein_id gnl|my_center|LOCUS_35770 117907 120006 gene locus_tag LOCUS_35780 117907 120006 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727118.1 protein_id gnl|my_center|LOCUS_35780 120084 120308 gene locus_tag LOCUS_35790 120084 120308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 120432 121466 gene locus_tag LOCUS_35800 120432 121466 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230309.1 protein_id gnl|my_center|LOCUS_35800 121463 122953 gene locus_tag LOCUS_35810 121463 122953 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030606.1 protein_id gnl|my_center|LOCUS_35810 123023 123958 gene locus_tag LOCUS_35820 123023 123958 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_35820 124046 125848 gene locus_tag LOCUS_35830 124046 125848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 125845 126879 gene locus_tag LOCUS_35840 125845 126879 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225593.1 protein_id gnl|my_center|LOCUS_35840 126876 127787 gene locus_tag LOCUS_35850 126876 127787 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980619.1 protein_id gnl|my_center|LOCUS_35850 127793 128803 gene locus_tag LOCUS_35860 127793 128803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065036.1 protein_id gnl|my_center|LOCUS_35860 128800 129822 gene locus_tag LOCUS_35870 128800 129822 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922572.1 protein_id gnl|my_center|LOCUS_35870 129819 130685 gene locus_tag LOCUS_35880 129819 130685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 131800 130688 gene locus_tag LOCUS_35890 131800 130688 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230529.1 protein_id gnl|my_center|LOCUS_35890 131833 132780 gene locus_tag LOCUS_35900 gene murQ 131833 132780 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029570.1 protein_id gnl|my_center|LOCUS_35900 132787 133851 gene locus_tag LOCUS_35910 132787 133851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 134453 133875 gene locus_tag LOCUS_35920 134453 133875 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978343.1 protein_id gnl|my_center|LOCUS_35920 134630 135574 gene locus_tag LOCUS_35930 134630 135574 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971447.1 protein_id gnl|my_center|LOCUS_35930 136831 135719 gene locus_tag LOCUS_35940 136831 135719 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027605.1 protein_id gnl|my_center|LOCUS_35940 137074 137376 gene locus_tag LOCUS_35950 137074 137376 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409536.1 protein_id gnl|my_center|LOCUS_35950 137373 137723 gene locus_tag LOCUS_35960 137373 137723 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226217.1 protein_id gnl|my_center|LOCUS_35960 138417 137755 gene locus_tag LOCUS_35970 138417 137755 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031135.1 protein_id gnl|my_center|LOCUS_35970 138625 140583 gene locus_tag LOCUS_35980 138625 140583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 141347 140676 gene locus_tag LOCUS_35990 141347 140676 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 protein_id gnl|my_center|LOCUS_35990 142174 141344 gene locus_tag LOCUS_36000 142174 141344 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_36000 142504 142211 gene locus_tag LOCUS_36010 142504 142211 CDS product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080013.1 protein_id gnl|my_center|LOCUS_36010 143961 142660 gene locus_tag LOCUS_36020 143961 142660 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084375.1 protein_id gnl|my_center|LOCUS_36020 144077 144982 gene locus_tag LOCUS_36030 144077 144982 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225528.1 protein_id gnl|my_center|LOCUS_36030 148181 144990 gene locus_tag LOCUS_36040 148181 144990 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224450.1 protein_id gnl|my_center|LOCUS_36040 149050 148367 gene locus_tag LOCUS_36050 149050 148367 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976651.1 protein_id gnl|my_center|LOCUS_36050 150252 149047 gene locus_tag LOCUS_36060 150252 149047 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976650.1 protein_id gnl|my_center|LOCUS_36060 151284 150310 gene locus_tag LOCUS_36070 151284 150310 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329145.1 protein_id gnl|my_center|LOCUS_36070 152599 151481 gene locus_tag LOCUS_36080 152599 151481 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284240.1 protein_id gnl|my_center|LOCUS_36080 152756 153214 gene locus_tag LOCUS_36090 152756 153214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 153371 154987 gene locus_tag LOCUS_36100 153371 154987 CDS product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895690.1 protein_id gnl|my_center|LOCUS_36100 155661 155134 gene locus_tag LOCUS_36110 155661 155134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 155842 156036 gene locus_tag LOCUS_36120 155842 156036 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_36120 156307 156182 gene locus_tag LOCUS_36130 156307 156182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 161154 156412 gene locus_tag LOCUS_36140 161154 156412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 161256 162644 gene locus_tag LOCUS_36150 161256 162644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 162684 162881 gene locus_tag LOCUS_36160 162684 162881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 163146 163748 gene locus_tag LOCUS_36170 163146 163748 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111108.1 protein_id gnl|my_center|LOCUS_36170 164778 163762 gene locus_tag LOCUS_36180 164778 163762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 165712 164798 gene locus_tag LOCUS_36190 165712 164798 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973039.1 protein_id gnl|my_center|LOCUS_36190 166503 165712 gene locus_tag LOCUS_36200 166503 165712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 167396 166500 gene locus_tag LOCUS_36210 167396 166500 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312137.1 protein_id gnl|my_center|LOCUS_36210 168526 167393 gene locus_tag LOCUS_36220 168526 167393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096543.1 protein_id gnl|my_center|LOCUS_36220 170096 168501 gene locus_tag LOCUS_36230 170096 168501 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537585.1 protein_id gnl|my_center|LOCUS_36230 170218 170853 gene locus_tag LOCUS_36240 170218 170853 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029198.1 protein_id gnl|my_center|LOCUS_36240 171208 170861 gene locus_tag LOCUS_36250 171208 170861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 172352 171324 gene locus_tag LOCUS_36260 gene glcK 172352 171324 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_36260 172584 173540 gene locus_tag LOCUS_36270 172584 173540 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970133.1 protein_id gnl|my_center|LOCUS_36270 174713 173607 gene locus_tag LOCUS_36280 174713 173607 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224399.1 protein_id gnl|my_center|LOCUS_36280 175793 174903 gene locus_tag LOCUS_36290 175793 174903 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028198.1 protein_id gnl|my_center|LOCUS_36290 178036 175985 gene locus_tag LOCUS_36300 178036 175985 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776624.1 protein_id gnl|my_center|LOCUS_36300 180707 178275 gene locus_tag LOCUS_36310 180707 178275 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223450.1 protein_id gnl|my_center|LOCUS_36310 180891 182807 gene locus_tag LOCUS_36320 180891 182807 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_36320 184859 182874 gene locus_tag LOCUS_36330 184859 182874 CDS product glycoside hydrolase family 18 chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030211.1 protein_id gnl|my_center|LOCUS_36330 185548 185159 gene locus_tag LOCUS_36340 185548 185159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 185820 186815 gene locus_tag LOCUS_36350 185820 186815 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_36350 186894 187220 gene locus_tag LOCUS_36360 186894 187220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 187431 187294 gene locus_tag LOCUS_36370 187431 187294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 187599 188090 gene locus_tag LOCUS_36380 187599 188090 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027329.1 protein_id gnl|my_center|LOCUS_36380 188204 188581 gene locus_tag LOCUS_36390 188204 188581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 188661 189086 gene locus_tag LOCUS_36400 188661 189086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 189267 191726 gene locus_tag LOCUS_36410 189267 191726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 191855 193318 gene locus_tag LOCUS_36420 191855 193318 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 protein_id gnl|my_center|LOCUS_36420 195026 193398 gene locus_tag LOCUS_36430 195026 193398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 196426 195116 gene locus_tag LOCUS_36440 196426 195116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36440 197363 196542 gene locus_tag LOCUS_36450 197363 196542 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 protein_id gnl|my_center|LOCUS_36450 198162 197407 gene locus_tag LOCUS_36460 198162 197407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_36460 199801 198215 gene locus_tag LOCUS_36470 199801 198215 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230949.1 protein_id gnl|my_center|LOCUS_36470 200001 199798 gene locus_tag LOCUS_36480 200001 199798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 202319 200673 gene locus_tag LOCUS_36490 202319 200673 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224032.1 protein_id gnl|my_center|LOCUS_36490 202594 204720 gene locus_tag LOCUS_36500 202594 204720 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529939.1 protein_id gnl|my_center|LOCUS_36500 204798 205967 gene locus_tag LOCUS_36510 204798 205967 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031339.1 protein_id gnl|my_center|LOCUS_36510 206089 206979 gene locus_tag LOCUS_36520 206089 206979 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229683.1 protein_id gnl|my_center|LOCUS_36520 206976 207764 gene locus_tag LOCUS_36530 206976 207764 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804277.1 protein_id gnl|my_center|LOCUS_36530 207893 208675 gene locus_tag LOCUS_36540 gene thyX 207893 208675 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390602.1 protein_id gnl|my_center|LOCUS_36540 208993 208685 gene locus_tag LOCUS_36550 208993 208685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 210098 208995 gene locus_tag LOCUS_36560 210098 208995 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484633.1 protein_id gnl|my_center|LOCUS_36560 211282 210167 gene locus_tag LOCUS_36570 211282 210167 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742063.1 protein_id gnl|my_center|LOCUS_36570 211595 212278 gene locus_tag LOCUS_36580 211595 212278 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727426.1 protein_id gnl|my_center|LOCUS_36580 212319 213101 gene locus_tag LOCUS_36590 212319 213101 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807577.1 protein_id gnl|my_center|LOCUS_36590 213547 213125 gene locus_tag LOCUS_36600 213547 213125 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930247.1 protein_id gnl|my_center|LOCUS_36600 214806 213625 gene locus_tag LOCUS_36610 214806 213625 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878160.1 protein_id gnl|my_center|LOCUS_36610 215473 214883 gene locus_tag LOCUS_36620 215473 214883 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 protein_id gnl|my_center|LOCUS_36620 215671 217332 gene locus_tag LOCUS_36630 215671 217332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 217302 218018 gene locus_tag LOCUS_36640 217302 218018 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_36640 218029 218595 gene locus_tag LOCUS_36650 218029 218595 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_36650 218598 221102 gene locus_tag LOCUS_36660 218598 221102 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_36660 221651 222154 gene locus_tag LOCUS_36670 221651 222154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 222174 222830 gene locus_tag LOCUS_36680 222174 222830 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_36680 222907 223377 gene locus_tag LOCUS_36690 222907 223377 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_36690 223521 224138 gene locus_tag LOCUS_36700 223521 224138 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079363.1 protein_id gnl|my_center|LOCUS_36700 224479 227304 gene locus_tag LOCUS_36710 gene gcvP 224479 227304 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_36710 227437 227982 gene locus_tag LOCUS_36720 227437 227982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 228334 227960 gene locus_tag LOCUS_36730 228334 227960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469765.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36730 228427 229023 gene locus_tag LOCUS_36740 228427 229023 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229714.1 protein_id gnl|my_center|LOCUS_36740 229210 229010 gene locus_tag LOCUS_36750 229210 229010 CDS product DUF5999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977451.1 protein_id gnl|my_center|LOCUS_36750 230165 229590 gene locus_tag LOCUS_36760 230165 229590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 230280 230681 gene locus_tag LOCUS_36770 230280 230681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 230770 231534 gene locus_tag LOCUS_36780 230770 231534 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325634.1 protein_id gnl|my_center|LOCUS_36780 232960 231626 gene locus_tag LOCUS_36790 232960 231626 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224472.1 protein_id gnl|my_center|LOCUS_36790 234152 233109 gene locus_tag LOCUS_36800 gene menE 234152 233109 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742122.1 protein_id gnl|my_center|LOCUS_36800 234081 234311 gene locus_tag LOCUS_36810 234081 234311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 234343 235173 gene locus_tag LOCUS_36820 gene menB 234343 235173 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963873.1 protein_id gnl|my_center|LOCUS_36820 235242 236906 gene locus_tag LOCUS_36830 gene menD 235242 236906 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466562.1 protein_id gnl|my_center|LOCUS_36830 237035 237682 gene locus_tag LOCUS_36840 237035 237682 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977513.1 protein_id gnl|my_center|LOCUS_36840 238432 237695 gene locus_tag LOCUS_36850 238432 237695 CDS product myo-inositol degradation transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030772.1 protein_id gnl|my_center|LOCUS_36850 238695 239177 gene locus_tag LOCUS_36860 238695 239177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 239204 239824 gene locus_tag LOCUS_36870 239204 239824 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027706.1 protein_id gnl|my_center|LOCUS_36870 241083 239860 gene locus_tag LOCUS_36880 241083 239860 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 protein_id gnl|my_center|LOCUS_36880 240973 241227 gene locus_tag LOCUS_36890 240973 241227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 241250 242074 gene locus_tag LOCUS_36900 241250 242074 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976414.1 protein_id gnl|my_center|LOCUS_36900 >Feature sequence15 645 475 gene locus_tag LOCUS_36910 645 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 887 666 gene locus_tag LOCUS_36920 887 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 1092 889 gene locus_tag LOCUS_36930 1092 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 2313 1441 gene locus_tag LOCUS_36940 2313 1441 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108987323.1 protein_id gnl|my_center|LOCUS_36940 2408 3823 gene locus_tag LOCUS_36950 2408 3823 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098426.1 protein_id gnl|my_center|LOCUS_36950 3826 4710 gene locus_tag LOCUS_36960 3826 4710 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_36960 6372 5758 gene locus_tag LOCUS_36970 6372 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 6652 7134 gene locus_tag LOCUS_36980 6652 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 7848 7051 gene locus_tag LOCUS_36990 7848 7051 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_36990 7962 8561 gene locus_tag LOCUS_37000 7962 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 9043 9345 gene locus_tag LOCUS_37010 9043 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 9888 9640 gene locus_tag LOCUS_37020 9888 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 10180 10542 gene locus_tag LOCUS_37030 10180 10542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 11213 10536 gene locus_tag LOCUS_37040 11213 10536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 12460 11462 gene locus_tag LOCUS_37050 12460 11462 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225780.1 protein_id gnl|my_center|LOCUS_37050 12572 13198 gene locus_tag LOCUS_37060 12572 13198 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814509.1 protein_id gnl|my_center|LOCUS_37060 16130 13800 gene locus_tag LOCUS_37070 16130 13800 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028573.1 protein_id gnl|my_center|LOCUS_37070 16029 16469 gene locus_tag LOCUS_37080 16029 16469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 16572 17084 gene locus_tag LOCUS_37090 16572 17084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 18316 17426 gene locus_tag LOCUS_37100 18316 17426 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229089.1 protein_id gnl|my_center|LOCUS_37100 18412 19194 gene locus_tag LOCUS_37110 18412 19194 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896869.1 protein_id gnl|my_center|LOCUS_37110 19467 20657 gene locus_tag LOCUS_37120 19467 20657 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742129.1 protein_id gnl|my_center|LOCUS_37120 20737 21117 gene locus_tag LOCUS_37130 20737 21117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 22492 21170 gene locus_tag LOCUS_37140 22492 21170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 22409 22618 gene locus_tag LOCUS_37150 22409 22618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 23140 22847 gene locus_tag LOCUS_37160 23140 22847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 23561 23307 gene locus_tag LOCUS_37170 23561 23307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 24182 23640 gene locus_tag LOCUS_37180 24182 23640 CDS product Imm1 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189879201.1 protein_id gnl|my_center|LOCUS_37180 24696 24385 gene locus_tag LOCUS_37190 24696 24385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 24637 24915 gene locus_tag LOCUS_37200 24637 24915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 25248 25175 gene locus_tag LOCUS_t00280 25248 25175 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 26220 25264 gene locus_tag LOCUS_37210 26220 25264 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029555.1 protein_id gnl|my_center|LOCUS_37210 26579 26250 gene locus_tag LOCUS_37220 26579 26250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 27157 26702 gene locus_tag LOCUS_37230 27157 26702 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_37230 27660 27232 gene locus_tag LOCUS_37240 27660 27232 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060606.1 protein_id gnl|my_center|LOCUS_37240 28206 27799 gene locus_tag LOCUS_37250 28206 27799 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_37250 28500 28216 gene locus_tag LOCUS_37260 28500 28216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 29001 31754 gene locus_tag LOCUS_37270 gene aceE 29001 31754 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976432.1 protein_id gnl|my_center|LOCUS_37270 32174 32016 gene locus_tag LOCUS_37280 32174 32016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 33003 32290 gene locus_tag LOCUS_37290 33003 32290 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640423.1 protein_id gnl|my_center|LOCUS_37290 35096 33066 gene locus_tag LOCUS_37300 35096 33066 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228450.1 protein_id gnl|my_center|LOCUS_37300 35641 35183 gene locus_tag LOCUS_37310 35641 35183 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640423.1 protein_id gnl|my_center|LOCUS_37310 36792 35764 gene locus_tag LOCUS_37320 36792 35764 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_37320 36935 37639 gene locus_tag LOCUS_37330 36935 37639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 37639 38802 gene locus_tag LOCUS_37340 37639 38802 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222139.1 protein_id gnl|my_center|LOCUS_37340 38799 39272 gene locus_tag LOCUS_37350 38799 39272 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082867.1 protein_id gnl|my_center|LOCUS_37350 39385 40590 gene locus_tag LOCUS_37360 gene fasR 39385 40590 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_37360 40708 41604 gene locus_tag LOCUS_37370 40708 41604 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_37370 41601 42557 gene locus_tag LOCUS_37380 41601 42557 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031009.1 protein_id gnl|my_center|LOCUS_37380 42620 42859 gene locus_tag LOCUS_37390 42620 42859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 42935 44164 gene locus_tag LOCUS_37400 42935 44164 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_37400 44210 45631 gene locus_tag LOCUS_37410 44210 45631 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060587.1 protein_id gnl|my_center|LOCUS_37410 46280 45783 gene locus_tag LOCUS_37420 46280 45783 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_37420 46485 47492 gene locus_tag LOCUS_37430 46485 47492 CDS product S8/S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223262.1 protein_id gnl|my_center|LOCUS_37430 47492 48058 gene locus_tag LOCUS_37440 47492 48058 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223264.1 protein_id gnl|my_center|LOCUS_37440 48055 48531 gene locus_tag LOCUS_37450 48055 48531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 48528 50978 gene locus_tag LOCUS_37460 48528 50978 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223261.1 protein_id gnl|my_center|LOCUS_37460 51810 50998 gene locus_tag LOCUS_37470 51810 50998 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224290.1 protein_id gnl|my_center|LOCUS_37470 53052 51886 gene locus_tag LOCUS_37480 53052 51886 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_37480 53673 53083 gene locus_tag LOCUS_37490 53673 53083 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_37490 56373 53731 gene locus_tag LOCUS_37500 56373 53731 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_37500 56672 57565 gene locus_tag LOCUS_37510 56672 57565 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466843.1 protein_id gnl|my_center|LOCUS_37510 59802 57694 gene locus_tag LOCUS_37520 59802 57694 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228470.1 protein_id gnl|my_center|LOCUS_37520 59913 60488 gene locus_tag LOCUS_37530 59913 60488 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_37530 60834 61193 gene locus_tag LOCUS_37540 60834 61193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 61249 62469 gene locus_tag LOCUS_37550 61249 62469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 63025 62480 gene locus_tag LOCUS_37560 63025 62480 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316410.1 protein_id gnl|my_center|LOCUS_37560 63100 63402 gene locus_tag LOCUS_37570 63100 63402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 63920 66517 gene locus_tag LOCUS_37580 63920 66517 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_37580 66960 66589 gene locus_tag LOCUS_37590 66960 66589 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729159.1 protein_id gnl|my_center|LOCUS_37590 68079 67045 gene locus_tag LOCUS_37600 68079 67045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 68237 68746 gene locus_tag LOCUS_37610 68237 68746 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214742.1 protein_id gnl|my_center|LOCUS_37610 68874 69872 gene locus_tag LOCUS_37620 68874 69872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 69906 70229 gene locus_tag LOCUS_37630 69906 70229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 70315 70767 gene locus_tag LOCUS_37640 gene soxR 70315 70767 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878334.1 protein_id gnl|my_center|LOCUS_37640 71846 70833 gene locus_tag LOCUS_37650 71846 70833 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_37650 71961 72533 gene locus_tag LOCUS_37660 71961 72533 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226517.1 protein_id gnl|my_center|LOCUS_37660 73639 72575 gene locus_tag LOCUS_37670 73639 72575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 75874 73802 gene locus_tag LOCUS_37680 75874 73802 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_37680 76120 76353 gene locus_tag LOCUS_37690 76120 76353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_37690 77143 76406 gene locus_tag LOCUS_37700 77143 76406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 77230 77976 gene locus_tag LOCUS_37710 gene yaaA 77230 77976 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_37710 79828 78152 gene locus_tag LOCUS_37720 79828 78152 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973202.1 protein_id gnl|my_center|LOCUS_37720 82187 80097 gene locus_tag LOCUS_37730 82187 80097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 82779 82366 gene locus_tag LOCUS_37740 82779 82366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 82705 82995 gene locus_tag LOCUS_37750 82705 82995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 83033 83278 gene locus_tag LOCUS_37760 83033 83278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 83428 84927 gene locus_tag LOCUS_37770 83428 84927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222128.1 protein_id gnl|my_center|LOCUS_37770 85128 85901 gene locus_tag LOCUS_37780 85128 85901 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731005.1 protein_id gnl|my_center|LOCUS_37780 85898 86521 gene locus_tag LOCUS_37790 85898 86521 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230112.1 protein_id gnl|my_center|LOCUS_37790 86518 87390 gene locus_tag LOCUS_37800 86518 87390 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046421936.1 protein_id gnl|my_center|LOCUS_37800 89077 87380 gene locus_tag LOCUS_37810 89077 87380 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051713212.1 protein_id gnl|my_center|LOCUS_37810 91547 89196 gene locus_tag LOCUS_37820 91547 89196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 93479 91605 gene locus_tag LOCUS_37830 93479 91605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 93666 95252 gene locus_tag LOCUS_37840 93666 95252 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027955.1 protein_id gnl|my_center|LOCUS_37840 95328 96146 gene locus_tag LOCUS_37850 95328 96146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 97156 96242 gene locus_tag LOCUS_37860 97156 96242 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226734.1 protein_id gnl|my_center|LOCUS_37860 97262 98251 gene locus_tag LOCUS_37870 97262 98251 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101381.1 protein_id gnl|my_center|LOCUS_37870 98298 99434 gene locus_tag LOCUS_37880 98298 99434 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229643.1 protein_id gnl|my_center|LOCUS_37880 100509 99454 gene locus_tag LOCUS_37890 100509 99454 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037062758.1 protein_id gnl|my_center|LOCUS_37890 100578 101231 gene locus_tag LOCUS_37900 100578 101231 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030760.1 protein_id gnl|my_center|LOCUS_37900 102560 101277 gene locus_tag LOCUS_37910 102560 101277 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_37910 103567 102557 gene locus_tag LOCUS_37920 103567 102557 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 protein_id gnl|my_center|LOCUS_37920 103812 103564 gene locus_tag LOCUS_37930 103812 103564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 105625 104222 gene locus_tag LOCUS_37940 gene sthA 105625 104222 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_37940 107000 105765 gene locus_tag LOCUS_37950 107000 105765 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972026.1 protein_id gnl|my_center|LOCUS_37950 107727 107005 gene locus_tag LOCUS_37960 107727 107005 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971473.1 protein_id gnl|my_center|LOCUS_37960 107841 108476 gene locus_tag LOCUS_37970 gene folE 107841 108476 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072479192.1 protein_id gnl|my_center|LOCUS_37970 108496 108891 gene locus_tag LOCUS_37980 108496 108891 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223911.1 protein_id gnl|my_center|LOCUS_37980 108961 109308 gene locus_tag LOCUS_37990 108961 109308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 109569 109315 gene locus_tag LOCUS_38000 109569 109315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976994.1 protein_id gnl|my_center|LOCUS_38000 109959 110315 gene locus_tag LOCUS_38010 109959 110315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 111507 110884 gene locus_tag LOCUS_38020 111507 110884 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974671.1 protein_id gnl|my_center|LOCUS_38020 111600 112349 gene locus_tag LOCUS_38030 111600 112349 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974670.1 protein_id gnl|my_center|LOCUS_38030 112384 113241 gene locus_tag LOCUS_38040 112384 113241 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975951.1 protein_id gnl|my_center|LOCUS_38040 113954 114115 gene locus_tag LOCUS_38050 113954 114115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 114180 114824 gene locus_tag LOCUS_38060 114180 114824 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223636.1 protein_id gnl|my_center|LOCUS_38060 115642 114809 gene locus_tag LOCUS_38070 115642 114809 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530904.1 protein_id gnl|my_center|LOCUS_38070 115692 116222 gene locus_tag LOCUS_38080 115692 116222 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228475.1 protein_id gnl|my_center|LOCUS_38080 116658 116215 gene locus_tag LOCUS_38090 116658 116215 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976424.1 protein_id gnl|my_center|LOCUS_38090 116584 116757 gene locus_tag LOCUS_38100 116584 116757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 116963 117406 gene locus_tag LOCUS_38110 116963 117406 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975279.1 protein_id gnl|my_center|LOCUS_38110 118064 117438 gene locus_tag LOCUS_38120 118064 117438 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 protein_id gnl|my_center|LOCUS_38120 119291 118104 gene locus_tag LOCUS_38130 119291 118104 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163818369.1 protein_id gnl|my_center|LOCUS_38130 119354 120298 gene locus_tag LOCUS_38140 119354 120298 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226156.1 protein_id gnl|my_center|LOCUS_38140 121153 120299 gene locus_tag LOCUS_38150 121153 120299 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028204.1 protein_id gnl|my_center|LOCUS_38150 121310 122791 gene locus_tag LOCUS_38160 121310 122791 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972517.1 protein_id gnl|my_center|LOCUS_38160 122791 123306 gene locus_tag LOCUS_38170 122791 123306 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226746.1 protein_id gnl|my_center|LOCUS_38170 123399 123977 gene locus_tag LOCUS_38180 123399 123977 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031635.1 protein_id gnl|my_center|LOCUS_38180 126955 124076 gene locus_tag LOCUS_38190 126955 124076 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_38190 127378 127055 gene locus_tag LOCUS_38200 127378 127055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 128760 127693 gene locus_tag LOCUS_38210 128760 127693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 128957 129682 gene locus_tag LOCUS_38220 gene lexA 128957 129682 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_38220 129791 130891 gene locus_tag LOCUS_38230 129791 130891 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230022.1 protein_id gnl|my_center|LOCUS_38230 133464 131002 gene locus_tag LOCUS_38240 gene leuS 133464 131002 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_38240 134289 133723 gene locus_tag LOCUS_38250 134289 133723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 134189 135733 gene locus_tag LOCUS_38260 134189 135733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 137028 135754 gene locus_tag LOCUS_38270 137028 135754 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_38270 136979 137155 gene locus_tag LOCUS_38280 136979 137155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 138580 137270 gene locus_tag LOCUS_38290 138580 137270 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_38290 140048 138789 gene locus_tag LOCUS_38300 140048 138789 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226359.1 protein_id gnl|my_center|LOCUS_38300 141452 140103 gene locus_tag LOCUS_38310 141452 140103 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_38310 141701 142435 gene locus_tag LOCUS_38320 141701 142435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971044.1 protein_id gnl|my_center|LOCUS_38320 143324 142464 gene locus_tag LOCUS_38330 143324 142464 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519563.1 protein_id gnl|my_center|LOCUS_38330 143241 143495 gene locus_tag LOCUS_38340 143241 143495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 143517 144638 gene locus_tag LOCUS_38350 143517 144638 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224352.1 protein_id gnl|my_center|LOCUS_38350 144709 145377 gene locus_tag LOCUS_38360 144709 145377 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727791.1 protein_id gnl|my_center|LOCUS_38360 145954 145484 gene locus_tag LOCUS_38370 145954 145484 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606669.1 protein_id gnl|my_center|LOCUS_38370 146079 147500 gene locus_tag LOCUS_38380 146079 147500 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_38380 147571 148305 gene locus_tag LOCUS_38390 147571 148305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 148459 148833 gene locus_tag LOCUS_38400 148459 148833 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977188.1 protein_id gnl|my_center|LOCUS_38400 148923 150395 gene locus_tag LOCUS_38410 148923 150395 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_38410 150441 151967 gene locus_tag LOCUS_38420 150441 151967 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877353.1 protein_id gnl|my_center|LOCUS_38420 152523 151981 gene locus_tag LOCUS_38430 152523 151981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 152727 153077 gene locus_tag LOCUS_38440 152727 153077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 protein_id gnl|my_center|LOCUS_38440 154280 153144 gene locus_tag LOCUS_38450 154280 153144 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179809238.1 protein_id gnl|my_center|LOCUS_38450 154369 155166 gene locus_tag LOCUS_38460 154369 155166 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_38460 155943 155194 gene locus_tag LOCUS_38470 155943 155194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 156550 155963 gene locus_tag LOCUS_38480 156550 155963 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_38480 156619 158484 gene locus_tag LOCUS_38490 156619 158484 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_38490 159332 158568 gene locus_tag LOCUS_38500 159332 158568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 160182 159520 gene locus_tag LOCUS_38510 160182 159520 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030616.1 protein_id gnl|my_center|LOCUS_38510 161438 160179 gene locus_tag LOCUS_38520 161438 160179 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_38520 161511 162539 gene locus_tag LOCUS_38530 161511 162539 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974569.1 protein_id gnl|my_center|LOCUS_38530 162817 162602 gene locus_tag LOCUS_38540 162817 162602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 163316 162858 gene locus_tag LOCUS_38550 163316 162858 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027704.1 protein_id gnl|my_center|LOCUS_38550 163418 164440 gene locus_tag LOCUS_38560 gene ftrA 163418 164440 CDS product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194618.1 protein_id gnl|my_center|LOCUS_38560 165205 164411 gene locus_tag LOCUS_38570 165205 164411 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_38570 166028 165363 gene locus_tag LOCUS_38580 166028 165363 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970812.1 protein_id gnl|my_center|LOCUS_38580 166256 166702 gene locus_tag LOCUS_38590 166256 166702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 166746 167825 gene locus_tag LOCUS_38600 166746 167825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 168360 167884 gene locus_tag LOCUS_38610 168360 167884 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226533.1 protein_id gnl|my_center|LOCUS_38610 168528 169481 gene locus_tag LOCUS_38620 168528 169481 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485415.1 protein_id gnl|my_center|LOCUS_38620 170031 169585 gene locus_tag LOCUS_38630 170031 169585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 172903 170180 gene locus_tag LOCUS_38640 172903 170180 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 protein_id gnl|my_center|LOCUS_38640 172805 174637 gene locus_tag LOCUS_38650 172805 174637 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229234.1 protein_id gnl|my_center|LOCUS_38650 174897 175439 gene locus_tag LOCUS_38660 174897 175439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974526.1 protein_id gnl|my_center|LOCUS_38660 175597 177252 gene locus_tag LOCUS_38670 175597 177252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 178045 177260 gene locus_tag LOCUS_38680 178045 177260 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898123.1 protein_id gnl|my_center|LOCUS_38680 178301 178228 gene locus_tag LOCUS_t00290 178301 178228 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 178407 179321 gene locus_tag LOCUS_38690 178407 179321 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_38690 180380 179391 gene locus_tag LOCUS_38700 gene yjfF 180380 179391 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_38700 181429 180377 gene locus_tag LOCUS_38710 181429 180377 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_38710 182937 181426 gene locus_tag LOCUS_38720 182937 181426 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_38720 183995 183021 gene locus_tag LOCUS_38730 183995 183021 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_38730 185199 184162 gene locus_tag LOCUS_38740 185199 184162 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_38740 186370 185489 gene locus_tag LOCUS_38750 186370 185489 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027747.1 protein_id gnl|my_center|LOCUS_38750 187376 186627 gene locus_tag LOCUS_38760 187376 186627 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_38760 187863 187558 gene locus_tag LOCUS_38770 187863 187558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 189343 188006 gene locus_tag LOCUS_38780 189343 188006 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 protein_id gnl|my_center|LOCUS_38780 189901 189506 gene locus_tag LOCUS_38790 189901 189506 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_38790 190251 189898 gene locus_tag LOCUS_38800 190251 189898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977263.1 protein_id gnl|my_center|LOCUS_38800 191452 190358 gene locus_tag LOCUS_38810 191452 190358 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894734.1 protein_id gnl|my_center|LOCUS_38810 191565 194567 gene locus_tag LOCUS_38820 191565 194567 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661056.1 protein_id gnl|my_center|LOCUS_38820 194609 197944 gene locus_tag LOCUS_38830 194609 197944 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 protein_id gnl|my_center|LOCUS_38830 198690 197926 gene locus_tag LOCUS_38840 198690 197926 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 protein_id gnl|my_center|LOCUS_38840 199655 198687 gene locus_tag LOCUS_38850 199655 198687 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_38850 200424 199789 gene locus_tag LOCUS_38860 200424 199789 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_38860 200884 200480 gene locus_tag LOCUS_38870 gene rsfS 200884 200480 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_38870 201136 202392 gene locus_tag LOCUS_38880 201136 202392 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_38880 202513 203340 gene locus_tag LOCUS_38890 202513 203340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 203879 203376 gene locus_tag LOCUS_38900 203879 203376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 204583 203936 gene locus_tag LOCUS_38910 204583 203936 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895252.1 protein_id gnl|my_center|LOCUS_38910 204731 205468 gene locus_tag LOCUS_38920 204731 205468 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896974.1 protein_id gnl|my_center|LOCUS_38920 206354 206893 gene locus_tag LOCUS_38930 206354 206893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 207420 207806 gene locus_tag LOCUS_38940 207420 207806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 208531 209028 gene locus_tag LOCUS_38950 208531 209028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 209431 209685 gene locus_tag LOCUS_38960 209431 209685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38960 210309 209698 gene locus_tag LOCUS_38970 gene nadD 210309 209698 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_38970 210426 211436 gene locus_tag LOCUS_38980 210426 211436 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028434.1 protein_id gnl|my_center|LOCUS_38980 213114 211468 gene locus_tag LOCUS_38990 213114 211468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 214499 213243 gene locus_tag LOCUS_39000 214499 213243 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_39000 215635 214514 gene locus_tag LOCUS_39010 gene proB 215635 214514 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_39010 217008 215656 gene locus_tag LOCUS_39020 gene obgE 217008 215656 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_39020 217346 217089 gene locus_tag LOCUS_39030 gene rpmA 217346 217089 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_39030 217667 217353 gene locus_tag LOCUS_39040 gene rplU 217667 217353 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067132.1 protein_id gnl|my_center|LOCUS_39040 220882 217865 gene locus_tag LOCUS_39050 220882 217865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39050 221720 220986 gene locus_tag LOCUS_39060 221720 220986 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_39060 223812 221890 gene locus_tag LOCUS_39070 223812 221890 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_39070 225061 223892 gene locus_tag LOCUS_39080 gene rodA 225061 223892 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_39080 227134 225071 gene locus_tag LOCUS_39090 gene mrdA 227134 225071 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_39090 227646 227131 gene locus_tag LOCUS_39100 227646 227131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 228812 227652 gene locus_tag LOCUS_39110 gene mreC 228812 227652 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_39110 229856 228825 gene locus_tag LOCUS_39120 229856 228825 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_39120 230462 230052 gene locus_tag LOCUS_39130 gene ndk 230462 230052 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060204.1 protein_id gnl|my_center|LOCUS_39130 232246 230624 gene locus_tag LOCUS_39140 232246 230624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 232632 232258 gene locus_tag LOCUS_39150 232632 232258 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228490.1 protein_id gnl|my_center|LOCUS_39150 233900 232629 gene locus_tag LOCUS_39160 233900 232629 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_39160 >Feature sequence16 <1 2514 gene locus_tag LOCUS_39170 <1 2514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228557.1:HAMP domain-containing protein 2518 3147 gene locus_tag LOCUS_39180 2518 3147 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030434.1 protein_id gnl|my_center|LOCUS_39180 3233 3976 gene locus_tag LOCUS_39190 3233 3976 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031670.1 protein_id gnl|my_center|LOCUS_39190 5355 4009 gene locus_tag LOCUS_39200 5355 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 8060 5535 gene locus_tag LOCUS_39210 8060 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 8165 8746 gene locus_tag LOCUS_39220 gene pyrE 8165 8746 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_39220 9167 8724 gene locus_tag LOCUS_39230 9167 8724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 9914 9246 gene locus_tag LOCUS_39240 9914 9246 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184762868.1 protein_id gnl|my_center|LOCUS_39240 10083 11105 gene locus_tag LOCUS_39250 gene fbaA 10083 11105 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_39250 11206 11628 gene locus_tag LOCUS_39260 11206 11628 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_39260 11873 13156 gene locus_tag LOCUS_39270 11873 13156 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_39270 13256 14182 gene locus_tag LOCUS_39280 13256 14182 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921532.1 protein_id gnl|my_center|LOCUS_39280 14389 14195 gene locus_tag LOCUS_39290 14389 14195 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222786.1 protein_id gnl|my_center|LOCUS_39290 15600 14401 gene locus_tag LOCUS_39300 15600 14401 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_39300 15706 16329 gene locus_tag LOCUS_39310 15706 16329 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028311.1 protein_id gnl|my_center|LOCUS_39310 >Feature sequence17 1146 94 gene locus_tag LOCUS_39320 gene corA 1146 94 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_39320 1578 2819 gene locus_tag LOCUS_39330 gene purD 1578 2819 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_39330 2864 3712 gene locus_tag LOCUS_39340 2864 3712 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_39340 3874 5151 gene locus_tag LOCUS_39350 gene murA 3874 5151 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227695.1 protein_id gnl|my_center|LOCUS_39350 5321 6655 gene locus_tag LOCUS_39360 5321 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 6712 7656 gene locus_tag LOCUS_39370 gene yedA 6712 7656 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_39370 8766 7708 gene locus_tag LOCUS_39380 gene hisC 8766 7708 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_39380 9980 8877 gene locus_tag LOCUS_39390 9980 8877 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028897.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39390 10630 10034 gene locus_tag LOCUS_39400 10630 10034 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226433.1 protein_id gnl|my_center|LOCUS_39400 12305 10701 gene locus_tag LOCUS_39410 12305 10701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 12277 12555 gene locus_tag LOCUS_39420 12277 12555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 13663 12575 gene locus_tag LOCUS_39430 13663 12575 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257992.1 protein_id gnl|my_center|LOCUS_39430 14939 13677 gene locus_tag LOCUS_39440 14939 13677 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_39440 16681 15038 gene locus_tag LOCUS_39450 16681 15038 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776768.1 protein_id gnl|my_center|LOCUS_39450 16738 17865 gene locus_tag LOCUS_39460 gene wecB 16738 17865 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_39460 17927 19978 gene locus_tag LOCUS_39470 17927 19978 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776746.1 protein_id gnl|my_center|LOCUS_39470 21929 20436 gene locus_tag LOCUS_39480 21929 20436 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224190.1 protein_id gnl|my_center|LOCUS_39480 22169 21960 gene locus_tag LOCUS_39490 22169 21960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224191.1 protein_id gnl|my_center|LOCUS_39490 23429 22323 gene locus_tag LOCUS_39500 23429 22323 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028459.1 protein_id gnl|my_center|LOCUS_39500 24439 23714 gene locus_tag LOCUS_39510 24439 23714 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_39510 24632 27280 gene locus_tag LOCUS_39520 24632 27280 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027766.1 protein_id gnl|my_center|LOCUS_39520 27277 27684 gene locus_tag LOCUS_39530 27277 27684 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977425.1 protein_id gnl|my_center|LOCUS_39530 27698 28066 gene locus_tag LOCUS_39540 27698 28066 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_39540 28047 28622 gene locus_tag LOCUS_39550 28047 28622 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977427.1 protein_id gnl|my_center|LOCUS_39550 29368 28625 gene locus_tag LOCUS_39560 29368 28625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 30850 29486 gene locus_tag LOCUS_39570 gene xylB 30850 29486 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877620.1 protein_id gnl|my_center|LOCUS_39570 32090 30945 gene locus_tag LOCUS_39580 gene xylA 32090 30945 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228546.1 protein_id gnl|my_center|LOCUS_39580 32225 33454 gene locus_tag LOCUS_39590 32225 33454 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228545.1 protein_id gnl|my_center|LOCUS_39590 33671 33459 gene locus_tag LOCUS_39600 33671 33459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 33792 34295 gene locus_tag LOCUS_39610 33792 34295 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226958.1 protein_id gnl|my_center|LOCUS_39610 34397 35254 gene locus_tag LOCUS_39620 34397 35254 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027090.1 protein_id gnl|my_center|LOCUS_39620 35361 35708 gene locus_tag LOCUS_39630 35361 35708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 35880 40280 gene locus_tag LOCUS_39640 35880 40280 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886065.1 protein_id gnl|my_center|LOCUS_39640 40897 40289 gene locus_tag LOCUS_39650 40897 40289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 41014 41547 gene locus_tag LOCUS_39660 41014 41547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 42131 41490 gene locus_tag LOCUS_39670 42131 41490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 42214 42810 gene locus_tag LOCUS_39680 42214 42810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 43194 42820 gene locus_tag LOCUS_39690 43194 42820 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 protein_id gnl|my_center|LOCUS_39690 43697 43248 gene locus_tag LOCUS_39700 43697 43248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229734.1 protein_id gnl|my_center|LOCUS_39700 44173 43694 gene locus_tag LOCUS_39710 44173 43694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 44267 45169 gene locus_tag LOCUS_39720 44267 45169 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229733.1 protein_id gnl|my_center|LOCUS_39720 45292 46239 gene locus_tag LOCUS_39730 45292 46239 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876395.1 protein_id gnl|my_center|LOCUS_39730 46365 47237 gene locus_tag LOCUS_39740 46365 47237 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972048.1 protein_id gnl|my_center|LOCUS_39740 47515 48081 gene locus_tag LOCUS_39750 47515 48081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 48957 48181 gene locus_tag LOCUS_39760 48957 48181 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410037.1 protein_id gnl|my_center|LOCUS_39760 51337 49112 gene locus_tag LOCUS_39770 gene katG 51337 49112 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027206.1 protein_id gnl|my_center|LOCUS_39770 51806 51369 gene locus_tag LOCUS_39780 51806 51369 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978301.1 protein_id gnl|my_center|LOCUS_39780 52007 52417 gene locus_tag LOCUS_39790 52007 52417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 53317 52538 gene locus_tag LOCUS_39800 53317 52538 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_39800 53427 53942 gene locus_tag LOCUS_39810 53427 53942 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228785.1 protein_id gnl|my_center|LOCUS_39810 55035 54019 gene locus_tag LOCUS_39820 55035 54019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 56543 55065 gene locus_tag LOCUS_39830 56543 55065 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230595.1 protein_id gnl|my_center|LOCUS_39830 57534 56761 gene locus_tag LOCUS_39840 57534 56761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 58241 57582 gene locus_tag LOCUS_39850 58241 57582 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974105.1 protein_id gnl|my_center|LOCUS_39850 58462 59247 gene locus_tag LOCUS_39860 58462 59247 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091311.1 protein_id gnl|my_center|LOCUS_39860 60055 59324 gene locus_tag LOCUS_39870 60055 59324 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862685.1 protein_id gnl|my_center|LOCUS_39870 60699 60100 gene locus_tag LOCUS_39880 60699 60100 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742221.1 protein_id gnl|my_center|LOCUS_39880 61085 61717 gene locus_tag LOCUS_39890 61085 61717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 61907 62368 gene locus_tag LOCUS_39900 61907 62368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 63213 62815 gene locus_tag LOCUS_39910 63213 62815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 63506 63901 gene locus_tag LOCUS_39920 63506 63901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 64110 64346 gene locus_tag LOCUS_39930 64110 64346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 64371 64661 gene locus_tag LOCUS_39940 64371 64661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 65488 64982 gene locus_tag LOCUS_39950 65488 64982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 65575 66597 gene locus_tag LOCUS_39960 65575 66597 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168991739.1 protein_id gnl|my_center|LOCUS_39960 66727 66930 gene locus_tag LOCUS_39970 66727 66930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 67269 66952 gene locus_tag LOCUS_39980 67269 66952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 67563 67489 gene locus_tag LOCUS_t00300 67563 67489 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 68187 67729 gene locus_tag LOCUS_39990 68187 67729 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225005.1 protein_id gnl|my_center|LOCUS_39990 68313 69488 gene locus_tag LOCUS_40000 68313 69488 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928952.1 protein_id gnl|my_center|LOCUS_40000 69753 69875 gene locus_tag LOCUS_40010 69753 69875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 71454 69886 gene locus_tag LOCUS_40020 71454 69886 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972177.1 protein_id gnl|my_center|LOCUS_40020 71841 72254 gene locus_tag LOCUS_40030 71841 72254 CDS product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225419.1 protein_id gnl|my_center|LOCUS_40030 72262 72639 gene locus_tag LOCUS_40040 72262 72639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 76404 72763 gene locus_tag LOCUS_40050 76404 72763 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031394.1 protein_id gnl|my_center|LOCUS_40050 77279 76860 gene locus_tag LOCUS_40060 77279 76860 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230381.1 protein_id gnl|my_center|LOCUS_40060 77692 77276 gene locus_tag LOCUS_40070 77692 77276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 77858 78961 gene locus_tag LOCUS_40080 77858 78961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 79906 79046 gene locus_tag LOCUS_40090 79906 79046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 80124 80852 gene locus_tag LOCUS_40100 80124 80852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 81373 80915 gene locus_tag LOCUS_40110 81373 80915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 81462 82400 gene locus_tag LOCUS_40120 81462 82400 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226026.1 protein_id gnl|my_center|LOCUS_40120 82457 83014 gene locus_tag LOCUS_40130 82457 83014 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226963.1 protein_id gnl|my_center|LOCUS_40130 83048 83428 gene locus_tag LOCUS_40140 83048 83428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 83711 84349 gene locus_tag LOCUS_40150 83711 84349 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230676.1 protein_id gnl|my_center|LOCUS_40150 85748 84360 gene locus_tag LOCUS_40160 85748 84360 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286818.1 protein_id gnl|my_center|LOCUS_40160 85823 86731 gene locus_tag LOCUS_40170 85823 86731 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221640267.1 protein_id gnl|my_center|LOCUS_40170 87147 86800 gene locus_tag LOCUS_40180 87147 86800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 87751 87164 gene locus_tag LOCUS_40190 87751 87164 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742119.1 protein_id gnl|my_center|LOCUS_40190 88212 87793 gene locus_tag LOCUS_40200 88212 87793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 88952 88404 gene locus_tag LOCUS_40210 88952 88404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 88960 89631 gene locus_tag LOCUS_40220 88960 89631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 90798 89833 gene locus_tag LOCUS_40230 90798 89833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 91466 90795 gene locus_tag LOCUS_40240 91466 90795 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973087.1 protein_id gnl|my_center|LOCUS_40240 92245 91790 gene locus_tag LOCUS_40250 92245 91790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 92376 92651 gene locus_tag LOCUS_40260 92376 92651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 93229 92681 gene locus_tag LOCUS_40270 93229 92681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 94265 93243 gene locus_tag LOCUS_40280 94265 93243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 94851 94282 gene locus_tag LOCUS_40290 94851 94282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 95203 95113 gene locus_tag LOCUS_t00310 95203 95113 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 96005 95442 gene locus_tag LOCUS_40300 96005 95442 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854913.1 protein_id gnl|my_center|LOCUS_40300 96104 96592 gene locus_tag LOCUS_40310 96104 96592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 97159 96662 gene locus_tag LOCUS_40320 97159 96662 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495205.1 protein_id gnl|my_center|LOCUS_40320 97456 98397 gene locus_tag LOCUS_40330 97456 98397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 98401 99219 gene locus_tag LOCUS_40340 98401 99219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 100506 99325 gene locus_tag LOCUS_40350 100506 99325 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_40350 101199 100798 gene locus_tag LOCUS_40360 101199 100798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 101165 101629 gene locus_tag LOCUS_40370 101165 101629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 102786 101683 gene locus_tag LOCUS_40380 102786 101683 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198466.1 protein_id gnl|my_center|LOCUS_40380 103530 103781 gene locus_tag LOCUS_40390 103530 103781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 103821 104693 gene locus_tag LOCUS_40400 103821 104693 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224326.1 protein_id gnl|my_center|LOCUS_40400 104750 105763 gene locus_tag LOCUS_40410 104750 105763 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225345.1 protein_id gnl|my_center|LOCUS_40410 105760 106575 gene locus_tag LOCUS_40420 105760 106575 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228386.1 protein_id gnl|my_center|LOCUS_40420 106700 107773 gene locus_tag LOCUS_40430 106700 107773 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027795.1 protein_id gnl|my_center|LOCUS_40430 108624 107782 gene locus_tag LOCUS_40440 108624 107782 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731143.1 protein_id gnl|my_center|LOCUS_40440 109375 108755 gene locus_tag LOCUS_40450 109375 108755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 110596 109688 gene locus_tag LOCUS_40460 110596 109688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 110763 110593 gene locus_tag LOCUS_40470 110763 110593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 111043 111933 gene locus_tag LOCUS_40480 111043 111933 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_40480 111992 113299 gene locus_tag LOCUS_40490 111992 113299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 115154 113313 gene locus_tag LOCUS_40500 115154 113313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 115932 115315 gene locus_tag LOCUS_40510 115932 115315 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 protein_id gnl|my_center|LOCUS_40510 117005 115929 gene locus_tag LOCUS_40520 117005 115929 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223202.1 protein_id gnl|my_center|LOCUS_40520 118146 117136 gene locus_tag LOCUS_40530 118146 117136 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023619.1 protein_id gnl|my_center|LOCUS_40530 119143 118325 gene locus_tag LOCUS_40540 119143 118325 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_40540 119224 119817 gene locus_tag LOCUS_40550 119224 119817 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974324.1 protein_id gnl|my_center|LOCUS_40550 120195 119830 gene locus_tag LOCUS_40560 120195 119830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225088.1 protein_id gnl|my_center|LOCUS_40560 120737 120192 gene locus_tag LOCUS_40570 120737 120192 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225089.1 protein_id gnl|my_center|LOCUS_40570 121403 120876 gene locus_tag LOCUS_40580 121403 120876 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227926.1 protein_id gnl|my_center|LOCUS_40580 121941 121531 gene locus_tag LOCUS_40590 121941 121531 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_40590 122384 121938 gene locus_tag LOCUS_40600 122384 121938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 122440 123096 gene locus_tag LOCUS_40610 122440 123096 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727869.1 protein_id gnl|my_center|LOCUS_40610 123148 123648 gene locus_tag LOCUS_40620 123148 123648 CDS product HAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028507.1 protein_id gnl|my_center|LOCUS_40620 123897 124595 gene locus_tag LOCUS_40630 123897 124595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 124674 125129 gene locus_tag LOCUS_40640 124674 125129 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404633.1 protein_id gnl|my_center|LOCUS_40640 125870 125160 gene locus_tag LOCUS_40650 125870 125160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030751.1 protein_id gnl|my_center|LOCUS_40650 126052 127296 gene locus_tag LOCUS_40660 126052 127296 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030748.1 protein_id gnl|my_center|LOCUS_40660 127296 128174 gene locus_tag LOCUS_40670 127296 128174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972703.1 protein_id gnl|my_center|LOCUS_40670 128375 128286 gene locus_tag LOCUS_t00320 128375 128286 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 131013 128485 gene locus_tag LOCUS_40680 131013 128485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 131129 132091 gene locus_tag LOCUS_40690 131129 132091 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_40690 132211 132741 gene locus_tag LOCUS_40700 132211 132741 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_40700 133589 132795 gene locus_tag LOCUS_40710 133589 132795 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_40710 133832 134035 gene locus_tag LOCUS_40720 133832 134035 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891980.1 protein_id gnl|my_center|LOCUS_40720 135515 134241 gene locus_tag LOCUS_40730 gene serS 135515 134241 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831496.1 protein_id gnl|my_center|LOCUS_40730 136514 135594 gene locus_tag LOCUS_40740 gene pheA 136514 135594 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_40740 137082 136624 gene locus_tag LOCUS_40750 137082 136624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 138349 137087 gene locus_tag LOCUS_40760 138349 137087 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840295.1 protein_id gnl|my_center|LOCUS_40760 138516 140801 gene locus_tag LOCUS_40770 138516 140801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804311.1 protein_id gnl|my_center|LOCUS_40770 142101 140692 gene locus_tag LOCUS_40780 142101 140692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 143330 142566 gene locus_tag LOCUS_40790 143330 142566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 143723 143337 gene locus_tag LOCUS_40800 143723 143337 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975744.1 protein_id gnl|my_center|LOCUS_40800 143742 144389 gene locus_tag LOCUS_40810 143742 144389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 145499 144381 gene locus_tag LOCUS_40820 145499 144381 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029200.1 protein_id gnl|my_center|LOCUS_40820 146194 145496 gene locus_tag LOCUS_40830 146194 145496 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_40830 146893 147048 gene locus_tag LOCUS_40840 146893 147048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 147681 147124 gene locus_tag LOCUS_40850 147681 147124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 149601 147700 gene locus_tag LOCUS_40860 149601 147700 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257930.1 protein_id gnl|my_center|LOCUS_40860 149703 150299 gene locus_tag LOCUS_40870 149703 150299 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_40870 150935 150378 gene locus_tag LOCUS_40880 150935 150378 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089165.1 protein_id gnl|my_center|LOCUS_40880 151101 151943 gene locus_tag LOCUS_40890 151101 151943 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387897.1 protein_id gnl|my_center|LOCUS_40890 153234 151897 gene locus_tag LOCUS_40900 gene cytX 153234 151897 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256688.1 protein_id gnl|my_center|LOCUS_40900 153710 153393 gene locus_tag LOCUS_40910 153710 153393 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975095.1 protein_id gnl|my_center|LOCUS_40910 154794 153916 gene locus_tag LOCUS_40920 154794 153916 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_40920 156506 154962 gene locus_tag LOCUS_40930 156506 154962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 156752 158197 gene locus_tag LOCUS_40940 156752 158197 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026955.1 protein_id gnl|my_center|LOCUS_40940 158194 159198 gene locus_tag LOCUS_40950 158194 159198 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026954.1 protein_id gnl|my_center|LOCUS_40950 160327 159158 gene locus_tag LOCUS_40960 160327 159158 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222776.1 protein_id gnl|my_center|LOCUS_40960 160785 160702 gene locus_tag LOCUS_t00330 160785 160702 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 160944 161684 gene locus_tag LOCUS_40970 160944 161684 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_40970 161702 162166 gene locus_tag LOCUS_40980 gene fhaB 161702 162166 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_40980 162163 163446 gene locus_tag LOCUS_40990 162163 163446 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029266.1 protein_id gnl|my_center|LOCUS_40990 163443 164816 gene locus_tag LOCUS_41000 163443 164816 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726618.1 protein_id gnl|my_center|LOCUS_41000 164813 166270 gene locus_tag LOCUS_41010 gene pbpA 164813 166270 CDS product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082861.1 protein_id gnl|my_center|LOCUS_41010 166296 166463 gene locus_tag LOCUS_41020 166296 166463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 166589 168442 gene locus_tag LOCUS_41030 gene pknB 166589 168442 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_41030 169289 168711 gene locus_tag LOCUS_41040 169289 168711 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 protein_id gnl|my_center|LOCUS_41040 169514 169759 gene locus_tag LOCUS_41050 gene crgA 169514 169759 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975080.1 protein_id gnl|my_center|LOCUS_41050 170760 169906 gene locus_tag LOCUS_41060 170760 169906 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495744.1 protein_id gnl|my_center|LOCUS_41060 171355 170825 gene locus_tag LOCUS_41070 171355 170825 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975078.1 protein_id gnl|my_center|LOCUS_41070 171497 171994 gene locus_tag LOCUS_41080 171497 171994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 174436 172103 gene locus_tag LOCUS_41090 174436 172103 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_41090 174786 174941 gene locus_tag LOCUS_41100 174786 174941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 176225 175050 gene locus_tag LOCUS_41110 176225 175050 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037159.1 protein_id gnl|my_center|LOCUS_41110 176713 176222 gene locus_tag LOCUS_41120 176713 176222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 177291 176935 gene locus_tag LOCUS_41130 gene kmtR 177291 176935 CDS product Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404335.1 protein_id gnl|my_center|LOCUS_41130 177505 178530 gene locus_tag LOCUS_41140 177505 178530 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027713.1 protein_id gnl|my_center|LOCUS_41140 178621 179526 gene locus_tag LOCUS_41150 178621 179526 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728494.1 protein_id gnl|my_center|LOCUS_41150 180214 179516 gene locus_tag LOCUS_41160 180214 179516 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167344383.1 protein_id gnl|my_center|LOCUS_41160 181316 180288 gene locus_tag LOCUS_41170 181316 180288 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_41170 182437 181421 gene locus_tag LOCUS_41180 182437 181421 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639357.1 protein_id gnl|my_center|LOCUS_41180 182644 183201 gene locus_tag LOCUS_41190 182644 183201 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921379.1 protein_id gnl|my_center|LOCUS_41190 183255 183704 gene locus_tag LOCUS_41200 183255 183704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 183752 184195 gene locus_tag LOCUS_41210 183752 184195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 184223 184804 gene locus_tag LOCUS_41220 184223 184804 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_41220 184846 185598 gene locus_tag LOCUS_41230 184846 185598 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141309845.1 protein_id gnl|my_center|LOCUS_41230 186080 185613 gene locus_tag LOCUS_41240 186080 185613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 187076 186162 gene locus_tag LOCUS_41250 187076 186162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 187916 187146 gene locus_tag LOCUS_41260 187916 187146 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_41260 188618 188028 gene locus_tag LOCUS_41270 188618 188028 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027617.1 protein_id gnl|my_center|LOCUS_41270 188949 188599 gene locus_tag LOCUS_41280 188949 188599 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_41280 189371 188946 gene locus_tag LOCUS_41290 189371 188946 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977672.1 protein_id gnl|my_center|LOCUS_41290 191799 189352 gene locus_tag LOCUS_41300 191799 189352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 193261 192317 gene locus_tag LOCUS_41310 193261 192317 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971447.1 protein_id gnl|my_center|LOCUS_41310 193497 194399 gene locus_tag LOCUS_41320 193497 194399 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727008.1 protein_id gnl|my_center|LOCUS_41320 194956 194396 gene locus_tag LOCUS_41330 194956 194396 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_41330 195093 195674 gene locus_tag LOCUS_41340 195093 195674 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 protein_id gnl|my_center|LOCUS_41340 195832 196935 gene locus_tag LOCUS_41350 195832 196935 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728962.1 protein_id gnl|my_center|LOCUS_41350 197044 198273 gene locus_tag LOCUS_41360 197044 198273 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_41360 198423 199202 gene locus_tag LOCUS_41370 198423 199202 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_41370 199249 201933 gene locus_tag LOCUS_41380 199249 201933 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977982.1 protein_id gnl|my_center|LOCUS_41380 204386 201969 gene locus_tag LOCUS_41390 204386 201969 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469742.1 protein_id gnl|my_center|LOCUS_41390 205081 204380 gene locus_tag LOCUS_41400 205081 204380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 protein_id gnl|my_center|LOCUS_41400 205356 207545 gene locus_tag LOCUS_41410 205356 207545 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_41410 207849 208433 gene locus_tag LOCUS_41420 207849 208433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223309.1 protein_id gnl|my_center|LOCUS_41420 208523 209701 gene locus_tag LOCUS_41430 208523 209701 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031091.1 protein_id gnl|my_center|LOCUS_41430 209698 210360 gene locus_tag LOCUS_41440 209698 210360 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031090.1 protein_id gnl|my_center|LOCUS_41440 210575 211963 gene locus_tag LOCUS_41450 210575 211963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 212768 212163 gene locus_tag LOCUS_41460 212768 212163 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228475.1 protein_id gnl|my_center|LOCUS_41460 212870 213634 gene locus_tag LOCUS_41470 212870 213634 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085699.1 protein_id gnl|my_center|LOCUS_41470 214515 213676 gene locus_tag LOCUS_41480 214515 213676 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466665.1 protein_id gnl|my_center|LOCUS_41480 214682 215311 gene locus_tag LOCUS_41490 214682 215311 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028564.1 protein_id gnl|my_center|LOCUS_41490 >Feature sequence18 207 695 gene locus_tag LOCUS_41500 207 695 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337336.1 protein_id gnl|my_center|LOCUS_41500 862 1788 gene locus_tag LOCUS_41510 862 1788 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_41510 1791 2060 gene locus_tag LOCUS_41520 1791 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 2144 2719 gene locus_tag LOCUS_41530 2144 2719 CDS product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228131.1 protein_id gnl|my_center|LOCUS_41530 2854 3567 gene locus_tag LOCUS_41540 2854 3567 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225513.1 protein_id gnl|my_center|LOCUS_41540 3695 4099 gene locus_tag LOCUS_41550 3695 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 5098 4139 gene locus_tag LOCUS_41560 5098 4139 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225890812.1 protein_id gnl|my_center|LOCUS_41560 5204 5767 gene locus_tag LOCUS_41570 5204 5767 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224939.1 protein_id gnl|my_center|LOCUS_41570 5864 6706 gene locus_tag LOCUS_41580 5864 6706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_41580 6743 7582 gene locus_tag LOCUS_41590 6743 7582 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227225.1 protein_id gnl|my_center|LOCUS_41590 7641 8825 gene locus_tag LOCUS_41600 7641 8825 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230183.1 protein_id gnl|my_center|LOCUS_41600 8822 9466 gene locus_tag LOCUS_41610 8822 9466 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_41610 10180 9512 gene locus_tag LOCUS_41620 10180 9512 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199702189.1 protein_id gnl|my_center|LOCUS_41620 10198 11193 gene locus_tag LOCUS_41630 10198 11193 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971534.1 protein_id gnl|my_center|LOCUS_41630 11304 11696 gene locus_tag LOCUS_41640 11304 11696 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776272.1 protein_id gnl|my_center|LOCUS_41640 12470 11868 gene locus_tag LOCUS_41650 12470 11868 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200072.1 protein_id gnl|my_center|LOCUS_41650 12568 13476 gene locus_tag LOCUS_41660 12568 13476 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229423.1 protein_id gnl|my_center|LOCUS_41660 14009 13578 gene locus_tag LOCUS_41670 14009 13578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 14234 15496 gene locus_tag LOCUS_41680 14234 15496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 15481 16128 gene locus_tag LOCUS_41690 15481 16128 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221997.1 protein_id gnl|my_center|LOCUS_41690 16194 16664 gene locus_tag LOCUS_41700 16194 16664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 16794 17804 gene locus_tag LOCUS_41710 16794 17804 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815513.1 protein_id gnl|my_center|LOCUS_41710 17812 18651 gene locus_tag LOCUS_41720 17812 18651 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029811.1 protein_id gnl|my_center|LOCUS_41720 19010 21004 gene locus_tag LOCUS_41730 19010 21004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 21124 22266 gene locus_tag LOCUS_41740 21124 22266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41740 22360 23031 gene locus_tag LOCUS_41750 22360 23031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 23028 23498 gene locus_tag LOCUS_41760 23028 23498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 23587 24213 gene locus_tag LOCUS_41770 23587 24213 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228774.1 protein_id gnl|my_center|LOCUS_41770 24350 24814 gene locus_tag LOCUS_41780 24350 24814 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224404.1 protein_id gnl|my_center|LOCUS_41780 25621 25145 gene locus_tag LOCUS_41790 25621 25145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 25746 26054 gene locus_tag LOCUS_41800 25746 26054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 26051 27253 gene locus_tag LOCUS_41810 26051 27253 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_41810 27658 28131 gene locus_tag LOCUS_41820 27658 28131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 28131 28463 gene locus_tag LOCUS_41830 28131 28463 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639882.1 protein_id gnl|my_center|LOCUS_41830 28566 29069 gene locus_tag LOCUS_41840 28566 29069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 29066 29407 gene locus_tag LOCUS_41850 29066 29407 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226535.1 protein_id gnl|my_center|LOCUS_41850 29429 30646 gene locus_tag LOCUS_41860 29429 30646 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226537.1 protein_id gnl|my_center|LOCUS_41860 31141 30653 gene locus_tag LOCUS_41870 31141 30653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 31553 33004 gene locus_tag LOCUS_41880 31553 33004 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727668.1 protein_id gnl|my_center|LOCUS_41880 33694 33005 gene locus_tag LOCUS_41890 33694 33005 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973517.1 protein_id gnl|my_center|LOCUS_41890 33853 34614 gene locus_tag LOCUS_41900 33853 34614 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028214.1 protein_id gnl|my_center|LOCUS_41900 35976 34726 gene locus_tag LOCUS_41910 35976 34726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 36284 35988 gene locus_tag LOCUS_41920 36284 35988 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222672.1 protein_id gnl|my_center|LOCUS_41920 36600 36439 gene locus_tag LOCUS_41930 36600 36439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 36677 36964 gene locus_tag LOCUS_41940 36677 36964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 37272 36883 gene locus_tag LOCUS_41950 37272 36883 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_41950 37379 37534 gene locus_tag LOCUS_41960 37379 37534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 37577 38032 gene locus_tag LOCUS_41970 37577 38032 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031198.1 protein_id gnl|my_center|LOCUS_41970 38452 38700 gene locus_tag LOCUS_41980 38452 38700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 38697 39107 gene locus_tag LOCUS_41990 38697 39107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 40157 39291 gene locus_tag LOCUS_42000 40157 39291 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224207.1 protein_id gnl|my_center|LOCUS_42000 40122 40283 gene locus_tag LOCUS_42010 40122 40283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 40871 40314 gene locus_tag LOCUS_42020 40871 40314 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222272.1 protein_id gnl|my_center|LOCUS_42020 41740 41162 gene locus_tag LOCUS_42030 41740 41162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 42085 43311 gene locus_tag LOCUS_42040 42085 43311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 44401 43826 gene locus_tag LOCUS_42050 44401 43826 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969624.1 protein_id gnl|my_center|LOCUS_42050 44937 46865 gene locus_tag LOCUS_42060 44937 46865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 47395 48516 gene locus_tag LOCUS_42070 47395 48516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 48525 49157 gene locus_tag LOCUS_42080 48525 49157 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_42080 49179 49385 gene locus_tag LOCUS_42090 49179 49385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 49448 49374 gene locus_tag LOCUS_t00340 49448 49374 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 50308 49595 gene locus_tag LOCUS_42100 50308 49595 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084718.1 protein_id gnl|my_center|LOCUS_42100 50512 50348 gene locus_tag LOCUS_42110 50512 50348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 51189 50794 gene locus_tag LOCUS_42120 51189 50794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 52237 51332 gene locus_tag LOCUS_42130 52237 51332 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_42130 52658 52317 gene locus_tag LOCUS_42140 52658 52317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 52715 53281 gene locus_tag LOCUS_42150 52715 53281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 53403 53792 gene locus_tag LOCUS_42160 53403 53792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 55617 53794 gene locus_tag LOCUS_42170 55617 53794 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_42170 56705 55722 gene locus_tag LOCUS_42180 56705 55722 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228449.1 protein_id gnl|my_center|LOCUS_42180 56837 58579 gene locus_tag LOCUS_42190 56837 58579 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030693.1 protein_id gnl|my_center|LOCUS_42190 59581 58637 gene locus_tag LOCUS_42200 59581 58637 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_42200 60482 59619 gene locus_tag LOCUS_42210 60482 59619 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_42210 60562 61899 gene locus_tag LOCUS_42220 60562 61899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 62963 62124 gene locus_tag LOCUS_42230 gene qorB 62963 62124 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560563.1 protein_id gnl|my_center|LOCUS_42230 63284 63610 gene locus_tag LOCUS_42240 63284 63610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 63803 64288 gene locus_tag LOCUS_42250 63803 64288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 65129 64392 gene locus_tag LOCUS_42260 65129 64392 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 protein_id gnl|my_center|LOCUS_42260 65360 65148 gene locus_tag LOCUS_42270 65360 65148 CDS product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228805.1 protein_id gnl|my_center|LOCUS_42270 65855 66943 gene locus_tag LOCUS_42280 gene trpS 65855 66943 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804845.1 protein_id gnl|my_center|LOCUS_42280 67602 67108 gene locus_tag LOCUS_42290 67602 67108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 67945 68115 gene locus_tag LOCUS_42300 67945 68115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 68307 68231 gene locus_tag LOCUS_t00350 68307 68231 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 69668 68481 gene locus_tag LOCUS_42310 69668 68481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 72241 69665 gene locus_tag LOCUS_42320 gene gyrA 72241 69665 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_42320 74200 72257 gene locus_tag LOCUS_42330 gene gyrB 74200 72257 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_42330 75059 74535 gene locus_tag LOCUS_42340 75059 74535 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975057.1 protein_id gnl|my_center|LOCUS_42340 76260 75049 gene locus_tag LOCUS_42350 gene recF 76260 75049 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_42350 77284 76340 gene locus_tag LOCUS_42360 gene gnd 77284 76340 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029286.1 protein_id gnl|my_center|LOCUS_42360 78517 77378 gene locus_tag LOCUS_42370 gene dnaN 78517 77378 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_42370 80663 79044 gene locus_tag LOCUS_42380 gene dnaA 80663 79044 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221955.1 protein_id gnl|my_center|LOCUS_42380 81255 81392 gene locus_tag LOCUS_42390 gene rpmH 81255 81392 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_42390 81464 81841 gene locus_tag LOCUS_42400 gene rnpA 81464 81841 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 protein_id gnl|my_center|LOCUS_42400 81838 82161 gene locus_tag LOCUS_42410 81838 82161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 82166 83119 gene locus_tag LOCUS_42420 82166 83119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 83139 83633 gene locus_tag LOCUS_42430 83139 83633 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_42430 83840 84529 gene locus_tag LOCUS_42440 gene rsmG 83840 84529 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_42440 84841 85611 gene locus_tag LOCUS_42450 84841 85611 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_42450 86151 87110 gene locus_tag LOCUS_42460 86151 87110 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_42460 88316 87297 gene locus_tag LOCUS_42470 88316 87297 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_42470 89732 88407 gene locus_tag LOCUS_42480 89732 88407 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_42480 90020 90637 gene locus_tag LOCUS_42490 90020 90637 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975043.1 protein_id gnl|my_center|LOCUS_42490 91250 90927 gene locus_tag LOCUS_42500 gene trxA 91250 90927 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_42500 92244 91315 gene locus_tag LOCUS_42510 gene trxB 92244 91315 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_42510 93039 92410 gene locus_tag LOCUS_42520 gene sigM 93039 92410 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 protein_id gnl|my_center|LOCUS_42520 94553 93048 gene locus_tag LOCUS_42530 94553 93048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 96344 94755 gene locus_tag LOCUS_42540 96344 94755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42540 98651 96438 gene locus_tag LOCUS_42550 98651 96438 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930082.1 protein_id gnl|my_center|LOCUS_42550 99234 98698 gene locus_tag LOCUS_42560 99234 98698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 99407 100813 gene locus_tag LOCUS_42570 99407 100813 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_42570 101137 102420 gene locus_tag LOCUS_42580 101137 102420 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224093.1 protein_id gnl|my_center|LOCUS_42580 103832 102531 gene locus_tag LOCUS_42590 103832 102531 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 protein_id gnl|my_center|LOCUS_42590 103942 104523 gene locus_tag LOCUS_42600 gene idi 103942 104523 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898999.1 protein_id gnl|my_center|LOCUS_42600 105741 104662 gene locus_tag LOCUS_42610 105741 104662 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_42610 106393 105767 gene locus_tag LOCUS_42620 106393 105767 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_42620 106541 106924 gene locus_tag LOCUS_42630 106541 106924 CDS product DUF5318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230992.1 protein_id gnl|my_center|LOCUS_42630 107006 109981 gene locus_tag LOCUS_42640 107006 109981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 110162 111526 gene locus_tag LOCUS_42650 110162 111526 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_42650 111578 112807 gene locus_tag LOCUS_42660 111578 112807 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326026.1 protein_id gnl|my_center|LOCUS_42660 113693 112899 gene locus_tag LOCUS_42670 113693 112899 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403419.1 protein_id gnl|my_center|LOCUS_42670 113871 114050 gene locus_tag LOCUS_42680 113871 114050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 114454 114116 gene locus_tag LOCUS_42690 114454 114116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975026.1 protein_id gnl|my_center|LOCUS_42690 114625 114915 gene locus_tag LOCUS_42700 gene rpsF 114625 114915 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975025.1 protein_id gnl|my_center|LOCUS_42700 115009 115569 gene locus_tag LOCUS_42710 115009 115569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 115662 115898 gene locus_tag LOCUS_42720 gene rpsR 115662 115898 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_42720 115916 116362 gene locus_tag LOCUS_42730 gene rplI 115916 116362 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_42730 116692 116471 gene locus_tag LOCUS_42740 116692 116471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 116574 117413 gene locus_tag LOCUS_42750 116574 117413 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_42750 117410 118384 gene locus_tag LOCUS_42760 117410 118384 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053659.1 protein_id gnl|my_center|LOCUS_42760 118381 119124 gene locus_tag LOCUS_42770 118381 119124 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 protein_id gnl|my_center|LOCUS_42770 120443 119136 gene locus_tag LOCUS_42780 120443 119136 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_42780 120762 122129 gene locus_tag LOCUS_42790 gene dnaB 120762 122129 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_42790 122305 123249 gene locus_tag LOCUS_42800 122305 123249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 123982 123251 gene locus_tag LOCUS_42810 123982 123251 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224031.1 protein_id gnl|my_center|LOCUS_42810 124485 124018 gene locus_tag LOCUS_42820 124485 124018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 125350 124559 gene locus_tag LOCUS_42830 125350 124559 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226808.1 protein_id gnl|my_center|LOCUS_42830 126560 125796 gene locus_tag LOCUS_42840 126560 125796 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973545.1 protein_id gnl|my_center|LOCUS_42840 127420 126572 gene locus_tag LOCUS_42850 127420 126572 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_42850 127593 129074 gene locus_tag LOCUS_42860 127593 129074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 129065 129712 gene locus_tag LOCUS_42870 129065 129712 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221997.1 protein_id gnl|my_center|LOCUS_42870 129825 130916 gene locus_tag LOCUS_42880 gene dnaN 129825 130916 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_42880 131644 130955 gene locus_tag LOCUS_42890 131644 130955 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977010.1 protein_id gnl|my_center|LOCUS_42890 133012 131744 gene locus_tag LOCUS_42900 133012 131744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 133724 133206 gene locus_tag LOCUS_42910 133724 133206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 133906 133730 gene locus_tag LOCUS_42920 133906 133730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 134203 133985 gene locus_tag LOCUS_42930 134203 133985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 134955 134317 gene locus_tag LOCUS_42940 gene upp 134955 134317 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_42940 135097 135585 gene locus_tag LOCUS_42950 135097 135585 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112944.1 protein_id gnl|my_center|LOCUS_42950 135601 136083 gene locus_tag LOCUS_42960 135601 136083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 136080 136550 gene locus_tag LOCUS_42970 gene tadA 136080 136550 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_42970 136642 136731 gene locus_tag LOCUS_t00360 136642 136731 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 137035 138210 gene locus_tag LOCUS_42980 137035 138210 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028385.1 protein_id gnl|my_center|LOCUS_42980 139078 138278 gene locus_tag LOCUS_42990 139078 138278 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_42990 139278 140303 gene locus_tag LOCUS_43000 139278 140303 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896752.1 protein_id gnl|my_center|LOCUS_43000 140830 140534 gene locus_tag LOCUS_43010 140830 140534 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412258.1 protein_id gnl|my_center|LOCUS_43010 141846 140893 gene locus_tag LOCUS_43020 141846 140893 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899384.1 protein_id gnl|my_center|LOCUS_43020 141999 143585 gene locus_tag LOCUS_43030 141999 143585 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_43030 143634 144257 gene locus_tag LOCUS_43040 143634 144257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 145552 144353 gene locus_tag LOCUS_43050 145552 144353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 146117 145560 gene locus_tag LOCUS_43060 146117 145560 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_43060 147468 146212 gene locus_tag LOCUS_43070 147468 146212 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275304.1 protein_id gnl|my_center|LOCUS_43070 147642 148715 gene locus_tag LOCUS_43080 147642 148715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 149641 148865 gene locus_tag LOCUS_43090 149641 148865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_43090 150576 149638 gene locus_tag LOCUS_43100 150576 149638 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_43100 151606 150635 gene locus_tag LOCUS_43110 151606 150635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224110.1 protein_id gnl|my_center|LOCUS_43110 151810 152508 gene locus_tag LOCUS_43120 151810 152508 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974575.1 protein_id gnl|my_center|LOCUS_43120 152802 152716 gene locus_tag LOCUS_t00370 152802 152716 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 153039 155441 gene locus_tag LOCUS_43130 153039 155441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 156857 155448 gene locus_tag LOCUS_43140 156857 155448 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878214.1 protein_id gnl|my_center|LOCUS_43140 157264 157725 gene locus_tag LOCUS_43150 157264 157725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 157731 158330 gene locus_tag LOCUS_43160 gene recR 157731 158330 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_43160 158323 158853 gene locus_tag LOCUS_43170 158323 158853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 158941 160215 gene locus_tag LOCUS_43180 158941 160215 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_43180 160212 161282 gene locus_tag LOCUS_43190 160212 161282 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_43190 162499 161726 gene locus_tag LOCUS_43200 162499 161726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 162666 163313 gene locus_tag LOCUS_43210 162666 163313 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224587.1 protein_id gnl|my_center|LOCUS_43210 163377 164336 gene locus_tag LOCUS_43220 163377 164336 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_43220 164380 165378 gene locus_tag LOCUS_43230 164380 165378 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894906.1 protein_id gnl|my_center|LOCUS_43230 165454 165843 gene locus_tag LOCUS_43240 165454 165843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 165988 166713 gene locus_tag LOCUS_43250 165988 166713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 166785 168308 gene locus_tag LOCUS_43260 166785 168308 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742127.1 protein_id gnl|my_center|LOCUS_43260 168385 169350 gene locus_tag LOCUS_43270 168385 169350 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284829.1 protein_id gnl|my_center|LOCUS_43270 169347 170225 gene locus_tag LOCUS_43280 169347 170225 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086015.1 protein_id gnl|my_center|LOCUS_43280 170222 171046 gene locus_tag LOCUS_43290 170222 171046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222021.1 protein_id gnl|my_center|LOCUS_43290 171043 171837 gene locus_tag LOCUS_43300 171043 171837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 173033 171834 gene locus_tag LOCUS_43310 173033 171834 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_43310 173501 173139 gene locus_tag LOCUS_43320 173501 173139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 174331 173543 gene locus_tag LOCUS_43330 174331 173543 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_43330 174902 174429 gene locus_tag LOCUS_43340 174902 174429 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193539.1 protein_id gnl|my_center|LOCUS_43340 175116 175706 gene locus_tag LOCUS_43350 175116 175706 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390522.1 protein_id gnl|my_center|LOCUS_43350 175735 176745 gene locus_tag LOCUS_43360 gene serA 175735 176745 CDS product D-3-phosphoglycerate dehydrogenase SerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403698.1 protein_id gnl|my_center|LOCUS_43360 176769 178247 gene locus_tag LOCUS_43370 176769 178247 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 protein_id gnl|my_center|LOCUS_43370 181514 178521 gene locus_tag LOCUS_43380 gene afsR 181514 178521 CDS product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 protein_id gnl|my_center|LOCUS_43380 182420 181764 gene locus_tag LOCUS_43390 182420 181764 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028564.1 protein_id gnl|my_center|LOCUS_43390 183897 182623 gene locus_tag LOCUS_43400 183897 182623 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485736.1 protein_id gnl|my_center|LOCUS_43400 183992 184978 gene locus_tag LOCUS_43410 183992 184978 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977970.1 protein_id gnl|my_center|LOCUS_43410 185076 185834 gene locus_tag LOCUS_43420 gene fabG 185076 185834 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_43420 185983 185810 gene locus_tag LOCUS_43430 185983 185810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 185936 186841 gene locus_tag LOCUS_43440 185936 186841 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030217.1 protein_id gnl|my_center|LOCUS_43440 187623 187237 gene locus_tag LOCUS_43450 187623 187237 CDS product SCO5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973607.1 protein_id gnl|my_center|LOCUS_43450 188679 187747 gene locus_tag LOCUS_43460 188679 187747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326561.1 protein_id gnl|my_center|LOCUS_43460 190250 188772 gene locus_tag LOCUS_43470 190250 188772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 190694 190302 gene locus_tag LOCUS_43480 190694 190302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 191675 190710 gene locus_tag LOCUS_43490 191675 190710 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060315.1 protein_id gnl|my_center|LOCUS_43490 192460 191678 gene locus_tag LOCUS_43500 gene cysW 192460 191678 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056131.1 protein_id gnl|my_center|LOCUS_43500 193313 192453 gene locus_tag LOCUS_43510 gene cysT 193313 192453 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926820.1 protein_id gnl|my_center|LOCUS_43510 194334 193321 gene locus_tag LOCUS_43520 194334 193321 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087645.1 protein_id gnl|my_center|LOCUS_43520 195812 194463 gene locus_tag LOCUS_43530 195812 194463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 196035 197039 gene locus_tag LOCUS_43540 196035 197039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 198576 197170 gene locus_tag LOCUS_43550 198576 197170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 198991 198608 gene locus_tag LOCUS_43560 198991 198608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 199278 200387 gene locus_tag LOCUS_43570 gene manA 199278 200387 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_43570 200561 201616 gene locus_tag LOCUS_43580 200561 201616 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225108.1 protein_id gnl|my_center|LOCUS_43580 202288 201680 gene locus_tag LOCUS_43590 202288 201680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226912.1 protein_id gnl|my_center|LOCUS_43590 202548 203357 gene locus_tag LOCUS_43600 202548 203357 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_43600 203422 204045 gene locus_tag LOCUS_43610 203422 204045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 204169 204903 gene locus_tag LOCUS_43620 204169 204903 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974977.1 protein_id gnl|my_center|LOCUS_43620 205211 207793 gene locus_tag LOCUS_43630 205211 207793 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_43630 208494 208042 gene locus_tag LOCUS_43640 208494 208042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 209658 208945 gene locus_tag LOCUS_43650 209658 208945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 210733 209714 gene locus_tag LOCUS_43660 210733 209714 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027413.1 protein_id gnl|my_center|LOCUS_43660 210926 212350 gene locus_tag LOCUS_43670 210926 212350 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 protein_id gnl|my_center|LOCUS_43670 213007 212378 gene locus_tag LOCUS_43680 213007 212378 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224090.1 protein_id gnl|my_center|LOCUS_43680 >Feature sequence19 360 746 gene locus_tag LOCUS_43690 360 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 2484 1036 gene locus_tag LOCUS_43700 2484 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 4213 2495 gene locus_tag LOCUS_43710 gene argS 4213 2495 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804295.1 protein_id gnl|my_center|LOCUS_43710 5241 4255 gene locus_tag LOCUS_43720 gene plsX 5241 4255 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173767.1 protein_id gnl|my_center|LOCUS_43720 5137 5343 gene locus_tag LOCUS_43730 5137 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 5905 5348 gene locus_tag LOCUS_43740 5905 5348 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030020.1 protein_id gnl|my_center|LOCUS_43740 6096 7424 gene locus_tag LOCUS_43750 6096 7424 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_43750 7721 8686 gene locus_tag LOCUS_43760 7721 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 8924 8763 gene locus_tag LOCUS_43770 8924 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 9524 8988 gene locus_tag LOCUS_43780 9524 8988 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977028.1 protein_id gnl|my_center|LOCUS_43780 10338 9547 gene locus_tag LOCUS_43790 10338 9547 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_43790 11236 10331 gene locus_tag LOCUS_43800 11236 10331 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975816.1 protein_id gnl|my_center|LOCUS_43800 11674 13359 gene locus_tag LOCUS_43810 11674 13359 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949626.1 protein_id gnl|my_center|LOCUS_43810 13494 14420 gene locus_tag LOCUS_43820 13494 14420 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229923.1 protein_id gnl|my_center|LOCUS_43820 14413 15360 gene locus_tag LOCUS_43830 14413 15360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229922.1 protein_id gnl|my_center|LOCUS_43830 15374 16402 gene locus_tag LOCUS_43840 15374 16402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_43840 16389 17405 gene locus_tag LOCUS_43850 16389 17405 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_43850 18258 17443 gene locus_tag LOCUS_43860 18258 17443 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_43860 18261 18635 gene locus_tag LOCUS_43870 18261 18635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 18632 19435 gene locus_tag LOCUS_43880 gene otsB 18632 19435 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_43880 20647 19466 gene locus_tag LOCUS_43890 20647 19466 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029671.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43890 22134 20704 gene locus_tag LOCUS_43900 22134 20704 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_43900 22204 22755 gene locus_tag LOCUS_43910 22204 22755 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_43910 23014 24264 gene locus_tag LOCUS_43920 gene thrC 23014 24264 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 protein_id gnl|my_center|LOCUS_43920 24309 24584 gene locus_tag LOCUS_43930 24309 24584 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_43930 24838 25038 gene locus_tag LOCUS_43940 24838 25038 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_43940 25308 26933 gene locus_tag LOCUS_43950 gene groL 25308 26933 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_43950 27867 27076 gene locus_tag LOCUS_43960 27867 27076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 29942 27963 gene locus_tag LOCUS_43970 29942 27963 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_43970 30069 30359 gene locus_tag LOCUS_43980 30069 30359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 32192 30537 gene locus_tag LOCUS_43990 32192 30537 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_43990 34622 32244 gene locus_tag LOCUS_44000 34622 32244 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_44000 34686 35594 gene locus_tag LOCUS_44010 34686 35594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 35718 36116 gene locus_tag LOCUS_44020 35718 36116 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_44020 37466 36147 gene locus_tag LOCUS_44030 37466 36147 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 protein_id gnl|my_center|LOCUS_44030 37658 38374 gene locus_tag LOCUS_44040 37658 38374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 38376 41324 gene locus_tag LOCUS_44050 38376 41324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029583.1 protein_id gnl|my_center|LOCUS_44050 41571 41359 gene locus_tag LOCUS_44060 41571 41359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 41748 43145 gene locus_tag LOCUS_44070 41748 43145 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230209.1 protein_id gnl|my_center|LOCUS_44070 43724 43254 gene locus_tag LOCUS_44080 43724 43254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 44326 43754 gene locus_tag LOCUS_44090 44326 43754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 44529 44972 gene locus_tag LOCUS_44100 44529 44972 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230207.1 protein_id gnl|my_center|LOCUS_44100 44978 46228 gene locus_tag LOCUS_44110 44978 46228 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_44110 46200 46748 gene locus_tag LOCUS_44120 gene thpR 46200 46748 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029587.1 protein_id gnl|my_center|LOCUS_44120 47853 46864 gene locus_tag LOCUS_44130 47853 46864 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974629.1 protein_id gnl|my_center|LOCUS_44130 47891 48967 gene locus_tag LOCUS_44140 47891 48967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 49406 49017 gene locus_tag LOCUS_44150 49406 49017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 49525 50715 gene locus_tag LOCUS_44160 gene lhgO 49525 50715 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727635.1 protein_id gnl|my_center|LOCUS_44160 50729 51439 gene locus_tag LOCUS_44170 50729 51439 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_44170 51487 52965 gene locus_tag LOCUS_44180 gene phoR 51487 52965 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403870.1 protein_id gnl|my_center|LOCUS_44180 54775 53006 gene locus_tag LOCUS_44190 54775 53006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 54908 56086 gene locus_tag LOCUS_44200 54908 56086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 56083 56823 gene locus_tag LOCUS_44210 56083 56823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222425.1 protein_id gnl|my_center|LOCUS_44210 56820 58106 gene locus_tag LOCUS_44220 56820 58106 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222426.1 protein_id gnl|my_center|LOCUS_44220 58123 58701 gene locus_tag LOCUS_44230 58123 58701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 58698 59387 gene locus_tag LOCUS_44240 58698 59387 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064128.1 protein_id gnl|my_center|LOCUS_44240 59413 60822 gene locus_tag LOCUS_44250 59413 60822 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085588.1 protein_id gnl|my_center|LOCUS_44250 60832 61377 gene locus_tag LOCUS_44260 60832 61377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 61496 63211 gene locus_tag LOCUS_44270 61496 63211 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 protein_id gnl|my_center|LOCUS_44270 63208 64782 gene locus_tag LOCUS_44280 63208 64782 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_44280 65852 64743 gene locus_tag LOCUS_44290 65852 64743 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866892.1 protein_id gnl|my_center|LOCUS_44290 66286 65855 gene locus_tag LOCUS_44300 66286 65855 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971919.1 protein_id gnl|my_center|LOCUS_44300 66800 66465 gene locus_tag LOCUS_44310 66800 66465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 67937 66837 gene locus_tag LOCUS_44320 gene fahA 67937 66837 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113316.1 protein_id gnl|my_center|LOCUS_44320 69106 67934 gene locus_tag LOCUS_44330 69106 67934 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222108.1 protein_id gnl|my_center|LOCUS_44330 69859 69194 gene locus_tag LOCUS_44340 69859 69194 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 protein_id gnl|my_center|LOCUS_44340 69949 71328 gene locus_tag LOCUS_44350 69949 71328 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868417.1 protein_id gnl|my_center|LOCUS_44350 71330 72463 gene locus_tag LOCUS_44360 71330 72463 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532194.1 protein_id gnl|my_center|LOCUS_44360 72626 72417 gene locus_tag LOCUS_44370 72626 72417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 72702 73397 gene locus_tag LOCUS_44380 72702 73397 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_44380 74400 73420 gene locus_tag LOCUS_44390 74400 73420 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728687.1 protein_id gnl|my_center|LOCUS_44390 74329 74601 gene locus_tag LOCUS_44400 74329 74601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 74853 74632 gene locus_tag LOCUS_44410 74853 74632 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978728.1 protein_id gnl|my_center|LOCUS_44410 75344 74853 gene locus_tag LOCUS_44420 75344 74853 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026883.1 protein_id gnl|my_center|LOCUS_44420 75972 75412 gene locus_tag LOCUS_44430 75972 75412 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222749.1 protein_id gnl|my_center|LOCUS_44430 76786 75965 gene locus_tag LOCUS_44440 76786 75965 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_44440 76907 78802 gene locus_tag LOCUS_44450 76907 78802 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_44450 78896 79480 gene locus_tag LOCUS_44460 78896 79480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 80208 79594 gene locus_tag LOCUS_44470 80208 79594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 80698 80432 gene locus_tag LOCUS_44480 80698 80432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 80592 81710 gene locus_tag LOCUS_44490 80592 81710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 83641 81707 gene locus_tag LOCUS_44500 83641 81707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 84084 83638 gene locus_tag LOCUS_44510 84084 83638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 85100 84747 gene locus_tag LOCUS_44520 85100 84747 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419762.1 protein_id gnl|my_center|LOCUS_44520 85525 86937 gene locus_tag LOCUS_44530 85525 86937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 88714 86912 gene locus_tag LOCUS_44540 88714 86912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 88897 89571 gene locus_tag LOCUS_44550 88897 89571 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727332.1 protein_id gnl|my_center|LOCUS_44550 90022 89549 gene locus_tag LOCUS_44560 90022 89549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 90744 90283 gene locus_tag LOCUS_44570 90744 90283 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027181.1 protein_id gnl|my_center|LOCUS_44570 90856 91788 gene locus_tag LOCUS_44580 90856 91788 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223696.1 protein_id gnl|my_center|LOCUS_44580 91846 92238 gene locus_tag LOCUS_44590 91846 92238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 92549 92235 gene locus_tag LOCUS_44600 92549 92235 CDS product DUF6510 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729807.1 protein_id gnl|my_center|LOCUS_44600 93282 92551 gene locus_tag LOCUS_44610 93282 92551 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223384.1 protein_id gnl|my_center|LOCUS_44610 93878 93279 gene locus_tag LOCUS_44620 93878 93279 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223383.1 protein_id gnl|my_center|LOCUS_44620 95757 93970 gene locus_tag LOCUS_44630 95757 93970 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028097.1 protein_id gnl|my_center|LOCUS_44630 96708 95782 gene locus_tag LOCUS_44640 96708 95782 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727008.1 protein_id gnl|my_center|LOCUS_44640 97596 96730 gene locus_tag LOCUS_44650 97596 96730 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727008.1 protein_id gnl|my_center|LOCUS_44650 97755 98750 gene locus_tag LOCUS_44660 97755 98750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 101130 98854 gene locus_tag LOCUS_44670 101130 98854 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742222.1 protein_id gnl|my_center|LOCUS_44670 102270 101455 gene locus_tag LOCUS_44680 102270 101455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 103031 102267 gene locus_tag LOCUS_44690 103031 102267 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525151.1 protein_id gnl|my_center|LOCUS_44690 103579 103034 gene locus_tag LOCUS_44700 gene ripB 103579 103034 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 protein_id gnl|my_center|LOCUS_44700 104121 107243 gene locus_tag LOCUS_44710 104121 107243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 107993 107649 gene locus_tag LOCUS_44720 gene bldG 107993 107649 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_44720 108315 108704 gene locus_tag LOCUS_44730 108315 108704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 108829 111147 gene locus_tag LOCUS_44740 108829 111147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 111307 111492 gene locus_tag LOCUS_44750 111307 111492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 111584 113935 gene locus_tag LOCUS_44760 111584 113935 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256027.1 protein_id gnl|my_center|LOCUS_44760 113937 114539 gene locus_tag LOCUS_44770 gene cobO 113937 114539 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976969.1 protein_id gnl|my_center|LOCUS_44770 118327 114569 gene locus_tag LOCUS_44780 gene cobN 118327 114569 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410648.1 protein_id gnl|my_center|LOCUS_44780 118263 118646 gene locus_tag LOCUS_44790 118263 118646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 118667 120112 gene locus_tag LOCUS_44800 gene cobG 118667 120112 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900454.1 protein_id gnl|my_center|LOCUS_44800 120109 120729 gene locus_tag LOCUS_44810 120109 120729 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_44810 120735 122234 gene locus_tag LOCUS_44820 120735 122234 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228824.1 protein_id gnl|my_center|LOCUS_44820 122980 122222 gene locus_tag LOCUS_44830 122980 122222 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975552.1 protein_id gnl|my_center|LOCUS_44830 123022 124104 gene locus_tag LOCUS_44840 123022 124104 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390744.1 protein_id gnl|my_center|LOCUS_44840 124856 124113 gene locus_tag LOCUS_44850 gene cobM 124856 124113 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075099.1 protein_id gnl|my_center|LOCUS_44850 126094 124853 gene locus_tag LOCUS_44860 gene cbiE 126094 124853 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114023.1 protein_id gnl|my_center|LOCUS_44860 126486 126091 gene locus_tag LOCUS_44870 126486 126091 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284874.1 protein_id gnl|my_center|LOCUS_44870 127220 126543 gene locus_tag LOCUS_44880 127220 126543 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_44880 129181 127217 gene locus_tag LOCUS_44890 129181 127217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 129341 130072 gene locus_tag LOCUS_44900 129341 130072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 130942 130139 gene locus_tag LOCUS_44910 130942 130139 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_44910 131065 131718 gene locus_tag LOCUS_44920 131065 131718 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466502.1 protein_id gnl|my_center|LOCUS_44920 131908 133152 gene locus_tag LOCUS_44930 131908 133152 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228864.1 protein_id gnl|my_center|LOCUS_44930 133246 133680 gene locus_tag LOCUS_44940 133246 133680 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225249.1 protein_id gnl|my_center|LOCUS_44940 134025 133789 gene locus_tag LOCUS_44950 134025 133789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 133981 134895 gene locus_tag LOCUS_44960 133981 134895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 135246 135806 gene locus_tag LOCUS_44970 135246 135806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 135822 137897 gene locus_tag LOCUS_44980 135822 137897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975548.1 protein_id gnl|my_center|LOCUS_44980 137920 142938 gene locus_tag LOCUS_44990 137920 142938 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_44990 143037 145838 gene locus_tag LOCUS_45000 143037 145838 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 protein_id gnl|my_center|LOCUS_45000 145943 146482 gene locus_tag LOCUS_45010 145943 146482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 147698 146589 gene locus_tag LOCUS_45020 147698 146589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 147862 148635 gene locus_tag LOCUS_45030 147862 148635 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 protein_id gnl|my_center|LOCUS_45030 149321 149025 gene locus_tag LOCUS_45040 149321 149025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 149206 151950 gene locus_tag LOCUS_45050 149206 151950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 152124 153179 gene locus_tag LOCUS_45060 152124 153179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 154175 153270 gene locus_tag LOCUS_45070 154175 153270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 154467 155015 gene locus_tag LOCUS_45080 154467 155015 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973087.1 protein_id gnl|my_center|LOCUS_45080 155015 156193 gene locus_tag LOCUS_45090 155015 156193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 157040 156540 gene locus_tag LOCUS_45100 157040 156540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 157131 157931 gene locus_tag LOCUS_45110 157131 157931 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015201.1 protein_id gnl|my_center|LOCUS_45110 159181 157970 gene locus_tag LOCUS_45120 159181 157970 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212011225.1 protein_id gnl|my_center|LOCUS_45120 159251 160222 gene locus_tag LOCUS_45130 159251 160222 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 protein_id gnl|my_center|LOCUS_45130 160371 160237 gene locus_tag LOCUS_45140 160371 160237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 160884 160408 gene locus_tag LOCUS_45150 160884 160408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 161387 160881 gene locus_tag LOCUS_45160 161387 160881 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141436.1 protein_id gnl|my_center|LOCUS_45160 161743 161387 gene locus_tag LOCUS_45170 161743 161387 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068923899.1 protein_id gnl|my_center|LOCUS_45170 163053 161929 gene locus_tag LOCUS_45180 163053 161929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 163574 163050 gene locus_tag LOCUS_45190 163574 163050 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_45190 167090 163767 gene locus_tag LOCUS_45200 167090 163767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 168387 167236 gene locus_tag LOCUS_45210 168387 167236 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921962.1 protein_id gnl|my_center|LOCUS_45210 169413 168961 gene locus_tag LOCUS_45220 169413 168961 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 protein_id gnl|my_center|LOCUS_45220 170567 169467 gene locus_tag LOCUS_45230 170567 169467 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040498402.1 protein_id gnl|my_center|LOCUS_45230 171528 170779 gene locus_tag LOCUS_45240 171528 170779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 172412 171525 gene locus_tag LOCUS_45250 172412 171525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 174270 172402 gene locus_tag LOCUS_45260 174270 172402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157355235.1 protein_id gnl|my_center|LOCUS_45260 175253 174267 gene locus_tag LOCUS_45270 175253 174267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 177811 175250 gene locus_tag LOCUS_45280 177811 175250 CDS product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133431295.1 protein_id gnl|my_center|LOCUS_45280 179273 177972 gene locus_tag LOCUS_45290 179273 177972 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975990.1 protein_id gnl|my_center|LOCUS_45290 180730 179270 gene locus_tag LOCUS_45300 180730 179270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484926.1 protein_id gnl|my_center|LOCUS_45300 181818 180727 gene locus_tag LOCUS_45310 181818 180727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485125.1 protein_id gnl|my_center|LOCUS_45310 182582 181815 gene locus_tag LOCUS_45320 182582 181815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090931279.1 protein_id gnl|my_center|LOCUS_45320 182692 183150 gene locus_tag LOCUS_45330 182692 183150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 183782 183273 gene locus_tag LOCUS_45340 183782 183273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 185183 184023 gene locus_tag LOCUS_45350 185183 184023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 185185 186084 gene locus_tag LOCUS_45360 185185 186084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179964304.1 protein_id gnl|my_center|LOCUS_45360 186579 186190 gene locus_tag LOCUS_45370 186579 186190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 186950 186720 gene locus_tag LOCUS_45380 186950 186720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 189750 186955 gene locus_tag LOCUS_45390 gene fdhF 189750 186955 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726709.1 protein_id gnl|my_center|LOCUS_45390 191309 189747 gene locus_tag LOCUS_45400 191309 189747 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726708.1 protein_id gnl|my_center|LOCUS_45400 191779 191306 gene locus_tag LOCUS_45410 191779 191306 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726707.1 protein_id gnl|my_center|LOCUS_45410 192790 191972 gene locus_tag LOCUS_45420 192790 191972 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227632.1 protein_id gnl|my_center|LOCUS_45420 194133 192811 gene locus_tag LOCUS_45430 194133 192811 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222086.1 protein_id gnl|my_center|LOCUS_45430 195031 194258 gene locus_tag LOCUS_45440 195031 194258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 195106 195972 gene locus_tag LOCUS_45450 195106 195972 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037344.1 protein_id gnl|my_center|LOCUS_45450 195985 197349 gene locus_tag LOCUS_45460 195985 197349 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 protein_id gnl|my_center|LOCUS_45460 197442 197933 gene locus_tag LOCUS_45470 197442 197933 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226534.1 protein_id gnl|my_center|LOCUS_45470 198115 198663 gene locus_tag LOCUS_45480 198115 198663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 198660 199583 gene locus_tag LOCUS_45490 198660 199583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 200132 199686 gene locus_tag LOCUS_45500 200132 199686 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222796.1 protein_id gnl|my_center|LOCUS_45500 201384 200371 gene locus_tag LOCUS_45510 201384 200371 CDS product CU044_5270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224334.1 protein_id gnl|my_center|LOCUS_45510 201506 202612 gene locus_tag LOCUS_45520 201506 202612 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109278575.1 protein_id gnl|my_center|LOCUS_45520 203375 202728 gene locus_tag LOCUS_45530 203375 202728 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_45530 204086 203454 gene locus_tag LOCUS_45540 204086 203454 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_45540 205332 204079 gene locus_tag LOCUS_45550 205332 204079 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870027.1 protein_id gnl|my_center|LOCUS_45550 206099 205359 gene locus_tag LOCUS_45560 206099 205359 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973545.1 protein_id gnl|my_center|LOCUS_45560 207060 206101 gene locus_tag LOCUS_45570 207060 206101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_45570 207284 210097 gene locus_tag LOCUS_45580 207284 210097 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 protein_id gnl|my_center|LOCUS_45580 212583 210367 gene locus_tag LOCUS_45590 212583 210367 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316462.1 protein_id gnl|my_center|LOCUS_45590 >Feature sequence20 575 1336 gene locus_tag LOCUS_45600 575 1336 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_45600 1528 1337 gene locus_tag LOCUS_45610 1528 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 1725 2162 gene locus_tag LOCUS_45620 1725 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 3041 2655 gene locus_tag LOCUS_45630 3041 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 3221 3096 gene locus_tag LOCUS_45640 3221 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 3324 3575 gene locus_tag LOCUS_45650 3324 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 4048 3581 gene locus_tag LOCUS_45660 4048 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 4896 4108 gene locus_tag LOCUS_45670 4896 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 5210 4893 gene locus_tag LOCUS_45680 5210 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 5620 5210 gene locus_tag LOCUS_45690 5620 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 6486 6208 gene locus_tag LOCUS_45700 6486 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 6371 6637 gene locus_tag LOCUS_45710 6371 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 6908 6729 gene locus_tag LOCUS_45720 6908 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 7515 6901 gene locus_tag LOCUS_45730 7515 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 7775 7512 gene locus_tag LOCUS_45740 7775 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 8822 7809 gene locus_tag LOCUS_45750 8822 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 9711 9511 gene locus_tag LOCUS_45760 9711 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 9801 10277 gene locus_tag LOCUS_45770 9801 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 10936 11865 gene locus_tag LOCUS_45780 10936 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 12065 11907 gene locus_tag LOCUS_45790 12065 11907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 <12977 12267 gene locus_tag LOCUS_45800 <12977 12267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940703.1:Tol-Pal system beta propeller repeat protein TolB >Feature sequence21 1801 764 gene locus_tag LOCUS_45810 1801 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 2717 2643 gene locus_tag LOCUS_t00380 2717 2643 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3164 3580 gene locus_tag LOCUS_45820 3164 3580 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004002642.1 protein_id gnl|my_center|LOCUS_45820 4445 3618 gene locus_tag LOCUS_45830 4445 3618 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 protein_id gnl|my_center|LOCUS_45830 4492 5745 gene locus_tag LOCUS_45840 4492 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_45840 6678 5836 gene locus_tag LOCUS_45850 6678 5836 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_45850 7688 6681 gene locus_tag LOCUS_45860 7688 6681 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 protein_id gnl|my_center|LOCUS_45860 8648 7716 gene locus_tag LOCUS_45870 8648 7716 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_45870 8732 9970 gene locus_tag LOCUS_45880 8732 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 10053 10313 gene locus_tag LOCUS_45890 10053 10313 CDS product hexameric tyrosine-coordinated heme protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963152.1 protein_id gnl|my_center|LOCUS_45890 11885 10338 gene locus_tag LOCUS_45900 gene hutH 11885 10338 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 protein_id gnl|my_center|LOCUS_45900 12675 11851 gene locus_tag LOCUS_45910 12675 11851 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461343.1 protein_id gnl|my_center|LOCUS_45910 12808 12880 gene locus_tag LOCUS_t00390 12808 12880 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12894 12965 gene locus_tag LOCUS_t00400 12894 12965 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 12975 13049 gene locus_tag LOCUS_t00410 12975 13049 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13241 14977 gene locus_tag LOCUS_45920 13241 14977 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085823.1 protein_id gnl|my_center|LOCUS_45920 15072 15815 gene locus_tag LOCUS_45930 15072 15815 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_45930 15827 16114 gene locus_tag LOCUS_45940 15827 16114 CDS product DUF6295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226838.1 protein_id gnl|my_center|LOCUS_45940 16458 16225 gene locus_tag LOCUS_45950 16458 16225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 17894 16644 gene locus_tag LOCUS_45960 17894 16644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 18907 18005 gene locus_tag LOCUS_45970 18907 18005 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222522.1 protein_id gnl|my_center|LOCUS_45970 19725 18922 gene locus_tag LOCUS_45980 19725 18922 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_45980 20552 19791 gene locus_tag LOCUS_45990 20552 19791 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977059.1 protein_id gnl|my_center|LOCUS_45990 21241 20549 gene locus_tag LOCUS_46000 21241 20549 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027961.1 protein_id gnl|my_center|LOCUS_46000 21341 21688 gene locus_tag LOCUS_46010 gene yodB 21341 21688 CDS product transcriptional regulator YodB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399427.1 protein_id gnl|my_center|LOCUS_46010 21681 23201 gene locus_tag LOCUS_46020 21681 23201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 23224 24255 gene locus_tag LOCUS_46030 gene add 23224 24255 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224867.1 protein_id gnl|my_center|LOCUS_46030 24397 25689 gene locus_tag LOCUS_46040 24397 25689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 27621 25732 gene locus_tag LOCUS_46050 27621 25732 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484240.1 protein_id gnl|my_center|LOCUS_46050 27801 28379 gene locus_tag LOCUS_46060 27801 28379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 28789 28544 gene locus_tag LOCUS_46070 28789 28544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 30269 28791 gene locus_tag LOCUS_46080 30269 28791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 30577 30266 gene locus_tag LOCUS_46090 30577 30266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 30730 31704 gene locus_tag LOCUS_46100 30730 31704 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836183.1 protein_id gnl|my_center|LOCUS_46100 32612 31716 gene locus_tag LOCUS_46110 32612 31716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 32818 34239 gene locus_tag LOCUS_46120 gene gndA 32818 34239 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222331.1 protein_id gnl|my_center|LOCUS_46120 35903 34362 gene locus_tag LOCUS_46130 35903 34362 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028938.1 protein_id gnl|my_center|LOCUS_46130 36054 36614 gene locus_tag LOCUS_46140 36054 36614 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975467.1 protein_id gnl|my_center|LOCUS_46140 36632 37042 gene locus_tag LOCUS_46150 36632 37042 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 protein_id gnl|my_center|LOCUS_46150 38284 37121 gene locus_tag LOCUS_46160 38284 37121 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031803.1 protein_id gnl|my_center|LOCUS_46160 38409 40910 gene locus_tag LOCUS_46170 38409 40910 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_46170 41903 40938 gene locus_tag LOCUS_46180 41903 40938 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224055.1 protein_id gnl|my_center|LOCUS_46180 43924 41900 gene locus_tag LOCUS_46190 43924 41900 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892409.1 protein_id gnl|my_center|LOCUS_46190 45144 44032 gene locus_tag LOCUS_46200 gene dusB 45144 44032 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028387.1 protein_id gnl|my_center|LOCUS_46200 45248 45910 gene locus_tag LOCUS_46210 45248 45910 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284416.1 protein_id gnl|my_center|LOCUS_46210 45966 46039 gene locus_tag LOCUS_t00420 45966 46039 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 46074 46145 gene locus_tag LOCUS_t00430 46074 46145 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 46174 46248 gene locus_tag LOCUS_t00440 46174 46248 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 46390 46596 gene locus_tag LOCUS_46220 46390 46596 CDS product DUF5302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228723.1 protein_id gnl|my_center|LOCUS_46220 46720 47412 gene locus_tag LOCUS_46230 46720 47412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 48132 47422 gene locus_tag LOCUS_46240 gene pgeF 48132 47422 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173521163.1 protein_id gnl|my_center|LOCUS_46240 48261 49304 gene locus_tag LOCUS_46250 48261 49304 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974786.1 protein_id gnl|my_center|LOCUS_46250 50472 49276 gene locus_tag LOCUS_46260 gene glgA 50472 49276 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805185.1 protein_id gnl|my_center|LOCUS_46260 50571 51797 gene locus_tag LOCUS_46270 gene glgC 50571 51797 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805186.1 protein_id gnl|my_center|LOCUS_46270 52415 51825 gene locus_tag LOCUS_46280 52415 51825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972086.1 protein_id gnl|my_center|LOCUS_46280 52855 53880 gene locus_tag LOCUS_46290 52855 53880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 53865 55502 gene locus_tag LOCUS_46300 53865 55502 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029665.1 protein_id gnl|my_center|LOCUS_46300 56561 55497 gene locus_tag LOCUS_46310 56561 55497 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226510.1 protein_id gnl|my_center|LOCUS_46310 57618 56659 gene locus_tag LOCUS_46320 57618 56659 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529611.1 protein_id gnl|my_center|LOCUS_46320 59614 57797 gene locus_tag LOCUS_46330 gene glmS 59614 57797 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976011.1 protein_id gnl|my_center|LOCUS_46330 59898 59623 gene locus_tag LOCUS_46340 59898 59623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976012.1 protein_id gnl|my_center|LOCUS_46340 60634 60071 gene locus_tag LOCUS_46350 60634 60071 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003499036.1 protein_id gnl|my_center|LOCUS_46350 61238 60714 gene locus_tag LOCUS_46360 61238 60714 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227140.1 protein_id gnl|my_center|LOCUS_46360 61388 61460 gene locus_tag LOCUS_t00450 61388 61460 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 61487 61561 gene locus_tag LOCUS_t00460 61487 61561 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 62131 61694 gene locus_tag LOCUS_46370 62131 61694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 63513 62245 gene locus_tag LOCUS_46380 63513 62245 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161162.1 protein_id gnl|my_center|LOCUS_46380 64069 63605 gene locus_tag LOCUS_46390 64069 63605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 66199 64073 gene locus_tag LOCUS_46400 66199 64073 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031619.1 protein_id gnl|my_center|LOCUS_46400 66636 69440 gene locus_tag LOCUS_46410 66636 69440 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184990288.1 protein_id gnl|my_center|LOCUS_46410 69527 70642 gene locus_tag LOCUS_46420 69527 70642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 70700 73036 gene locus_tag LOCUS_46430 70700 73036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 74190 73012 gene locus_tag LOCUS_46440 74190 73012 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876812.1 protein_id gnl|my_center|LOCUS_46440 75231 74221 gene locus_tag LOCUS_46450 75231 74221 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726798.1 protein_id gnl|my_center|LOCUS_46450 76231 75353 gene locus_tag LOCUS_46460 gene rbsK 76231 75353 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113483.1 protein_id gnl|my_center|LOCUS_46460 76566 77336 gene locus_tag LOCUS_46470 76566 77336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027585.1 protein_id gnl|my_center|LOCUS_46470 77769 77392 gene locus_tag LOCUS_46480 77769 77392 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222744.1 protein_id gnl|my_center|LOCUS_46480 79058 78150 gene locus_tag LOCUS_46490 79058 78150 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026854.1 protein_id gnl|my_center|LOCUS_46490 79166 80548 gene locus_tag LOCUS_46500 79166 80548 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230905.1 protein_id gnl|my_center|LOCUS_46500 81464 80535 gene locus_tag LOCUS_46510 81464 80535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 81611 82585 gene locus_tag LOCUS_46520 81611 82585 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267240.1 protein_id gnl|my_center|LOCUS_46520 82665 84353 gene locus_tag LOCUS_46530 gene polX 82665 84353 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_46530 84592 86142 gene locus_tag LOCUS_46540 84592 86142 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729712.1 protein_id gnl|my_center|LOCUS_46540 86752 86198 gene locus_tag LOCUS_46550 86752 86198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 88548 86938 gene locus_tag LOCUS_46560 88548 86938 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 protein_id gnl|my_center|LOCUS_46560 88871 88545 gene locus_tag LOCUS_46570 88871 88545 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976999.1 protein_id gnl|my_center|LOCUS_46570 90547 89075 gene locus_tag LOCUS_46580 90547 89075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 90915 90544 gene locus_tag LOCUS_46590 90915 90544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977612.1 protein_id gnl|my_center|LOCUS_46590 91681 90923 gene locus_tag LOCUS_46600 91681 90923 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_46600 92971 91790 gene locus_tag LOCUS_46610 92971 91790 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_46610 93876 92983 gene locus_tag LOCUS_46620 93876 92983 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167379699.1 protein_id gnl|my_center|LOCUS_46620 94378 93887 gene locus_tag LOCUS_46630 94378 93887 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_46630 95538 94378 gene locus_tag LOCUS_46640 95538 94378 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728068.1 protein_id gnl|my_center|LOCUS_46640 96032 95538 gene locus_tag LOCUS_46650 gene ripB 96032 95538 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212069.1 protein_id gnl|my_center|LOCUS_46650 96476 96063 gene locus_tag LOCUS_46660 96476 96063 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225267572.1 protein_id gnl|my_center|LOCUS_46660 98052 96697 gene locus_tag LOCUS_46670 98052 96697 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228517.1 protein_id gnl|my_center|LOCUS_46670 97942 98226 gene locus_tag LOCUS_46680 97942 98226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 98944 98204 gene locus_tag LOCUS_46690 98944 98204 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230642.1 protein_id gnl|my_center|LOCUS_46690 99223 100587 gene locus_tag LOCUS_46700 99223 100587 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_46700 100597 101127 gene locus_tag LOCUS_46710 100597 101127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 101148 101870 gene locus_tag LOCUS_46720 101148 101870 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027858.1 protein_id gnl|my_center|LOCUS_46720 103538 102078 gene locus_tag LOCUS_46730 103538 102078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 104426 104166 gene locus_tag LOCUS_46740 104426 104166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 104446 107436 gene locus_tag LOCUS_46750 104446 107436 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950658.1 protein_id gnl|my_center|LOCUS_46750 107436 108311 gene locus_tag LOCUS_46760 107436 108311 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899172.1 protein_id gnl|my_center|LOCUS_46760 109209 108274 gene locus_tag LOCUS_46770 109209 108274 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_46770 112061 109302 gene locus_tag LOCUS_46780 112061 109302 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_46780 112246 113610 gene locus_tag LOCUS_46790 112246 113610 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975885.1 protein_id gnl|my_center|LOCUS_46790 113641 114267 gene locus_tag LOCUS_46800 113641 114267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 114264 115859 gene locus_tag LOCUS_46810 114264 115859 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466887.1 protein_id gnl|my_center|LOCUS_46810 115873 118002 gene locus_tag LOCUS_46820 115873 118002 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 protein_id gnl|my_center|LOCUS_46820 118002 118769 gene locus_tag LOCUS_46830 118002 118769 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_46830 118766 120499 gene locus_tag LOCUS_46840 118766 120499 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110557.1 protein_id gnl|my_center|LOCUS_46840 120582 120788 gene locus_tag LOCUS_46850 120582 120788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 120866 121741 gene locus_tag LOCUS_46860 120866 121741 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 protein_id gnl|my_center|LOCUS_46860 121812 122069 gene locus_tag LOCUS_46870 121812 122069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 122489 122073 gene locus_tag LOCUS_46880 122489 122073 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391610.1 protein_id gnl|my_center|LOCUS_46880 124473 122554 gene locus_tag LOCUS_46890 124473 122554 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730234.1 protein_id gnl|my_center|LOCUS_46890 126249 124675 gene locus_tag LOCUS_46900 126249 124675 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223948.1 protein_id gnl|my_center|LOCUS_46900 126305 127210 gene locus_tag LOCUS_46910 126305 127210 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 protein_id gnl|my_center|LOCUS_46910 127210 128148 gene locus_tag LOCUS_46920 127210 128148 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976847.1 protein_id gnl|my_center|LOCUS_46920 128186 130126 gene locus_tag LOCUS_46930 128186 130126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 130559 130116 gene locus_tag LOCUS_46940 130559 130116 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239004.1 protein_id gnl|my_center|LOCUS_46940 130639 131688 gene locus_tag LOCUS_46950 130639 131688 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245738.1 protein_id gnl|my_center|LOCUS_46950 132257 131685 gene locus_tag LOCUS_46960 132257 131685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 132371 133204 gene locus_tag LOCUS_46970 132371 133204 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230706.1 protein_id gnl|my_center|LOCUS_46970 133238 133930 gene locus_tag LOCUS_46980 133238 133930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 134077 134604 gene locus_tag LOCUS_46990 134077 134604 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 protein_id gnl|my_center|LOCUS_46990 134881 134561 gene locus_tag LOCUS_47000 134881 134561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 135245 135556 gene locus_tag LOCUS_47010 135245 135556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 135663 136205 gene locus_tag LOCUS_47020 135663 136205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 137664 136519 gene locus_tag LOCUS_47030 137664 136519 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_47030 138558 137665 gene locus_tag LOCUS_47040 138558 137665 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222886.1 protein_id gnl|my_center|LOCUS_47040 140471 138549 gene locus_tag LOCUS_47050 140471 138549 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229660.1 protein_id gnl|my_center|LOCUS_47050 142029 140476 gene locus_tag LOCUS_47060 142029 140476 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_47060 142099 142677 gene locus_tag LOCUS_47070 142099 142677 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028578.1 protein_id gnl|my_center|LOCUS_47070 144866 142737 gene locus_tag LOCUS_47080 144866 142737 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 protein_id gnl|my_center|LOCUS_47080 145875 145015 gene locus_tag LOCUS_47090 145875 145015 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_47090 146851 145880 gene locus_tag LOCUS_47100 146851 145880 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_47100 147396 146851 gene locus_tag LOCUS_47110 147396 146851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 148573 147482 gene locus_tag LOCUS_47120 gene corA 148573 147482 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_47120 148638 149393 gene locus_tag LOCUS_47130 148638 149393 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_47130 152523 149404 gene locus_tag LOCUS_47140 152523 149404 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027705.1 protein_id gnl|my_center|LOCUS_47140 153623 152520 gene locus_tag LOCUS_47150 153623 152520 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_47150 153750 155243 gene locus_tag LOCUS_47160 153750 155243 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230396.1 protein_id gnl|my_center|LOCUS_47160 156175 155213 gene locus_tag LOCUS_47170 156175 155213 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414553.1 protein_id gnl|my_center|LOCUS_47170 156205 157689 gene locus_tag LOCUS_47180 156205 157689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 158700 157705 gene locus_tag LOCUS_47190 gene menC 158700 157705 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_47190 160085 158739 gene locus_tag LOCUS_47200 160085 158739 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_47200 161226 160096 gene locus_tag LOCUS_47210 161226 160096 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495359.1 protein_id gnl|my_center|LOCUS_47210 163379 161226 gene locus_tag LOCUS_47220 163379 161226 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227758.1 protein_id gnl|my_center|LOCUS_47220 164436 163369 gene locus_tag LOCUS_47230 164436 163369 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029875.1 protein_id gnl|my_center|LOCUS_47230 165785 164433 gene locus_tag LOCUS_47240 165785 164433 CDS product DUF5691 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029873.1 protein_id gnl|my_center|LOCUS_47240 167119 165782 gene locus_tag LOCUS_47250 167119 165782 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850841.1 protein_id gnl|my_center|LOCUS_47250 167277 167128 gene locus_tag LOCUS_47260 167277 167128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 168980 167421 gene locus_tag LOCUS_47270 168980 167421 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731268.1 protein_id gnl|my_center|LOCUS_47270 169173 169012 gene locus_tag LOCUS_47280 169173 169012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 169626 172430 gene locus_tag LOCUS_47290 169626 172430 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031572.1 protein_id gnl|my_center|LOCUS_47290 172469 173974 gene locus_tag LOCUS_47300 172469 173974 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384516.1 protein_id gnl|my_center|LOCUS_47300 176914 173975 gene locus_tag LOCUS_47310 176914 173975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 177596 176928 gene locus_tag LOCUS_47320 177596 176928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 177839 178840 gene locus_tag LOCUS_47330 177839 178840 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_47330 179063 179386 gene locus_tag LOCUS_47340 179063 179386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 179611 180759 gene locus_tag LOCUS_47350 179611 180759 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_47350 180774 181697 gene locus_tag LOCUS_47360 180774 181697 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_47360 183007 181748 gene locus_tag LOCUS_47370 183007 181748 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_47370 183353 184267 gene locus_tag LOCUS_47380 183353 184267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 184889 185170 gene locus_tag LOCUS_47390 184889 185170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 >Feature sequence22 903 2054 gene locus_tag LOCUS_47400 gene rffA 903 2054 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 protein_id gnl|my_center|LOCUS_47400 2054 2827 gene locus_tag LOCUS_47410 2054 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 3909 2842 gene locus_tag LOCUS_47420 3909 2842 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_47420 4503 4039 gene locus_tag LOCUS_47430 4503 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 4584 5555 gene locus_tag LOCUS_47440 4584 5555 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_47440 >Feature sequence23 >Feature sequence24 1656 343 gene locus_tag LOCUS_47450 1656 343 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_47450 1927 3051 gene locus_tag LOCUS_47460 1927 3051 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_47460 4220 3552 gene locus_tag LOCUS_47470 4220 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 5096 4443 gene locus_tag LOCUS_47480 5096 4443 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056877.1 protein_id gnl|my_center|LOCUS_47480 5342 5653 gene locus_tag LOCUS_47490 5342 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47490 5637 5798 gene locus_tag LOCUS_47500 5637 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47500 7255 5831 gene locus_tag LOCUS_47510 7255 5831 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283916.1 protein_id gnl|my_center|LOCUS_47510 9493 8264 gene locus_tag LOCUS_47520 9493 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 10057 9704 gene locus_tag LOCUS_47530 10057 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 11036 10455 gene locus_tag LOCUS_47540 11036 10455 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486994.1 protein_id gnl|my_center|LOCUS_47540 12012 11197 gene locus_tag LOCUS_47550 12012 11197 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204082927.1 protein_id gnl|my_center|LOCUS_47550 12035 12565 gene locus_tag LOCUS_47560 12035 12565 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831756.1 protein_id gnl|my_center|LOCUS_47560 13340 12534 gene locus_tag LOCUS_47570 13340 12534 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819104.1 protein_id gnl|my_center|LOCUS_47570 13672 13406 gene locus_tag LOCUS_47580 13672 13406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 14379 14104 gene locus_tag LOCUS_47590 14379 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 15954 14536 gene locus_tag LOCUS_47600 15954 14536 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223174.1 protein_id gnl|my_center|LOCUS_47600 16686 15991 gene locus_tag LOCUS_47610 16686 15991 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031090.1 protein_id gnl|my_center|LOCUS_47610 17783 16683 gene locus_tag LOCUS_47620 17783 16683 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031091.1 protein_id gnl|my_center|LOCUS_47620 18276 17887 gene locus_tag LOCUS_47630 18276 17887 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087865.1 protein_id gnl|my_center|LOCUS_47630 18583 19104 gene locus_tag LOCUS_47640 18583 19104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 19626 19192 gene locus_tag LOCUS_47650 19626 19192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 19955 19725 gene locus_tag LOCUS_47660 19955 19725 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228830.1 protein_id gnl|my_center|LOCUS_47660 20744 19965 gene locus_tag LOCUS_47670 20744 19965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 21565 20741 gene locus_tag LOCUS_47680 21565 20741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228828.1 protein_id gnl|my_center|LOCUS_47680 23192 21666 gene locus_tag LOCUS_47690 23192 21666 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326400.1 protein_id gnl|my_center|LOCUS_47690 23252 24310 gene locus_tag LOCUS_47700 23252 24310 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973529.1 protein_id gnl|my_center|LOCUS_47700 25774 24365 gene locus_tag LOCUS_47710 25774 24365 CDS product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 protein_id gnl|my_center|LOCUS_47710 25858 27465 gene locus_tag LOCUS_47720 25858 27465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 27479 28099 gene locus_tag LOCUS_47730 27479 28099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 28233 28964 gene locus_tag LOCUS_47740 28233 28964 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_47740 29030 30088 gene locus_tag LOCUS_47750 29030 30088 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972242.1 protein_id gnl|my_center|LOCUS_47750 30066 30824 gene locus_tag LOCUS_47760 30066 30824 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_47760 31015 31905 gene locus_tag LOCUS_47770 31015 31905 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_47770 32729 31959 gene locus_tag LOCUS_47780 32729 31959 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419190.1 protein_id gnl|my_center|LOCUS_47780 33968 32832 gene locus_tag LOCUS_47790 33968 32832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 35764 34088 gene locus_tag LOCUS_47800 35764 34088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 38112 36121 gene locus_tag LOCUS_47810 38112 36121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 39846 38374 gene locus_tag LOCUS_47820 39846 38374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 39938 42157 gene locus_tag LOCUS_47830 39938 42157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 42266 43165 gene locus_tag LOCUS_47840 42266 43165 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125980453.1 protein_id gnl|my_center|LOCUS_47840 43179 44258 gene locus_tag LOCUS_47850 43179 44258 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257788.1 protein_id gnl|my_center|LOCUS_47850 45237 44251 gene locus_tag LOCUS_47860 45237 44251 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_47860 45364 46224 gene locus_tag LOCUS_47870 45364 46224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 46221 47150 gene locus_tag LOCUS_47880 46221 47150 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_47880 47392 48519 gene locus_tag LOCUS_47890 47392 48519 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222923.1 protein_id gnl|my_center|LOCUS_47890 48550 49638 gene locus_tag LOCUS_47900 48550 49638 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222926.1 protein_id gnl|my_center|LOCUS_47900 49779 50681 gene locus_tag LOCUS_47910 49779 50681 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 protein_id gnl|my_center|LOCUS_47910 51014 53653 gene locus_tag LOCUS_47920 51014 53653 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455006.1 protein_id gnl|my_center|LOCUS_47920 53845 55611 gene locus_tag LOCUS_47930 53845 55611 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229295.1 protein_id gnl|my_center|LOCUS_47930 56930 55650 gene locus_tag LOCUS_47940 56930 55650 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028727.1 protein_id gnl|my_center|LOCUS_47940 58022 57084 gene locus_tag LOCUS_47950 gene cofD 58022 57084 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_47950 58196 59824 gene locus_tag LOCUS_47960 58196 59824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 60016 60273 gene locus_tag LOCUS_47970 60016 60273 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975777.1 protein_id gnl|my_center|LOCUS_47970 60496 63345 gene locus_tag LOCUS_47980 60496 63345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 63342 64889 gene locus_tag LOCUS_47990 63342 64889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 65317 64922 gene locus_tag LOCUS_48000 65317 64922 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063628643.1 protein_id gnl|my_center|LOCUS_48000 65494 65889 gene locus_tag LOCUS_48010 65494 65889 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975781.1 protein_id gnl|my_center|LOCUS_48010 65983 67338 gene locus_tag LOCUS_48020 65983 67338 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_48020 67345 67518 gene locus_tag LOCUS_48030 67345 67518 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975784.1 protein_id gnl|my_center|LOCUS_48030 67515 68657 gene locus_tag LOCUS_48040 67515 68657 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975785.1 protein_id gnl|my_center|LOCUS_48040 68701 69639 gene locus_tag LOCUS_48050 68701 69639 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_48050 69809 70411 gene locus_tag LOCUS_48060 69809 70411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 70467 71546 gene locus_tag LOCUS_48070 70467 71546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 72204 71557 gene locus_tag LOCUS_48080 72204 71557 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031090.1 protein_id gnl|my_center|LOCUS_48080 73391 72201 gene locus_tag LOCUS_48090 73391 72201 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030388.1 protein_id gnl|my_center|LOCUS_48090 73842 73510 gene locus_tag LOCUS_48100 73842 73510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 74014 75441 gene locus_tag LOCUS_48110 gene ahcY 74014 75441 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_48110 75730 77013 gene locus_tag LOCUS_48120 gene ahcY 75730 77013 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_48120 78159 77170 gene locus_tag LOCUS_48130 78159 77170 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731133.1 protein_id gnl|my_center|LOCUS_48130 78200 79192 gene locus_tag LOCUS_48140 78200 79192 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731132.1 protein_id gnl|my_center|LOCUS_48140 80576 79200 gene locus_tag LOCUS_48150 80576 79200 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072542.1 protein_id gnl|my_center|LOCUS_48150 81760 80756 gene locus_tag LOCUS_48160 81760 80756 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731130.1 protein_id gnl|my_center|LOCUS_48160 82959 81757 gene locus_tag LOCUS_48170 82959 81757 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113005.1 protein_id gnl|my_center|LOCUS_48170 83603 82956 gene locus_tag LOCUS_48180 83603 82956 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092089.1 protein_id gnl|my_center|LOCUS_48180 85252 83600 gene locus_tag LOCUS_48190 85252 83600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 85586 86263 gene locus_tag LOCUS_48200 gene mtrA 85586 86263 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_48200 86376 88031 gene locus_tag LOCUS_48210 gene mtrB 86376 88031 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028715.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48210 88021 89841 gene locus_tag LOCUS_48220 88021 89841 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028714.1 protein_id gnl|my_center|LOCUS_48220 90039 90809 gene locus_tag LOCUS_48230 90039 90809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 91328 91987 gene locus_tag LOCUS_48240 gene raiA 91328 91987 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229726.1 protein_id gnl|my_center|LOCUS_48240 92116 92817 gene locus_tag LOCUS_48250 92116 92817 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_48250 94051 92810 gene locus_tag LOCUS_48260 94051 92810 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028712.1 protein_id gnl|my_center|LOCUS_48260 94383 94120 gene locus_tag LOCUS_48270 94383 94120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 94597 97398 gene locus_tag LOCUS_48280 gene secA 94597 97398 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_48280 97995 97480 gene locus_tag LOCUS_48290 97995 97480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 99672 98335 gene locus_tag LOCUS_48300 99672 98335 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028657.1 protein_id gnl|my_center|LOCUS_48300 100449 99709 gene locus_tag LOCUS_48310 100449 99709 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230307.1 protein_id gnl|my_center|LOCUS_48310 100601 101635 gene locus_tag LOCUS_48320 100601 101635 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092074.1 protein_id gnl|my_center|LOCUS_48320 101649 101885 gene locus_tag LOCUS_48330 101649 101885 CDS product PTS glucose/sucrose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975905.1 protein_id gnl|my_center|LOCUS_48330 102005 102451 gene locus_tag LOCUS_48340 102005 102451 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977435.1 protein_id gnl|my_center|LOCUS_48340 102442 103098 gene locus_tag LOCUS_48350 102442 103098 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027849.1 protein_id gnl|my_center|LOCUS_48350 103120 103377 gene locus_tag LOCUS_48360 103120 103377 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224593.1 protein_id gnl|my_center|LOCUS_48360 103383 105116 gene locus_tag LOCUS_48370 gene ptsP 103383 105116 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977434.1 protein_id gnl|my_center|LOCUS_48370 105204 106508 gene locus_tag LOCUS_48380 105204 106508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 106568 107215 gene locus_tag LOCUS_48390 106568 107215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 107239 107745 gene locus_tag LOCUS_48400 107239 107745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028709.1 protein_id gnl|my_center|LOCUS_48400 107797 108432 gene locus_tag LOCUS_48410 107797 108432 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_48410 108564 109322 gene locus_tag LOCUS_48420 108564 109322 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223969.1 protein_id gnl|my_center|LOCUS_48420 110840 109329 gene locus_tag LOCUS_48430 110840 109329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 110997 111953 gene locus_tag LOCUS_48440 110997 111953 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228725.1 protein_id gnl|my_center|LOCUS_48440 111950 112825 gene locus_tag LOCUS_48450 111950 112825 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029227.1 protein_id gnl|my_center|LOCUS_48450 112890 114845 gene locus_tag LOCUS_48460 112890 114845 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_48460 116675 115212 gene locus_tag LOCUS_48470 116675 115212 CDS product NADH-quinone oxidoreductase subunit NuoF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326195.1 protein_id gnl|my_center|LOCUS_48470 117541 116672 gene locus_tag LOCUS_48480 117541 116672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 118994 117723 gene locus_tag LOCUS_48490 118994 117723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 119604 119017 gene locus_tag LOCUS_48500 119604 119017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 119728 120294 gene locus_tag LOCUS_48510 119728 120294 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224412.1 protein_id gnl|my_center|LOCUS_48510 120294 120491 gene locus_tag LOCUS_48520 120294 120491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 120607 121428 gene locus_tag LOCUS_48530 120607 121428 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228729.1 protein_id gnl|my_center|LOCUS_48530 121462 126414 gene locus_tag LOCUS_48540 121462 126414 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_48540 127314 126424 gene locus_tag LOCUS_48550 127314 126424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 127268 128659 gene locus_tag LOCUS_48560 gene prfB 127268 128659 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_48560 128888 128700 gene locus_tag LOCUS_48570 128888 128700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975842.1 protein_id gnl|my_center|LOCUS_48570 129063 129752 gene locus_tag LOCUS_48580 gene ftsE 129063 129752 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_48580 129767 130666 gene locus_tag LOCUS_48590 gene ftsX 129767 130666 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_48590 130736 131218 gene locus_tag LOCUS_48600 gene smpB 130736 131218 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_48600 131222 133108 gene locus_tag LOCUS_48610 131222 133108 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284244.1 protein_id gnl|my_center|LOCUS_48610 133401 133785 gene locus_tag LOCUS_tm00010 133401 133785 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 133960 134559 gene locus_tag LOCUS_48620 133960 134559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 135598 134579 gene locus_tag LOCUS_48630 135598 134579 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030372.1 protein_id gnl|my_center|LOCUS_48630 136760 135684 gene locus_tag LOCUS_48640 136760 135684 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146919646.1 protein_id gnl|my_center|LOCUS_48640 136962 139169 gene locus_tag LOCUS_48650 136962 139169 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727059.1 protein_id gnl|my_center|LOCUS_48650 139233 140873 gene locus_tag LOCUS_48660 139233 140873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229290.1 protein_id gnl|my_center|LOCUS_48660 140995 141144 gene locus_tag LOCUS_48670 140995 141144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 141422 142684 gene locus_tag LOCUS_48680 141422 142684 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841211.1 protein_id gnl|my_center|LOCUS_48680 142681 146886 gene locus_tag LOCUS_48690 142681 146886 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229292.1 protein_id gnl|my_center|LOCUS_48690 146892 148751 gene locus_tag LOCUS_48700 146892 148751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 148748 149773 gene locus_tag LOCUS_48710 148748 149773 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401257.1 protein_id gnl|my_center|LOCUS_48710 150454 149714 gene locus_tag LOCUS_48720 150454 149714 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229286.1 protein_id gnl|my_center|LOCUS_48720 150517 152364 gene locus_tag LOCUS_48730 150517 152364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419613.1 protein_id gnl|my_center|LOCUS_48730 152971 152357 gene locus_tag LOCUS_48740 152971 152357 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226000.1 protein_id gnl|my_center|LOCUS_48740 153031 153735 gene locus_tag LOCUS_48750 153031 153735 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223216.1 protein_id gnl|my_center|LOCUS_48750 155015 153732 gene locus_tag LOCUS_48760 155015 153732 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730275.1 protein_id gnl|my_center|LOCUS_48760 155147 156106 gene locus_tag LOCUS_48770 155147 156106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 156230 157087 gene locus_tag LOCUS_48780 156230 157087 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897810.1 protein_id gnl|my_center|LOCUS_48780 157693 157133 gene locus_tag LOCUS_48790 157693 157133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48790 158326 157700 gene locus_tag LOCUS_48800 158326 157700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48800 158455 159792 gene locus_tag LOCUS_48810 158455 159792 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_48810 159803 160552 gene locus_tag LOCUS_48820 159803 160552 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228155.1 protein_id gnl|my_center|LOCUS_48820 161737 160580 gene locus_tag LOCUS_48830 161737 160580 CDS product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029803.1 protein_id gnl|my_center|LOCUS_48830 163362 161878 gene locus_tag LOCUS_48840 163362 161878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 164410 163451 gene locus_tag LOCUS_48850 164410 163451 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029804.1 protein_id gnl|my_center|LOCUS_48850 164670 165782 gene locus_tag LOCUS_48860 164670 165782 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 protein_id gnl|my_center|LOCUS_48860 165902 167728 gene locus_tag LOCUS_48870 165902 167728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 167790 169565 gene locus_tag LOCUS_48880 167790 169565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 169666 170913 gene locus_tag LOCUS_48890 169666 170913 CDS product damage-control phosphatase ARMT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485432.1 protein_id gnl|my_center|LOCUS_48890 171736 170921 gene locus_tag LOCUS_48900 171736 170921 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_48900 171923 173464 gene locus_tag LOCUS_48910 171923 173464 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083171434.1 protein_id gnl|my_center|LOCUS_48910 173448 174356 gene locus_tag LOCUS_48920 173448 174356 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224428.1 protein_id gnl|my_center|LOCUS_48920 174370 175389 gene locus_tag LOCUS_48930 174370 175389 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878491.1 protein_id gnl|my_center|LOCUS_48930 175582 176712 gene locus_tag LOCUS_48940 175582 176712 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_48940 176746 178335 gene locus_tag LOCUS_48950 176746 178335 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225732.1 protein_id gnl|my_center|LOCUS_48950 178792 178622 gene locus_tag LOCUS_48960 178792 178622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 179415 178792 gene locus_tag LOCUS_48970 179415 178792 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 protein_id gnl|my_center|LOCUS_48970 180482 179604 gene locus_tag LOCUS_48980 180482 179604 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_48980 180568 181515 gene locus_tag LOCUS_48990 180568 181515 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_48990 182329 181526 gene locus_tag LOCUS_49000 182329 181526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222106.1 protein_id gnl|my_center|LOCUS_49000 184180 182345 gene locus_tag LOCUS_49010 184180 182345 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222107.1 protein_id gnl|my_center|LOCUS_49010 186097 184757 gene locus_tag LOCUS_49020 186097 184757 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977756.1 protein_id gnl|my_center|LOCUS_49020 186352 187725 gene locus_tag LOCUS_49030 186352 187725 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_49030 187791 188906 gene locus_tag LOCUS_49040 gene ald 187791 188906 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229678.1 protein_id gnl|my_center|LOCUS_49040 190374 188983 gene locus_tag LOCUS_49050 190374 188983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 190709 190509 gene locus_tag LOCUS_49060 190709 190509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 191462 190800 gene locus_tag LOCUS_49070 191462 190800 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_49070 192622 191459 gene locus_tag LOCUS_49080 192622 191459 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027559.1 protein_id gnl|my_center|LOCUS_49080 192782 194602 gene locus_tag LOCUS_49090 gene ggt 192782 194602 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224631.1 protein_id gnl|my_center|LOCUS_49090 196046 194574 gene locus_tag LOCUS_49100 196046 194574 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229439.1 protein_id gnl|my_center|LOCUS_49100 196350 196195 gene locus_tag LOCUS_49110 196350 196195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 196639 197427 gene locus_tag LOCUS_49120 196639 197427 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943910.1 protein_id gnl|my_center|LOCUS_49120 197506 197823 gene locus_tag LOCUS_49130 197506 197823 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666291.1 protein_id gnl|my_center|LOCUS_49130 198109 197912 gene locus_tag LOCUS_49140 198109 197912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 198389 199396 gene locus_tag LOCUS_49150 198389 199396 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086676092.1 protein_id gnl|my_center|LOCUS_49150 199925 199332 gene locus_tag LOCUS_49160 199925 199332 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893780.1 protein_id gnl|my_center|LOCUS_49160 200069 200758 gene locus_tag LOCUS_49170 200069 200758 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973686.1 protein_id gnl|my_center|LOCUS_49170 200785 204516 gene locus_tag LOCUS_49180 200785 204516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 204494 205117 gene locus_tag LOCUS_49190 204494 205117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 >Feature sequence25 961 2073 gene locus_tag LOCUS_49200 gene gcvT 961 2073 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 protein_id gnl|my_center|LOCUS_49200 2070 2459 gene locus_tag LOCUS_49210 gene gcvH 2070 2459 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 protein_id gnl|my_center|LOCUS_49210 2485 3855 gene locus_tag LOCUS_49220 2485 3855 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_49220 4335 3859 gene locus_tag LOCUS_49230 4335 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 4964 4338 gene locus_tag LOCUS_49240 4964 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 5142 6317 gene locus_tag LOCUS_49250 5142 6317 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027880.1 protein_id gnl|my_center|LOCUS_49250 7007 6684 gene locus_tag LOCUS_49260 7007 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 7140 7607 gene locus_tag LOCUS_49270 gene bcp 7140 7607 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_49270 7742 7815 gene locus_tag LOCUS_t00470 7742 7815 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8093 7836 gene locus_tag LOCUS_49280 8093 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 8608 9786 gene locus_tag LOCUS_49290 8608 9786 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_49290 9806 10471 gene locus_tag LOCUS_49300 9806 10471 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 protein_id gnl|my_center|LOCUS_49300 10585 11328 gene locus_tag LOCUS_49310 10585 11328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_49310 11332 13818 gene locus_tag LOCUS_49320 11332 13818 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_49320 14109 13849 gene locus_tag LOCUS_49330 14109 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 16040 14109 gene locus_tag LOCUS_49340 16040 14109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 17825 16176 gene locus_tag LOCUS_49350 17825 16176 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728275.1 protein_id gnl|my_center|LOCUS_49350 18552 17920 gene locus_tag LOCUS_49360 gene rdgB 18552 17920 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_49360 19235 18549 gene locus_tag LOCUS_49370 gene rph 19235 18549 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_49370 20035 19283 gene locus_tag LOCUS_49380 20035 19283 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_49380 20886 20032 gene locus_tag LOCUS_49390 gene murI 20886 20032 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 protein_id gnl|my_center|LOCUS_49390 20789 20986 gene locus_tag LOCUS_49400 20789 20986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 21920 21126 gene locus_tag LOCUS_49410 21920 21126 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 protein_id gnl|my_center|LOCUS_49410 22089 23702 gene locus_tag LOCUS_49420 22089 23702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 24854 23907 gene locus_tag LOCUS_49430 24854 23907 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975900.1 protein_id gnl|my_center|LOCUS_49430 25145 24867 gene locus_tag LOCUS_49440 25145 24867 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 protein_id gnl|my_center|LOCUS_49440 25772 25359 gene locus_tag LOCUS_49450 25772 25359 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896304.1 protein_id gnl|my_center|LOCUS_49450 26306 25782 gene locus_tag LOCUS_49460 26306 25782 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_49460 26756 26343 gene locus_tag LOCUS_49470 26756 26343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 26721 27953 gene locus_tag LOCUS_49480 26721 27953 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_49480 28017 28589 gene locus_tag LOCUS_49490 28017 28589 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_49490 28755 29369 gene locus_tag LOCUS_49500 28755 29369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 31243 29489 gene locus_tag LOCUS_49510 31243 29489 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929967.1 protein_id gnl|my_center|LOCUS_49510 32163 31393 gene locus_tag LOCUS_49520 32163 31393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 33270 32311 gene locus_tag LOCUS_49530 33270 32311 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229676.1 protein_id gnl|my_center|LOCUS_49530 33620 33369 gene locus_tag LOCUS_49540 33620 33369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 35351 33786 gene locus_tag LOCUS_49550 35351 33786 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_49550 35500 36132 gene locus_tag LOCUS_49560 35500 36132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 36784 36203 gene locus_tag LOCUS_49570 36784 36203 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_49570 38228 36888 gene locus_tag LOCUS_49580 38228 36888 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_49580 39063 38434 gene locus_tag LOCUS_49590 39063 38434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 40044 39130 gene locus_tag LOCUS_49600 40044 39130 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 protein_id gnl|my_center|LOCUS_49600 40608 40141 gene locus_tag LOCUS_49610 40608 40141 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225559.1 protein_id gnl|my_center|LOCUS_49610 40675 42069 gene locus_tag LOCUS_49620 40675 42069 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904086.1 protein_id gnl|my_center|LOCUS_49620 42333 42564 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cacgaccgtgcatggtcacg 44263 42581 gene locus_tag LOCUS_49630 44263 42581 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 protein_id gnl|my_center|LOCUS_49630 44477 46201 gene locus_tag LOCUS_49640 44477 46201 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229919.1 protein_id gnl|my_center|LOCUS_49640 47220 46297 gene locus_tag LOCUS_49650 47220 46297 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226008.1 protein_id gnl|my_center|LOCUS_49650 47467 48501 gene locus_tag LOCUS_49660 47467 48501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 49328 48738 gene locus_tag LOCUS_49670 49328 48738 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_49670 49620 51440 gene locus_tag LOCUS_49680 49620 51440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 51527 52216 gene locus_tag LOCUS_49690 51527 52216 CDS product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027353.1 protein_id gnl|my_center|LOCUS_49690 53249 52290 gene locus_tag LOCUS_49700 gene meaB 53249 52290 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_49700 54451 53252 gene locus_tag LOCUS_49710 54451 53252 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_49710 54562 54984 gene locus_tag LOCUS_49720 gene mce 54562 54984 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 protein_id gnl|my_center|LOCUS_49720 55168 56466 gene locus_tag LOCUS_49730 55168 56466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 57317 56589 gene locus_tag LOCUS_49740 57317 56589 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_49740 58157 57453 gene locus_tag LOCUS_49750 58157 57453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 58667 58350 gene locus_tag LOCUS_49760 58667 58350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_49760 60269 58761 gene locus_tag LOCUS_49770 60269 58761 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229492.1 protein_id gnl|my_center|LOCUS_49770 60327 61001 gene locus_tag LOCUS_49780 gene nucS 60327 61001 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_49780 61179 61739 gene locus_tag LOCUS_49790 61179 61739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 61863 62690 gene locus_tag LOCUS_49800 61863 62690 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_49800 62902 62663 gene locus_tag LOCUS_49810 62902 62663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 62868 63614 gene locus_tag LOCUS_49820 62868 63614 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227225.1 protein_id gnl|my_center|LOCUS_49820 63837 64442 gene locus_tag LOCUS_49830 63837 64442 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230170.1 protein_id gnl|my_center|LOCUS_49830 64439 65089 gene locus_tag LOCUS_49840 64439 65089 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_49840 65896 65534 gene locus_tag LOCUS_49850 65896 65534 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_49850 66353 65952 gene locus_tag LOCUS_49860 66353 65952 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229521.1 protein_id gnl|my_center|LOCUS_49860 67849 66422 gene locus_tag LOCUS_49870 gene atpD 67849 66422 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896328.1 protein_id gnl|my_center|LOCUS_49870 68750 67851 gene locus_tag LOCUS_49880 68750 67851 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_49880 70403 68754 gene locus_tag LOCUS_49890 gene atpA 70403 68754 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973626.1 protein_id gnl|my_center|LOCUS_49890 71213 70428 gene locus_tag LOCUS_49900 71213 70428 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_49900 71868 71320 gene locus_tag LOCUS_49910 71868 71320 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030209.1 protein_id gnl|my_center|LOCUS_49910 72121 71897 gene locus_tag LOCUS_49920 gene atpE 72121 71897 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973629.1 protein_id gnl|my_center|LOCUS_49920 72976 72188 gene locus_tag LOCUS_49930 gene atpB 72976 72188 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030208.1 protein_id gnl|my_center|LOCUS_49930 73336 73112 gene locus_tag LOCUS_49940 73336 73112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 73813 73391 gene locus_tag LOCUS_49950 73813 73391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973631.1 protein_id gnl|my_center|LOCUS_49950 75305 73929 gene locus_tag LOCUS_49960 75305 73929 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_49960 76631 75363 gene locus_tag LOCUS_49970 76631 75363 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_49970 77124 76738 gene locus_tag LOCUS_49980 77124 76738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 78640 77162 gene locus_tag LOCUS_49990 78640 77162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 79465 78818 gene locus_tag LOCUS_50000 79465 78818 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973635.1 protein_id gnl|my_center|LOCUS_50000 80385 79531 gene locus_tag LOCUS_50010 gene prmC 80385 79531 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_50010 81480 80431 gene locus_tag LOCUS_50020 gene prfA 81480 80431 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229537.1 protein_id gnl|my_center|LOCUS_50020 81801 81583 gene locus_tag LOCUS_50030 gene rpmE 81801 81583 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775950.1 protein_id gnl|my_center|LOCUS_50030 84047 82029 gene locus_tag LOCUS_50040 84047 82029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 85421 84462 gene locus_tag LOCUS_50050 gene thrB 85421 84462 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_50050 86610 85552 gene locus_tag LOCUS_50060 gene thrC 86610 85552 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_50060 88819 87077 gene locus_tag LOCUS_50070 88819 87077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 89904 88816 gene locus_tag LOCUS_50080 89904 88816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 90273 91151 gene locus_tag LOCUS_50090 90273 91151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 91421 92746 gene locus_tag LOCUS_50100 91421 92746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 94431 92842 gene locus_tag LOCUS_50110 94431 92842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 96122 94815 gene locus_tag LOCUS_50120 96122 94815 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_50120 97634 96168 gene locus_tag LOCUS_50130 gene lysA 97634 96168 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_50130 98321 97638 gene locus_tag LOCUS_50140 98321 97638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 98594 100321 gene locus_tag LOCUS_50150 gene treS 98594 100321 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031594.1 protein_id gnl|my_center|LOCUS_50150 102765 100450 gene locus_tag LOCUS_50160 102765 100450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 103638 102880 gene locus_tag LOCUS_50170 103638 102880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_50170 104308 103802 gene locus_tag LOCUS_50180 104308 103802 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225030.1 protein_id gnl|my_center|LOCUS_50180 104515 105777 gene locus_tag LOCUS_50190 104515 105777 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 protein_id gnl|my_center|LOCUS_50190 105781 107091 gene locus_tag LOCUS_50200 105781 107091 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975833.1 protein_id gnl|my_center|LOCUS_50200 107104 108510 gene locus_tag LOCUS_50210 107104 108510 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865510.1 protein_id gnl|my_center|LOCUS_50210 108507 109394 gene locus_tag LOCUS_50220 108507 109394 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975831.1 protein_id gnl|my_center|LOCUS_50220 109779 110375 gene locus_tag LOCUS_50230 109779 110375 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223644.1 protein_id gnl|my_center|LOCUS_50230 110400 110750 gene locus_tag LOCUS_50240 110400 110750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 111314 110766 gene locus_tag LOCUS_50250 111314 110766 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247931.1 protein_id gnl|my_center|LOCUS_50250 112337 111456 gene locus_tag LOCUS_50260 112337 111456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 113176 112649 gene locus_tag LOCUS_50270 113176 112649 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229692.1 protein_id gnl|my_center|LOCUS_50270 114930 113227 gene locus_tag LOCUS_50280 gene treZ 114930 113227 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224465.1 protein_id gnl|my_center|LOCUS_50280 117173 114993 gene locus_tag LOCUS_50290 gene treY 117173 114993 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224464.1 protein_id gnl|my_center|LOCUS_50290 119390 117246 gene locus_tag LOCUS_50300 gene glgX 119390 117246 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030640.1 protein_id gnl|my_center|LOCUS_50300 120834 119521 gene locus_tag LOCUS_50310 120834 119521 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976000.1 protein_id gnl|my_center|LOCUS_50310 121534 120845 gene locus_tag LOCUS_50320 121534 120845 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_50320 121682 122209 gene locus_tag LOCUS_50330 121682 122209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 122354 122797 gene locus_tag LOCUS_50340 gene mscL 122354 122797 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_50340 123449 122856 gene locus_tag LOCUS_50350 123449 122856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 124205 125077 gene locus_tag LOCUS_50360 124205 125077 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_50360 125093 125302 gene locus_tag LOCUS_50370 125093 125302 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_50370 125474 125683 gene locus_tag LOCUS_50380 125474 125683 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222338.1 protein_id gnl|my_center|LOCUS_50380 127875 125860 gene locus_tag LOCUS_50390 127875 125860 CDS product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201368745.1 protein_id gnl|my_center|LOCUS_50390 129474 127894 gene locus_tag LOCUS_50400 129474 127894 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131344932.1 protein_id gnl|my_center|LOCUS_50400 130488 129505 gene locus_tag LOCUS_50410 130488 129505 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972133.1 protein_id gnl|my_center|LOCUS_50410 131423 130500 gene locus_tag LOCUS_50420 131423 130500 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_50420 132893 131511 gene locus_tag LOCUS_50430 132893 131511 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972131.1 protein_id gnl|my_center|LOCUS_50430 134291 133149 gene locus_tag LOCUS_50440 134291 133149 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_50440 134582 137452 gene locus_tag LOCUS_50450 134582 137452 CDS product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228676.1 protein_id gnl|my_center|LOCUS_50450 138588 137584 gene locus_tag LOCUS_50460 138588 137584 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228681.1 protein_id gnl|my_center|LOCUS_50460 138947 138702 gene locus_tag LOCUS_50470 138947 138702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 139167 138940 gene locus_tag LOCUS_50480 139167 138940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 139580 139359 gene locus_tag LOCUS_50490 139580 139359 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978159.1 protein_id gnl|my_center|LOCUS_50490 140428 139577 gene locus_tag LOCUS_50500 140428 139577 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_50500 140573 141019 gene locus_tag LOCUS_50510 140573 141019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 141097 142539 gene locus_tag LOCUS_50520 141097 142539 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028648.1 protein_id gnl|my_center|LOCUS_50520 142609 142734 gene locus_tag LOCUS_50530 142609 142734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 142959 143450 gene locus_tag LOCUS_50540 142959 143450 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_50540 143447 145066 gene locus_tag LOCUS_50550 143447 145066 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229590.1 protein_id gnl|my_center|LOCUS_50550 145157 146170 gene locus_tag LOCUS_50560 gene speB 145157 146170 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_50560 146276 147421 gene locus_tag LOCUS_50570 146276 147421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 147418 148557 gene locus_tag LOCUS_50580 gene rodA 147418 148557 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_50580 148573 149673 gene locus_tag LOCUS_50590 148573 149673 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414172.1 protein_id gnl|my_center|LOCUS_50590 150614 149724 gene locus_tag LOCUS_50600 150614 149724 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230653.1 protein_id gnl|my_center|LOCUS_50600 152773 150656 gene locus_tag LOCUS_50610 152773 150656 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028768.1 protein_id gnl|my_center|LOCUS_50610 152872 153678 gene locus_tag LOCUS_50620 152872 153678 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230655.1 protein_id gnl|my_center|LOCUS_50620 153866 154270 gene locus_tag LOCUS_50630 153866 154270 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225759.1 protein_id gnl|my_center|LOCUS_50630 154833 154294 gene locus_tag LOCUS_50640 154833 154294 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226520.1 protein_id gnl|my_center|LOCUS_50640 154936 155709 gene locus_tag LOCUS_50650 154936 155709 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030136.1 protein_id gnl|my_center|LOCUS_50650 155757 156869 gene locus_tag LOCUS_50660 155757 156869 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228351.1 protein_id gnl|my_center|LOCUS_50660 156881 157672 gene locus_tag LOCUS_50670 156881 157672 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230233.1 protein_id gnl|my_center|LOCUS_50670 158927 157779 gene locus_tag LOCUS_50680 158927 157779 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030905.1 protein_id gnl|my_center|LOCUS_50680 159178 160473 gene locus_tag LOCUS_50690 159178 160473 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972557.1 protein_id gnl|my_center|LOCUS_50690 160470 161153 gene locus_tag LOCUS_50700 160470 161153 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972556.1 protein_id gnl|my_center|LOCUS_50700 162360 161131 gene locus_tag LOCUS_50710 162360 161131 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028750.1 protein_id gnl|my_center|LOCUS_50710 164021 162357 gene locus_tag LOCUS_50720 164021 162357 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028751.1 protein_id gnl|my_center|LOCUS_50720 164646 164095 gene locus_tag LOCUS_50730 164646 164095 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284042.1 protein_id gnl|my_center|LOCUS_50730 164798 166315 gene locus_tag LOCUS_50740 164798 166315 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229897.1 protein_id gnl|my_center|LOCUS_50740 166405 167118 gene locus_tag LOCUS_50750 166405 167118 CDS product DUF4232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222133.1 protein_id gnl|my_center|LOCUS_50750 167204 167734 gene locus_tag LOCUS_50760 167204 167734 CDS product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_50760 167986 167738 gene locus_tag LOCUS_50770 167986 167738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 168355 167987 gene locus_tag LOCUS_50780 168355 167987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 169314 168772 gene locus_tag LOCUS_50790 169314 168772 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029338.1 protein_id gnl|my_center|LOCUS_50790 170096 169386 gene locus_tag LOCUS_50800 170096 169386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 173854 170264 gene locus_tag LOCUS_50810 173854 170264 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226454.1 protein_id gnl|my_center|LOCUS_50810 175762 174380 gene locus_tag LOCUS_50820 175762 174380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 176076 176276 gene locus_tag LOCUS_50830 176076 176276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 176399 182587 gene locus_tag LOCUS_50840 176399 182587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50840 182587 188085 gene locus_tag LOCUS_50850 182587 188085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 188082 188501 gene locus_tag LOCUS_50860 188082 188501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 188752 189228 gene locus_tag LOCUS_50870 188752 189228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 189810 189280 gene locus_tag LOCUS_50880 189810 189280 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528179.1 protein_id gnl|my_center|LOCUS_50880 190513 189863 gene locus_tag LOCUS_50890 190513 189863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 191322 190600 gene locus_tag LOCUS_50900 191322 190600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 191534 193531 gene locus_tag LOCUS_50910 191534 193531 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028768.1 protein_id gnl|my_center|LOCUS_50910 193708 195210 gene locus_tag LOCUS_50920 193708 195210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 195553 195251 gene locus_tag LOCUS_50930 195553 195251 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977594.1 protein_id gnl|my_center|LOCUS_50930 195619 196248 gene locus_tag LOCUS_50940 195619 196248 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859221.1 protein_id gnl|my_center|LOCUS_50940 196480 196408 gene locus_tag LOCUS_t00480 196480 196408 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 196610 196999 gene locus_tag LOCUS_50950 196610 196999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 197592 198320 gene locus_tag LOCUS_50960 197592 198320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 198968 199987 gene locus_tag LOCUS_50970 198968 199987 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 protein_id gnl|my_center|LOCUS_50970 201302 200088 gene locus_tag LOCUS_50980 201302 200088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537581.1 protein_id gnl|my_center|LOCUS_50980 201713 201327 gene locus_tag LOCUS_50990 201713 201327 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031756.1 protein_id gnl|my_center|LOCUS_50990 202996 201725 gene locus_tag LOCUS_51000 202996 201725 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973990.1 protein_id gnl|my_center|LOCUS_51000 204688 203144 gene locus_tag LOCUS_51010 204688 203144 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804106.1 protein_id gnl|my_center|LOCUS_51010 >Feature sequence26 495 1808 gene locus_tag LOCUS_51020 495 1808 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730678.1 protein_id gnl|my_center|LOCUS_51020 1882 2655 gene locus_tag LOCUS_51030 1882 2655 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_51030 2725 3252 gene locus_tag LOCUS_51040 2725 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 3267 4514 gene locus_tag LOCUS_51050 3267 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 4511 5353 gene locus_tag LOCUS_51060 4511 5353 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030957.1 protein_id gnl|my_center|LOCUS_51060 5514 7070 gene locus_tag LOCUS_51070 5514 7070 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275275.1 protein_id gnl|my_center|LOCUS_51070 7072 7602 gene locus_tag LOCUS_51080 7072 7602 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_51080 7708 9786 gene locus_tag LOCUS_51090 7708 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 9783 11744 gene locus_tag LOCUS_51100 9783 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 11802 13163 gene locus_tag LOCUS_51110 11802 13163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 13439 14218 gene locus_tag LOCUS_51120 13439 14218 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_51120 14230 15183 gene locus_tag LOCUS_51130 14230 15183 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223551.1 protein_id gnl|my_center|LOCUS_51130 16559 15351 gene locus_tag LOCUS_51140 16559 15351 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480120.1 protein_id gnl|my_center|LOCUS_51140 17158 16667 gene locus_tag LOCUS_51150 17158 16667 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 protein_id gnl|my_center|LOCUS_51150 17267 18436 gene locus_tag LOCUS_51160 17267 18436 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_51160 19526 18486 gene locus_tag LOCUS_51170 19526 18486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 19664 20725 gene locus_tag LOCUS_51180 gene mnmA 19664 20725 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_51180 21369 20737 gene locus_tag LOCUS_51190 21369 20737 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031843.1 protein_id gnl|my_center|LOCUS_51190 21389 22513 gene locus_tag LOCUS_51200 21389 22513 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_51200 22651 24840 gene locus_tag LOCUS_51210 gene ligA 22651 24840 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030278.1 protein_id gnl|my_center|LOCUS_51210 25146 27227 gene locus_tag LOCUS_51220 gene rmdB 25146 27227 CDS product cyclic Di-GMP phosphodiesterase RmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030279.1 protein_id gnl|my_center|LOCUS_51220 27319 27618 gene locus_tag LOCUS_51230 gene gatC 27319 27618 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_51230 27615 29105 gene locus_tag LOCUS_51240 gene gatA 27615 29105 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 protein_id gnl|my_center|LOCUS_51240 29214 30722 gene locus_tag LOCUS_51250 gene gatB 29214 30722 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_51250 30926 32875 gene locus_tag LOCUS_51260 30926 32875 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_51260 34150 33005 gene locus_tag LOCUS_51270 34150 33005 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_51270 34219 35151 gene locus_tag LOCUS_51280 34219 35151 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223960.1 protein_id gnl|my_center|LOCUS_51280 35478 38240 gene locus_tag LOCUS_51290 35478 38240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 38949 40694 gene locus_tag LOCUS_51300 38949 40694 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_51300 40747 41271 gene locus_tag LOCUS_51310 gene ilvN 40747 41271 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_51310 41299 42348 gene locus_tag LOCUS_51320 gene ilvC 41299 42348 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223583.1 protein_id gnl|my_center|LOCUS_51320 43928 42429 gene locus_tag LOCUS_51330 gene dacB 43928 42429 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_51330 44609 44073 gene locus_tag LOCUS_51340 44609 44073 CDS product DUF1707 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030637.1 protein_id gnl|my_center|LOCUS_51340 45643 44696 gene locus_tag LOCUS_51350 45643 44696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 45904 46443 gene locus_tag LOCUS_51360 45904 46443 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 protein_id gnl|my_center|LOCUS_51360 46440 47195 gene locus_tag LOCUS_51370 46440 47195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265944.1 protein_id gnl|my_center|LOCUS_51370 47192 49819 gene locus_tag LOCUS_51380 47192 49819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 51185 49836 gene locus_tag LOCUS_51390 51185 49836 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226840.1 protein_id gnl|my_center|LOCUS_51390 52166 51303 gene locus_tag LOCUS_51400 52166 51303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 52481 54070 gene locus_tag LOCUS_51410 gene serA 52481 54070 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_51410 55621 54653 gene locus_tag LOCUS_51420 55621 54653 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225279.1 protein_id gnl|my_center|LOCUS_51420 56835 55648 gene locus_tag LOCUS_51430 56835 55648 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140281.1 protein_id gnl|my_center|LOCUS_51430 57551 56832 gene locus_tag LOCUS_51440 57551 56832 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 protein_id gnl|my_center|LOCUS_51440 58655 57552 gene locus_tag LOCUS_51450 58655 57552 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972913.1 protein_id gnl|my_center|LOCUS_51450 58759 60027 gene locus_tag LOCUS_51460 58759 60027 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224850.1 protein_id gnl|my_center|LOCUS_51460 60073 61119 gene locus_tag LOCUS_51470 60073 61119 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_51470 61266 62357 gene locus_tag LOCUS_51480 61266 62357 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284299.1 protein_id gnl|my_center|LOCUS_51480 63261 62608 gene locus_tag LOCUS_51490 63261 62608 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_51490 63571 65145 gene locus_tag LOCUS_51500 gene cimA 63571 65145 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_51500 65538 65164 gene locus_tag LOCUS_51510 65538 65164 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015550.1 protein_id gnl|my_center|LOCUS_51510 65692 66462 gene locus_tag LOCUS_51520 65692 66462 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973449.1 protein_id gnl|my_center|LOCUS_51520 66455 67819 gene locus_tag LOCUS_51530 gene gltX 66455 67819 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_51530 67902 68231 gene locus_tag LOCUS_51540 67902 68231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 68274 69098 gene locus_tag LOCUS_51550 68274 69098 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775810.1 protein_id gnl|my_center|LOCUS_51550 69095 70171 gene locus_tag LOCUS_51560 69095 70171 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776452.1 protein_id gnl|my_center|LOCUS_51560 72190 70211 gene locus_tag LOCUS_51570 72190 70211 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226475.1 protein_id gnl|my_center|LOCUS_51570 72350 72422 gene locus_tag LOCUS_t00490 72350 72422 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 72473 72546 gene locus_tag LOCUS_t00500 72473 72546 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 72558 72631 gene locus_tag LOCUS_t00510 72558 72631 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 72787 73794 gene locus_tag LOCUS_51580 72787 73794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 73851 74345 gene locus_tag LOCUS_51590 73851 74345 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532579.1 protein_id gnl|my_center|LOCUS_51590 76017 74323 gene locus_tag LOCUS_51600 76017 74323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 76770 76054 gene locus_tag LOCUS_51610 gene ndgR 76770 76054 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_51610 76905 78290 gene locus_tag LOCUS_51620 gene leuC 76905 78290 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_51620 78319 78906 gene locus_tag LOCUS_51630 gene leuD 78319 78906 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_51630 79194 79493 gene locus_tag LOCUS_51640 79194 79493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 79841 79620 gene locus_tag LOCUS_51650 79841 79620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 80632 79886 gene locus_tag LOCUS_51660 gene actII 80632 79886 CDS product TetR family transcriptional regulator ActII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030045.1 protein_id gnl|my_center|LOCUS_51660 80833 82302 gene locus_tag LOCUS_51670 80833 82302 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030046.1 protein_id gnl|my_center|LOCUS_51670 83367 82756 gene locus_tag LOCUS_51680 gene cofC 83367 82756 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_51680 83538 84326 gene locus_tag LOCUS_51690 83538 84326 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_51690 84393 85400 gene locus_tag LOCUS_51700 84393 85400 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_51700 85397 86635 gene locus_tag LOCUS_51710 85397 86635 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_51710 86676 87791 gene locus_tag LOCUS_51720 86676 87791 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_51720 88239 87793 gene locus_tag LOCUS_51730 88239 87793 CDS product DUF3515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081467.1 protein_id gnl|my_center|LOCUS_51730 88522 88289 gene locus_tag LOCUS_51740 88522 88289 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_51740 88570 89559 gene locus_tag LOCUS_51750 88570 89559 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_51750 89630 90607 gene locus_tag LOCUS_51760 89630 90607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 90645 91436 gene locus_tag LOCUS_51770 gene thiD 90645 91436 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973431.1 protein_id gnl|my_center|LOCUS_51770 92150 91506 gene locus_tag LOCUS_51780 92150 91506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 92510 92259 gene locus_tag LOCUS_51790 92510 92259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 92656 94215 gene locus_tag LOCUS_51800 92656 94215 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_51800 94253 96424 gene locus_tag LOCUS_51810 gene recG 94253 96424 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_51810 96815 97375 gene locus_tag LOCUS_51820 gene rsmD 96815 97375 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_51820 97393 97869 gene locus_tag LOCUS_51830 gene coaD 97393 97869 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_51830 97942 98514 gene locus_tag LOCUS_51840 97942 98514 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_51840 98516 98695 gene locus_tag LOCUS_51850 gene rpmF 98516 98695 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 protein_id gnl|my_center|LOCUS_51850 98917 98759 gene locus_tag LOCUS_51860 98917 98759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 98935 99684 gene locus_tag LOCUS_51870 gene rnc 98935 99684 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_51870 99753 100667 gene locus_tag LOCUS_51880 gene mutM 99753 100667 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_51880 100708 100983 gene locus_tag LOCUS_51890 100708 100983 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223794.1 protein_id gnl|my_center|LOCUS_51890 101173 101367 gene locus_tag LOCUS_51900 101173 101367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 101740 105447 gene locus_tag LOCUS_51910 gene smc 101740 105447 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_51910 105690 106907 gene locus_tag LOCUS_51920 gene ftsY 105690 106907 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_51920 108057 106954 gene locus_tag LOCUS_51930 108057 106954 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977801.1 protein_id gnl|my_center|LOCUS_51930 108299 108886 gene locus_tag LOCUS_51940 gene sigR 108299 108886 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_51940 109795 108959 gene locus_tag LOCUS_51950 109795 108959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 109865 110443 gene locus_tag LOCUS_51960 109865 110443 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977517.1 protein_id gnl|my_center|LOCUS_51960 110586 110891 gene locus_tag LOCUS_51970 110586 110891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 110925 111740 gene locus_tag LOCUS_51980 110925 111740 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495273.1 protein_id gnl|my_center|LOCUS_51980 111737 113245 gene locus_tag LOCUS_51990 111737 113245 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730039.1 protein_id gnl|my_center|LOCUS_51990 113302 113928 gene locus_tag LOCUS_52000 113302 113928 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_52000 114561 113932 gene locus_tag LOCUS_52010 114561 113932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 116784 114931 gene locus_tag LOCUS_52020 gene typA 116784 114931 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_52020 117265 118020 gene locus_tag LOCUS_52030 117265 118020 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974811.1 protein_id gnl|my_center|LOCUS_52030 119616 118180 gene locus_tag LOCUS_52040 119616 118180 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891663.1 protein_id gnl|my_center|LOCUS_52040 122918 119859 gene locus_tag LOCUS_52050 122918 119859 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028058.1 protein_id gnl|my_center|LOCUS_52050 123156 124043 gene locus_tag LOCUS_52060 123156 124043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 125362 124076 gene locus_tag LOCUS_52070 125362 124076 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028409.1 protein_id gnl|my_center|LOCUS_52070 125512 126090 gene locus_tag LOCUS_52080 125512 126090 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_52080 127014 126103 gene locus_tag LOCUS_52090 127014 126103 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031422.1 protein_id gnl|my_center|LOCUS_52090 127116 127508 gene locus_tag LOCUS_52100 127116 127508 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224170.1 protein_id gnl|my_center|LOCUS_52100 129514 127523 gene locus_tag LOCUS_52110 129514 127523 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230344.1 protein_id gnl|my_center|LOCUS_52110 130641 129625 gene locus_tag LOCUS_52120 130641 129625 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 protein_id gnl|my_center|LOCUS_52120 131505 130720 gene locus_tag LOCUS_52130 131505 130720 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_52130 131795 133255 gene locus_tag LOCUS_52140 131795 133255 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031663.1 protein_id gnl|my_center|LOCUS_52140 133439 134686 gene locus_tag LOCUS_52150 133439 134686 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185067440.1 protein_id gnl|my_center|LOCUS_52150 134765 135520 gene locus_tag LOCUS_52160 134765 135520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 136443 135904 gene locus_tag LOCUS_52170 136443 135904 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030444.1 protein_id gnl|my_center|LOCUS_52170 137330 136440 gene locus_tag LOCUS_52180 137330 136440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 137489 138490 gene locus_tag LOCUS_52190 137489 138490 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852489.1 protein_id gnl|my_center|LOCUS_52190 139880 138510 gene locus_tag LOCUS_52200 139880 138510 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224336.1 protein_id gnl|my_center|LOCUS_52200 140241 139870 gene locus_tag LOCUS_52210 140241 139870 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_52210 142687 140444 gene locus_tag LOCUS_52220 142687 140444 CDS product SGNH hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624217.1 protein_id gnl|my_center|LOCUS_52220 142928 143203 gene locus_tag LOCUS_52230 142928 143203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 144576 143212 gene locus_tag LOCUS_52240 144576 143212 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_52240 144724 145476 gene locus_tag LOCUS_52250 144724 145476 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878347.1 protein_id gnl|my_center|LOCUS_52250 145540 145926 gene locus_tag LOCUS_52260 145540 145926 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229473.1 protein_id gnl|my_center|LOCUS_52260 146835 146512 gene locus_tag LOCUS_52270 146835 146512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 147211 147849 gene locus_tag LOCUS_52280 147211 147849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 147941 148015 gene locus_tag LOCUS_t00520 147941 148015 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 148452 148165 gene locus_tag LOCUS_52290 148452 148165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 148657 148454 gene locus_tag LOCUS_52300 148657 148454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 149564 148713 gene locus_tag LOCUS_52310 149564 148713 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028635.1 protein_id gnl|my_center|LOCUS_52310 150060 149545 gene locus_tag LOCUS_52320 150060 149545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180053.1 protein_id gnl|my_center|LOCUS_52320 150266 150057 gene locus_tag LOCUS_52330 150266 150057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 150540 151073 gene locus_tag LOCUS_52340 150540 151073 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225897.1 protein_id gnl|my_center|LOCUS_52340 151165 151872 gene locus_tag LOCUS_52350 151165 151872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 151894 152607 gene locus_tag LOCUS_52360 151894 152607 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223927.1 protein_id gnl|my_center|LOCUS_52360 152613 153485 gene locus_tag LOCUS_52370 152613 153485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 154899 153514 gene locus_tag LOCUS_52380 154899 153514 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227115.1 protein_id gnl|my_center|LOCUS_52380 155099 156406 gene locus_tag LOCUS_52390 155099 156406 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_52390 157625 156423 gene locus_tag LOCUS_52400 157625 156423 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 protein_id gnl|my_center|LOCUS_52400 158943 157759 gene locus_tag LOCUS_52410 158943 157759 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_52410 159842 158940 gene locus_tag LOCUS_52420 159842 158940 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224573.1 protein_id gnl|my_center|LOCUS_52420 161080 159842 gene locus_tag LOCUS_52430 161080 159842 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222448.1 protein_id gnl|my_center|LOCUS_52430 161282 161518 gene locus_tag LOCUS_52440 161282 161518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 161594 162352 gene locus_tag LOCUS_52450 161594 162352 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_52450 162521 163723 gene locus_tag LOCUS_52460 162521 163723 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326457.1 protein_id gnl|my_center|LOCUS_52460 164263 163700 gene locus_tag LOCUS_52470 164263 163700 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907766.1 protein_id gnl|my_center|LOCUS_52470 164377 164634 gene locus_tag LOCUS_52480 164377 164634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 165762 164758 gene locus_tag LOCUS_52490 165762 164758 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031646.1 protein_id gnl|my_center|LOCUS_52490 166015 165767 gene locus_tag LOCUS_52500 166015 165767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 166253 167302 gene locus_tag LOCUS_52510 166253 167302 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188751788.1 protein_id gnl|my_center|LOCUS_52510 168575 167367 gene locus_tag LOCUS_52520 168575 167367 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_52520 168899 169144 gene locus_tag LOCUS_52530 168899 169144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 169141 169872 gene locus_tag LOCUS_52540 169141 169872 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031621.1 protein_id gnl|my_center|LOCUS_52540 170216 170067 gene locus_tag LOCUS_52550 170216 170067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 170943 170443 gene locus_tag LOCUS_52560 170943 170443 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031882.1 protein_id gnl|my_center|LOCUS_52560 171439 170936 gene locus_tag LOCUS_52570 171439 170936 CDS product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226138.1 protein_id gnl|my_center|LOCUS_52570 171495 172088 gene locus_tag LOCUS_52580 171495 172088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 172565 172203 gene locus_tag LOCUS_52590 172565 172203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 172848 172660 gene locus_tag LOCUS_52600 172848 172660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 173753 172875 gene locus_tag LOCUS_52610 173753 172875 CDS product TIGR03854 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225293.1 protein_id gnl|my_center|LOCUS_52610 174589 173801 gene locus_tag LOCUS_52620 174589 173801 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_52620 175584 174586 gene locus_tag LOCUS_52630 175584 174586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 175716 177017 gene locus_tag LOCUS_52640 175716 177017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 176127 176043 gene locus_tag LOCUS_t00530 176127 176043 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 177020 177694 gene locus_tag LOCUS_52650 177020 177694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_52650 177691 180096 gene locus_tag LOCUS_52660 177691 180096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 180108 182489 gene locus_tag LOCUS_52670 180108 182489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 182551 184479 gene locus_tag LOCUS_52680 182551 184479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 >Feature sequence27 <1 1151 gene locus_tag LOCUS_52690 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405092.1:NAD(P)/FAD-dependent oxidoreductase 1467 1117 gene locus_tag LOCUS_52700 1467 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 2227 1538 gene locus_tag LOCUS_52710 2227 1538 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028204.1 protein_id gnl|my_center|LOCUS_52710 2704 2285 gene locus_tag LOCUS_52720 2704 2285 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_52720 3339 2743 gene locus_tag LOCUS_52730 3339 2743 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870827.1 protein_id gnl|my_center|LOCUS_52730 4462 3455 gene locus_tag LOCUS_52740 4462 3455 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225829.1 protein_id gnl|my_center|LOCUS_52740 >Feature sequence28 2877 298 gene locus_tag LOCUS_52750 2877 298 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028455.1 protein_id gnl|my_center|LOCUS_52750 4235 2952 gene locus_tag LOCUS_52760 gene clpX 4235 2952 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_52760 5074 4430 gene locus_tag LOCUS_52770 5074 4430 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228511.1 protein_id gnl|my_center|LOCUS_52770 5733 5089 gene locus_tag LOCUS_52780 5733 5089 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 protein_id gnl|my_center|LOCUS_52780 7447 6071 gene locus_tag LOCUS_52790 gene tig 7447 6071 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_52790 8510 7647 gene locus_tag LOCUS_52800 8510 7647 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_52800 8787 9266 gene locus_tag LOCUS_52810 8787 9266 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 protein_id gnl|my_center|LOCUS_52810 9345 9698 gene locus_tag LOCUS_52820 9345 9698 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975682.1 protein_id gnl|my_center|LOCUS_52820 9953 10438 gene locus_tag LOCUS_52830 9953 10438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 10649 11353 gene locus_tag LOCUS_52840 10649 11353 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_52840 11393 12481 gene locus_tag LOCUS_52850 11393 12481 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_52850 12786 13016 gene locus_tag LOCUS_52860 12786 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 13016 13543 gene locus_tag LOCUS_52870 13016 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 13513 13641 gene locus_tag LOCUS_52880 13513 13641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 13808 13737 gene locus_tag LOCUS_t00540 13808 13737 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13898 13972 gene locus_tag LOCUS_t00550 13898 13972 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14509 14712 gene locus_tag LOCUS_52890 14509 14712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 15625 14807 gene locus_tag LOCUS_52900 15625 14807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 16433 16104 gene locus_tag LOCUS_52910 16433 16104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 16479 16871 gene locus_tag LOCUS_52920 16479 16871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 17152 17334 gene locus_tag LOCUS_52930 17152 17334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 17846 17364 gene locus_tag LOCUS_52940 17846 17364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 18021 18905 gene locus_tag LOCUS_52950 18021 18905 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040364.1 protein_id gnl|my_center|LOCUS_52950 19331 19999 gene locus_tag LOCUS_52960 19331 19999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 20857 20090 gene locus_tag LOCUS_52970 20857 20090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 21692 20973 gene locus_tag LOCUS_52980 21692 20973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 22157 23035 gene locus_tag LOCUS_52990 22157 23035 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226237.1 protein_id gnl|my_center|LOCUS_52990 23777 23055 gene locus_tag LOCUS_53000 23777 23055 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_53000 24735 24160 gene locus_tag LOCUS_53010 24735 24160 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328266.1 protein_id gnl|my_center|LOCUS_53010 25355 24963 gene locus_tag LOCUS_53020 25355 24963 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896379.1 protein_id gnl|my_center|LOCUS_53020 25464 25961 gene locus_tag LOCUS_53030 25464 25961 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313124.1 protein_id gnl|my_center|LOCUS_53030 26146 27879 gene locus_tag LOCUS_53040 26146 27879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 27971 28537 gene locus_tag LOCUS_53050 27971 28537 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_53050 28790 29593 gene locus_tag LOCUS_53060 28790 29593 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230059.1 protein_id gnl|my_center|LOCUS_53060 29590 30651 gene locus_tag LOCUS_53070 gene galT 29590 30651 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 protein_id gnl|my_center|LOCUS_53070 30910 31806 gene locus_tag LOCUS_53080 30910 31806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 32003 32932 gene locus_tag LOCUS_53090 32003 32932 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_53090 32990 33499 gene locus_tag LOCUS_53100 32990 33499 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977487.1 protein_id gnl|my_center|LOCUS_53100 34840 33536 gene locus_tag LOCUS_53110 34840 33536 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030397.1 protein_id gnl|my_center|LOCUS_53110 35080 35634 gene locus_tag LOCUS_53120 35080 35634 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226387.1 protein_id gnl|my_center|LOCUS_53120 38288 35706 gene locus_tag LOCUS_53130 gene lanKC 38288 35706 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495285.1 protein_id gnl|my_center|LOCUS_53130 39468 38356 gene locus_tag LOCUS_53140 39468 38356 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976175.1 protein_id gnl|my_center|LOCUS_53140 39586 40812 gene locus_tag LOCUS_53150 39586 40812 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028461.1 protein_id gnl|my_center|LOCUS_53150 40823 41008 gene locus_tag LOCUS_53160 40823 41008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 41499 41032 gene locus_tag LOCUS_53170 41499 41032 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_53170 41634 42122 gene locus_tag LOCUS_53180 gene def 41634 42122 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392416.1 protein_id gnl|my_center|LOCUS_53180 43539 42133 gene locus_tag LOCUS_53190 43539 42133 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027930.1 protein_id gnl|my_center|LOCUS_53190 44277 43663 gene locus_tag LOCUS_53200 44277 43663 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_53200 44463 47030 gene locus_tag LOCUS_53210 gene pepN 44463 47030 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228585.1 protein_id gnl|my_center|LOCUS_53210 47192 47743 gene locus_tag LOCUS_53220 47192 47743 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_53220 47764 49629 gene locus_tag LOCUS_53230 47764 49629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 49640 50611 gene locus_tag LOCUS_53240 49640 50611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 52070 50643 gene locus_tag LOCUS_53250 52070 50643 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804864.1 protein_id gnl|my_center|LOCUS_53250 52394 53032 gene locus_tag LOCUS_53260 52394 53032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 53108 54946 gene locus_tag LOCUS_53270 gene ilvD 53108 54946 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028925.1 protein_id gnl|my_center|LOCUS_53270 55112 55594 gene locus_tag LOCUS_53280 55112 55594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 55879 55670 gene locus_tag LOCUS_53290 55879 55670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 56721 55906 gene locus_tag LOCUS_53300 56721 55906 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114349.1 protein_id gnl|my_center|LOCUS_53300 57238 56729 gene locus_tag LOCUS_53310 57238 56729 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878108.1 protein_id gnl|my_center|LOCUS_53310 57615 59687 gene locus_tag LOCUS_53320 57615 59687 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_53320 60519 59671 gene locus_tag LOCUS_53330 gene purU 60519 59671 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275169.1 protein_id gnl|my_center|LOCUS_53330 62552 60600 gene locus_tag LOCUS_53340 62552 60600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 63261 62758 gene locus_tag LOCUS_53350 63261 62758 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091014.1 protein_id gnl|my_center|LOCUS_53350 64879 63272 gene locus_tag LOCUS_53360 64879 63272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 65219 65479 gene locus_tag LOCUS_53370 65219 65479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 65561 65902 gene locus_tag LOCUS_53380 65561 65902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 66081 65899 gene locus_tag LOCUS_53390 66081 65899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 66050 66994 gene locus_tag LOCUS_53400 66050 66994 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 protein_id gnl|my_center|LOCUS_53400 67030 67413 gene locus_tag LOCUS_53410 67030 67413 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_53410 67444 68997 gene locus_tag LOCUS_53420 67444 68997 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228685.1 protein_id gnl|my_center|LOCUS_53420 70792 69128 gene locus_tag LOCUS_53430 gene ettA 70792 69128 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976122.1 protein_id gnl|my_center|LOCUS_53430 72104 70803 gene locus_tag LOCUS_53440 72104 70803 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227346.1 protein_id gnl|my_center|LOCUS_53440 73151 72459 gene locus_tag LOCUS_53450 73151 72459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 73354 73935 gene locus_tag LOCUS_53460 73354 73935 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_53460 73937 75001 gene locus_tag LOCUS_53470 73937 75001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 76872 75241 gene locus_tag LOCUS_53480 76872 75241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 79252 76910 gene locus_tag LOCUS_53490 79252 76910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 80481 79249 gene locus_tag LOCUS_53500 gene cobA 80481 79249 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977272.1 protein_id gnl|my_center|LOCUS_53500 81692 80607 gene locus_tag LOCUS_53510 81692 80607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 82719 81703 gene locus_tag LOCUS_53520 82719 81703 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028014.1 protein_id gnl|my_center|LOCUS_53520 83921 82845 gene locus_tag LOCUS_53530 83921 82845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 84065 84364 gene locus_tag LOCUS_53540 84065 84364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 85007 84387 gene locus_tag LOCUS_53550 85007 84387 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_53550 86446 85004 gene locus_tag LOCUS_53560 86446 85004 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027372.1 protein_id gnl|my_center|LOCUS_53560 87207 86443 gene locus_tag LOCUS_53570 87207 86443 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027371.1 protein_id gnl|my_center|LOCUS_53570 87298 88011 gene locus_tag LOCUS_53580 87298 88011 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727054.1 protein_id gnl|my_center|LOCUS_53580 88031 89044 gene locus_tag LOCUS_53590 88031 89044 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_53590 89080 89535 gene locus_tag LOCUS_53600 89080 89535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 91671 89560 gene locus_tag LOCUS_53610 91671 89560 CDS product SGNH hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624217.1 protein_id gnl|my_center|LOCUS_53610 92661 92029 gene locus_tag LOCUS_53620 92661 92029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 96275 92781 gene locus_tag LOCUS_53630 gene dnaE 96275 92781 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_53630 96580 96314 gene locus_tag LOCUS_53640 96580 96314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 97456 96719 gene locus_tag LOCUS_53650 97456 96719 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898123.1 protein_id gnl|my_center|LOCUS_53650 97570 98718 gene locus_tag LOCUS_53660 97570 98718 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_53660 98718 99590 gene locus_tag LOCUS_53670 98718 99590 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897937.1 protein_id gnl|my_center|LOCUS_53670 99578 100468 gene locus_tag LOCUS_53680 99578 100468 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388257.1 protein_id gnl|my_center|LOCUS_53680 100465 101550 gene locus_tag LOCUS_53690 100465 101550 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 protein_id gnl|my_center|LOCUS_53690 101540 102217 gene locus_tag LOCUS_53700 101540 102217 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_53700 102308 103267 gene locus_tag LOCUS_53710 102308 103267 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224686.1 protein_id gnl|my_center|LOCUS_53710 104134 103412 gene locus_tag LOCUS_53720 104134 103412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 105253 104201 gene locus_tag LOCUS_53730 105253 104201 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975333.1 protein_id gnl|my_center|LOCUS_53730 106053 105253 gene locus_tag LOCUS_53740 106053 105253 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258912.1 protein_id gnl|my_center|LOCUS_53740 106993 106034 gene locus_tag LOCUS_53750 106993 106034 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_53750 108152 107199 gene locus_tag LOCUS_53760 108152 107199 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951710.1 protein_id gnl|my_center|LOCUS_53760 109213 108392 gene locus_tag LOCUS_53770 109213 108392 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263481.1 protein_id gnl|my_center|LOCUS_53770 109342 110322 gene locus_tag LOCUS_53780 109342 110322 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223398.1 protein_id gnl|my_center|LOCUS_53780 110382 110456 gene locus_tag LOCUS_t00560 110382 110456 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 110781 111341 gene locus_tag LOCUS_53790 110781 111341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 111405 111920 gene locus_tag LOCUS_53800 111405 111920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 113358 112171 gene locus_tag LOCUS_53810 113358 112171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 114153 113794 gene locus_tag LOCUS_53820 114153 113794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 114521 114234 gene locus_tag LOCUS_53830 114521 114234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 114556 114975 gene locus_tag LOCUS_53840 114556 114975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 116774 115269 gene locus_tag LOCUS_53850 116774 115269 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230306.1 protein_id gnl|my_center|LOCUS_53850 117569 117030 gene locus_tag LOCUS_53860 117569 117030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 118222 117740 gene locus_tag LOCUS_53870 118222 117740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 119389 118376 gene locus_tag LOCUS_53880 119389 118376 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027388.1 protein_id gnl|my_center|LOCUS_53880 120129 119431 gene locus_tag LOCUS_53890 120129 119431 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230779.1 protein_id gnl|my_center|LOCUS_53890 122377 120305 gene locus_tag LOCUS_53900 122377 120305 CDS product NPCBM/NEW2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222766.1 protein_id gnl|my_center|LOCUS_53900 122725 123951 gene locus_tag LOCUS_53910 122725 123951 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059698.1 protein_id gnl|my_center|LOCUS_53910 124039 126234 gene locus_tag LOCUS_53920 124039 126234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 126293 128695 gene locus_tag LOCUS_53930 126293 128695 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_53930 129879 128962 gene locus_tag LOCUS_53940 129879 128962 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338290.1 protein_id gnl|my_center|LOCUS_53940 130805 129906 gene locus_tag LOCUS_53950 130805 129906 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170674.1 protein_id gnl|my_center|LOCUS_53950 131839 130802 gene locus_tag LOCUS_53960 131839 130802 CDS product glucosamine--fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336747.1 protein_id gnl|my_center|LOCUS_53960 132871 132059 gene locus_tag LOCUS_53970 132871 132059 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089169.1 protein_id gnl|my_center|LOCUS_53970 133897 132908 gene locus_tag LOCUS_53980 133897 132908 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_53980 134688 133894 gene locus_tag LOCUS_53990 134688 133894 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804037.1 protein_id gnl|my_center|LOCUS_53990 135419 134685 gene locus_tag LOCUS_54000 135419 134685 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067164.1 protein_id gnl|my_center|LOCUS_54000 137191 135521 gene locus_tag LOCUS_54010 137191 135521 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804066.1 protein_id gnl|my_center|LOCUS_54010 138109 137216 gene locus_tag LOCUS_54020 138109 137216 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804067.1 protein_id gnl|my_center|LOCUS_54020 139080 138106 gene locus_tag LOCUS_54030 139080 138106 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804968.1 protein_id gnl|my_center|LOCUS_54030 139262 140896 gene locus_tag LOCUS_54040 139262 140896 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_54040 140941 142320 gene locus_tag LOCUS_54050 140941 142320 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230096.1 protein_id gnl|my_center|LOCUS_54050 142317 144038 gene locus_tag LOCUS_54060 142317 144038 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706887.1 protein_id gnl|my_center|LOCUS_54060 144049 144657 gene locus_tag LOCUS_54070 144049 144657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 145237 144731 gene locus_tag LOCUS_54080 145237 144731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 146723 145290 gene locus_tag LOCUS_54090 146723 145290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_54090 146965 149214 gene locus_tag LOCUS_54100 146965 149214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 149211 149858 gene locus_tag LOCUS_54110 149211 149858 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_54110 149943 150455 gene locus_tag LOCUS_54120 149943 150455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 150452 150916 gene locus_tag LOCUS_54130 150452 150916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 150929 152416 gene locus_tag LOCUS_54140 150929 152416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 152509 153189 gene locus_tag LOCUS_54150 152509 153189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 153186 153854 gene locus_tag LOCUS_54160 153186 153854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 156128 153885 gene locus_tag LOCUS_54170 156128 153885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 157845 156364 gene locus_tag LOCUS_54180 157845 156364 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777125.1 protein_id gnl|my_center|LOCUS_54180 158116 157829 gene locus_tag LOCUS_54190 158116 157829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 159270 158113 gene locus_tag LOCUS_54200 159270 158113 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777123.1 protein_id gnl|my_center|LOCUS_54200 159818 159267 gene locus_tag LOCUS_54210 159818 159267 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327688.1 protein_id gnl|my_center|LOCUS_54210 160948 159947 gene locus_tag LOCUS_54220 160948 159947 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030800.1 protein_id gnl|my_center|LOCUS_54220 161850 160945 gene locus_tag LOCUS_54230 161850 160945 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030799.1 protein_id gnl|my_center|LOCUS_54230 163015 161945 gene locus_tag LOCUS_54240 163015 161945 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 protein_id gnl|my_center|LOCUS_54240 163231 164847 gene locus_tag LOCUS_54250 163231 164847 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965798.1 protein_id gnl|my_center|LOCUS_54250 164844 165803 gene locus_tag LOCUS_54260 164844 165803 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085651.1 protein_id gnl|my_center|LOCUS_54260 165796 166683 gene locus_tag LOCUS_54270 165796 166683 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811978.1 protein_id gnl|my_center|LOCUS_54270 166680 167669 gene locus_tag LOCUS_54280 166680 167669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966002.1 protein_id gnl|my_center|LOCUS_54280 167666 168658 gene locus_tag LOCUS_54290 167666 168658 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_54290 168683 170539 gene locus_tag LOCUS_54300 168683 170539 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085656.1 protein_id gnl|my_center|LOCUS_54300 171425 170688 gene locus_tag LOCUS_54310 171425 170688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 173628 171892 gene locus_tag LOCUS_54320 173628 171892 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_54320 >Feature sequence29 814 14 gene locus_tag LOCUS_54330 814 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974416.1 protein_id gnl|my_center|LOCUS_54330 1722 817 gene locus_tag LOCUS_54340 1722 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 1938 2198 gene locus_tag LOCUS_54350 1938 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 2341 6780 gene locus_tag LOCUS_54360 2341 6780 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029700.1 protein_id gnl|my_center|LOCUS_54360 7180 6908 gene locus_tag LOCUS_54370 7180 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 7331 9115 gene locus_tag LOCUS_54380 7331 9115 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_54380 9378 10766 gene locus_tag LOCUS_54390 9378 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973466.1 protein_id gnl|my_center|LOCUS_54390 11348 12547 gene locus_tag LOCUS_54400 11348 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 13924 12524 gene locus_tag LOCUS_54410 13924 12524 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_54410 14049 14510 gene locus_tag LOCUS_54420 14049 14510 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222831.1 protein_id gnl|my_center|LOCUS_54420 14554 15387 gene locus_tag LOCUS_54430 14554 15387 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222820.1 protein_id gnl|my_center|LOCUS_54430 15416 17065 gene locus_tag LOCUS_54440 15416 17065 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_54440 17672 17073 gene locus_tag LOCUS_54450 17672 17073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 18757 17669 gene locus_tag LOCUS_54460 18757 17669 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_54460 19190 18837 gene locus_tag LOCUS_54470 19190 18837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 19593 19204 gene locus_tag LOCUS_54480 19593 19204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227878.1 protein_id gnl|my_center|LOCUS_54480 19661 20020 gene locus_tag LOCUS_54490 19661 20020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 20017 22206 gene locus_tag LOCUS_54500 20017 22206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 23667 22252 gene locus_tag LOCUS_54510 23667 22252 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229300.1 protein_id gnl|my_center|LOCUS_54510 23776 24246 gene locus_tag LOCUS_54520 23776 24246 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229301.1 protein_id gnl|my_center|LOCUS_54520 25542 24256 gene locus_tag LOCUS_54530 25542 24256 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_54530 25940 25551 gene locus_tag LOCUS_54540 25940 25551 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974083.1 protein_id gnl|my_center|LOCUS_54540 27208 25937 gene locus_tag LOCUS_54550 27208 25937 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 protein_id gnl|my_center|LOCUS_54550 28400 27276 gene locus_tag LOCUS_54560 28400 27276 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222770.1 protein_id gnl|my_center|LOCUS_54560 29773 28397 gene locus_tag LOCUS_54570 29773 28397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974086.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54570 29657 29977 gene locus_tag LOCUS_54580 29657 29977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 31064 30030 gene locus_tag LOCUS_54590 31064 30030 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222768.1 protein_id gnl|my_center|LOCUS_54590 32273 31254 gene locus_tag LOCUS_54600 32273 31254 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222768.1 protein_id gnl|my_center|LOCUS_54600 32605 33852 gene locus_tag LOCUS_54610 32605 33852 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_54610 35166 33922 gene locus_tag LOCUS_54620 35166 33922 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029925.1 protein_id gnl|my_center|LOCUS_54620 36581 35409 gene locus_tag LOCUS_54630 36581 35409 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 protein_id gnl|my_center|LOCUS_54630 36783 36610 gene locus_tag LOCUS_54640 36783 36610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 36909 38219 gene locus_tag LOCUS_54650 36909 38219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 39151 38210 gene locus_tag LOCUS_54660 39151 38210 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974125.1 protein_id gnl|my_center|LOCUS_54660 40231 39227 gene locus_tag LOCUS_54670 gene trpS 40231 39227 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_54670 41609 40275 gene locus_tag LOCUS_54680 41609 40275 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113973.1 protein_id gnl|my_center|LOCUS_54680 41776 42738 gene locus_tag LOCUS_54690 gene galE 41776 42738 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224287.1 protein_id gnl|my_center|LOCUS_54690 43618 42788 gene locus_tag LOCUS_54700 43618 42788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 45160 43715 gene locus_tag LOCUS_54710 45160 43715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 45216 45779 gene locus_tag LOCUS_54720 gene padR 45216 45779 CDS product transcriptional regulator PadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233588.1 protein_id gnl|my_center|LOCUS_54720 47899 45776 gene locus_tag LOCUS_54730 47899 45776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54730 49338 48121 gene locus_tag LOCUS_54740 49338 48121 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222746.1 protein_id gnl|my_center|LOCUS_54740 49719 49432 gene locus_tag LOCUS_54750 49719 49432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 50851 49730 gene locus_tag LOCUS_54760 50851 49730 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403266.1 protein_id gnl|my_center|LOCUS_54760 51033 51689 gene locus_tag LOCUS_54770 51033 51689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 52170 51700 gene locus_tag LOCUS_54780 52170 51700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54780 52735 52163 gene locus_tag LOCUS_54790 52735 52163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 53569 52742 gene locus_tag LOCUS_54800 53569 52742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 54907 53591 gene locus_tag LOCUS_54810 54907 53591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 55026 55274 gene locus_tag LOCUS_54820 55026 55274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 56236 55391 gene locus_tag LOCUS_54830 56236 55391 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_54830 57843 56299 gene locus_tag LOCUS_54840 gene purH 57843 56299 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222720.1 protein_id gnl|my_center|LOCUS_54840 58513 57911 gene locus_tag LOCUS_54850 gene purN 58513 57911 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_54850 58623 59105 gene locus_tag LOCUS_54860 58623 59105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 >Feature sequence30 1764 130 gene locus_tag LOCUS_54870 1764 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 3214 2339 gene locus_tag LOCUS_54880 gene sucD 3214 2339 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974163.1 protein_id gnl|my_center|LOCUS_54880 4395 3214 gene locus_tag LOCUS_54890 gene sucC 4395 3214 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974164.1 protein_id gnl|my_center|LOCUS_54890 4955 4554 gene locus_tag LOCUS_54900 4955 4554 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_54900 7377 5131 gene locus_tag LOCUS_54910 gene pcrA 7377 5131 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_54910 7473 8192 gene locus_tag LOCUS_54920 7473 8192 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_54920 8313 9050 gene locus_tag LOCUS_54930 8313 9050 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227890.1 protein_id gnl|my_center|LOCUS_54930 9815 9069 gene locus_tag LOCUS_54940 9815 9069 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228660.1 protein_id gnl|my_center|LOCUS_54940 10559 9852 gene locus_tag LOCUS_54950 10559 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 12025 10565 gene locus_tag LOCUS_54960 12025 10565 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_54960 12803 12165 gene locus_tag LOCUS_54970 12803 12165 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_54970 13993 12803 gene locus_tag LOCUS_54980 13993 12803 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 protein_id gnl|my_center|LOCUS_54980 14618 14367 gene locus_tag LOCUS_54990 14618 14367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 14873 16456 gene locus_tag LOCUS_55000 14873 16456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 16518 16670 gene locus_tag LOCUS_55010 16518 16670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 16774 17250 gene locus_tag LOCUS_55020 16774 17250 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_55020 17271 19658 gene locus_tag LOCUS_55030 17271 19658 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_55030 19655 20530 gene locus_tag LOCUS_55040 19655 20530 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_55040 20738 21550 gene locus_tag LOCUS_55050 20738 21550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 22748 21708 gene locus_tag LOCUS_55060 22748 21708 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_55060 23755 22868 gene locus_tag LOCUS_55070 23755 22868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 23821 25491 gene locus_tag LOCUS_55080 23821 25491 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030600.1 protein_id gnl|my_center|LOCUS_55080 26999 25458 gene locus_tag LOCUS_55090 26999 25458 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908308.1 protein_id gnl|my_center|LOCUS_55090 29998 26996 gene locus_tag LOCUS_55100 29998 26996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 33365 30018 gene locus_tag LOCUS_55110 33365 30018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 34938 33418 gene locus_tag LOCUS_55120 34938 33418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 36428 35022 gene locus_tag LOCUS_55130 36428 35022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 38257 36434 gene locus_tag LOCUS_55140 38257 36434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 39602 38397 gene locus_tag LOCUS_55150 39602 38397 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039282280.1 protein_id gnl|my_center|LOCUS_55150 41477 39930 gene locus_tag LOCUS_55160 gene guaA 41477 39930 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_55160 43307 41637 gene locus_tag LOCUS_55170 43307 41637 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086844353.1 protein_id gnl|my_center|LOCUS_55170 44872 43316 gene locus_tag LOCUS_55180 44872 43316 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_55180 44984 46960 gene locus_tag LOCUS_55190 44984 46960 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_55190 48698 46968 gene locus_tag LOCUS_55200 48698 46968 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_55200 48936 50072 gene locus_tag LOCUS_55210 gene nagA 48936 50072 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 protein_id gnl|my_center|LOCUS_55210 51223 50105 gene locus_tag LOCUS_55220 51223 50105 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_55220 52797 51316 gene locus_tag LOCUS_55230 gene guaB 52797 51316 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222684.1 protein_id gnl|my_center|LOCUS_55230 53369 54364 gene locus_tag LOCUS_55240 53369 54364 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485134.1 protein_id gnl|my_center|LOCUS_55240 54474 54851 gene locus_tag LOCUS_55250 54474 54851 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003073549.1 protein_id gnl|my_center|LOCUS_55250 55033 54812 gene locus_tag LOCUS_55260 55033 54812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55260 55686 55030 gene locus_tag LOCUS_55270 55686 55030 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974204.1 protein_id gnl|my_center|LOCUS_55270 57525 55900 gene locus_tag LOCUS_55280 gene groL 57525 55900 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_55280 57907 57596 gene locus_tag LOCUS_55290 gene groES 57907 57596 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056050.1 protein_id gnl|my_center|LOCUS_55290 58292 59569 gene locus_tag LOCUS_55300 58292 59569 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_55300 59734 60546 gene locus_tag LOCUS_55310 59734 60546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 61610 60573 gene locus_tag LOCUS_55320 gene tsaD 61610 60573 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_55320 62103 61597 gene locus_tag LOCUS_55330 gene rimI 62103 61597 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_55330 62813 62100 gene locus_tag LOCUS_55340 gene tsaB 62813 62100 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_55340 63501 62947 gene locus_tag LOCUS_55350 63501 62947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 64139 63504 gene locus_tag LOCUS_55360 64139 63504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 66617 64287 gene locus_tag LOCUS_55370 66617 64287 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327169.1 protein_id gnl|my_center|LOCUS_55370 67309 66614 gene locus_tag LOCUS_55380 67309 66614 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_55380 67830 67306 gene locus_tag LOCUS_55390 67830 67306 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_55390 68413 67928 gene locus_tag LOCUS_55400 gene tsaE 68413 67928 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_55400 69456 68410 gene locus_tag LOCUS_55410 69456 68410 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_55410 70627 69482 gene locus_tag LOCUS_55420 gene alr 70627 69482 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_55420 72210 70714 gene locus_tag LOCUS_55430 72210 70714 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_55430 72616 72272 gene locus_tag LOCUS_55440 72616 72272 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_55440 72798 73721 gene locus_tag LOCUS_55450 gene coaA 72798 73721 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222129.1 protein_id gnl|my_center|LOCUS_55450 73740 74702 gene locus_tag LOCUS_55460 73740 74702 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082376.1 protein_id gnl|my_center|LOCUS_55460 74792 75721 gene locus_tag LOCUS_55470 74792 75721 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_55470 75718 76587 gene locus_tag LOCUS_55480 75718 76587 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974986.1 protein_id gnl|my_center|LOCUS_55480 76584 77537 gene locus_tag LOCUS_55490 76584 77537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_55490 77584 78300 gene locus_tag LOCUS_55500 77584 78300 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974984.1 protein_id gnl|my_center|LOCUS_55500 79741 78386 gene locus_tag LOCUS_55510 gene glmM 79741 78386 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_55510 80264 79743 gene locus_tag LOCUS_55520 gene rpsI 80264 79743 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_55520 80738 80295 gene locus_tag LOCUS_55530 gene rplM 80738 80295 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_55530 81094 81792 gene locus_tag LOCUS_55540 81094 81792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 81873 83090 gene locus_tag LOCUS_55550 81873 83090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 83209 86226 gene locus_tag LOCUS_55560 83209 86226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55560 87154 86216 gene locus_tag LOCUS_55570 gene truA 87154 86216 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086862314.1 protein_id gnl|my_center|LOCUS_55570 87821 87297 gene locus_tag LOCUS_55580 87821 87297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 88937 87921 gene locus_tag LOCUS_55590 88937 87921 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_55590 89724 89098 gene locus_tag LOCUS_55600 gene rpsD 89724 89098 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 protein_id gnl|my_center|LOCUS_55600 90148 89744 gene locus_tag LOCUS_55610 gene rpsK 90148 89744 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_55610 90680 90183 gene locus_tag LOCUS_55620 90680 90183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 91194 90973 gene locus_tag LOCUS_55630 gene infA 91194 90973 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_55630 92076 91627 gene locus_tag LOCUS_55640 92076 91627 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190249366.1 protein_id gnl|my_center|LOCUS_55640 92964 92137 gene locus_tag LOCUS_55650 gene map 92964 92137 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_55650 93703 93050 gene locus_tag LOCUS_55660 93703 93050 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_55660 95010 93703 gene locus_tag LOCUS_55670 gene secY 95010 93703 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_55670 95646 95191 gene locus_tag LOCUS_55680 gene rplO 95646 95191 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_55680 95831 95649 gene locus_tag LOCUS_55690 gene rpmD 95831 95649 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776359.1 protein_id gnl|my_center|LOCUS_55690 96464 95835 gene locus_tag LOCUS_55700 gene rpsE 96464 95835 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_55700 96888 96505 gene locus_tag LOCUS_55710 gene rplR 96888 96505 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974252.1 protein_id gnl|my_center|LOCUS_55710 97433 96891 gene locus_tag LOCUS_55720 gene rplF 97433 96891 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_55720 97850 97452 gene locus_tag LOCUS_55730 gene rpsH 97850 97452 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_55730 98157 97972 gene locus_tag LOCUS_55740 98157 97972 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_55740 98729 98160 gene locus_tag LOCUS_55750 gene rplE 98729 98160 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_55750 99049 98729 gene locus_tag LOCUS_55760 99049 98729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 99418 99050 gene locus_tag LOCUS_55770 gene rplN 99418 99050 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_55770 99883 99599 gene locus_tag LOCUS_55780 gene rpsQ 99883 99599 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_55780 100112 99876 gene locus_tag LOCUS_55790 gene rpmC 100112 99876 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_55790 100531 100112 gene locus_tag LOCUS_55800 gene rplP 100531 100112 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558864.1 protein_id gnl|my_center|LOCUS_55800 101397 100534 gene locus_tag LOCUS_55810 101397 100534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 101756 101397 gene locus_tag LOCUS_55820 gene rplV 101756 101397 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974262.1 protein_id gnl|my_center|LOCUS_55820 102067 101789 gene locus_tag LOCUS_55830 gene rpsS 102067 101789 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892827.1 protein_id gnl|my_center|LOCUS_55830 102915 102079 gene locus_tag LOCUS_55840 gene rplB 102915 102079 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_55840 103347 103045 gene locus_tag LOCUS_55850 gene rplW 103347 103045 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403581.1 protein_id gnl|my_center|LOCUS_55850 103994 103347 gene locus_tag LOCUS_55860 gene rplD 103994 103347 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974266.1 protein_id gnl|my_center|LOCUS_55860 104644 103991 gene locus_tag LOCUS_55870 gene rplC 104644 103991 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_55870 105009 104659 gene locus_tag LOCUS_55880 gene rpsJ 105009 104659 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_55880 106403 105210 gene locus_tag LOCUS_55890 gene tuf 106403 105210 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_55890 108669 106570 gene locus_tag LOCUS_55900 gene fusA 108669 106570 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974302.1 protein_id gnl|my_center|LOCUS_55900 109179 108709 gene locus_tag LOCUS_55910 gene rpsG 109179 108709 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776385.1 protein_id gnl|my_center|LOCUS_55910 109660 109181 gene locus_tag LOCUS_55920 gene rpsL 109660 109181 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_55920 113971 110096 gene locus_tag LOCUS_55930 113971 110096 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_55930 >Feature sequence31 243 458 gene locus_tag LOCUS_55940 243 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 1286 681 gene locus_tag LOCUS_55950 1286 681 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269997.1 protein_id gnl|my_center|LOCUS_55950 2164 1685 gene locus_tag LOCUS_55960 2164 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 2784 2161 gene locus_tag LOCUS_55970 2784 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 3625 4323 gene locus_tag LOCUS_55980 3625 4323 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230072.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55980 5276 4926 gene locus_tag LOCUS_55990 5276 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 5588 6241 gene locus_tag LOCUS_56000 5588 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 6806 6534 gene locus_tag LOCUS_56010 6806 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 8251 6824 gene locus_tag LOCUS_56020 8251 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 8449 9186 gene locus_tag LOCUS_56030 8449 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 9442 9792 gene locus_tag LOCUS_56040 9442 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 10433 9951 gene locus_tag LOCUS_56050 10433 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 10636 11454 gene locus_tag LOCUS_56060 10636 11454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 11546 11734 gene locus_tag LOCUS_56070 11546 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 12198 12019 gene locus_tag LOCUS_56080 12198 12019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 12178 12978 gene locus_tag LOCUS_56090 12178 12978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56090 14450 13374 gene locus_tag LOCUS_56100 14450 13374 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000362.1 protein_id gnl|my_center|LOCUS_56100 14536 15282 gene locus_tag LOCUS_56110 14536 15282 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224871.1 protein_id gnl|my_center|LOCUS_56110 16095 15949 gene locus_tag LOCUS_56120 16095 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56120 16729 16430 gene locus_tag LOCUS_56130 16729 16430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56130 18621 17821 gene locus_tag LOCUS_56140 18621 17821 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028225.1 protein_id gnl|my_center|LOCUS_56140 18914 18615 gene locus_tag LOCUS_56150 18914 18615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56150 19006 19578 gene locus_tag LOCUS_56160 19006 19578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 20410 19823 gene locus_tag LOCUS_56170 20410 19823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56170 21156 20443 gene locus_tag LOCUS_56180 21156 20443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 21687 22178 gene locus_tag LOCUS_56190 21687 22178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 22535 23287 gene locus_tag LOCUS_56200 22535 23287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 23540 24064 gene locus_tag LOCUS_56210 23540 24064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 24381 24130 gene locus_tag LOCUS_56220 24381 24130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 24723 25139 gene locus_tag LOCUS_56230 24723 25139 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228199.1 protein_id gnl|my_center|LOCUS_56230 25139 26353 gene locus_tag LOCUS_56240 25139 26353 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228198.1 protein_id gnl|my_center|LOCUS_56240 27435 26518 gene locus_tag LOCUS_56250 27435 26518 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029194.1 protein_id gnl|my_center|LOCUS_56250 27930 27436 gene locus_tag LOCUS_56260 27930 27436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56260 28308 28649 gene locus_tag LOCUS_56270 28308 28649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265779.1 protein_id gnl|my_center|LOCUS_56270 28831 29463 gene locus_tag LOCUS_56280 28831 29463 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404111.1 protein_id gnl|my_center|LOCUS_56280 30574 29570 gene locus_tag LOCUS_56290 30574 29570 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896541.1 protein_id gnl|my_center|LOCUS_56290 31719 30757 gene locus_tag LOCUS_56300 31719 30757 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082015379.1 protein_id gnl|my_center|LOCUS_56300 32836 31973 gene locus_tag LOCUS_56310 32836 31973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56310 33815 32946 gene locus_tag LOCUS_56320 33815 32946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229910.1 protein_id gnl|my_center|LOCUS_56320 34270 34674 gene locus_tag LOCUS_56330 34270 34674 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 protein_id gnl|my_center|LOCUS_56330 35248 34856 gene locus_tag LOCUS_56340 35248 34856 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 protein_id gnl|my_center|LOCUS_56340 35856 35434 gene locus_tag LOCUS_56350 35856 35434 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972459.1 protein_id gnl|my_center|LOCUS_56350 36725 35853 gene locus_tag LOCUS_56360 gene sigJ 36725 35853 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 protein_id gnl|my_center|LOCUS_56360 36865 37278 gene locus_tag LOCUS_56370 36865 37278 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893670.1 protein_id gnl|my_center|LOCUS_56370 38386 37478 gene locus_tag LOCUS_56380 38386 37478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 39233 38817 gene locus_tag LOCUS_56390 39233 38817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56390 39717 40706 gene locus_tag LOCUS_56400 39717 40706 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733219.1 protein_id gnl|my_center|LOCUS_56400 41582 40932 gene locus_tag LOCUS_56410 41582 40932 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105916.1 protein_id gnl|my_center|LOCUS_56410 41881 42303 gene locus_tag LOCUS_56420 41881 42303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 43035 42328 gene locus_tag LOCUS_56430 43035 42328 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229950.1 protein_id gnl|my_center|LOCUS_56430 43139 44077 gene locus_tag LOCUS_56440 43139 44077 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229949.1 protein_id gnl|my_center|LOCUS_56440 44220 44720 gene locus_tag LOCUS_56450 44220 44720 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030665.1 protein_id gnl|my_center|LOCUS_56450 45834 44956 gene locus_tag LOCUS_56460 45834 44956 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226961.1 protein_id gnl|my_center|LOCUS_56460 46781 45831 gene locus_tag LOCUS_56470 46781 45831 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222262.1 protein_id gnl|my_center|LOCUS_56470 47017 47745 gene locus_tag LOCUS_56480 47017 47745 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088525.1 protein_id gnl|my_center|LOCUS_56480 49995 47842 gene locus_tag LOCUS_56490 49995 47842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56490 50716 51474 gene locus_tag LOCUS_56500 50716 51474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 51777 52598 gene locus_tag LOCUS_56510 51777 52598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 53413 52655 gene locus_tag LOCUS_56520 53413 52655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 53657 53956 gene locus_tag LOCUS_56530 53657 53956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 54669 54028 gene locus_tag LOCUS_56540 54669 54028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 55181 55693 gene locus_tag LOCUS_56550 55181 55693 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228216.1 protein_id gnl|my_center|LOCUS_56550 55690 56790 gene locus_tag LOCUS_56560 55690 56790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072482346.1 protein_id gnl|my_center|LOCUS_56560 57486 57082 gene locus_tag LOCUS_56570 57486 57082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 57380 57592 gene locus_tag LOCUS_56580 57380 57592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 59101 57866 gene locus_tag LOCUS_56590 gene nhaA 59101 57866 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026778.1 protein_id gnl|my_center|LOCUS_56590 59367 59197 gene locus_tag LOCUS_56600 59367 59197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 59568 60002 gene locus_tag LOCUS_56610 59568 60002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56610 60796 60074 gene locus_tag LOCUS_56620 60796 60074 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031806.1 protein_id gnl|my_center|LOCUS_56620 61372 60962 gene locus_tag LOCUS_56630 61372 60962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56630 62057 61389 gene locus_tag LOCUS_56640 62057 61389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 61996 62379 gene locus_tag LOCUS_56650 61996 62379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 62910 62470 gene locus_tag LOCUS_56660 62910 62470 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085007.1 protein_id gnl|my_center|LOCUS_56660 64078 63044 gene locus_tag LOCUS_56670 64078 63044 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092172.1 protein_id gnl|my_center|LOCUS_56670 64398 64075 gene locus_tag LOCUS_56680 64398 64075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 64330 64827 gene locus_tag LOCUS_56690 64330 64827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 65963 64860 gene locus_tag LOCUS_56700 65963 64860 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031517.1 protein_id gnl|my_center|LOCUS_56700 66238 65978 gene locus_tag LOCUS_56710 66238 65978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 66119 66622 gene locus_tag LOCUS_56720 66119 66622 CDS product aminoglycoside nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123821061.1 protein_id gnl|my_center|LOCUS_56720 67653 66709 gene locus_tag LOCUS_56730 67653 66709 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485278.1 protein_id gnl|my_center|LOCUS_56730 67799 68323 gene locus_tag LOCUS_56740 67799 68323 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091310114.1 protein_id gnl|my_center|LOCUS_56740 68898 68410 gene locus_tag LOCUS_56750 68898 68410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 70204 68990 gene locus_tag LOCUS_56760 70204 68990 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285235.1 protein_id gnl|my_center|LOCUS_56760 71584 70481 gene locus_tag LOCUS_56770 71584 70481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224572.1 protein_id gnl|my_center|LOCUS_56770 71863 72741 gene locus_tag LOCUS_56780 71863 72741 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 protein_id gnl|my_center|LOCUS_56780 73106 72627 gene locus_tag LOCUS_56790 73106 72627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 73961 73143 gene locus_tag LOCUS_56800 73961 73143 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031499.1 protein_id gnl|my_center|LOCUS_56800 75257 74241 gene locus_tag LOCUS_56810 75257 74241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 75430 76344 gene locus_tag LOCUS_56820 75430 76344 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296810.1 protein_id gnl|my_center|LOCUS_56820 76879 76358 gene locus_tag LOCUS_56830 76879 76358 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028479.1 protein_id gnl|my_center|LOCUS_56830 77144 76947 gene locus_tag LOCUS_56840 77144 76947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 77053 78297 gene locus_tag LOCUS_56850 77053 78297 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226215.1 protein_id gnl|my_center|LOCUS_56850 78459 79874 gene locus_tag LOCUS_56860 78459 79874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 80209 80039 gene locus_tag LOCUS_56870 80209 80039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 80130 80573 gene locus_tag LOCUS_56880 80130 80573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226389.1 protein_id gnl|my_center|LOCUS_56880 80617 81891 gene locus_tag LOCUS_56890 80617 81891 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870027.1 protein_id gnl|my_center|LOCUS_56890 81888 82562 gene locus_tag LOCUS_56900 81888 82562 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_56900 83450 82566 gene locus_tag LOCUS_56910 83450 82566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 84255 83554 gene locus_tag LOCUS_56920 84255 83554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56920 84977 84327 gene locus_tag LOCUS_56930 84977 84327 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 protein_id gnl|my_center|LOCUS_56930 86137 84968 gene locus_tag LOCUS_56940 86137 84968 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029800.1 protein_id gnl|my_center|LOCUS_56940 86479 86255 gene locus_tag LOCUS_56950 86479 86255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 87022 86669 gene locus_tag LOCUS_56960 87022 86669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 87209 87694 gene locus_tag LOCUS_56970 87209 87694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 87908 88543 gene locus_tag LOCUS_56980 87908 88543 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225120.1 protein_id gnl|my_center|LOCUS_56980 89052 88555 gene locus_tag LOCUS_56990 89052 88555 CDS product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978065.1 protein_id gnl|my_center|LOCUS_56990 89128 89697 gene locus_tag LOCUS_57000 89128 89697 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284050.1 protein_id gnl|my_center|LOCUS_57000 90110 89736 gene locus_tag LOCUS_57010 gene crcB 90110 89736 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031399.1 protein_id gnl|my_center|LOCUS_57010 90454 90107 gene locus_tag LOCUS_57020 90454 90107 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972099.1 protein_id gnl|my_center|LOCUS_57020 90924 90451 gene locus_tag LOCUS_57030 gene crcB 90924 90451 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031398.1 protein_id gnl|my_center|LOCUS_57030 91246 91737 gene locus_tag LOCUS_57040 91246 91737 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261973.1 protein_id gnl|my_center|LOCUS_57040 92667 91777 gene locus_tag LOCUS_57050 92667 91777 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087636.1 protein_id gnl|my_center|LOCUS_57050 94057 92705 gene locus_tag LOCUS_57060 94057 92705 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851586.1 protein_id gnl|my_center|LOCUS_57060 94023 94178 gene locus_tag LOCUS_57070 94023 94178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57070 94349 94660 gene locus_tag LOCUS_57080 94349 94660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 94657 94890 gene locus_tag LOCUS_57090 94657 94890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 95053 97293 gene locus_tag LOCUS_57100 95053 97293 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030648.1 protein_id gnl|my_center|LOCUS_57100 98327 97320 gene locus_tag LOCUS_57110 98327 97320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57110 98645 98415 gene locus_tag LOCUS_57120 98645 98415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 98803 99630 gene locus_tag LOCUS_57130 98803 99630 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971433.1 protein_id gnl|my_center|LOCUS_57130 99784 100509 gene locus_tag LOCUS_57140 99784 100509 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862685.1 protein_id gnl|my_center|LOCUS_57140 101135 100542 gene locus_tag LOCUS_57150 101135 100542 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230536.1 protein_id gnl|my_center|LOCUS_57150 102467 101397 gene locus_tag LOCUS_57160 102467 101397 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088246.1 protein_id gnl|my_center|LOCUS_57160 103256 102594 gene locus_tag LOCUS_57170 103256 102594 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974444.1 protein_id gnl|my_center|LOCUS_57170 103682 103296 gene locus_tag LOCUS_57180 103682 103296 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866702.1 protein_id gnl|my_center|LOCUS_57180 104050 103688 gene locus_tag LOCUS_57190 104050 103688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57190 104195 105097 gene locus_tag LOCUS_57200 104195 105097 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123743405.1 protein_id gnl|my_center|LOCUS_57200 106812 105079 gene locus_tag LOCUS_57210 106812 105079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226966.1 protein_id gnl|my_center|LOCUS_57210 107023 107793 gene locus_tag LOCUS_57220 107023 107793 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263481.1 protein_id gnl|my_center|LOCUS_57220 107885 108649 gene locus_tag LOCUS_57230 107885 108649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 108912 109832 gene locus_tag LOCUS_57240 108912 109832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 110667 109939 gene locus_tag LOCUS_57250 110667 109939 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030303.1 protein_id gnl|my_center|LOCUS_57250 111326 110736 gene locus_tag LOCUS_57260 111326 110736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 112185 111367 gene locus_tag LOCUS_57270 112185 111367 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727349.1 protein_id gnl|my_center|LOCUS_57270 112329 114791 gene locus_tag LOCUS_57280 112329 114791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 115323 114805 gene locus_tag LOCUS_57290 115323 114805 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031191.1 protein_id gnl|my_center|LOCUS_57290 115916 115335 gene locus_tag LOCUS_57300 115916 115335 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972196.1 protein_id gnl|my_center|LOCUS_57300 116044 116760 gene locus_tag LOCUS_57310 116044 116760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 116822 117100 gene locus_tag LOCUS_57320 116822 117100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57320 117739 117146 gene locus_tag LOCUS_57330 117739 117146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226778.1 protein_id gnl|my_center|LOCUS_57330 118687 117854 gene locus_tag LOCUS_57340 118687 117854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57340 119631 118774 gene locus_tag LOCUS_57350 119631 118774 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_57350 119912 120562 gene locus_tag LOCUS_57360 119912 120562 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486110.1 protein_id gnl|my_center|LOCUS_57360 121136 120597 gene locus_tag LOCUS_57370 121136 120597 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975821.1 protein_id gnl|my_center|LOCUS_57370 122051 121170 gene locus_tag LOCUS_57380 122051 121170 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228232.1 protein_id gnl|my_center|LOCUS_57380 122593 122072 gene locus_tag LOCUS_57390 122593 122072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57390 122673 123140 gene locus_tag LOCUS_57400 122673 123140 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227660.1 protein_id gnl|my_center|LOCUS_57400 123299 125605 gene locus_tag LOCUS_57410 123299 125605 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029087.1 protein_id gnl|my_center|LOCUS_57410 127247 125691 gene locus_tag LOCUS_57420 gene paaP 127247 125691 CDS product aminopeptidase PaaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101464.1 protein_id gnl|my_center|LOCUS_57420 127395 127778 gene locus_tag LOCUS_57430 127395 127778 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897009.1 protein_id gnl|my_center|LOCUS_57430 127775 128464 gene locus_tag LOCUS_57440 127775 128464 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977985.1 protein_id gnl|my_center|LOCUS_57440 129335 128496 gene locus_tag LOCUS_57450 129335 128496 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729466.1 protein_id gnl|my_center|LOCUS_57450 130295 129348 gene locus_tag LOCUS_57460 130295 129348 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916599.1 protein_id gnl|my_center|LOCUS_57460 130915 130292 gene locus_tag LOCUS_57470 130915 130292 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027391.1 protein_id gnl|my_center|LOCUS_57470 132101 130950 gene locus_tag LOCUS_57480 gene dgoD 132101 130950 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230776.1 protein_id gnl|my_center|LOCUS_57480 132796 132098 gene locus_tag LOCUS_57490 132796 132098 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230779.1 protein_id gnl|my_center|LOCUS_57490 133714 132884 gene locus_tag LOCUS_57500 133714 132884 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524829.1 protein_id gnl|my_center|LOCUS_57500 134646 133711 gene locus_tag LOCUS_57510 134646 133711 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530308.1 protein_id gnl|my_center|LOCUS_57510 135938 134649 gene locus_tag LOCUS_57520 135938 134649 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 protein_id gnl|my_center|LOCUS_57520 137073 136255 gene locus_tag LOCUS_57530 137073 136255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 138175 137204 gene locus_tag LOCUS_57540 138175 137204 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 protein_id gnl|my_center|LOCUS_57540 139650 138265 gene locus_tag LOCUS_57550 139650 138265 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_57550 140480 139647 gene locus_tag LOCUS_57560 140480 139647 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224316.1 protein_id gnl|my_center|LOCUS_57560 141436 140477 gene locus_tag LOCUS_57570 141436 140477 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224315.1 protein_id gnl|my_center|LOCUS_57570 142804 141512 gene locus_tag LOCUS_57580 142804 141512 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 protein_id gnl|my_center|LOCUS_57580 143164 145332 gene locus_tag LOCUS_57590 143164 145332 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227075.1 protein_id gnl|my_center|LOCUS_57590 145438 146751 gene locus_tag LOCUS_57600 145438 146751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57600 147198 146836 gene locus_tag LOCUS_57610 147198 146836 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_57610 147338 148351 gene locus_tag LOCUS_57620 147338 148351 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_57620 148323 149108 gene locus_tag LOCUS_57630 148323 149108 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969730.1 protein_id gnl|my_center|LOCUS_57630 149262 150524 gene locus_tag LOCUS_57640 149262 150524 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031686.1 protein_id gnl|my_center|LOCUS_57640 151220 150666 gene locus_tag LOCUS_57650 151220 150666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57650 151346 152428 gene locus_tag LOCUS_57660 151346 152428 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970799.1 protein_id gnl|my_center|LOCUS_57660 152535 153350 gene locus_tag LOCUS_57670 152535 153350 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_57670 153750 153376 gene locus_tag LOCUS_57680 153750 153376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57680 153989 154264 gene locus_tag LOCUS_57690 153989 154264 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062094.1 protein_id gnl|my_center|LOCUS_57690 154843 154370 gene locus_tag LOCUS_57700 154843 154370 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028645.1 protein_id gnl|my_center|LOCUS_57700 155833 154976 gene locus_tag LOCUS_57710 155833 154976 CDS product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 protein_id gnl|my_center|LOCUS_57710 156717 155830 gene locus_tag LOCUS_57720 156717 155830 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812031.1 protein_id gnl|my_center|LOCUS_57720 157484 156714 gene locus_tag LOCUS_57730 gene mntB 157484 156714 CDS product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 protein_id gnl|my_center|LOCUS_57730 158443 157481 gene locus_tag LOCUS_57740 gene aztC 158443 157481 CDS product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532309.1 protein_id gnl|my_center|LOCUS_57740 159756 158647 gene locus_tag LOCUS_57750 159756 158647 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921105.1 protein_id gnl|my_center|LOCUS_57750 160469 159849 gene locus_tag LOCUS_57760 160469 159849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 160545 161153 gene locus_tag LOCUS_57770 160545 161153 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727869.1 protein_id gnl|my_center|LOCUS_57770 161274 161885 gene locus_tag LOCUS_57780 161274 161885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 162749 161961 gene locus_tag LOCUS_57790 162749 161961 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 protein_id gnl|my_center|LOCUS_57790 162848 163396 gene locus_tag LOCUS_57800 162848 163396 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_57800 163517 164395 gene locus_tag LOCUS_57810 163517 164395 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029030.1 protein_id gnl|my_center|LOCUS_57810 166930 164354 gene locus_tag LOCUS_57820 166930 164354 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 protein_id gnl|my_center|LOCUS_57820 166811 167935 gene locus_tag LOCUS_57830 166811 167935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57830 167946 169496 gene locus_tag LOCUS_57840 167946 169496 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230797.1 protein_id gnl|my_center|LOCUS_57840 >Feature sequence32 1115 6 gene locus_tag LOCUS_57850 1115 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 1816 1181 gene locus_tag LOCUS_57860 1816 1181 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142665.1 protein_id gnl|my_center|LOCUS_57860 2244 1813 gene locus_tag LOCUS_57870 2244 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 2395 3615 gene locus_tag LOCUS_57880 2395 3615 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_57880 3603 4265 gene locus_tag LOCUS_57890 3603 4265 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_57890 4353 4775 gene locus_tag LOCUS_57900 4353 4775 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027424.1 protein_id gnl|my_center|LOCUS_57900 4934 5656 gene locus_tag LOCUS_57910 4934 5656 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804184.1 protein_id gnl|my_center|LOCUS_57910 5713 6339 gene locus_tag LOCUS_57920 5713 6339 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223072.1 protein_id gnl|my_center|LOCUS_57920 6429 7289 gene locus_tag LOCUS_57930 6429 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 8480 7323 gene locus_tag LOCUS_57940 8480 7323 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742129.1 protein_id gnl|my_center|LOCUS_57940 9912 8491 gene locus_tag LOCUS_57950 9912 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 10961 9909 gene locus_tag LOCUS_57960 10961 9909 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229214.1 protein_id gnl|my_center|LOCUS_57960 11845 10958 gene locus_tag LOCUS_57970 11845 10958 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229213.1 protein_id gnl|my_center|LOCUS_57970 12105 13562 gene locus_tag LOCUS_57980 12105 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 13559 14230 gene locus_tag LOCUS_57990 13559 14230 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_57990 14319 15584 gene locus_tag LOCUS_58000 gene aldO 14319 15584 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_58000 15749 18529 gene locus_tag LOCUS_58010 15749 18529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 18658 19266 gene locus_tag LOCUS_58020 18658 19266 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258321.1 protein_id gnl|my_center|LOCUS_58020 19304 20185 gene locus_tag LOCUS_58030 19304 20185 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226536.1 protein_id gnl|my_center|LOCUS_58030 20971 20249 gene locus_tag LOCUS_58040 20971 20249 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229004.1 protein_id gnl|my_center|LOCUS_58040 21070 21483 gene locus_tag LOCUS_58050 21070 21483 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229003.1 protein_id gnl|my_center|LOCUS_58050 21549 21773 gene locus_tag LOCUS_58060 21549 21773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 22773 22249 gene locus_tag LOCUS_58070 22773 22249 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226663.1 protein_id gnl|my_center|LOCUS_58070 24720 22774 gene locus_tag LOCUS_58080 24720 22774 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226664.1 protein_id gnl|my_center|LOCUS_58080 25163 24720 gene locus_tag LOCUS_58090 25163 24720 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 protein_id gnl|my_center|LOCUS_58090 25456 25166 gene locus_tag LOCUS_58100 25456 25166 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226666.1 protein_id gnl|my_center|LOCUS_58100 27194 25473 gene locus_tag LOCUS_58110 27194 25473 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_58110 27915 27184 gene locus_tag LOCUS_58120 27915 27184 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226668.1 protein_id gnl|my_center|LOCUS_58120 28359 27919 gene locus_tag LOCUS_58130 28359 27919 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226669.1 protein_id gnl|my_center|LOCUS_58130 30259 28397 gene locus_tag LOCUS_58140 30259 28397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58140 30508 30377 gene locus_tag LOCUS_58150 30508 30377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58150 30999 30505 gene locus_tag LOCUS_58160 30999 30505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226671.1 protein_id gnl|my_center|LOCUS_58160 31442 30999 gene locus_tag LOCUS_58170 31442 30999 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226672.1 protein_id gnl|my_center|LOCUS_58170 33007 31493 gene locus_tag LOCUS_58180 33007 31493 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226673.1 protein_id gnl|my_center|LOCUS_58180 35779 33161 gene locus_tag LOCUS_58190 35779 33161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 36395 35751 gene locus_tag LOCUS_58200 36395 35751 CDS product DUF4157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226675.1 protein_id gnl|my_center|LOCUS_58200 37963 36512 gene locus_tag LOCUS_58210 37963 36512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58210 38979 37960 gene locus_tag LOCUS_58220 38979 37960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58220 40658 38976 gene locus_tag LOCUS_58230 40658 38976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 40684 40890 gene locus_tag LOCUS_58240 40684 40890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58240 42922 40871 gene locus_tag LOCUS_58250 42922 40871 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226676.1 protein_id gnl|my_center|LOCUS_58250 43581 42919 gene locus_tag LOCUS_58260 43581 42919 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226677.1 protein_id gnl|my_center|LOCUS_58260 44237 43578 gene locus_tag LOCUS_58270 44237 43578 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222892.1 protein_id gnl|my_center|LOCUS_58270 45425 44292 gene locus_tag LOCUS_58280 45425 44292 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407371.1 protein_id gnl|my_center|LOCUS_58280 46510 45626 gene locus_tag LOCUS_58290 46510 45626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145860136.1 protein_id gnl|my_center|LOCUS_58290 47514 46633 gene locus_tag LOCUS_58300 47514 46633 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084097.1 protein_id gnl|my_center|LOCUS_58300 48235 47618 gene locus_tag LOCUS_58310 48235 47618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58310 48883 48422 gene locus_tag LOCUS_58320 48883 48422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 49335 48919 gene locus_tag LOCUS_58330 49335 48919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58330 50049 49537 gene locus_tag LOCUS_58340 50049 49537 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223215.1 protein_id gnl|my_center|LOCUS_58340 50227 51387 gene locus_tag LOCUS_58350 50227 51387 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978098.1 protein_id gnl|my_center|LOCUS_58350 51648 51391 gene locus_tag LOCUS_58360 51648 51391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 52474 51857 gene locus_tag LOCUS_58370 52474 51857 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978224.1 protein_id gnl|my_center|LOCUS_58370 54041 52518 gene locus_tag LOCUS_58380 54041 52518 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 protein_id gnl|my_center|LOCUS_58380 54925 54164 gene locus_tag LOCUS_58390 54925 54164 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 protein_id gnl|my_center|LOCUS_58390 55539 54943 gene locus_tag LOCUS_58400 gene sigK 55539 54943 CDS product ECF RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314022.1 protein_id gnl|my_center|LOCUS_58400 57220 55784 gene locus_tag LOCUS_58410 57220 55784 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028042.1 protein_id gnl|my_center|LOCUS_58410 57898 57479 gene locus_tag LOCUS_58420 57898 57479 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029627.1 protein_id gnl|my_center|LOCUS_58420 58056 59090 gene locus_tag LOCUS_58430 58056 59090 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228913.1 protein_id gnl|my_center|LOCUS_58430 59676 59179 gene locus_tag LOCUS_58440 59676 59179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58440 59996 60943 gene locus_tag LOCUS_58450 59996 60943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58450 60933 63254 gene locus_tag LOCUS_58460 gene hypF 60933 63254 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225635.1 protein_id gnl|my_center|LOCUS_58460 63344 63892 gene locus_tag LOCUS_58470 63344 63892 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409503.1 protein_id gnl|my_center|LOCUS_58470 64425 63958 gene locus_tag LOCUS_58480 64425 63958 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898000.1 protein_id gnl|my_center|LOCUS_58480 64588 65271 gene locus_tag LOCUS_58490 64588 65271 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026858.1 protein_id gnl|my_center|LOCUS_58490 66382 65339 gene locus_tag LOCUS_58500 66382 65339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 66983 66375 gene locus_tag LOCUS_58510 66983 66375 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_58510 67498 67839 gene locus_tag LOCUS_58520 67498 67839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 69020 67938 gene locus_tag LOCUS_58530 69020 67938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 69355 69017 gene locus_tag LOCUS_58540 69355 69017 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141202.1 protein_id gnl|my_center|LOCUS_58540 70453 69479 gene locus_tag LOCUS_58550 70453 69479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 70686 71534 gene locus_tag LOCUS_58560 70686 71534 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028181.1 protein_id gnl|my_center|LOCUS_58560 71584 72867 gene locus_tag LOCUS_58570 71584 72867 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978322.1 protein_id gnl|my_center|LOCUS_58570 72864 74144 gene locus_tag LOCUS_58580 72864 74144 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727005.1 protein_id gnl|my_center|LOCUS_58580 74146 75087 gene locus_tag LOCUS_58590 74146 75087 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978324.1 protein_id gnl|my_center|LOCUS_58590 75084 75896 gene locus_tag LOCUS_58600 75084 75896 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225765.1 protein_id gnl|my_center|LOCUS_58600 75916 77157 gene locus_tag LOCUS_58610 75916 77157 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_58610 77937 77581 gene locus_tag LOCUS_58620 77937 77581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58620 78545 78048 gene locus_tag LOCUS_58630 78545 78048 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_58630 79185 78598 gene locus_tag LOCUS_58640 79185 78598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 80127 79282 gene locus_tag LOCUS_58650 80127 79282 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225774.1 protein_id gnl|my_center|LOCUS_58650 81191 80160 gene locus_tag LOCUS_58660 81191 80160 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029553.1 protein_id gnl|my_center|LOCUS_58660 81329 81403 gene locus_tag LOCUS_t00570 81329 81403 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 81447 81521 gene locus_tag LOCUS_t00580 81447 81521 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 81543 82997 gene locus_tag LOCUS_58670 81543 82997 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 protein_id gnl|my_center|LOCUS_58670 82997 84037 gene locus_tag LOCUS_58680 82997 84037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 84034 85740 gene locus_tag LOCUS_58690 84034 85740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027710.1 protein_id gnl|my_center|LOCUS_58690 85771 86958 gene locus_tag LOCUS_58700 85771 86958 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977524.1 protein_id gnl|my_center|LOCUS_58700 86951 88147 gene locus_tag LOCUS_58710 86951 88147 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495330.1 protein_id gnl|my_center|LOCUS_58710 88994 88152 gene locus_tag LOCUS_58720 88994 88152 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728964.1 protein_id gnl|my_center|LOCUS_58720 89107 89685 gene locus_tag LOCUS_58730 89107 89685 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080680.1 protein_id gnl|my_center|LOCUS_58730 90583 89705 gene locus_tag LOCUS_58740 90583 89705 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007446839.1 protein_id gnl|my_center|LOCUS_58740 90846 91616 gene locus_tag LOCUS_58750 90846 91616 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027539.1 protein_id gnl|my_center|LOCUS_58750 92537 92193 gene locus_tag LOCUS_58760 92537 92193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58760 93828 92797 gene locus_tag LOCUS_58770 gene gnd 93828 92797 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_58770 95498 93873 gene locus_tag LOCUS_58780 gene pgi 95498 93873 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_58780 97670 95598 gene locus_tag LOCUS_58790 gene tkt 97670 95598 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_58790 99165 97774 gene locus_tag LOCUS_58800 gene zwf 99165 97774 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974206.1 protein_id gnl|my_center|LOCUS_58800 100232 99420 gene locus_tag LOCUS_58810 100232 99420 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030363.1 protein_id gnl|my_center|LOCUS_58810 100773 100294 gene locus_tag LOCUS_58820 100773 100294 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027124.1 protein_id gnl|my_center|LOCUS_58820 102671 100941 gene locus_tag LOCUS_58830 102671 100941 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748434.1 protein_id gnl|my_center|LOCUS_58830 103208 103876 gene locus_tag LOCUS_58840 103208 103876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58840 105300 103975 gene locus_tag LOCUS_58850 105300 103975 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062698019.1 protein_id gnl|my_center|LOCUS_58850 105389 106336 gene locus_tag LOCUS_58860 105389 106336 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027162.1 protein_id gnl|my_center|LOCUS_58860 107201 106320 gene locus_tag LOCUS_58870 107201 106320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_58870 108219 107206 gene locus_tag LOCUS_58880 108219 107206 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226863.1 protein_id gnl|my_center|LOCUS_58880 108152 108361 gene locus_tag LOCUS_58890 108152 108361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 109346 108321 gene locus_tag LOCUS_58900 109346 108321 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226862.1 protein_id gnl|my_center|LOCUS_58900 109502 132175 gene locus_tag LOCUS_58910 109502 132175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 132252 132464 gene locus_tag LOCUS_58920 132252 132464 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975599.1 protein_id gnl|my_center|LOCUS_58920 133682 132600 gene locus_tag LOCUS_58930 133682 132600 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259666.1 protein_id gnl|my_center|LOCUS_58930 135571 133688 gene locus_tag LOCUS_58940 135571 133688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226857.1 protein_id gnl|my_center|LOCUS_58940 137268 135568 gene locus_tag LOCUS_58950 137268 135568 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226856.1 protein_id gnl|my_center|LOCUS_58950 137423 138115 gene locus_tag LOCUS_58960 137423 138115 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863097.1 protein_id gnl|my_center|LOCUS_58960 138112 139719 gene locus_tag LOCUS_58970 138112 139719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 139776 140291 gene locus_tag LOCUS_58980 139776 140291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230193.1 protein_id gnl|my_center|LOCUS_58980 140288 141421 gene locus_tag LOCUS_58990 140288 141421 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306837.1 protein_id gnl|my_center|LOCUS_58990 141418 142140 gene locus_tag LOCUS_59000 141418 142140 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 protein_id gnl|my_center|LOCUS_59000 142134 143378 gene locus_tag LOCUS_59010 142134 143378 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_59010 143572 144564 gene locus_tag LOCUS_59020 143572 144564 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_59020 145465 144620 gene locus_tag LOCUS_59030 gene cobF 145465 144620 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031346.1 protein_id gnl|my_center|LOCUS_59030 146514 145621 gene locus_tag LOCUS_59040 146514 145621 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940569.1 protein_id gnl|my_center|LOCUS_59040 146609 147001 gene locus_tag LOCUS_59050 146609 147001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_59050 149249 147171 gene locus_tag LOCUS_59060 149249 147171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59060 150125 149286 gene locus_tag LOCUS_59070 150125 149286 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_59070 151087 150122 gene locus_tag LOCUS_59080 151087 150122 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_59080 152323 151109 gene locus_tag LOCUS_59090 152323 151109 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242083.1 protein_id gnl|my_center|LOCUS_59090 152567 153742 gene locus_tag LOCUS_59100 152567 153742 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230103.1 protein_id gnl|my_center|LOCUS_59100 154145 156316 gene locus_tag LOCUS_59110 154145 156316 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027193.1 protein_id gnl|my_center|LOCUS_59110 158284 156377 gene locus_tag LOCUS_59120 158284 156377 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975395.1 protein_id gnl|my_center|LOCUS_59120 158748 160409 gene locus_tag LOCUS_59130 gene kdpA 158748 160409 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730504.1 protein_id gnl|my_center|LOCUS_59130 >Feature sequence33 231 1577 gene locus_tag LOCUS_59140 231 1577 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225936.1 protein_id gnl|my_center|LOCUS_59140 1585 2532 gene locus_tag LOCUS_59150 1585 2532 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225935.1 protein_id gnl|my_center|LOCUS_59150 2529 3386 gene locus_tag LOCUS_59160 2529 3386 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225934.1 protein_id gnl|my_center|LOCUS_59160 3437 6163 gene locus_tag LOCUS_59170 3437 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59170 6280 9255 gene locus_tag LOCUS_59180 6280 9255 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226436.1 protein_id gnl|my_center|LOCUS_59180 9678 9346 gene locus_tag LOCUS_59190 9678 9346 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388091.1 protein_id gnl|my_center|LOCUS_59190 9786 10526 gene locus_tag LOCUS_59200 9786 10526 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229392.1 protein_id gnl|my_center|LOCUS_59200 10722 11216 gene locus_tag LOCUS_59210 10722 11216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 12294 11227 gene locus_tag LOCUS_59220 12294 11227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_59220 13046 12291 gene locus_tag LOCUS_59230 13046 12291 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_59230 13934 13128 gene locus_tag LOCUS_59240 gene modA 13934 13128 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_59240 14362 13952 gene locus_tag LOCUS_59250 14362 13952 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_59250 14744 14535 gene locus_tag LOCUS_59260 14744 14535 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531022.1 protein_id gnl|my_center|LOCUS_59260 15257 16375 gene locus_tag LOCUS_59270 15257 16375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 17020 16424 gene locus_tag LOCUS_59280 17020 16424 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083483.1 protein_id gnl|my_center|LOCUS_59280 17115 17999 gene locus_tag LOCUS_59290 17115 17999 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275478.1 protein_id gnl|my_center|LOCUS_59290 18471 17992 gene locus_tag LOCUS_59300 18471 17992 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225559.1 protein_id gnl|my_center|LOCUS_59300 18575 19051 gene locus_tag LOCUS_59310 18575 19051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59310 20002 19055 gene locus_tag LOCUS_59320 20002 19055 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899238.1 protein_id gnl|my_center|LOCUS_59320 20390 20058 gene locus_tag LOCUS_59330 20390 20058 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082141.1 protein_id gnl|my_center|LOCUS_59330 23414 20424 gene locus_tag LOCUS_59340 23414 20424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 24217 23411 gene locus_tag LOCUS_59350 24217 23411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_59350 24852 24214 gene locus_tag LOCUS_59360 24852 24214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083291.1 protein_id gnl|my_center|LOCUS_59360 25315 26157 gene locus_tag LOCUS_59370 25315 26157 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031819.1 protein_id gnl|my_center|LOCUS_59370 26485 27603 gene locus_tag LOCUS_59380 26485 27603 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_59380 27622 28185 gene locus_tag LOCUS_59390 27622 28185 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031817.1 protein_id gnl|my_center|LOCUS_59390 28182 29207 gene locus_tag LOCUS_59400 28182 29207 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727207.1 protein_id gnl|my_center|LOCUS_59400 29226 29816 gene locus_tag LOCUS_59410 29226 29816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 30034 30741 gene locus_tag LOCUS_59420 30034 30741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 30981 33578 gene locus_tag LOCUS_59430 gene lanKC 30981 33578 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092529862.1 protein_id gnl|my_center|LOCUS_59430 33578 33718 gene locus_tag LOCUS_59440 33578 33718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59440 33838 35529 gene locus_tag LOCUS_59450 33838 35529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031101.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_59450 35526 37241 gene locus_tag LOCUS_59460 35526 37241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031102.1 protein_id gnl|my_center|LOCUS_59460 38151 37480 gene locus_tag LOCUS_59470 38151 37480 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228649.1 protein_id gnl|my_center|LOCUS_59470 39684 38410 gene locus_tag LOCUS_59480 39684 38410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 39584 39781 gene locus_tag LOCUS_59490 39584 39781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 40342 41835 gene locus_tag LOCUS_59500 40342 41835 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_59500 43255 41825 gene locus_tag LOCUS_59510 43255 41825 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727370.1 protein_id gnl|my_center|LOCUS_59510 43319 43924 gene locus_tag LOCUS_59520 43319 43924 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 protein_id gnl|my_center|LOCUS_59520 43935 45689 gene locus_tag LOCUS_59530 43935 45689 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_59530 45924 46688 gene locus_tag LOCUS_59540 45924 46688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59540 46775 47164 gene locus_tag LOCUS_59550 46775 47164 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973901.1 protein_id gnl|my_center|LOCUS_59550 48126 47206 gene locus_tag LOCUS_59560 48126 47206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 49087 48170 gene locus_tag LOCUS_59570 49087 48170 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_59570 49240 50118 gene locus_tag LOCUS_59580 49240 50118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 51991 50096 gene locus_tag LOCUS_59590 51991 50096 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_59590 53066 52047 gene locus_tag LOCUS_59600 53066 52047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 53355 53140 gene locus_tag LOCUS_59610 53355 53140 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976983.1 protein_id gnl|my_center|LOCUS_59610 55068 53470 gene locus_tag LOCUS_59620 55068 53470 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_59620 55935 55285 gene locus_tag LOCUS_59630 55935 55285 CDS product acVLRF1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 protein_id gnl|my_center|LOCUS_59630 56518 57816 gene locus_tag LOCUS_59640 56518 57816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 58488 57883 gene locus_tag LOCUS_59650 58488 57883 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_59650 59668 58505 gene locus_tag LOCUS_59660 59668 58505 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030073.1 protein_id gnl|my_center|LOCUS_59660 60456 59713 gene locus_tag LOCUS_59670 60456 59713 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228377.1 protein_id gnl|my_center|LOCUS_59670 61355 60453 gene locus_tag LOCUS_59680 61355 60453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028266.1 protein_id gnl|my_center|LOCUS_59680 62225 61470 gene locus_tag LOCUS_59690 62225 61470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 62386 63000 gene locus_tag LOCUS_59700 62386 63000 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222789.1 protein_id gnl|my_center|LOCUS_59700 64052 63054 gene locus_tag LOCUS_59710 64052 63054 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256300.1 protein_id gnl|my_center|LOCUS_59710 64414 64049 gene locus_tag LOCUS_59720 64414 64049 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660436.1 protein_id gnl|my_center|LOCUS_59720 64519 65277 gene locus_tag LOCUS_59730 64519 65277 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031782.1 protein_id gnl|my_center|LOCUS_59730 65406 66809 gene locus_tag LOCUS_59740 65406 66809 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803753.1 protein_id gnl|my_center|LOCUS_59740 68541 66829 gene locus_tag LOCUS_59750 gene ade 68541 66829 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338640.1 protein_id gnl|my_center|LOCUS_59750 69539 68538 gene locus_tag LOCUS_59760 69539 68538 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887048.1 protein_id gnl|my_center|LOCUS_59760 70588 69536 gene locus_tag LOCUS_59770 70588 69536 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379352.1 protein_id gnl|my_center|LOCUS_59770 71613 70621 gene locus_tag LOCUS_59780 71613 70621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230681.1 protein_id gnl|my_center|LOCUS_59780 72437 71610 gene locus_tag LOCUS_59790 72437 71610 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315562.1 protein_id gnl|my_center|LOCUS_59790 73255 72434 gene locus_tag LOCUS_59800 73255 72434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382189.1 protein_id gnl|my_center|LOCUS_59800 73515 74456 gene locus_tag LOCUS_59810 73515 74456 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226270.1 protein_id gnl|my_center|LOCUS_59810 75481 74636 gene locus_tag LOCUS_59820 gene hisG 75481 74636 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_59820 75897 75547 gene locus_tag LOCUS_59830 75897 75547 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226745.1 protein_id gnl|my_center|LOCUS_59830 77777 76152 gene locus_tag LOCUS_59840 77777 76152 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029195.1 protein_id gnl|my_center|LOCUS_59840 78639 78265 gene locus_tag LOCUS_59850 78639 78265 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057839.1 protein_id gnl|my_center|LOCUS_59850 79201 78764 gene locus_tag LOCUS_59860 79201 78764 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_59860 80471 79206 gene locus_tag LOCUS_59870 80471 79206 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_59870 81247 80471 gene locus_tag LOCUS_59880 gene sufC 81247 80471 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_59880 81581 81252 gene locus_tag LOCUS_59890 81581 81252 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_59890 82699 81578 gene locus_tag LOCUS_59900 gene sufD 82699 81578 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_59900 84111 82699 gene locus_tag LOCUS_59910 gene sufB 84111 82699 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_59910 84953 84108 gene locus_tag LOCUS_59920 84953 84108 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_59920 85340 86272 gene locus_tag LOCUS_59930 85340 86272 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_59930 86269 87033 gene locus_tag LOCUS_59940 86269 87033 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_59940 87261 88166 gene locus_tag LOCUS_59950 87261 88166 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 protein_id gnl|my_center|LOCUS_59950 88262 89266 gene locus_tag LOCUS_59960 88262 89266 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_59960 89277 89975 gene locus_tag LOCUS_59970 89277 89975 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_59970 91362 89980 gene locus_tag LOCUS_59980 91362 89980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59980 91516 93087 gene locus_tag LOCUS_59990 91516 93087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59990 94143 93181 gene locus_tag LOCUS_60000 94143 93181 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_60000 94371 96524 gene locus_tag LOCUS_60010 gene tkt 94371 96524 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_60010 96537 97640 gene locus_tag LOCUS_60020 gene tal 96537 97640 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224676.1 protein_id gnl|my_center|LOCUS_60020 97648 99273 gene locus_tag LOCUS_60030 97648 99273 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_60030 99320 100987 gene locus_tag LOCUS_60040 gene zwf 99320 100987 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031084.1 protein_id gnl|my_center|LOCUS_60040 101040 101954 gene locus_tag LOCUS_60050 gene opcA 101040 101954 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972335.1 protein_id gnl|my_center|LOCUS_60050 102018 102794 gene locus_tag LOCUS_60060 gene pgl 102018 102794 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_60060 103197 102844 gene locus_tag LOCUS_60070 103197 102844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60070 103790 103194 gene locus_tag LOCUS_60080 gene nthA 103790 103194 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879389.1 protein_id gnl|my_center|LOCUS_60080 104452 103787 gene locus_tag LOCUS_60090 gene nthB 104452 103787 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400923.1 protein_id gnl|my_center|LOCUS_60090 104831 105322 gene locus_tag LOCUS_60100 104831 105322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60100 105369 106613 gene locus_tag LOCUS_60110 105369 106613 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224708.1 protein_id gnl|my_center|LOCUS_60110 106610 107266 gene locus_tag LOCUS_60120 106610 107266 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977570.1 protein_id gnl|my_center|LOCUS_60120 108384 107233 gene locus_tag LOCUS_60130 108384 107233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60130 110751 108502 gene locus_tag LOCUS_60140 110751 108502 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084710.1 protein_id gnl|my_center|LOCUS_60140 111815 110886 gene locus_tag LOCUS_60150 111815 110886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60150 112024 112554 gene locus_tag LOCUS_60160 112024 112554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60160 113663 112614 gene locus_tag LOCUS_60170 113663 112614 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027701.1 protein_id gnl|my_center|LOCUS_60170 113849 115255 gene locus_tag LOCUS_60180 113849 115255 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_60180 115453 117057 gene locus_tag LOCUS_60190 115453 117057 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726949.1 protein_id gnl|my_center|LOCUS_60190 117756 117409 gene locus_tag LOCUS_60200 117756 117409 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_60200 118061 117831 gene locus_tag LOCUS_60210 118061 117831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 118951 118172 gene locus_tag LOCUS_60220 gene tpiA 118951 118172 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_60220 120138 118951 gene locus_tag LOCUS_60230 120138 118951 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224667.1 protein_id gnl|my_center|LOCUS_60230 121142 120138 gene locus_tag LOCUS_60240 gene gap 121142 120138 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_60240 121352 122125 gene locus_tag LOCUS_60250 121352 122125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60250 123109 122129 gene locus_tag LOCUS_60260 gene whiA 123109 122129 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_60260 124166 123174 gene locus_tag LOCUS_60270 gene yvcK 124166 123174 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_60270 125187 124318 gene locus_tag LOCUS_60280 gene rapZ 125187 124318 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_60280 127336 125393 gene locus_tag LOCUS_60290 gene uvrC 127336 125393 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028063.1 protein_id gnl|my_center|LOCUS_60290 128044 127616 gene locus_tag LOCUS_60300 128044 127616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60300 131074 128234 gene locus_tag LOCUS_60310 gene uvrA 131074 128234 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_60310 131291 132166 gene locus_tag LOCUS_60320 131291 132166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60320 132196 132840 gene locus_tag LOCUS_60330 132196 132840 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_60330 134210 132918 gene locus_tag LOCUS_60340 134210 132918 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525075.1 protein_id gnl|my_center|LOCUS_60340 134784 134410 gene locus_tag LOCUS_60350 134784 134410 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974216.1 protein_id gnl|my_center|LOCUS_60350 135515 134826 gene locus_tag LOCUS_60360 135515 134826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60360 135682 136434 gene locus_tag LOCUS_60370 135682 136434 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028258.1 protein_id gnl|my_center|LOCUS_60370 136500 137063 gene locus_tag LOCUS_60380 136500 137063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60380 137370 137074 gene locus_tag LOCUS_60390 137370 137074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60390 138346 137507 gene locus_tag LOCUS_60400 gene pssA 138346 137507 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972511.1 protein_id gnl|my_center|LOCUS_60400 139004 138333 gene locus_tag LOCUS_60410 139004 138333 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972510.1 protein_id gnl|my_center|LOCUS_60410 140175 139144 gene locus_tag LOCUS_60420 140175 139144 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_60420 141515 140415 gene locus_tag LOCUS_60430 141515 140415 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804980.1 protein_id gnl|my_center|LOCUS_60430 143195 141552 gene locus_tag LOCUS_60440 143195 141552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60440 144197 143259 gene locus_tag LOCUS_60450 144197 143259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804978.1 protein_id gnl|my_center|LOCUS_60450 145250 144285 gene locus_tag LOCUS_60460 145250 144285 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_60460 146446 145247 gene locus_tag LOCUS_60470 gene steA 146446 145247 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_60470 148255 146537 gene locus_tag LOCUS_60480 gene recN 148255 146537 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_60480 149423 148503 gene locus_tag LOCUS_60490 149423 148503 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_60490 150306 149506 gene locus_tag LOCUS_60500 150306 149506 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_60500 150622 150356 gene locus_tag LOCUS_60510 150622 150356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60510 151094 151441 gene locus_tag LOCUS_60520 151094 151441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977038.1 protein_id gnl|my_center|LOCUS_60520 152633 151611 gene locus_tag LOCUS_60530 152633 151611 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_60530 153058 152630 gene locus_tag LOCUS_60540 153058 152630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60540 153143 154369 gene locus_tag LOCUS_60550 153143 154369 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_60550 155306 154515 gene locus_tag LOCUS_60560 155306 154515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60560 155411 156337 gene locus_tag LOCUS_60570 155411 156337 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257434.1 protein_id gnl|my_center|LOCUS_60570 <158335 156523 gene locus_tag LOCUS_60580 <158335 156523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977032.1:tetratricopeptide repeat protein >Feature sequence34 >Feature sequence35 126 716 gene locus_tag LOCUS_60590 gene calD 126 716 CDS product calcium binding protein CalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974571.1 protein_id gnl|my_center|LOCUS_60590 1582 905 gene locus_tag LOCUS_60600 1582 905 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224187.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60600 1801 2508 gene locus_tag LOCUS_60610 1801 2508 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027419.1 protein_id gnl|my_center|LOCUS_60610 3869 2823 gene locus_tag LOCUS_60620 3869 2823 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529023.1 protein_id gnl|my_center|LOCUS_60620 3960 4571 gene locus_tag LOCUS_60630 3960 4571 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030557.1 protein_id gnl|my_center|LOCUS_60630 5353 4772 gene locus_tag LOCUS_60640 5353 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60640 5673 5335 gene locus_tag LOCUS_60650 5673 5335 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_60650 5761 6267 gene locus_tag LOCUS_60660 5761 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085872.1 protein_id gnl|my_center|LOCUS_60660 6461 6742 gene locus_tag LOCUS_60670 6461 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60670 7249 6800 gene locus_tag LOCUS_60680 7249 6800 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085287.1 protein_id gnl|my_center|LOCUS_60680 7470 8363 gene locus_tag LOCUS_60690 7470 8363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973848.1 protein_id gnl|my_center|LOCUS_60690 8363 9064 gene locus_tag LOCUS_60700 8363 9064 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028267.1 protein_id gnl|my_center|LOCUS_60700 9061 10206 gene locus_tag LOCUS_60710 9061 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60710 10203 10814 gene locus_tag LOCUS_60720 10203 10814 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226387.1 protein_id gnl|my_center|LOCUS_60720 10840 11232 gene locus_tag LOCUS_60730 10840 11232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60730 11464 13989 gene locus_tag LOCUS_60740 11464 13989 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204026380.1 protein_id gnl|my_center|LOCUS_60740 14734 13964 gene locus_tag LOCUS_60750 14734 13964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60750 16049 15258 gene locus_tag LOCUS_60760 16049 15258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60760 17033 16194 gene locus_tag LOCUS_60770 17033 16194 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227428.1 protein_id gnl|my_center|LOCUS_60770 17128 17859 gene locus_tag LOCUS_60780 17128 17859 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227429.1 protein_id gnl|my_center|LOCUS_60780 18339 18019 gene locus_tag LOCUS_60790 18339 18019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60790 18707 19879 gene locus_tag LOCUS_60800 18707 19879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60800 20552 21106 gene locus_tag LOCUS_60810 20552 21106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60810 21103 21486 gene locus_tag LOCUS_60820 21103 21486 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223657.1 protein_id gnl|my_center|LOCUS_60820 22515 21553 gene locus_tag LOCUS_60830 22515 21553 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534186.1 protein_id gnl|my_center|LOCUS_60830 22618 23187 gene locus_tag LOCUS_60840 22618 23187 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971593.1 protein_id gnl|my_center|LOCUS_60840 23428 23946 gene locus_tag LOCUS_60850 23428 23946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60850 23943 24458 gene locus_tag LOCUS_60860 23943 24458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60860 24574 25569 gene locus_tag LOCUS_60870 24574 25569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60870 26483 25617 gene locus_tag LOCUS_60880 gene xerD 26483 25617 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546237.1 protein_id gnl|my_center|LOCUS_60880 26659 27051 gene locus_tag LOCUS_60890 26659 27051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60890 27183 28142 gene locus_tag LOCUS_60900 27183 28142 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 protein_id gnl|my_center|LOCUS_60900 28293 28922 gene locus_tag LOCUS_60910 28293 28922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60910 29033 29740 gene locus_tag LOCUS_60920 gene lexA 29033 29740 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225332.1 protein_id gnl|my_center|LOCUS_60920 30150 29950 gene locus_tag LOCUS_60930 30150 29950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60930 30274 30504 gene locus_tag LOCUS_60940 30274 30504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60940 31661 30438 gene locus_tag LOCUS_60950 31661 30438 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742146.1 protein_id gnl|my_center|LOCUS_60950 32121 32801 gene locus_tag LOCUS_60960 32121 32801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204944093.1 protein_id gnl|my_center|LOCUS_60960 34057 33065 gene locus_tag LOCUS_60970 34057 33065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60970 35539 34229 gene locus_tag LOCUS_60980 35539 34229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60980 35929 38796 gene locus_tag LOCUS_60990 35929 38796 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225870.1 protein_id gnl|my_center|LOCUS_60990 39790 39440 gene locus_tag LOCUS_61000 39790 39440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61000 39964 40578 gene locus_tag LOCUS_61010 39964 40578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61010 41098 40757 gene locus_tag LOCUS_61020 41098 40757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61020 41917 41303 gene locus_tag LOCUS_61030 41917 41303 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254574.1 protein_id gnl|my_center|LOCUS_61030 42901 42287 gene locus_tag LOCUS_61040 42901 42287 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222840.1 protein_id gnl|my_center|LOCUS_61040 43013 43921 gene locus_tag LOCUS_61050 43013 43921 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031765.1 protein_id gnl|my_center|LOCUS_61050 44892 44206 gene locus_tag LOCUS_61060 44892 44206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61060 45768 45025 gene locus_tag LOCUS_61070 45768 45025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61070 46459 46983 gene locus_tag LOCUS_61080 46459 46983 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797789.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61080 47199 48065 gene locus_tag LOCUS_61090 47199 48065 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_61090 48182 49165 gene locus_tag LOCUS_61100 48182 49165 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_61100 49400 49771 gene locus_tag LOCUS_61110 49400 49771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61110 50852 49830 gene locus_tag LOCUS_61120 50852 49830 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227082.1 protein_id gnl|my_center|LOCUS_61120 51079 52617 gene locus_tag LOCUS_61130 51079 52617 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028346.1 protein_id gnl|my_center|LOCUS_61130 52842 53960 gene locus_tag LOCUS_61140 52842 53960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61140 53991 58709 gene locus_tag LOCUS_61150 53991 58709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61150 59370 59161 gene locus_tag LOCUS_61160 59370 59161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61160 60037 59372 gene locus_tag LOCUS_61170 60037 59372 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967002.1 protein_id gnl|my_center|LOCUS_61170 60734 60042 gene locus_tag LOCUS_61180 60734 60042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61180 61682 61104 gene locus_tag LOCUS_61190 61682 61104 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898165.1 protein_id gnl|my_center|LOCUS_61190 61956 62384 gene locus_tag LOCUS_61200 61956 62384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61200 62439 63089 gene locus_tag LOCUS_61210 62439 63089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 63223 65019 gene locus_tag LOCUS_61220 63223 65019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61220 65093 65512 gene locus_tag LOCUS_61230 65093 65512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61230 66815 65439 gene locus_tag LOCUS_61240 66815 65439 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966616.1 protein_id gnl|my_center|LOCUS_61240 67201 67968 gene locus_tag LOCUS_61250 67201 67968 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895059.1 protein_id gnl|my_center|LOCUS_61250 68158 70758 gene locus_tag LOCUS_61260 gene ppsA 68158 70758 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201372230.1 protein_id gnl|my_center|LOCUS_61260 71270 70809 gene locus_tag LOCUS_61270 71270 70809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61270 71609 72640 gene locus_tag LOCUS_61280 71609 72640 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976087.1 protein_id gnl|my_center|LOCUS_61280 74059 72668 gene locus_tag LOCUS_61290 74059 72668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61290 74266 75615 gene locus_tag LOCUS_61300 74266 75615 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_61300 76125 75679 gene locus_tag LOCUS_61310 76125 75679 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977923.1 protein_id gnl|my_center|LOCUS_61310 77209 76292 gene locus_tag LOCUS_61320 77209 76292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61320 78828 77497 gene locus_tag LOCUS_61330 78828 77497 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_61330 79514 78897 gene locus_tag LOCUS_61340 79514 78897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 81309 80326 gene locus_tag LOCUS_61350 81309 80326 CDS product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226393.1 protein_id gnl|my_center|LOCUS_61350 81230 81562 gene locus_tag LOCUS_61360 81230 81562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61360 81940 82494 gene locus_tag LOCUS_61370 81940 82494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61370 82533 83411 gene locus_tag LOCUS_61380 gene qqlR 82533 83411 CDS product N-acyl homoserine lactonase QqlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886818.1 protein_id gnl|my_center|LOCUS_61380 83473 83964 gene locus_tag LOCUS_61390 83473 83964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61390 85196 84147 gene locus_tag LOCUS_61400 85196 84147 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974569.1 protein_id gnl|my_center|LOCUS_61400 85312 86241 gene locus_tag LOCUS_61410 85312 86241 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_61410 86888 86421 gene locus_tag LOCUS_61420 86888 86421 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262634.1 protein_id gnl|my_center|LOCUS_61420 88266 87082 gene locus_tag LOCUS_61430 88266 87082 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870809.1 protein_id gnl|my_center|LOCUS_61430 89130 88354 gene locus_tag LOCUS_61440 89130 88354 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230307.1 protein_id gnl|my_center|LOCUS_61440 89619 89221 gene locus_tag LOCUS_61450 89619 89221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61450 92409 89632 gene locus_tag LOCUS_61460 92409 89632 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304129.1 protein_id gnl|my_center|LOCUS_61460 92513 93202 gene locus_tag LOCUS_61470 92513 93202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61470 93645 93863 gene locus_tag LOCUS_61480 93645 93863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61480 94468 94058 gene locus_tag LOCUS_61490 94468 94058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61490 94772 95473 gene locus_tag LOCUS_61500 94772 95473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028451.1 protein_id gnl|my_center|LOCUS_61500 95912 96481 gene locus_tag LOCUS_61510 95912 96481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61510 97429 96833 gene locus_tag LOCUS_61520 97429 96833 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222489.1 protein_id gnl|my_center|LOCUS_61520 97929 97426 gene locus_tag LOCUS_61530 97929 97426 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993326.1 protein_id gnl|my_center|LOCUS_61530 98210 97863 gene locus_tag LOCUS_61540 98210 97863 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224368.1 protein_id gnl|my_center|LOCUS_61540 99141 98503 gene locus_tag LOCUS_61550 99141 98503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61550 100539 99667 gene locus_tag LOCUS_61560 gene trpD 100539 99667 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 protein_id gnl|my_center|LOCUS_61560 100447 100728 gene locus_tag LOCUS_61570 100447 100728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61570 100985 102184 gene locus_tag LOCUS_61580 gene trpB 100985 102184 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460915.1 protein_id gnl|my_center|LOCUS_61580 102181 103002 gene locus_tag LOCUS_61590 gene trpA 102181 103002 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142606.1 protein_id gnl|my_center|LOCUS_61590 102999 103757 gene locus_tag LOCUS_61600 102999 103757 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064405.1 protein_id gnl|my_center|LOCUS_61600 103847 104791 gene locus_tag LOCUS_61610 103847 104791 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729384.1 protein_id gnl|my_center|LOCUS_61610 105044 104820 gene locus_tag LOCUS_61620 105044 104820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61620 105177 106043 gene locus_tag LOCUS_61630 105177 106043 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529557.1 protein_id gnl|my_center|LOCUS_61630 106209 107153 gene locus_tag LOCUS_61640 gene sigJ 106209 107153 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226028235.1 protein_id gnl|my_center|LOCUS_61640 107247 108443 gene locus_tag LOCUS_61650 107247 108443 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 protein_id gnl|my_center|LOCUS_61650 109181 108537 gene locus_tag LOCUS_61660 109181 108537 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_61660 110485 109178 gene locus_tag LOCUS_61670 110485 109178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61670 110597 111151 gene locus_tag LOCUS_61680 110597 111151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61680 111163 112239 gene locus_tag LOCUS_61690 111163 112239 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306837.1 protein_id gnl|my_center|LOCUS_61690 112236 112961 gene locus_tag LOCUS_61700 112236 112961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225402.1 protein_id gnl|my_center|LOCUS_61700 112958 114142 gene locus_tag LOCUS_61710 112958 114142 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225403.1 protein_id gnl|my_center|LOCUS_61710 114405 115136 gene locus_tag LOCUS_61720 114405 115136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61720 116271 115219 gene locus_tag LOCUS_61730 116271 115219 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467337.1 protein_id gnl|my_center|LOCUS_61730 118440 116299 gene locus_tag LOCUS_61740 118440 116299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61740 118743 120347 gene locus_tag LOCUS_61750 118743 120347 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_61750 120389 121330 gene locus_tag LOCUS_61760 120389 121330 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268897.1 protein_id gnl|my_center|LOCUS_61760 121327 122190 gene locus_tag LOCUS_61770 121327 122190 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105045.1 protein_id gnl|my_center|LOCUS_61770 122187 123203 gene locus_tag LOCUS_61780 122187 123203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085654.1 protein_id gnl|my_center|LOCUS_61780 123200 124246 gene locus_tag LOCUS_61790 123200 124246 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_61790 124243 125190 gene locus_tag LOCUS_61800 124243 125190 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839930.1 protein_id gnl|my_center|LOCUS_61800 125187 126011 gene locus_tag LOCUS_61810 125187 126011 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285030.1 protein_id gnl|my_center|LOCUS_61810 126008 127264 gene locus_tag LOCUS_61820 126008 127264 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 protein_id gnl|my_center|LOCUS_61820 127264 128460 gene locus_tag LOCUS_61830 127264 128460 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_61830 128462 128959 gene locus_tag LOCUS_61840 gene ripB 128462 128959 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 protein_id gnl|my_center|LOCUS_61840 129622 128981 gene locus_tag LOCUS_61850 129622 128981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61850 129841 130551 gene locus_tag LOCUS_61860 129841 130551 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390008.1 protein_id gnl|my_center|LOCUS_61860 130548 131246 gene locus_tag LOCUS_61870 130548 131246 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973118.1 protein_id gnl|my_center|LOCUS_61870 131233 132609 gene locus_tag LOCUS_61880 131233 132609 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 protein_id gnl|my_center|LOCUS_61880 132609 133790 gene locus_tag LOCUS_61890 132609 133790 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861718.1 protein_id gnl|my_center|LOCUS_61890 133874 135604 gene locus_tag LOCUS_61900 133874 135604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61900 135632 136486 gene locus_tag LOCUS_61910 135632 136486 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384270.1 protein_id gnl|my_center|LOCUS_61910 136483 137397 gene locus_tag LOCUS_61920 136483 137397 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836550.1 protein_id gnl|my_center|LOCUS_61920 137434 138198 gene locus_tag LOCUS_61930 137434 138198 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525151.1 protein_id gnl|my_center|LOCUS_61930 138335 138781 gene locus_tag LOCUS_61940 138335 138781 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_61940 139775 138879 gene locus_tag LOCUS_61950 139775 138879 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930125.1 protein_id gnl|my_center|LOCUS_61950 141330 139888 gene locus_tag LOCUS_61960 141330 139888 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_61960 142166 141327 gene locus_tag LOCUS_61970 142166 141327 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972375.1 protein_id gnl|my_center|LOCUS_61970 143175 142159 gene locus_tag LOCUS_61980 143175 142159 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031035.1 protein_id gnl|my_center|LOCUS_61980 144581 143265 gene locus_tag LOCUS_61990 144581 143265 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972377.1 protein_id gnl|my_center|LOCUS_61990 146882 145599 gene locus_tag LOCUS_62000 146882 145599 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977569.1 protein_id gnl|my_center|LOCUS_62000 147527 147150 gene locus_tag LOCUS_62010 147527 147150 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224150.1 protein_id gnl|my_center|LOCUS_62010 148152 147544 gene locus_tag LOCUS_62020 148152 147544 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400591.1 protein_id gnl|my_center|LOCUS_62020 148235 149164 gene locus_tag LOCUS_62030 148235 149164 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912371.1 protein_id gnl|my_center|LOCUS_62030 150155 149259 gene locus_tag LOCUS_62040 150155 149259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62040 150906 152114 gene locus_tag LOCUS_62050 150906 152114 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_62050 152289 154097 gene locus_tag LOCUS_62060 152289 154097 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110061.1 protein_id gnl|my_center|LOCUS_62060 154848 154087 gene locus_tag LOCUS_62070 154848 154087 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225044.1 protein_id gnl|my_center|LOCUS_62070 155668 154856 gene locus_tag LOCUS_62080 155668 154856 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225473.1 protein_id gnl|my_center|LOCUS_62080 156070 155732 gene locus_tag LOCUS_62090 156070 155732 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226554.1 protein_id gnl|my_center|LOCUS_62090 156516 156067 gene locus_tag LOCUS_62100 156516 156067 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226553.1 protein_id gnl|my_center|LOCUS_62100 157891 156710 gene locus_tag LOCUS_62110 157891 156710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62110 158338 159195 gene locus_tag LOCUS_62120 158338 159195 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729479.1 protein_id gnl|my_center|LOCUS_62120 >Feature sequence36 178 732 gene locus_tag LOCUS_62130 178 732 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284396.1 protein_id gnl|my_center|LOCUS_62130 732 1367 gene locus_tag LOCUS_62140 732 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 2118 1411 gene locus_tag LOCUS_62150 2118 1411 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222330.1 protein_id gnl|my_center|LOCUS_62150 3414 2200 gene locus_tag LOCUS_62160 3414 2200 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918994.1 protein_id gnl|my_center|LOCUS_62160 3599 4090 gene locus_tag LOCUS_62170 3599 4090 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891554.1 protein_id gnl|my_center|LOCUS_62170 4096 4506 gene locus_tag LOCUS_62180 4096 4506 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974546.1 protein_id gnl|my_center|LOCUS_62180 4616 7006 gene locus_tag LOCUS_62190 4616 7006 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 protein_id gnl|my_center|LOCUS_62190 7113 8201 gene locus_tag LOCUS_62200 7113 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62200 8407 9135 gene locus_tag LOCUS_62210 8407 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62210 9330 9845 gene locus_tag LOCUS_62220 9330 9845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62220 10638 9922 gene locus_tag LOCUS_62230 10638 9922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 10760 11968 gene locus_tag LOCUS_62240 10760 11968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 11965 12621 gene locus_tag LOCUS_62250 11965 12621 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_62250 12708 13019 gene locus_tag LOCUS_62260 12708 13019 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249692.1 protein_id gnl|my_center|LOCUS_62260 13032 13523 gene locus_tag LOCUS_62270 13032 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62270 13523 13897 gene locus_tag LOCUS_62280 13523 13897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62280 14435 13947 gene locus_tag LOCUS_62290 14435 13947 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469843.1 protein_id gnl|my_center|LOCUS_62290 14877 14587 gene locus_tag LOCUS_62300 14877 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62300 15027 16232 gene locus_tag LOCUS_62310 15027 16232 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 protein_id gnl|my_center|LOCUS_62310 16229 17149 gene locus_tag LOCUS_62320 16229 17149 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_62320 17230 18237 gene locus_tag LOCUS_62330 17230 18237 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230423.1 protein_id gnl|my_center|LOCUS_62330 19182 18304 gene locus_tag LOCUS_62340 19182 18304 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972532.1 protein_id gnl|my_center|LOCUS_62340 20118 19342 gene locus_tag LOCUS_62350 20118 19342 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818296.1 protein_id gnl|my_center|LOCUS_62350 21279 20188 gene locus_tag LOCUS_62360 21279 20188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227468.1 protein_id gnl|my_center|LOCUS_62360 23328 21355 gene locus_tag LOCUS_62370 23328 21355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62370 24661 23456 gene locus_tag LOCUS_62380 24661 23456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62380 24835 25506 gene locus_tag LOCUS_62390 24835 25506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62390 26255 25527 gene locus_tag LOCUS_62400 26255 25527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 26981 26487 gene locus_tag LOCUS_62410 26981 26487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62410 27970 26987 gene locus_tag LOCUS_62420 27970 26987 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156575380.1 protein_id gnl|my_center|LOCUS_62420 28104 29240 gene locus_tag LOCUS_62430 28104 29240 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091317270.1 protein_id gnl|my_center|LOCUS_62430 30092 29262 gene locus_tag LOCUS_62440 30092 29262 CDS product NPP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031599.1 protein_id gnl|my_center|LOCUS_62440 31781 30255 gene locus_tag LOCUS_62450 31781 30255 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_62450 32462 31992 gene locus_tag LOCUS_62460 32462 31992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62460 33335 32490 gene locus_tag LOCUS_62470 33335 32490 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031456.1 protein_id gnl|my_center|LOCUS_62470 33550 34974 gene locus_tag LOCUS_62480 33550 34974 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031455.1 protein_id gnl|my_center|LOCUS_62480 33684 33588 gene locus_tag LOCUS_t00590 33684 33588 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 35755 35012 gene locus_tag LOCUS_62490 35755 35012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62490 36688 36782 gene locus_tag LOCUS_t00600 36688 36782 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 37726 37031 gene locus_tag LOCUS_62500 37726 37031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62500 37940 38866 gene locus_tag LOCUS_62510 37940 38866 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876395.1 protein_id gnl|my_center|LOCUS_62510 39040 39858 gene locus_tag LOCUS_62520 39040 39858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62520 40029 40502 gene locus_tag LOCUS_62530 40029 40502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62530 42793 40499 gene locus_tag LOCUS_62540 42793 40499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62540 44354 42918 gene locus_tag LOCUS_62550 44354 42918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62550 44507 45157 gene locus_tag LOCUS_62560 44507 45157 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229182.1 protein_id gnl|my_center|LOCUS_62560 45742 45191 gene locus_tag LOCUS_62570 45742 45191 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029611.1 protein_id gnl|my_center|LOCUS_62570 45836 46789 gene locus_tag LOCUS_62580 45836 46789 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028824.1 protein_id gnl|my_center|LOCUS_62580 47170 46799 gene locus_tag LOCUS_62590 47170 46799 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093593.1 protein_id gnl|my_center|LOCUS_62590 47456 48871 gene locus_tag LOCUS_62600 47456 48871 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 protein_id gnl|my_center|LOCUS_62600 48913 49308 gene locus_tag LOCUS_62610 48913 49308 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226375.1 protein_id gnl|my_center|LOCUS_62610 50145 49351 gene locus_tag LOCUS_62620 50145 49351 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225798.1 protein_id gnl|my_center|LOCUS_62620 51131 50262 gene locus_tag LOCUS_62630 51131 50262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62630 52468 51320 gene locus_tag LOCUS_62640 52468 51320 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270458.1 protein_id gnl|my_center|LOCUS_62640 52618 54681 gene locus_tag LOCUS_62650 52618 54681 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228648.1 protein_id gnl|my_center|LOCUS_62650 55286 54678 gene locus_tag LOCUS_62660 55286 54678 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228649.1 protein_id gnl|my_center|LOCUS_62660 55385 56116 gene locus_tag LOCUS_62670 55385 56116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223290.1 protein_id gnl|my_center|LOCUS_62670 56116 58566 gene locus_tag LOCUS_62680 56116 58566 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207316850.1 protein_id gnl|my_center|LOCUS_62680 58644 59231 gene locus_tag LOCUS_62690 58644 59231 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973087.1 protein_id gnl|my_center|LOCUS_62690 59228 60379 gene locus_tag LOCUS_62700 59228 60379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62700 61783 60491 gene locus_tag LOCUS_62710 61783 60491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62710 62995 61883 gene locus_tag LOCUS_62720 62995 61883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 63626 63234 gene locus_tag LOCUS_62730 63626 63234 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 protein_id gnl|my_center|LOCUS_62730 64827 63820 gene locus_tag LOCUS_62740 64827 63820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 66001 64844 gene locus_tag LOCUS_62750 66001 64844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62750 67883 65988 gene locus_tag LOCUS_62760 67883 65988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62760 69026 68175 gene locus_tag LOCUS_62770 69026 68175 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218604714.1 protein_id gnl|my_center|LOCUS_62770 69477 69830 gene locus_tag LOCUS_62780 69477 69830 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081659.1 protein_id gnl|my_center|LOCUS_62780 70420 69857 gene locus_tag LOCUS_62790 70420 69857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62790 71732 70581 gene locus_tag LOCUS_62800 71732 70581 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_62800 71896 72627 gene locus_tag LOCUS_62810 71896 72627 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_62810 72681 75056 gene locus_tag LOCUS_62820 72681 75056 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028573.1 protein_id gnl|my_center|LOCUS_62820 75219 75614 gene locus_tag LOCUS_62830 75219 75614 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001796324.1 protein_id gnl|my_center|LOCUS_62830 75835 76758 gene locus_tag LOCUS_62840 75835 76758 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225421.1 protein_id gnl|my_center|LOCUS_62840 76773 77372 gene locus_tag LOCUS_62850 76773 77372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62850 77376 78380 gene locus_tag LOCUS_62860 77376 78380 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727119.1 protein_id gnl|my_center|LOCUS_62860 78377 80554 gene locus_tag LOCUS_62870 78377 80554 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531564.1 protein_id gnl|my_center|LOCUS_62870 80602 82137 gene locus_tag LOCUS_62880 80602 82137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62880 82959 82429 gene locus_tag LOCUS_62890 82959 82429 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086962.1 protein_id gnl|my_center|LOCUS_62890 84019 82964 gene locus_tag LOCUS_62900 84019 82964 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727875.1 protein_id gnl|my_center|LOCUS_62900 84515 84102 gene locus_tag LOCUS_62910 84515 84102 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976576.1 protein_id gnl|my_center|LOCUS_62910 87405 84610 gene locus_tag LOCUS_62920 87405 84610 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406189.1 protein_id gnl|my_center|LOCUS_62920 87600 88766 gene locus_tag LOCUS_62930 87600 88766 CDS product EfeM/EfeO family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847669.1 protein_id gnl|my_center|LOCUS_62930 88763 89992 gene locus_tag LOCUS_62940 88763 89992 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229345.1 protein_id gnl|my_center|LOCUS_62940 90142 91800 gene locus_tag LOCUS_62950 90142 91800 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229346.1 protein_id gnl|my_center|LOCUS_62950 93160 91895 gene locus_tag LOCUS_62960 93160 91895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62960 93639 93157 gene locus_tag LOCUS_62970 93639 93157 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222096.1 protein_id gnl|my_center|LOCUS_62970 93761 95005 gene locus_tag LOCUS_62980 93761 95005 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029752.1 protein_id gnl|my_center|LOCUS_62980 94996 95637 gene locus_tag LOCUS_62990 94996 95637 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 protein_id gnl|my_center|LOCUS_62990 95651 96184 gene locus_tag LOCUS_63000 95651 96184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63000 96337 96738 gene locus_tag LOCUS_63010 96337 96738 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971761.1 protein_id gnl|my_center|LOCUS_63010 96985 96776 gene locus_tag LOCUS_63020 96985 96776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63020 97910 96990 gene locus_tag LOCUS_63030 97910 96990 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975951.1 protein_id gnl|my_center|LOCUS_63030 98863 98030 gene locus_tag LOCUS_63040 98863 98030 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136617434.1 protein_id gnl|my_center|LOCUS_63040 99061 99621 gene locus_tag LOCUS_63050 99061 99621 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971468.1 protein_id gnl|my_center|LOCUS_63050 99868 100338 gene locus_tag LOCUS_63060 99868 100338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63060 100404 101132 gene locus_tag LOCUS_63070 100404 101132 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896957.1 protein_id gnl|my_center|LOCUS_63070 101146 101466 gene locus_tag LOCUS_63080 101146 101466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63080 101489 102541 gene locus_tag LOCUS_63090 101489 102541 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 protein_id gnl|my_center|LOCUS_63090 102586 102789 gene locus_tag LOCUS_63100 102586 102789 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855276.1 protein_id gnl|my_center|LOCUS_63100 102822 104957 gene locus_tag LOCUS_63110 102822 104957 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_63110 106798 105164 gene locus_tag LOCUS_63120 106798 105164 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_63120 107895 107020 gene locus_tag LOCUS_63130 107895 107020 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028273.1 protein_id gnl|my_center|LOCUS_63130 108228 107962 gene locus_tag LOCUS_63140 108228 107962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 109444 108356 gene locus_tag LOCUS_63150 109444 108356 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_63150 109706 110389 gene locus_tag LOCUS_63160 109706 110389 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976592.1 protein_id gnl|my_center|LOCUS_63160 110744 110541 gene locus_tag LOCUS_63170 gene bldC 110744 110541 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_63170 111975 111064 gene locus_tag LOCUS_63180 111975 111064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974882.1 protein_id gnl|my_center|LOCUS_63180 112074 113177 gene locus_tag LOCUS_63190 112074 113177 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228727.1 protein_id gnl|my_center|LOCUS_63190 113329 113562 gene locus_tag LOCUS_63200 113329 113562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63200 114743 113718 gene locus_tag LOCUS_63210 gene purM 114743 113718 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974885.1 protein_id gnl|my_center|LOCUS_63210 116134 114740 gene locus_tag LOCUS_63220 gene purF 116134 114740 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_63220 116383 117093 gene locus_tag LOCUS_63230 116383 117093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 117559 117104 gene locus_tag LOCUS_63240 117559 117104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 118993 117563 gene locus_tag LOCUS_63250 118993 117563 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029787.1 protein_id gnl|my_center|LOCUS_63250 119106 119798 gene locus_tag LOCUS_63260 119106 119798 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111238.1 protein_id gnl|my_center|LOCUS_63260 121183 119705 gene locus_tag LOCUS_63270 121183 119705 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392514.1 protein_id gnl|my_center|LOCUS_63270 121891 121226 gene locus_tag LOCUS_63280 121891 121226 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227881.1 protein_id gnl|my_center|LOCUS_63280 123975 121888 gene locus_tag LOCUS_63290 123975 121888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63290 125183 124029 gene locus_tag LOCUS_63300 125183 124029 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973478.1 protein_id gnl|my_center|LOCUS_63300 125252 127402 gene locus_tag LOCUS_63310 125252 127402 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229532.1 protein_id gnl|my_center|LOCUS_63310 129727 127472 gene locus_tag LOCUS_63320 gene purL 129727 127472 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_63320 130407 129724 gene locus_tag LOCUS_63330 gene purQ 130407 129724 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_63330 130999 130550 gene locus_tag LOCUS_63340 130999 130550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63340 131417 131172 gene locus_tag LOCUS_63350 gene purS 131417 131172 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 protein_id gnl|my_center|LOCUS_63350 131714 132805 gene locus_tag LOCUS_63360 gene pdhA 131714 132805 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_63360 132802 133776 gene locus_tag LOCUS_63370 132802 133776 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_63370 133791 135155 gene locus_tag LOCUS_63380 133791 135155 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_63380 135258 135551 gene locus_tag LOCUS_63390 135258 135551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 135829 135608 gene locus_tag LOCUS_63400 135829 135608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63400 137797 135974 gene locus_tag LOCUS_63410 137797 135974 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_63410 137954 138751 gene locus_tag LOCUS_63420 137954 138751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63420 139244 138756 gene locus_tag LOCUS_63430 139244 138756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63430 139337 139744 gene locus_tag LOCUS_63440 139337 139744 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530753.1 protein_id gnl|my_center|LOCUS_63440 140319 139714 gene locus_tag LOCUS_63450 140319 139714 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406182.1 protein_id gnl|my_center|LOCUS_63450 140355 141116 gene locus_tag LOCUS_63460 140355 141116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63460 143151 141130 gene locus_tag LOCUS_63470 143151 141130 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256905.1 protein_id gnl|my_center|LOCUS_63470 143613 143173 gene locus_tag LOCUS_63480 143613 143173 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027656.1 protein_id gnl|my_center|LOCUS_63480 143693 146068 gene locus_tag LOCUS_63490 143693 146068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63490 147098 146073 gene locus_tag LOCUS_63500 gene mgrA 147098 146073 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_63500 149149 147095 gene locus_tag LOCUS_63510 149149 147095 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730837.1 protein_id gnl|my_center|LOCUS_63510 >Feature sequence37 607 1104 gene locus_tag LOCUS_63520 607 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63520 1517 2269 gene locus_tag LOCUS_63530 1517 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63530 2736 2314 gene locus_tag LOCUS_63540 gene arfB 2736 2314 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230741.1 protein_id gnl|my_center|LOCUS_63540 3041 3901 gene locus_tag LOCUS_63550 3041 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63550 3937 4512 gene locus_tag LOCUS_63560 3937 4512 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230784.1 protein_id gnl|my_center|LOCUS_63560 4812 6344 gene locus_tag LOCUS_63570 gene phoD 4812 6344 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_63570 7915 6329 gene locus_tag LOCUS_63580 7915 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63580 9470 8010 gene locus_tag LOCUS_63590 9470 8010 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_63590 9596 10555 gene locus_tag LOCUS_63600 9596 10555 CDS product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 protein_id gnl|my_center|LOCUS_63600 10552 11748 gene locus_tag LOCUS_63610 10552 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63610 11736 12599 gene locus_tag LOCUS_63620 11736 12599 CDS product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_63620 12596 13906 gene locus_tag LOCUS_63630 12596 13906 CDS product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202627.1 protein_id gnl|my_center|LOCUS_63630 13996 14886 gene locus_tag LOCUS_63640 13996 14886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63640 16118 14862 gene locus_tag LOCUS_63650 16118 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63650 16444 16118 gene locus_tag LOCUS_63660 16444 16118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63660 16714 19077 gene locus_tag LOCUS_63670 gene lon 16714 19077 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030152.1 protein_id gnl|my_center|LOCUS_63670 19241 20776 gene locus_tag LOCUS_63680 19241 20776 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173812.1 protein_id gnl|my_center|LOCUS_63680 20905 22200 gene locus_tag LOCUS_63690 20905 22200 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730565.1 protein_id gnl|my_center|LOCUS_63690 24096 22396 gene locus_tag LOCUS_63700 24096 22396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63700 25811 24093 gene locus_tag LOCUS_63710 25811 24093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63710 26455 25844 gene locus_tag LOCUS_63720 26455 25844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63720 27801 26617 gene locus_tag LOCUS_63730 27801 26617 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222962.1 protein_id gnl|my_center|LOCUS_63730 27888 28211 gene locus_tag LOCUS_63740 27888 28211 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_63740 28885 28109 gene locus_tag LOCUS_63750 28885 28109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63750 29089 29562 gene locus_tag LOCUS_63760 29089 29562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63760 29844 32219 gene locus_tag LOCUS_63770 29844 32219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63770 33912 32230 gene locus_tag LOCUS_63780 gene ctaD 33912 32230 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971911.1 protein_id gnl|my_center|LOCUS_63780 34031 34399 gene locus_tag LOCUS_63790 gene trxA 34031 34399 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_63790 35228 34434 gene locus_tag LOCUS_63800 35228 34434 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_63800 36583 35288 gene locus_tag LOCUS_63810 36583 35288 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_63810 37890 36682 gene locus_tag LOCUS_63820 37890 36682 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408560.1 protein_id gnl|my_center|LOCUS_63820 38960 37968 gene locus_tag LOCUS_63830 38960 37968 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223218.1 protein_id gnl|my_center|LOCUS_63830 39856 38966 gene locus_tag LOCUS_63840 39856 38966 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804906.1 protein_id gnl|my_center|LOCUS_63840 41299 39980 gene locus_tag LOCUS_63850 41299 39980 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_63850 41792 43087 gene locus_tag LOCUS_63860 41792 43087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63860 44155 43136 gene locus_tag LOCUS_63870 44155 43136 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 protein_id gnl|my_center|LOCUS_63870 45634 44201 gene locus_tag LOCUS_63880 45634 44201 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_63880 46425 45631 gene locus_tag LOCUS_63890 46425 45631 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224316.1 protein_id gnl|my_center|LOCUS_63890 46370 46546 gene locus_tag LOCUS_63900 46370 46546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63900 47492 46518 gene locus_tag LOCUS_63910 47492 46518 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971588.1 protein_id gnl|my_center|LOCUS_63910 48893 47580 gene locus_tag LOCUS_63920 48893 47580 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 protein_id gnl|my_center|LOCUS_63920 48781 49110 gene locus_tag LOCUS_63930 48781 49110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63930 50958 49450 gene locus_tag LOCUS_63940 50958 49450 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143420.1 protein_id gnl|my_center|LOCUS_63940 51202 52344 gene locus_tag LOCUS_63950 51202 52344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974090.1 protein_id gnl|my_center|LOCUS_63950 52341 53561 gene locus_tag LOCUS_63960 52341 53561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63960 54957 53659 gene locus_tag LOCUS_63970 54957 53659 CDS product alpha-2,8-polysialyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029922.1 protein_id gnl|my_center|LOCUS_63970 55895 54954 gene locus_tag LOCUS_63980 55895 54954 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974094.1 protein_id gnl|my_center|LOCUS_63980 57981 55909 gene locus_tag LOCUS_63990 57981 55909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63990 58148 59086 gene locus_tag LOCUS_64000 58148 59086 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225228.1 protein_id gnl|my_center|LOCUS_64000 60496 59114 gene locus_tag LOCUS_64010 60496 59114 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_64010 60728 61348 gene locus_tag LOCUS_64020 60728 61348 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284416.1 protein_id gnl|my_center|LOCUS_64020 62671 61394 gene locus_tag LOCUS_64030 62671 61394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977118.1 protein_id gnl|my_center|LOCUS_64030 62852 64270 gene locus_tag LOCUS_64040 62852 64270 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_64040 64274 65236 gene locus_tag LOCUS_64050 64274 65236 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976584.1 protein_id gnl|my_center|LOCUS_64050 65233 66087 gene locus_tag LOCUS_64060 65233 66087 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_64060 66113 67756 gene locus_tag LOCUS_64070 66113 67756 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_64070 67767 68801 gene locus_tag LOCUS_64080 67767 68801 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_64080 68882 69766 gene locus_tag LOCUS_64090 68882 69766 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029030.1 protein_id gnl|my_center|LOCUS_64090 70490 69876 gene locus_tag LOCUS_64100 gene eda 70490 69876 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_64100 71446 70487 gene locus_tag LOCUS_64110 71446 70487 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951113.1 protein_id gnl|my_center|LOCUS_64110 73275 71443 gene locus_tag LOCUS_64120 gene edd 73275 71443 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284323.1 protein_id gnl|my_center|LOCUS_64120 74756 73272 gene locus_tag LOCUS_64130 gene zwf 74756 73272 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726838.1 protein_id gnl|my_center|LOCUS_64130 74862 76037 gene locus_tag LOCUS_64140 74862 76037 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876734.1 protein_id gnl|my_center|LOCUS_64140 76840 76067 gene locus_tag LOCUS_64150 76840 76067 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084123.1 protein_id gnl|my_center|LOCUS_64150 76918 77532 gene locus_tag LOCUS_64160 gene rpsD 76918 77532 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977321.1 protein_id gnl|my_center|LOCUS_64160 78574 77612 gene locus_tag LOCUS_64170 78574 77612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64170 79261 78701 gene locus_tag LOCUS_64180 79261 78701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64180 80945 79434 gene locus_tag LOCUS_64190 80945 79434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64190 81260 82129 gene locus_tag LOCUS_64200 81260 82129 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525156.1 protein_id gnl|my_center|LOCUS_64200 82197 83042 gene locus_tag LOCUS_64210 gene folP 82197 83042 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327205.1 protein_id gnl|my_center|LOCUS_64210 84524 83091 gene locus_tag LOCUS_64220 84524 83091 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_64220 84698 85168 gene locus_tag LOCUS_64230 84698 85168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64230 85898 85098 gene locus_tag LOCUS_64240 85898 85098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64240 86687 85899 gene locus_tag LOCUS_64250 86687 85899 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028652.1 protein_id gnl|my_center|LOCUS_64250 87453 86680 gene locus_tag LOCUS_64260 87453 86680 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975914.1 protein_id gnl|my_center|LOCUS_64260 87756 87508 gene locus_tag LOCUS_64270 87756 87508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64270 88010 88990 gene locus_tag LOCUS_64280 88010 88990 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_64280 89132 90652 gene locus_tag LOCUS_64290 89132 90652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64290 90684 91487 gene locus_tag LOCUS_64300 90684 91487 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031676.1 protein_id gnl|my_center|LOCUS_64300 92969 91668 gene locus_tag LOCUS_64310 gene aceA 92969 91668 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223536.1 protein_id gnl|my_center|LOCUS_64310 93204 94673 gene locus_tag LOCUS_64320 93204 94673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64320 94767 95720 gene locus_tag LOCUS_64330 94767 95720 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_64330 95830 97056 gene locus_tag LOCUS_64340 95830 97056 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727016.1 protein_id gnl|my_center|LOCUS_64340 97695 97141 gene locus_tag LOCUS_64350 97695 97141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64350 98750 97854 gene locus_tag LOCUS_64360 98750 97854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64360 99520 99110 gene locus_tag LOCUS_64370 99520 99110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64370 100626 99781 gene locus_tag LOCUS_64380 100626 99781 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199889868.1 protein_id gnl|my_center|LOCUS_64380 101171 100629 gene locus_tag LOCUS_64390 101171 100629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64390 101377 101168 gene locus_tag LOCUS_64400 101377 101168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64400 102740 101466 gene locus_tag LOCUS_64410 102740 101466 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 protein_id gnl|my_center|LOCUS_64410 103687 102842 gene locus_tag LOCUS_64420 103687 102842 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971433.1 protein_id gnl|my_center|LOCUS_64420 104373 103810 gene locus_tag LOCUS_64430 104373 103810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64430 105297 104515 gene locus_tag LOCUS_64440 105297 104515 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978033.1 protein_id gnl|my_center|LOCUS_64440 106335 105445 gene locus_tag LOCUS_64450 gene folD 106335 105445 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070308.1 protein_id gnl|my_center|LOCUS_64450 106776 106507 gene locus_tag LOCUS_64460 106776 106507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64460 107111 106860 gene locus_tag LOCUS_64470 107111 106860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64470 107158 107769 gene locus_tag LOCUS_64480 107158 107769 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030670.1 protein_id gnl|my_center|LOCUS_64480 108314 107856 gene locus_tag LOCUS_64490 108314 107856 CDS product DUF3291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030162.1 protein_id gnl|my_center|LOCUS_64490 109015 108329 gene locus_tag LOCUS_64500 109015 108329 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971473.1 protein_id gnl|my_center|LOCUS_64500 109193 109996 gene locus_tag LOCUS_64510 109193 109996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64510 111872 109935 gene locus_tag LOCUS_64520 111872 109935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64520 112723 111869 gene locus_tag LOCUS_64530 112723 111869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64530 113001 112825 gene locus_tag LOCUS_64540 113001 112825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 113163 115688 gene locus_tag LOCUS_64550 113163 115688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64550 117968 115689 gene locus_tag LOCUS_64560 117968 115689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64560 119604 118309 gene locus_tag LOCUS_64570 119604 118309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64570 121837 119840 gene locus_tag LOCUS_64580 121837 119840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 122744 121842 gene locus_tag LOCUS_64590 122744 121842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64590 122991 122845 gene locus_tag LOCUS_64600 122991 122845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64600 123162 125708 gene locus_tag LOCUS_64610 123162 125708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64610 126968 125721 gene locus_tag LOCUS_64620 126968 125721 CDS product HEXXH motif domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229895.1 protein_id gnl|my_center|LOCUS_64620 128193 126979 gene locus_tag LOCUS_64630 128193 126979 CDS product FxsB family radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229894.1 protein_id gnl|my_center|LOCUS_64630 128428 128907 gene locus_tag LOCUS_64640 128428 128907 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225198.1 protein_id gnl|my_center|LOCUS_64640 129038 129670 gene locus_tag LOCUS_64650 129038 129670 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227079.1 protein_id gnl|my_center|LOCUS_64650 129697 130410 gene locus_tag LOCUS_64660 129697 130410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64660 131366 130527 gene locus_tag LOCUS_64670 131366 130527 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_64670 131685 135551 gene locus_tag LOCUS_64680 131685 135551 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227790.1 protein_id gnl|my_center|LOCUS_64680 135575 136858 gene locus_tag LOCUS_64690 135575 136858 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086878.1 protein_id gnl|my_center|LOCUS_64690 137260 136883 gene locus_tag LOCUS_64700 137260 136883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64700 137411 139156 gene locus_tag LOCUS_64710 137411 139156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64710 139178 141160 gene locus_tag LOCUS_64720 139178 141160 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230673.1 protein_id gnl|my_center|LOCUS_64720 >Feature sequence38 606 1067 gene locus_tag LOCUS_64730 606 1067 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401141.1 protein_id gnl|my_center|LOCUS_64730 >Feature sequence39 1131 2492 gene locus_tag LOCUS_64740 1131 2492 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529494.1 protein_id gnl|my_center|LOCUS_64740 2489 3439 gene locus_tag LOCUS_64750 2489 3439 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528078.1 protein_id gnl|my_center|LOCUS_64750 3439 4347 gene locus_tag LOCUS_64760 3439 4347 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034858202.1 protein_id gnl|my_center|LOCUS_64760 4347 5414 gene locus_tag LOCUS_64770 4347 5414 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975293.1 protein_id gnl|my_center|LOCUS_64770 5414 6490 gene locus_tag LOCUS_64780 gene ugpC 5414 6490 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972908.1 protein_id gnl|my_center|LOCUS_64780 6514 6690 gene locus_tag LOCUS_64790 6514 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64790 6767 8227 gene locus_tag LOCUS_64800 6767 8227 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031393.1 protein_id gnl|my_center|LOCUS_64800 8224 8703 gene locus_tag LOCUS_64810 8224 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64810 8705 9940 gene locus_tag LOCUS_64820 8705 9940 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970145.1 protein_id gnl|my_center|LOCUS_64820 9956 10288 gene locus_tag LOCUS_64830 9956 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64830 11164 10496 gene locus_tag LOCUS_64840 11164 10496 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031090.1 protein_id gnl|my_center|LOCUS_64840 12404 11214 gene locus_tag LOCUS_64850 12404 11214 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_64850 12300 12581 gene locus_tag LOCUS_64860 12300 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64860 12595 14304 gene locus_tag LOCUS_64870 12595 14304 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_64870 15636 14773 gene locus_tag LOCUS_64880 15636 14773 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225309.1 protein_id gnl|my_center|LOCUS_64880 15725 16450 gene locus_tag LOCUS_64890 15725 16450 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226429.1 protein_id gnl|my_center|LOCUS_64890 16713 16922 gene locus_tag LOCUS_64900 16713 16922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64900 16873 17133 gene locus_tag LOCUS_64910 16873 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64910 17706 17215 gene locus_tag LOCUS_64920 17706 17215 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928568.1 protein_id gnl|my_center|LOCUS_64920 17830 19149 gene locus_tag LOCUS_64930 17830 19149 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083760.1 protein_id gnl|my_center|LOCUS_64930 19194 19427 gene locus_tag LOCUS_64940 19194 19427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64940 >Feature sequence40 <1 602 gene locus_tag LOCUS_64950 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010908727.1:FAD-dependent oxidoreductase 671 1447 gene locus_tag LOCUS_64960 671 1447 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222327.1 protein_id gnl|my_center|LOCUS_64960 1499 2032 gene locus_tag LOCUS_64970 1499 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64970 2673 1915 gene locus_tag LOCUS_64980 2673 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64980 3086 3817 gene locus_tag LOCUS_64990 3086 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64990 4410 3916 gene locus_tag LOCUS_65000 4410 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65000 6864 4885 gene locus_tag LOCUS_65010 6864 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65010 7123 7317 gene locus_tag LOCUS_65020 7123 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65020 7518 7766 gene locus_tag LOCUS_65030 7518 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65030 8085 8915 gene locus_tag LOCUS_65040 8085 8915 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_65040 8957 9838 gene locus_tag LOCUS_65050 8957 9838 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972022.1 protein_id gnl|my_center|LOCUS_65050 12285 9877 gene locus_tag LOCUS_65060 12285 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65060 12520 15363 gene locus_tag LOCUS_65070 12520 15363 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487609.1 protein_id gnl|my_center|LOCUS_65070 15763 17556 gene locus_tag LOCUS_65080 15763 17556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65080 18563 17880 gene locus_tag LOCUS_65090 18563 17880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65090 19412 20164 gene locus_tag LOCUS_65100 19412 20164 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226620.1 protein_id gnl|my_center|LOCUS_65100 21344 20514 gene locus_tag LOCUS_65110 21344 20514 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223735.1 protein_id gnl|my_center|LOCUS_65110 21685 21341 gene locus_tag LOCUS_65120 21685 21341 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225806.1 protein_id gnl|my_center|LOCUS_65120 22869 21682 gene locus_tag LOCUS_65130 22869 21682 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027050.1 protein_id gnl|my_center|LOCUS_65130 23812 22901 gene locus_tag LOCUS_65140 23812 22901 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226621.1 protein_id gnl|my_center|LOCUS_65140 24662 23817 gene locus_tag LOCUS_65150 24662 23817 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947166.1 protein_id gnl|my_center|LOCUS_65150 26118 24751 gene locus_tag LOCUS_65160 26118 24751 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226624.1 protein_id gnl|my_center|LOCUS_65160 26239 27267 gene locus_tag LOCUS_65170 26239 27267 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383135.1 protein_id gnl|my_center|LOCUS_65170 27264 28019 gene locus_tag LOCUS_65180 gene kduD 27264 28019 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972791.1 protein_id gnl|my_center|LOCUS_65180 29037 28231 gene locus_tag LOCUS_65190 29037 28231 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226620.1 protein_id gnl|my_center|LOCUS_65190 29441 30478 gene locus_tag LOCUS_65200 gene kdgK1 29441 30478 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_65200 31125 30826 gene locus_tag LOCUS_65210 31125 30826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65210 31419 31132 gene locus_tag LOCUS_65220 31419 31132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65220 31361 33388 gene locus_tag LOCUS_65230 31361 33388 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225154.1 protein_id gnl|my_center|LOCUS_65230 33766 34788 gene locus_tag LOCUS_65240 33766 34788 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852489.1 protein_id gnl|my_center|LOCUS_65240 34869 37139 gene locus_tag LOCUS_65250 34869 37139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65250 37523 37284 gene locus_tag LOCUS_65260 37523 37284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65260 37495 38700 gene locus_tag LOCUS_65270 37495 38700 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878184.1 protein_id gnl|my_center|LOCUS_65270 38710 39720 gene locus_tag LOCUS_65280 38710 39720 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031643.1 protein_id gnl|my_center|LOCUS_65280 39720 40601 gene locus_tag LOCUS_65290 39720 40601 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031642.1 protein_id gnl|my_center|LOCUS_65290 41769 40681 gene locus_tag LOCUS_65300 41769 40681 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804785.1 protein_id gnl|my_center|LOCUS_65300 43320 41791 gene locus_tag LOCUS_65310 43320 41791 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446585.1 protein_id gnl|my_center|LOCUS_65310 43696 44145 gene locus_tag LOCUS_65320 43696 44145 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224367.1 protein_id gnl|my_center|LOCUS_65320 47306 44142 gene locus_tag LOCUS_65330 47306 44142 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 protein_id gnl|my_center|LOCUS_65330 48312 47416 gene locus_tag LOCUS_65340 48312 47416 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729360.1 protein_id gnl|my_center|LOCUS_65340 48418 48639 gene locus_tag LOCUS_65350 48418 48639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65350 51153 48721 gene locus_tag LOCUS_65360 51153 48721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65360 52329 51307 gene locus_tag LOCUS_65370 52329 51307 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224933.1 protein_id gnl|my_center|LOCUS_65370 52277 52534 gene locus_tag LOCUS_65380 52277 52534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65380 52606 53850 gene locus_tag LOCUS_65390 52606 53850 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224934.1 protein_id gnl|my_center|LOCUS_65390 53856 54821 gene locus_tag LOCUS_65400 53856 54821 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224935.1 protein_id gnl|my_center|LOCUS_65400 54818 55624 gene locus_tag LOCUS_65410 54818 55624 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224936.1 protein_id gnl|my_center|LOCUS_65410 55651 57342 gene locus_tag LOCUS_65420 55651 57342 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224937.1 protein_id gnl|my_center|LOCUS_65420 57426 58496 gene locus_tag LOCUS_65430 57426 58496 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224933.1 protein_id gnl|my_center|LOCUS_65430 59596 58562 gene locus_tag LOCUS_65440 59596 58562 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_65440 60746 59703 gene locus_tag LOCUS_65450 60746 59703 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225264.1 protein_id gnl|my_center|LOCUS_65450 60976 62247 gene locus_tag LOCUS_65460 60976 62247 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224934.1 protein_id gnl|my_center|LOCUS_65460 62250 63209 gene locus_tag LOCUS_65470 62250 63209 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224935.1 protein_id gnl|my_center|LOCUS_65470 63206 64015 gene locus_tag LOCUS_65480 63206 64015 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224936.1 protein_id gnl|my_center|LOCUS_65480 64027 65964 gene locus_tag LOCUS_65490 64027 65964 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225268.1 protein_id gnl|my_center|LOCUS_65490 66308 69256 gene locus_tag LOCUS_65500 66308 69256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65500 69544 70245 gene locus_tag LOCUS_65510 69544 70245 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_65510 70848 70474 gene locus_tag LOCUS_65520 70848 70474 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036200.1 protein_id gnl|my_center|LOCUS_65520 71046 71663 gene locus_tag LOCUS_65530 71046 71663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65530 72510 72013 gene locus_tag LOCUS_65540 72510 72013 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223215.1 protein_id gnl|my_center|LOCUS_65540 72764 73315 gene locus_tag LOCUS_65550 72764 73315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65550 73322 74419 gene locus_tag LOCUS_65560 73322 74419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65560 74518 75399 gene locus_tag LOCUS_65570 74518 75399 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950743.1 protein_id gnl|my_center|LOCUS_65570 76822 76040 gene locus_tag LOCUS_65580 76822 76040 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_65580 76976 78328 gene locus_tag LOCUS_65590 76976 78328 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429773.1 protein_id gnl|my_center|LOCUS_65590 78325 79809 gene locus_tag LOCUS_65600 78325 79809 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028557.1 protein_id gnl|my_center|LOCUS_65600 79806 80816 gene locus_tag LOCUS_65610 gene rbsC 79806 80816 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_65610 80909 81889 gene locus_tag LOCUS_65620 80909 81889 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975981.1 protein_id gnl|my_center|LOCUS_65620 81937 82926 gene locus_tag LOCUS_65630 81937 82926 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916599.1 protein_id gnl|my_center|LOCUS_65630 83127 85796 gene locus_tag LOCUS_65640 83127 85796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65640 86135 87553 gene locus_tag LOCUS_65650 86135 87553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65650 87651 88313 gene locus_tag LOCUS_65660 87651 88313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65660 88891 89658 gene locus_tag LOCUS_65670 88891 89658 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878027.1 protein_id gnl|my_center|LOCUS_65670 89761 90558 gene locus_tag LOCUS_65680 89761 90558 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227079.1 protein_id gnl|my_center|LOCUS_65680 90572 91294 gene locus_tag LOCUS_65690 90572 91294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65690 91291 91599 gene locus_tag LOCUS_65700 91291 91599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_65700 91859 92137 gene locus_tag LOCUS_65710 91859 92137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731457.1 protein_id gnl|my_center|LOCUS_65710 92616 92248 gene locus_tag LOCUS_65720 92616 92248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65720 92813 93163 gene locus_tag LOCUS_65730 92813 93163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65730 94411 93785 gene locus_tag LOCUS_65740 94411 93785 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115862.1 protein_id gnl|my_center|LOCUS_65740 94884 94411 gene locus_tag LOCUS_65750 94884 94411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65750 95040 95387 gene locus_tag LOCUS_65760 95040 95387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65760 95909 95331 gene locus_tag LOCUS_65770 95909 95331 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729836.1 protein_id gnl|my_center|LOCUS_65770 96272 97189 gene locus_tag LOCUS_65780 96272 97189 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730772.1 protein_id gnl|my_center|LOCUS_65780 97255 97728 gene locus_tag LOCUS_65790 97255 97728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65790 98083 98463 gene locus_tag LOCUS_65800 98083 98463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65800 98592 99872 gene locus_tag LOCUS_65810 98592 99872 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390922.1 protein_id gnl|my_center|LOCUS_65810 100942 100271 gene locus_tag LOCUS_65820 100942 100271 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731458.1 protein_id gnl|my_center|LOCUS_65820 101951 101334 gene locus_tag LOCUS_65830 101951 101334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65830 102105 102686 gene locus_tag LOCUS_65840 102105 102686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65840 103341 102877 gene locus_tag LOCUS_65850 103341 102877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65850 103476 104201 gene locus_tag LOCUS_65860 103476 104201 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223216.1 protein_id gnl|my_center|LOCUS_65860 104651 104929 gene locus_tag LOCUS_65870 104651 104929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65870 104926 105987 gene locus_tag LOCUS_65880 104926 105987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65880 106136 106498 gene locus_tag LOCUS_65890 106136 106498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65890 107222 106617 gene locus_tag LOCUS_65900 107222 106617 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729057.1 protein_id gnl|my_center|LOCUS_65900 107536 107273 gene locus_tag LOCUS_65910 107536 107273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65910 107468 108259 gene locus_tag LOCUS_65920 107468 108259 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729058.1 protein_id gnl|my_center|LOCUS_65920 109284 108394 gene locus_tag LOCUS_65930 109284 108394 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978137.1 protein_id gnl|my_center|LOCUS_65930 110916 109456 gene locus_tag LOCUS_65940 110916 109456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65940 113133 111475 gene locus_tag LOCUS_65950 113133 111475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65950 114350 113925 gene locus_tag LOCUS_65960 114350 113925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65960 114654 115097 gene locus_tag LOCUS_65970 114654 115097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65970 115617 115297 gene locus_tag LOCUS_65980 115617 115297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65980 115800 116213 gene locus_tag LOCUS_65990 115800 116213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65990 116804 116457 gene locus_tag LOCUS_66000 116804 116457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66000 >Feature sequence41 942 88 gene locus_tag LOCUS_66010 942 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66010 1082 1951 gene locus_tag LOCUS_66020 1082 1951 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225425.1 protein_id gnl|my_center|LOCUS_66020 2405 2073 gene locus_tag LOCUS_66030 2405 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66030 2955 2752 gene locus_tag LOCUS_66040 2955 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66040 3874 2966 gene locus_tag LOCUS_66050 3874 2966 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225890812.1 protein_id gnl|my_center|LOCUS_66050 4155 3880 gene locus_tag LOCUS_66060 4155 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66060 6186 4216 gene locus_tag LOCUS_66070 6186 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66070 6824 6504 gene locus_tag LOCUS_66080 6824 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66080 7581 6997 gene locus_tag LOCUS_66090 7581 6997 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225073.1 protein_id gnl|my_center|LOCUS_66090 7906 7598 gene locus_tag LOCUS_66100 7906 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66100 7788 9170 gene locus_tag LOCUS_66110 7788 9170 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_66110 9200 9403 gene locus_tag LOCUS_66120 9200 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66120 9400 9615 gene locus_tag LOCUS_66130 9400 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66130 9647 10384 gene locus_tag LOCUS_66140 9647 10384 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223914.1 protein_id gnl|my_center|LOCUS_66140 10645 11127 gene locus_tag LOCUS_66150 10645 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_66150 11652 12833 gene locus_tag LOCUS_66160 11652 12833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66160 12904 14016 gene locus_tag LOCUS_66170 12904 14016 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031776.1 protein_id gnl|my_center|LOCUS_66170 14969 14088 gene locus_tag LOCUS_66180 14969 14088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66180 16282 15137 gene locus_tag LOCUS_66190 16282 15137 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029664.1 protein_id gnl|my_center|LOCUS_66190 16698 16291 gene locus_tag LOCUS_66200 16698 16291 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974528.1 protein_id gnl|my_center|LOCUS_66200 16909 17442 gene locus_tag LOCUS_66210 16909 17442 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_66210 17439 18167 gene locus_tag LOCUS_66220 17439 18167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 protein_id gnl|my_center|LOCUS_66220 18173 19963 gene locus_tag LOCUS_66230 18173 19963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66230 21209 20031 gene locus_tag LOCUS_66240 21209 20031 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226537.1 protein_id gnl|my_center|LOCUS_66240 21183 21386 gene locus_tag LOCUS_66250 21183 21386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66250 21730 21392 gene locus_tag LOCUS_66260 21730 21392 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226535.1 protein_id gnl|my_center|LOCUS_66260 22182 21784 gene locus_tag LOCUS_66270 22182 21784 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730888.1 protein_id gnl|my_center|LOCUS_66270 22555 23088 gene locus_tag LOCUS_66280 22555 23088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66280 24091 23129 gene locus_tag LOCUS_66290 24091 23129 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026837.1 protein_id gnl|my_center|LOCUS_66290 24453 24088 gene locus_tag LOCUS_66300 24453 24088 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230674.1 protein_id gnl|my_center|LOCUS_66300 25828 24566 gene locus_tag LOCUS_66310 25828 24566 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_66310 26319 25927 gene locus_tag LOCUS_66320 26319 25927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66320 27127 26456 gene locus_tag LOCUS_66330 27127 26456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66330 27796 28506 gene locus_tag LOCUS_66340 27796 28506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66340 28610 29047 gene locus_tag LOCUS_66350 28610 29047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66350 29044 31398 gene locus_tag LOCUS_66360 29044 31398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66360 31447 32211 gene locus_tag LOCUS_66370 31447 32211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66370 32268 32813 gene locus_tag LOCUS_66380 32268 32813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66380 34224 32872 gene locus_tag LOCUS_66390 34224 32872 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 protein_id gnl|my_center|LOCUS_66390 34363 35184 gene locus_tag LOCUS_66400 34363 35184 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978631.1 protein_id gnl|my_center|LOCUS_66400 35248 35511 gene locus_tag LOCUS_66410 35248 35511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66410 35588 37834 gene locus_tag LOCUS_66420 35588 37834 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_66420 37877 39244 gene locus_tag LOCUS_66430 37877 39244 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_66430 39714 39268 gene locus_tag LOCUS_66440 39714 39268 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226527.1 protein_id gnl|my_center|LOCUS_66440 40070 39711 gene locus_tag LOCUS_66450 40070 39711 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226526.1 protein_id gnl|my_center|LOCUS_66450 41149 40187 gene locus_tag LOCUS_66460 41149 40187 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467673.1 protein_id gnl|my_center|LOCUS_66460 41250 42278 gene locus_tag LOCUS_66470 41250 42278 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229442.1 protein_id gnl|my_center|LOCUS_66470 42285 42644 gene locus_tag LOCUS_66480 42285 42644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66480 42687 43163 gene locus_tag LOCUS_66490 42687 43163 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674531.1 protein_id gnl|my_center|LOCUS_66490 43244 44389 gene locus_tag LOCUS_66500 43244 44389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230089.1 protein_id gnl|my_center|LOCUS_66500 44551 45756 gene locus_tag LOCUS_66510 44551 45756 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496011.1 protein_id gnl|my_center|LOCUS_66510 46008 45829 gene locus_tag LOCUS_66520 46008 45829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66520 46816 46043 gene locus_tag LOCUS_66530 46816 46043 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 protein_id gnl|my_center|LOCUS_66530 47950 46934 gene locus_tag LOCUS_66540 47950 46934 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_66540 48203 48526 gene locus_tag LOCUS_66550 48203 48526 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976901.1 protein_id gnl|my_center|LOCUS_66550 48607 49230 gene locus_tag LOCUS_66560 48607 49230 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878471.1 protein_id gnl|my_center|LOCUS_66560 49248 49571 gene locus_tag LOCUS_66570 49248 49571 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142756.1 protein_id gnl|my_center|LOCUS_66570 49987 50904 gene locus_tag LOCUS_66580 49987 50904 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230336.1 protein_id gnl|my_center|LOCUS_66580 50952 51359 gene locus_tag LOCUS_66590 50952 51359 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_66590 52095 51352 gene locus_tag LOCUS_66600 52095 51352 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 protein_id gnl|my_center|LOCUS_66600 52963 52157 gene locus_tag LOCUS_66610 52963 52157 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_66610 53769 52963 gene locus_tag LOCUS_66620 53769 52963 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_66620 54704 53769 gene locus_tag LOCUS_66630 54704 53769 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_66630 54848 55297 gene locus_tag LOCUS_66640 54848 55297 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977923.1 protein_id gnl|my_center|LOCUS_66640 55771 56520 gene locus_tag LOCUS_66650 55771 56520 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226469.1 protein_id gnl|my_center|LOCUS_66650 56827 57243 gene locus_tag LOCUS_66660 56827 57243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66660 57269 57832 gene locus_tag LOCUS_66670 57269 57832 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_66670 59175 58090 gene locus_tag LOCUS_66680 59175 58090 CDS product RNA polymerase subunit sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203909262.1 protein_id gnl|my_center|LOCUS_66680 60184 59666 gene locus_tag LOCUS_66690 60184 59666 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226048.1 protein_id gnl|my_center|LOCUS_66690 60317 61312 gene locus_tag LOCUS_66700 60317 61312 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043789805.1 protein_id gnl|my_center|LOCUS_66700 62954 61710 gene locus_tag LOCUS_66710 62954 61710 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921469.1 protein_id gnl|my_center|LOCUS_66710 64653 63280 gene locus_tag LOCUS_66720 64653 63280 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535091.1 protein_id gnl|my_center|LOCUS_66720 65543 64854 gene locus_tag LOCUS_66730 65543 64854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66730 66254 65694 gene locus_tag LOCUS_66740 66254 65694 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226517.1 protein_id gnl|my_center|LOCUS_66740 66351 66827 gene locus_tag LOCUS_66750 66351 66827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66750 66970 67365 gene locus_tag LOCUS_66760 66970 67365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66760 68351 67398 gene locus_tag LOCUS_66770 68351 67398 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697738.1 protein_id gnl|my_center|LOCUS_66770 68528 69220 gene locus_tag LOCUS_66780 68528 69220 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225650.1 protein_id gnl|my_center|LOCUS_66780 69217 69486 gene locus_tag LOCUS_66790 69217 69486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66790 69473 70204 gene locus_tag LOCUS_66800 69473 70204 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225648.1 protein_id gnl|my_center|LOCUS_66800 70321 71397 gene locus_tag LOCUS_66810 70321 71397 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225647.1 protein_id gnl|my_center|LOCUS_66810 71399 73183 gene locus_tag LOCUS_66820 71399 73183 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225646.1 protein_id gnl|my_center|LOCUS_66820 73235 73930 gene locus_tag LOCUS_66830 73235 73930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66830 73927 74679 gene locus_tag LOCUS_66840 73927 74679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66840 74676 75320 gene locus_tag LOCUS_66850 74676 75320 CDS product DUF6084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225643.1 protein_id gnl|my_center|LOCUS_66850 75317 76822 gene locus_tag LOCUS_66860 75317 76822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66860 76819 77406 gene locus_tag LOCUS_66870 76819 77406 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225641.1 protein_id gnl|my_center|LOCUS_66870 77501 77920 gene locus_tag LOCUS_66880 gene hypA 77501 77920 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880634.1 protein_id gnl|my_center|LOCUS_66880 77877 78155 gene locus_tag LOCUS_66890 77877 78155 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225640.1 protein_id gnl|my_center|LOCUS_66890 78163 79290 gene locus_tag LOCUS_66900 gene hypD 78163 79290 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225639.1 protein_id gnl|my_center|LOCUS_66900 79287 80363 gene locus_tag LOCUS_66910 gene hypE 79287 80363 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_66910 80338 80784 gene locus_tag LOCUS_66920 80338 80784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66920 81140 82411 gene locus_tag LOCUS_66930 81140 82411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226646.1 protein_id gnl|my_center|LOCUS_66930 82413 83279 gene locus_tag LOCUS_66940 82413 83279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226647.1 protein_id gnl|my_center|LOCUS_66940 83825 84265 gene locus_tag LOCUS_66950 83825 84265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66950 84323 85264 gene locus_tag LOCUS_66960 84323 85264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66960 85271 86362 gene locus_tag LOCUS_66970 85271 86362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66970 86420 87523 gene locus_tag LOCUS_66980 86420 87523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66980 87598 88365 gene locus_tag LOCUS_66990 87598 88365 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975420.1 protein_id gnl|my_center|LOCUS_66990 88438 89250 gene locus_tag LOCUS_67000 88438 89250 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015485.1 protein_id gnl|my_center|LOCUS_67000 89945 89202 gene locus_tag LOCUS_67010 89945 89202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67010 91369 89942 gene locus_tag LOCUS_67020 gene purB 91369 89942 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_67020 94735 91490 gene locus_tag LOCUS_67030 94735 91490 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224450.1 protein_id gnl|my_center|LOCUS_67030 94865 95398 gene locus_tag LOCUS_67040 94865 95398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67040 95429 96202 gene locus_tag LOCUS_67050 95429 96202 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087125.1 protein_id gnl|my_center|LOCUS_67050 96776 96300 gene locus_tag LOCUS_67060 96776 96300 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229196.1 protein_id gnl|my_center|LOCUS_67060 96923 97978 gene locus_tag LOCUS_67070 96923 97978 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_67070 99026 98073 gene locus_tag LOCUS_67080 99026 98073 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227751.1 protein_id gnl|my_center|LOCUS_67080 99115 99525 gene locus_tag LOCUS_67090 99115 99525 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227750.1 protein_id gnl|my_center|LOCUS_67090 100279 99563 gene locus_tag LOCUS_67100 100279 99563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67100 101107 100316 gene locus_tag LOCUS_67110 101107 100316 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_67110 101186 102145 gene locus_tag LOCUS_67120 101186 102145 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028963.1 protein_id gnl|my_center|LOCUS_67120 102142 102975 gene locus_tag LOCUS_67130 102142 102975 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226542.1 protein_id gnl|my_center|LOCUS_67130 103028 103462 gene locus_tag LOCUS_67140 103028 103462 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095430.1 protein_id gnl|my_center|LOCUS_67140 103643 104248 gene locus_tag LOCUS_67150 103643 104248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67150 104839 104402 gene locus_tag LOCUS_67160 104839 104402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67160 105009 105968 gene locus_tag LOCUS_67170 105009 105968 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376717.1 protein_id gnl|my_center|LOCUS_67170 106637 106107 gene locus_tag LOCUS_67180 106637 106107 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939756.1 protein_id gnl|my_center|LOCUS_67180 107099 107749 gene locus_tag LOCUS_67190 107099 107749 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_67190 107830 109476 gene locus_tag LOCUS_67200 107830 109476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67200 110394 109534 gene locus_tag LOCUS_67210 110394 109534 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_67210 110769 110503 gene locus_tag LOCUS_67220 110769 110503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67220 110907 111947 gene locus_tag LOCUS_67230 110907 111947 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_67230 111962 112783 gene locus_tag LOCUS_67240 111962 112783 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067171.1 protein_id gnl|my_center|LOCUS_67240 112909 114141 gene locus_tag LOCUS_67250 112909 114141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67250 115083 114121 gene locus_tag LOCUS_67260 115083 114121 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029688.1 protein_id gnl|my_center|LOCUS_67260 115141 115866 gene locus_tag LOCUS_67270 115141 115866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67270 116811 115897 gene locus_tag LOCUS_67280 116811 115897 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230294.1 protein_id gnl|my_center|LOCUS_67280 116952 117839 gene locus_tag LOCUS_67290 116952 117839 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028266.1 protein_id gnl|my_center|LOCUS_67290 117839 118564 gene locus_tag LOCUS_67300 117839 118564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028267.1 protein_id gnl|my_center|LOCUS_67300 118587 119720 gene locus_tag LOCUS_67310 118587 119720 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028268.1 protein_id gnl|my_center|LOCUS_67310 119717 120322 gene locus_tag LOCUS_67320 119717 120322 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_67320 120815 120372 gene locus_tag LOCUS_67330 120815 120372 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974357.1 protein_id gnl|my_center|LOCUS_67330 >Feature sequence42 1360 140 gene locus_tag LOCUS_67340 1360 140 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028973.1 protein_id gnl|my_center|LOCUS_67340 1648 1451 gene locus_tag LOCUS_67350 1648 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67350 1547 2185 gene locus_tag LOCUS_67360 1547 2185 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862601.1 protein_id gnl|my_center|LOCUS_67360 3006 2362 gene locus_tag LOCUS_67370 3006 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67370 4305 3094 gene locus_tag LOCUS_67380 4305 3094 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225403.1 protein_id gnl|my_center|LOCUS_67380 5030 4302 gene locus_tag LOCUS_67390 5030 4302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225402.1 protein_id gnl|my_center|LOCUS_67390 6151 5027 gene locus_tag LOCUS_67400 6151 5027 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225401.1 protein_id gnl|my_center|LOCUS_67400 6749 6138 gene locus_tag LOCUS_67410 6749 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67410 6864 7604 gene locus_tag LOCUS_67420 6864 7604 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229333.1 protein_id gnl|my_center|LOCUS_67420 7594 9411 gene locus_tag LOCUS_67430 7594 9411 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229334.1 protein_id gnl|my_center|LOCUS_67430 9425 10960 gene locus_tag LOCUS_67440 9425 10960 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028007.1 protein_id gnl|my_center|LOCUS_67440 11003 12292 gene locus_tag LOCUS_67450 11003 12292 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027384.1 protein_id gnl|my_center|LOCUS_67450 13454 12270 gene locus_tag LOCUS_67460 13454 12270 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230887.1 protein_id gnl|my_center|LOCUS_67460 13569 14201 gene locus_tag LOCUS_67470 13569 14201 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222937.1 protein_id gnl|my_center|LOCUS_67470 15429 14215 gene locus_tag LOCUS_67480 gene fdhA 15429 14215 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226972.1 protein_id gnl|my_center|LOCUS_67480 17322 15562 gene locus_tag LOCUS_67490 17322 15562 CDS product SelB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727952.1 protein_id gnl|my_center|LOCUS_67490 18593 17322 gene locus_tag LOCUS_67500 gene selA 18593 17322 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226943.1 protein_id gnl|my_center|LOCUS_67500 19110 18769 gene locus_tag LOCUS_67510 19110 18769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67510 19338 19114 gene locus_tag LOCUS_67520 19338 19114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67520 20160 20669 gene locus_tag LOCUS_67530 20160 20669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67530 21389 20997 gene locus_tag LOCUS_67540 21389 20997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67540 21853 21461 gene locus_tag LOCUS_67550 21853 21461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67550 21845 22375 gene locus_tag LOCUS_67560 21845 22375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67560 22551 22360 gene locus_tag LOCUS_67570 22551 22360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67570 22613 22894 gene locus_tag LOCUS_67580 22613 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67580 22987 22894 gene locus_tag LOCUS_t00610 22987 22894 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 23082 24089 gene locus_tag LOCUS_67590 gene selD 23082 24089 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226944.1 protein_id gnl|my_center|LOCUS_67590 25063 24098 gene locus_tag LOCUS_67600 gene nrfD 25063 24098 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227549.1 protein_id gnl|my_center|LOCUS_67600 25809 25060 gene locus_tag LOCUS_67610 25809 25060 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145933610.1 protein_id gnl|my_center|LOCUS_67610 28975 25802 gene locus_tag LOCUS_67620 gene fdh 28975 25802 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227547.1 transl_except (pos:complement(28415..28417),aa:Sec) note codon on position 187 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_67620 29515 29105 gene locus_tag LOCUS_67630 29515 29105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67630 29913 29515 gene locus_tag LOCUS_67640 29913 29515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67640 30028 30558 gene locus_tag LOCUS_67650 30028 30558 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854343.1 protein_id gnl|my_center|LOCUS_67650 31693 30629 gene locus_tag LOCUS_67660 31693 30629 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976251.1 protein_id gnl|my_center|LOCUS_67660 33120 31702 gene locus_tag LOCUS_67670 33120 31702 CDS product adenylosuccinate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312495.1 protein_id gnl|my_center|LOCUS_67670 33834 33193 gene locus_tag LOCUS_67680 33834 33193 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228584.1 protein_id gnl|my_center|LOCUS_67680 34094 34879 gene locus_tag LOCUS_67690 34094 34879 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223482.1 protein_id gnl|my_center|LOCUS_67690 34906 35589 gene locus_tag LOCUS_67700 34906 35589 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228705.1 protein_id gnl|my_center|LOCUS_67700 36855 35590 gene locus_tag LOCUS_67710 36855 35590 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228706.1 protein_id gnl|my_center|LOCUS_67710 37441 37010 gene locus_tag LOCUS_67720 37441 37010 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_67720 37528 37932 gene locus_tag LOCUS_67730 37528 37932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67730 39204 37969 gene locus_tag LOCUS_67740 gene kynU 39204 37969 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338098.1 protein_id gnl|my_center|LOCUS_67740 39594 40346 gene locus_tag LOCUS_67750 39594 40346 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029507.1 protein_id gnl|my_center|LOCUS_67750 40461 40679 gene locus_tag LOCUS_67760 40461 40679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67760 42026 40785 gene locus_tag LOCUS_67770 42026 40785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67770 42178 42717 gene locus_tag LOCUS_67780 42178 42717 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_67780 43633 42662 gene locus_tag LOCUS_67790 43633 42662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67790 44977 43733 gene locus_tag LOCUS_67800 44977 43733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67800 45179 46546 gene locus_tag LOCUS_67810 45179 46546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67810 46817 46978 gene locus_tag LOCUS_67820 46817 46978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67820 47353 47072 gene locus_tag LOCUS_67830 47353 47072 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726761.1 protein_id gnl|my_center|LOCUS_67830 48461 47400 gene locus_tag LOCUS_67840 48461 47400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67840 49267 48473 gene locus_tag LOCUS_67850 49267 48473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67850 51528 49426 gene locus_tag LOCUS_67860 51528 49426 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226200.1 protein_id gnl|my_center|LOCUS_67860 52342 51710 gene locus_tag LOCUS_67870 52342 51710 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_67870 53121 52339 gene locus_tag LOCUS_67880 53121 52339 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028920.1 protein_id gnl|my_center|LOCUS_67880 53927 53118 gene locus_tag LOCUS_67890 53927 53118 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_67890 53812 54090 gene locus_tag LOCUS_67900 53812 54090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67900 54095 54793 gene locus_tag LOCUS_67910 54095 54793 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223868.1 protein_id gnl|my_center|LOCUS_67910 54867 55244 gene locus_tag LOCUS_67920 54867 55244 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973561.1 protein_id gnl|my_center|LOCUS_67920 55241 55555 gene locus_tag LOCUS_67930 gene trxA 55241 55555 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_67930 55561 57018 gene locus_tag LOCUS_67940 gene radA 55561 57018 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_67940 57052 58191 gene locus_tag LOCUS_67950 gene disA 57052 58191 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_67950 58943 58233 gene locus_tag LOCUS_67960 58943 58233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67960 59070 59936 gene locus_tag LOCUS_67970 59070 59936 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_67970 61047 60112 gene locus_tag LOCUS_67980 gene eboE 61047 60112 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028848.1 protein_id gnl|my_center|LOCUS_67980 63905 61467 gene locus_tag LOCUS_67990 63905 61467 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_67990 63873 64109 gene locus_tag LOCUS_68000 63873 64109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68000 64581 64237 gene locus_tag LOCUS_68010 64581 64237 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_68010 65594 65136 gene locus_tag LOCUS_68020 65594 65136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68020 66444 65920 gene locus_tag LOCUS_68030 66444 65920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68030 66478 67185 gene locus_tag LOCUS_68040 66478 67185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68040 67801 67253 gene locus_tag LOCUS_68050 67801 67253 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894076.1 protein_id gnl|my_center|LOCUS_68050 68536 69468 gene locus_tag LOCUS_68060 68536 69468 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_68060 69848 69588 gene locus_tag LOCUS_68070 69848 69588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68070 71866 70190 gene locus_tag LOCUS_68080 gene lysS 71866 70190 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975532.1 protein_id gnl|my_center|LOCUS_68080 72708 71926 gene locus_tag LOCUS_68090 72708 71926 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_68090 75214 72716 gene locus_tag LOCUS_68100 75214 72716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68100 76705 75863 gene locus_tag LOCUS_68110 gene panC 76705 75863 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084897.1 protein_id gnl|my_center|LOCUS_68110 77586 76696 gene locus_tag LOCUS_68120 77586 76696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68120 77734 78699 gene locus_tag LOCUS_68130 77734 78699 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_68130 79902 78703 gene locus_tag LOCUS_68140 79902 78703 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_68140 80190 81476 gene locus_tag LOCUS_68150 80190 81476 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224833.1 protein_id gnl|my_center|LOCUS_68150 81552 82736 gene locus_tag LOCUS_68160 81552 82736 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_68160 83193 82744 gene locus_tag LOCUS_68170 83193 82744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68170 83707 83207 gene locus_tag LOCUS_68180 gene folK 83707 83207 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_68180 84093 83704 gene locus_tag LOCUS_68190 gene folB 84093 83704 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 protein_id gnl|my_center|LOCUS_68190 84512 84090 gene locus_tag LOCUS_68200 84512 84090 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 protein_id gnl|my_center|LOCUS_68200 85384 84509 gene locus_tag LOCUS_68210 gene folP 85384 84509 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_68210 86123 85539 gene locus_tag LOCUS_68220 gene folE 86123 85539 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_68220 88129 86126 gene locus_tag LOCUS_68230 gene ftsH 88129 86126 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_68230 88954 88397 gene locus_tag LOCUS_68240 gene hpt 88954 88397 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_68240 89947 88967 gene locus_tag LOCUS_68250 gene tilS 89947 88967 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_68250 91240 90161 gene locus_tag LOCUS_68260 91240 90161 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_68260 92702 91308 gene locus_tag LOCUS_68270 gene dacB 92702 91308 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485148.1 protein_id gnl|my_center|LOCUS_68270 92789 93313 gene locus_tag LOCUS_68280 92789 93313 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_68280 94528 93374 gene locus_tag LOCUS_68290 94528 93374 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030158.1 protein_id gnl|my_center|LOCUS_68290 96547 94742 gene locus_tag LOCUS_68300 96547 94742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68300 97850 96747 gene locus_tag LOCUS_68310 97850 96747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68310 98727 97936 gene locus_tag LOCUS_68320 98727 97936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68320 100576 98939 gene locus_tag LOCUS_68330 100576 98939 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_68330 100821 101903 gene locus_tag LOCUS_68340 100821 101903 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976978.1 protein_id gnl|my_center|LOCUS_68340 102662 101922 gene locus_tag LOCUS_68350 102662 101922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68350 102790 103623 gene locus_tag LOCUS_68360 102790 103623 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_68360 104232 103684 gene locus_tag LOCUS_68370 104232 103684 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222694.1 protein_id gnl|my_center|LOCUS_68370 105334 104372 gene locus_tag LOCUS_68380 105334 104372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68380 105809 105531 gene locus_tag LOCUS_68390 105809 105531 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977125.1 protein_id gnl|my_center|LOCUS_68390 106051 107055 gene locus_tag LOCUS_68400 106051 107055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68400 107991 107104 gene locus_tag LOCUS_68410 107991 107104 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223827.1 protein_id gnl|my_center|LOCUS_68410 108063 108986 gene locus_tag LOCUS_68420 108063 108986 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466733.1 protein_id gnl|my_center|LOCUS_68420 109099 109920 gene locus_tag LOCUS_68430 109099 109920 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031368.1 protein_id gnl|my_center|LOCUS_68430 110019 110684 gene locus_tag LOCUS_68440 110019 110684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68440 111514 110750 gene locus_tag LOCUS_68450 111514 110750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68450 112267 111593 gene locus_tag LOCUS_68460 112267 111593 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_68460 113733 112264 gene locus_tag LOCUS_68470 113733 112264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68470 114050 114847 gene locus_tag LOCUS_68480 114050 114847 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228773.1 protein_id gnl|my_center|LOCUS_68480 115036 115260 gene locus_tag LOCUS_68490 gene infA 115036 115260 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228772.1 protein_id gnl|my_center|LOCUS_68490 115394 115822 gene locus_tag LOCUS_68500 115394 115822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68500 116469 115957 gene locus_tag LOCUS_68510 116469 115957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68510 116978 116526 gene locus_tag LOCUS_68520 116978 116526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68520 116966 117295 gene locus_tag LOCUS_68530 116966 117295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68530 118935 117313 gene locus_tag LOCUS_68540 118935 117313 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413355.1 protein_id gnl|my_center|LOCUS_68540 >Feature sequence43 1271 537 gene locus_tag LOCUS_68550 1271 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68550 1606 1944 gene locus_tag LOCUS_68560 1606 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_68560 2110 2037 gene locus_tag LOCUS_t00620 2110 2037 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2289 2864 gene locus_tag LOCUS_68570 gene dcd 2289 2864 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_68570 3022 3639 gene locus_tag LOCUS_68580 3022 3639 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_68580 3640 4638 gene locus_tag LOCUS_68590 gene pitH 3640 4638 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_68590 5550 4639 gene locus_tag LOCUS_68600 gene mshD 5550 4639 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_68600 5729 7429 gene locus_tag LOCUS_68610 5729 7429 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230897.1 protein_id gnl|my_center|LOCUS_68610 8277 7564 gene locus_tag LOCUS_68620 gene glnR 8277 7564 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_68620 8521 8769 gene locus_tag LOCUS_68630 8521 8769 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 protein_id gnl|my_center|LOCUS_68630 8811 9488 gene locus_tag LOCUS_68640 8811 9488 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974808.1 protein_id gnl|my_center|LOCUS_68640 9538 10050 gene locus_tag LOCUS_68650 9538 10050 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_68650 10047 10817 gene locus_tag LOCUS_68660 10047 10817 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727694.1 protein_id gnl|my_center|LOCUS_68660 10910 11374 gene locus_tag LOCUS_68670 10910 11374 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977746.1 protein_id gnl|my_center|LOCUS_68670 11546 11956 gene locus_tag LOCUS_68680 11546 11956 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230720.1 protein_id gnl|my_center|LOCUS_68680 11953 12792 gene locus_tag LOCUS_68690 11953 12792 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974806.1 protein_id gnl|my_center|LOCUS_68690 12792 13097 gene locus_tag LOCUS_68700 12792 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68700 13363 13106 gene locus_tag LOCUS_68710 13363 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68710 13296 14522 gene locus_tag LOCUS_68720 13296 14522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68720 15384 14512 gene locus_tag LOCUS_68730 15384 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68730 16121 15450 gene locus_tag LOCUS_68740 16121 15450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68740 16714 16121 gene locus_tag LOCUS_68750 16714 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68750 16923 18851 gene locus_tag LOCUS_68760 16923 18851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68760 18948 22040 gene locus_tag LOCUS_68770 18948 22040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68770 22214 23470 gene locus_tag LOCUS_68780 22214 23470 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_68780 23460 24200 gene locus_tag LOCUS_68790 23460 24200 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 protein_id gnl|my_center|LOCUS_68790 24608 24246 gene locus_tag LOCUS_68800 24608 24246 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 protein_id gnl|my_center|LOCUS_68800 24733 25230 gene locus_tag LOCUS_68810 24733 25230 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974791.1 protein_id gnl|my_center|LOCUS_68810 25616 26026 gene locus_tag LOCUS_68820 25616 26026 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_68820 26078 27118 gene locus_tag LOCUS_68830 26078 27118 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_68830 27596 27162 gene locus_tag LOCUS_68840 gene dtd 27596 27162 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029487.1 protein_id gnl|my_center|LOCUS_68840 27642 28589 gene locus_tag LOCUS_68850 27642 28589 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_68850 28639 29619 gene locus_tag LOCUS_68860 28639 29619 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845576.1 protein_id gnl|my_center|LOCUS_68860 30358 29624 gene locus_tag LOCUS_68870 30358 29624 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_68870 30766 30434 gene locus_tag LOCUS_68880 30766 30434 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868443.1 protein_id gnl|my_center|LOCUS_68880 31421 30945 gene locus_tag LOCUS_68890 31421 30945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68890 31874 31425 gene locus_tag LOCUS_68900 31874 31425 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222362.1 protein_id gnl|my_center|LOCUS_68900 32845 31928 gene locus_tag LOCUS_68910 32845 31928 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729216.1 protein_id gnl|my_center|LOCUS_68910 33198 32842 gene locus_tag LOCUS_68920 gene blaI 33198 32842 CDS product transcriptional repressor BlaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950618.1 protein_id gnl|my_center|LOCUS_68920 33250 33765 gene locus_tag LOCUS_68930 33250 33765 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 protein_id gnl|my_center|LOCUS_68930 34306 33803 gene locus_tag LOCUS_68940 34306 33803 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029694.1 protein_id gnl|my_center|LOCUS_68940 35151 34342 gene locus_tag LOCUS_68950 35151 34342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_68950 35897 35148 gene locus_tag LOCUS_68960 35897 35148 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031214.1 protein_id gnl|my_center|LOCUS_68960 36023 37315 gene locus_tag LOCUS_68970 gene mshA 36023 37315 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326818.1 protein_id gnl|my_center|LOCUS_68970 36887 36789 gene locus_tag LOCUS_t00630 36887 36789 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 37325 37810 gene locus_tag LOCUS_68980 37325 37810 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222390.1 protein_id gnl|my_center|LOCUS_68980 37862 38602 gene locus_tag LOCUS_68990 37862 38602 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_68990 39692 39033 gene locus_tag LOCUS_69000 gene phoU 39692 39033 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_69000 39816 40985 gene locus_tag LOCUS_69010 39816 40985 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_69010 40982 41671 gene locus_tag LOCUS_69020 40982 41671 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_69020 42367 41750 gene locus_tag LOCUS_69030 42367 41750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69030 42625 43107 gene locus_tag LOCUS_69040 42625 43107 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_69040 43125 43595 gene locus_tag LOCUS_69050 gene ispF 43125 43595 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804549.1 protein_id gnl|my_center|LOCUS_69050 43774 44043 gene locus_tag LOCUS_69060 43774 44043 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894403.1 protein_id gnl|my_center|LOCUS_69060 45449 44136 gene locus_tag LOCUS_69070 45449 44136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69070 45846 47267 gene locus_tag LOCUS_69080 gene cysS 45846 47267 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_69080 47291 48250 gene locus_tag LOCUS_69090 gene rlmB 47291 48250 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_69090 48299 48373 gene locus_tag LOCUS_t00640 48299 48373 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 49536 48859 gene locus_tag LOCUS_69100 49536 48859 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228567.1 protein_id gnl|my_center|LOCUS_69100 49620 50354 gene locus_tag LOCUS_69110 49620 50354 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977890.1 protein_id gnl|my_center|LOCUS_69110 50395 51018 gene locus_tag LOCUS_69120 50395 51018 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977891.1 protein_id gnl|my_center|LOCUS_69120 51145 51327 gene locus_tag LOCUS_69130 51145 51327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69130 52998 52108 gene locus_tag LOCUS_69140 52998 52108 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028612.1 protein_id gnl|my_center|LOCUS_69140 53131 53793 gene locus_tag LOCUS_69150 53131 53793 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022464.1 protein_id gnl|my_center|LOCUS_69150 53930 54343 gene locus_tag LOCUS_69160 53930 54343 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893670.1 protein_id gnl|my_center|LOCUS_69160 54456 54887 gene locus_tag LOCUS_69170 54456 54887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69170 55256 55699 gene locus_tag LOCUS_69180 55256 55699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69180 55862 55677 gene locus_tag LOCUS_69190 55862 55677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69190 56648 55911 gene locus_tag LOCUS_69200 56648 55911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69200 57759 56782 gene locus_tag LOCUS_69210 57759 56782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69210 58664 58026 gene locus_tag LOCUS_69220 58664 58026 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862601.1 protein_id gnl|my_center|LOCUS_69220 58799 59149 gene locus_tag LOCUS_69230 58799 59149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69230 59146 59292 gene locus_tag LOCUS_69240 59146 59292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69240 60168 59416 gene locus_tag LOCUS_69250 60168 59416 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090295.1 protein_id gnl|my_center|LOCUS_69250 60896 60297 gene locus_tag LOCUS_69260 60896 60297 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114713242.1 protein_id gnl|my_center|LOCUS_69260 61072 61683 gene locus_tag LOCUS_69270 61072 61683 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 protein_id gnl|my_center|LOCUS_69270 63413 64420 gene locus_tag LOCUS_69280 gene blaPEN-bpc 63413 64420 CDS product PEN family class A beta-lactamase, Bpc-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551611.1 protein_id gnl|my_center|LOCUS_69280 64706 65374 gene locus_tag LOCUS_69290 64706 65374 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_69290 65422 65324 gene locus_tag LOCUS_t00650 65422 65324 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 65811 65404 gene locus_tag LOCUS_69300 65811 65404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69300 66083 65808 gene locus_tag LOCUS_69310 66083 65808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69310 66404 67564 gene locus_tag LOCUS_69320 gene yeaW 66404 67564 CDS product carnitine monooxygenase subunit YeaW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067835.1 protein_id gnl|my_center|LOCUS_69320 69230 67671 gene locus_tag LOCUS_69330 69230 67671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69330 69169 69372 gene locus_tag LOCUS_69340 69169 69372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69340 69946 69623 gene locus_tag LOCUS_69350 69946 69623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69350 71640 70348 gene locus_tag LOCUS_69360 71640 70348 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030223.1 protein_id gnl|my_center|LOCUS_69360 73397 71940 gene locus_tag LOCUS_69370 gene lpdA 73397 71940 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283919.1 protein_id gnl|my_center|LOCUS_69370 74213 73506 gene locus_tag LOCUS_69380 74213 73506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69380 74463 76472 gene locus_tag LOCUS_69390 74463 76472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69390 76475 77137 gene locus_tag LOCUS_69400 76475 77137 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_69400 77535 78167 gene locus_tag LOCUS_69410 77535 78167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69410 78244 80223 gene locus_tag LOCUS_69420 78244 80223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69420 80220 80879 gene locus_tag LOCUS_69430 80220 80879 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_69430 81098 80916 gene locus_tag LOCUS_69440 81098 80916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69440 82038 81385 gene locus_tag LOCUS_69450 82038 81385 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_69450 83231 82035 gene locus_tag LOCUS_69460 83231 82035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69460 83392 84099 gene locus_tag LOCUS_69470 83392 84099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69470 84824 84150 gene locus_tag LOCUS_69480 84824 84150 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_69480 86950 84812 gene locus_tag LOCUS_69490 86950 84812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69490 87515 86988 gene locus_tag LOCUS_69500 87515 86988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69500 88284 87646 gene locus_tag LOCUS_69510 88284 87646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69510 88442 89593 gene locus_tag LOCUS_69520 88442 89593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69520 89590 90246 gene locus_tag LOCUS_69530 89590 90246 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_69530 92027 90267 gene locus_tag LOCUS_69540 92027 90267 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027264.1 protein_id gnl|my_center|LOCUS_69540 92278 92925 gene locus_tag LOCUS_69550 92278 92925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69550 93229 92990 gene locus_tag LOCUS_69560 93229 92990 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173203.1 protein_id gnl|my_center|LOCUS_69560 93954 93268 gene locus_tag LOCUS_69570 93954 93268 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225513.1 protein_id gnl|my_center|LOCUS_69570 94064 94690 gene locus_tag LOCUS_69580 94064 94690 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_69580 95350 94679 gene locus_tag LOCUS_69590 95350 94679 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230978.1 protein_id gnl|my_center|LOCUS_69590 96468 95347 gene locus_tag LOCUS_69600 96468 95347 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086843653.1 protein_id gnl|my_center|LOCUS_69600 97722 96562 gene locus_tag LOCUS_69610 97722 96562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69610 97607 99025 gene locus_tag LOCUS_69620 97607 99025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69620 99039 99590 gene locus_tag LOCUS_69630 99039 99590 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_69630 99775 100287 gene locus_tag LOCUS_69640 99775 100287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69640 101022 100324 gene locus_tag LOCUS_69650 gene tenA 101022 100324 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877712.1 protein_id gnl|my_center|LOCUS_69650 101215 102753 gene locus_tag LOCUS_69660 101215 102753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69660 102746 104083 gene locus_tag LOCUS_69670 102746 104083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69670 104080 108291 gene locus_tag LOCUS_69680 104080 108291 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052667156.1 protein_id gnl|my_center|LOCUS_69680 >Feature sequence44 3095 1434 gene locus_tag LOCUS_69690 gene kdpA 3095 1434 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730504.1 protein_id gnl|my_center|LOCUS_69690 3418 5994 gene locus_tag LOCUS_69700 3418 5994 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_69700 6026 6457 gene locus_tag LOCUS_69710 6026 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69710 7463 6492 gene locus_tag LOCUS_69720 7463 6492 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_69720 8396 7473 gene locus_tag LOCUS_69730 8396 7473 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284362.1 protein_id gnl|my_center|LOCUS_69730 8789 8592 gene locus_tag LOCUS_69740 8789 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69740 10050 8941 gene locus_tag LOCUS_69750 10050 8941 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230545.1 protein_id gnl|my_center|LOCUS_69750 10205 11194 gene locus_tag LOCUS_69760 10205 11194 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230546.1 protein_id gnl|my_center|LOCUS_69760 12148 11210 gene locus_tag LOCUS_69770 12148 11210 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094967.1 protein_id gnl|my_center|LOCUS_69770 12842 12156 gene locus_tag LOCUS_69780 12842 12156 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094966.1 protein_id gnl|my_center|LOCUS_69780 15018 12928 gene locus_tag LOCUS_69790 15018 12928 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 protein_id gnl|my_center|LOCUS_69790 16025 15168 gene locus_tag LOCUS_69800 16025 15168 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921099.1 protein_id gnl|my_center|LOCUS_69800 16970 16071 gene locus_tag LOCUS_69810 16970 16071 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689435.1 protein_id gnl|my_center|LOCUS_69810 19388 17163 gene locus_tag LOCUS_69820 19388 17163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69820 21432 19444 gene locus_tag LOCUS_69830 21432 19444 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226188.1 protein_id gnl|my_center|LOCUS_69830 22330 21512 gene locus_tag LOCUS_69840 22330 21512 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226189.1 protein_id gnl|my_center|LOCUS_69840 23346 22327 gene locus_tag LOCUS_69850 23346 22327 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226190.1 protein_id gnl|my_center|LOCUS_69850 24619 23360 gene locus_tag LOCUS_69860 24619 23360 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226191.1 protein_id gnl|my_center|LOCUS_69860 25721 24687 gene locus_tag LOCUS_69870 25721 24687 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226192.1 protein_id gnl|my_center|LOCUS_69870 26403 25894 gene locus_tag LOCUS_69880 26403 25894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69880 27960 26551 gene locus_tag LOCUS_69890 27960 26551 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222854.1 protein_id gnl|my_center|LOCUS_69890 28520 29212 gene locus_tag LOCUS_69900 28520 29212 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084755.1 protein_id gnl|my_center|LOCUS_69900 29205 30131 gene locus_tag LOCUS_69910 29205 30131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 protein_id gnl|my_center|LOCUS_69910 30128 31753 gene locus_tag LOCUS_69920 30128 31753 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_69920 31803 32024 gene locus_tag LOCUS_69930 31803 32024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69930 32708 32058 gene locus_tag LOCUS_69940 32708 32058 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110055.1 protein_id gnl|my_center|LOCUS_69940 32936 33982 gene locus_tag LOCUS_69950 32936 33982 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921017.1 protein_id gnl|my_center|LOCUS_69950 34838 34020 gene locus_tag LOCUS_69960 34838 34020 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034857483.1 protein_id gnl|my_center|LOCUS_69960 35884 34835 gene locus_tag LOCUS_69970 35884 34835 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104350.1 protein_id gnl|my_center|LOCUS_69970 35985 36986 gene locus_tag LOCUS_69980 35985 36986 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014889.1 protein_id gnl|my_center|LOCUS_69980 36983 37717 gene locus_tag LOCUS_69990 36983 37717 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803785.1 protein_id gnl|my_center|LOCUS_69990 38822 37782 gene locus_tag LOCUS_70000 38822 37782 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729983.1 protein_id gnl|my_center|LOCUS_70000 38937 40106 gene locus_tag LOCUS_70010 38937 40106 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031356.1 protein_id gnl|my_center|LOCUS_70010 41726 40224 gene locus_tag LOCUS_70020 41726 40224 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 protein_id gnl|my_center|LOCUS_70020 42878 41850 gene locus_tag LOCUS_70030 42878 41850 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729996.1 protein_id gnl|my_center|LOCUS_70030 43771 42875 gene locus_tag LOCUS_70040 43771 42875 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031352.1 protein_id gnl|my_center|LOCUS_70040 44823 43768 gene locus_tag LOCUS_70050 44823 43768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896031.1 protein_id gnl|my_center|LOCUS_70050 45797 44832 gene locus_tag LOCUS_70060 45797 44832 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729990.1 protein_id gnl|my_center|LOCUS_70060 46816 45920 gene locus_tag LOCUS_70070 46816 45920 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031353.1 protein_id gnl|my_center|LOCUS_70070 48759 46813 gene locus_tag LOCUS_70080 gene iolD 48759 46813 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_70080 49679 48756 gene locus_tag LOCUS_70090 gene iolB 49679 48756 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729993.1 protein_id gnl|my_center|LOCUS_70090 50524 49676 gene locus_tag LOCUS_70100 50524 49676 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896035.1 protein_id gnl|my_center|LOCUS_70100 51537 50572 gene locus_tag LOCUS_70110 gene iolC 51537 50572 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729991.1 protein_id gnl|my_center|LOCUS_70110 52491 51541 gene locus_tag LOCUS_70120 52491 51541 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729986.1 protein_id gnl|my_center|LOCUS_70120 53500 52496 gene locus_tag LOCUS_70130 53500 52496 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487216.1 protein_id gnl|my_center|LOCUS_70130 53683 54408 gene locus_tag LOCUS_70140 53683 54408 CDS product myo-inositol degradation transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030772.1 protein_id gnl|my_center|LOCUS_70140 54537 57740 gene locus_tag LOCUS_70150 54537 57740 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484982.1 protein_id gnl|my_center|LOCUS_70150 58459 57809 gene locus_tag LOCUS_70160 58459 57809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70160 58521 60380 gene locus_tag LOCUS_70170 58521 60380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70170 60461 61294 gene locus_tag LOCUS_70180 60461 61294 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_70180 61789 61331 gene locus_tag LOCUS_70190 61789 61331 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027346.1 protein_id gnl|my_center|LOCUS_70190 61905 62486 gene locus_tag LOCUS_70200 61905 62486 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978089.1 protein_id gnl|my_center|LOCUS_70200 64050 62602 gene locus_tag LOCUS_70210 64050 62602 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_70210 64254 64847 gene locus_tag LOCUS_70220 64254 64847 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534996.1 protein_id gnl|my_center|LOCUS_70220 64906 65148 gene locus_tag LOCUS_70230 64906 65148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70230 65481 65032 gene locus_tag LOCUS_70240 65481 65032 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226058.1 protein_id gnl|my_center|LOCUS_70240 65639 66847 gene locus_tag LOCUS_70250 gene dxr 65639 66847 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_70250 68490 66979 gene locus_tag LOCUS_70260 68490 66979 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727276.1 protein_id gnl|my_center|LOCUS_70260 68520 70223 gene locus_tag LOCUS_70270 68520 70223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70270 70313 70828 gene locus_tag LOCUS_70280 70313 70828 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028935.1 protein_id gnl|my_center|LOCUS_70280 71432 70803 gene locus_tag LOCUS_70290 71432 70803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70290 72353 71508 gene locus_tag LOCUS_70300 72353 71508 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728964.1 protein_id gnl|my_center|LOCUS_70300 72515 72937 gene locus_tag LOCUS_70310 72515 72937 CDS product diol dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727731.1 protein_id gnl|my_center|LOCUS_70310 72971 75265 gene locus_tag LOCUS_70320 72971 75265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70320 75281 77140 gene locus_tag LOCUS_70330 75281 77140 CDS product diol dehydratase reactivase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268867.1 protein_id gnl|my_center|LOCUS_70330 77144 77590 gene locus_tag LOCUS_70340 77144 77590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70340 77601 78023 gene locus_tag LOCUS_70350 77601 78023 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727730.1 protein_id gnl|my_center|LOCUS_70350 79014 78106 gene locus_tag LOCUS_70360 79014 78106 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_70360 80055 79681 gene locus_tag LOCUS_70370 80055 79681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70370 80392 81429 gene locus_tag LOCUS_70380 80392 81429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70380 82393 82034 gene locus_tag LOCUS_70390 82393 82034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70390 82862 82449 gene locus_tag LOCUS_70400 82862 82449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70400 84045 82963 gene locus_tag LOCUS_70410 84045 82963 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088246.1 protein_id gnl|my_center|LOCUS_70410 84745 84095 gene locus_tag LOCUS_70420 84745 84095 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595940.1 protein_id gnl|my_center|LOCUS_70420 85256 84738 gene locus_tag LOCUS_70430 85256 84738 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228449.1 protein_id gnl|my_center|LOCUS_70430 85334 86386 gene locus_tag LOCUS_70440 85334 86386 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088246.1 protein_id gnl|my_center|LOCUS_70440 87767 86403 gene locus_tag LOCUS_70450 gene rclA 87767 86403 CDS product reactive chlorine resistance oxidoreductase RclA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195937.1 protein_id gnl|my_center|LOCUS_70450 87859 88770 gene locus_tag LOCUS_70460 87859 88770 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221640267.1 protein_id gnl|my_center|LOCUS_70460 89374 88820 gene locus_tag LOCUS_70470 89374 88820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70470 89485 90432 gene locus_tag LOCUS_70480 89485 90432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70480 91493 90504 gene locus_tag LOCUS_70490 91493 90504 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226238.1 protein_id gnl|my_center|LOCUS_70490 93037 91781 gene locus_tag LOCUS_70500 93037 91781 CDS product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030163.1 protein_id gnl|my_center|LOCUS_70500 93746 93039 gene locus_tag LOCUS_70510 gene cseB 93746 93039 CDS product two-component system response regulator CseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975477.1 protein_id gnl|my_center|LOCUS_70510 95472 93883 gene locus_tag LOCUS_70520 95472 93883 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275275.1 protein_id gnl|my_center|LOCUS_70520 95776 96552 gene locus_tag LOCUS_70530 95776 96552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70530 96585 97820 gene locus_tag LOCUS_70540 96585 97820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70540 97933 99282 gene locus_tag LOCUS_70550 97933 99282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70550 100469 99891 gene locus_tag LOCUS_70560 100469 99891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70560 100561 100977 gene locus_tag LOCUS_70570 100561 100977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222812.1 protein_id gnl|my_center|LOCUS_70570 102176 100998 gene locus_tag LOCUS_70580 102176 100998 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_70580 102682 102254 gene locus_tag LOCUS_70590 gene nsrR 102682 102254 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031657.1 protein_id gnl|my_center|LOCUS_70590 104446 102719 gene locus_tag LOCUS_70600 gene thiC 104446 102719 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220133538.1 protein_id gnl|my_center|LOCUS_70600 105418 104636 gene locus_tag LOCUS_70610 105418 104636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70610 105611 106027 gene locus_tag LOCUS_70620 105611 106027 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_70620 106087 107268 gene locus_tag LOCUS_70630 106087 107268 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_70630 >Feature sequence45 30 923 gene locus_tag LOCUS_70640 30 923 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730506.1 protein_id gnl|my_center|LOCUS_70640 1084 1800 gene locus_tag LOCUS_70650 1084 1800 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_70650 1810 3684 gene locus_tag LOCUS_70660 1810 3684 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093091.1 protein_id gnl|my_center|LOCUS_70660 3681 4235 gene locus_tag LOCUS_70670 3681 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70670 4649 4389 gene locus_tag LOCUS_70680 4649 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70680 4837 6054 gene locus_tag LOCUS_70690 4837 6054 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230102.1 protein_id gnl|my_center|LOCUS_70690 6135 7043 gene locus_tag LOCUS_70700 6135 7043 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031538.1 protein_id gnl|my_center|LOCUS_70700 7108 8541 gene locus_tag LOCUS_70710 7108 8541 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729608.1 protein_id gnl|my_center|LOCUS_70710 8598 9278 gene locus_tag LOCUS_70720 8598 9278 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484304.1 protein_id gnl|my_center|LOCUS_70720 9275 10315 gene locus_tag LOCUS_70730 9275 10315 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027040.1 protein_id gnl|my_center|LOCUS_70730 10481 11293 gene locus_tag LOCUS_70740 10481 11293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70740 11373 11582 gene locus_tag LOCUS_70750 11373 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70750 11951 11727 gene locus_tag LOCUS_70760 gene rpsR 11951 11727 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028969.1 protein_id gnl|my_center|LOCUS_70760 13099 11948 gene locus_tag LOCUS_70770 13099 11948 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456408.1 protein_id gnl|my_center|LOCUS_70770 13162 13326 gene locus_tag LOCUS_70780 gene rpmG 13162 13326 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063154.1 protein_id gnl|my_center|LOCUS_70780 13329 13574 gene locus_tag LOCUS_70790 13329 13574 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 protein_id gnl|my_center|LOCUS_70790 13574 13810 gene locus_tag LOCUS_70800 gene rpmB 13574 13810 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028971.1 protein_id gnl|my_center|LOCUS_70800 13810 14109 gene locus_tag LOCUS_70810 gene rpsN 13810 14109 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975403.1 protein_id gnl|my_center|LOCUS_70810 14117 14287 gene locus_tag LOCUS_70820 gene rpmF 14117 14287 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978430.1 protein_id gnl|my_center|LOCUS_70820 17092 14384 gene locus_tag LOCUS_70830 17092 14384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70830 17276 17449 gene locus_tag LOCUS_70840 17276 17449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70840 17784 17404 gene locus_tag LOCUS_70850 17784 17404 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504168.1 protein_id gnl|my_center|LOCUS_70850 18358 17987 gene locus_tag LOCUS_70860 18358 17987 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228912.1 protein_id gnl|my_center|LOCUS_70860 19611 18583 gene locus_tag LOCUS_70870 19611 18583 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191003.1 protein_id gnl|my_center|LOCUS_70870 19970 19608 gene locus_tag LOCUS_70880 19970 19608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70880 20830 19967 gene locus_tag LOCUS_70890 20830 19967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70890 21653 20862 gene locus_tag LOCUS_70900 21653 20862 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226684.1 protein_id gnl|my_center|LOCUS_70900 22908 21712 gene locus_tag LOCUS_70910 22908 21712 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226683.1 protein_id gnl|my_center|LOCUS_70910 23884 23084 gene locus_tag LOCUS_70920 23884 23084 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226682.1 protein_id gnl|my_center|LOCUS_70920 24137 25612 gene locus_tag LOCUS_70930 24137 25612 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226681.1 protein_id gnl|my_center|LOCUS_70930 27270 25621 gene locus_tag LOCUS_70940 27270 25621 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_70940 27634 28395 gene locus_tag LOCUS_70950 27634 28395 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226344.1 protein_id gnl|my_center|LOCUS_70950 28392 29333 gene locus_tag LOCUS_70960 gene pfkB 28392 29333 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028823.1 protein_id gnl|my_center|LOCUS_70960 29407 30576 gene locus_tag LOCUS_70970 29407 30576 CDS product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886406.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70970 30573 30890 gene locus_tag LOCUS_70980 30573 30890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70980 30883 31341 gene locus_tag LOCUS_70990 30883 31341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70990 31338 32378 gene locus_tag LOCUS_71000 31338 32378 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_71000 32409 32693 gene locus_tag LOCUS_71010 32409 32693 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804003.1 protein_id gnl|my_center|LOCUS_71010 32686 34350 gene locus_tag LOCUS_71020 gene ptsP 32686 34350 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977434.1 protein_id gnl|my_center|LOCUS_71020 35779 34418 gene locus_tag LOCUS_71030 35779 34418 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727870.1 protein_id gnl|my_center|LOCUS_71030 35924 36559 gene locus_tag LOCUS_71040 35924 36559 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727869.1 protein_id gnl|my_center|LOCUS_71040 37435 36641 gene locus_tag LOCUS_71050 37435 36641 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113207.1 protein_id gnl|my_center|LOCUS_71050 38607 37432 gene locus_tag LOCUS_71060 38607 37432 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031498.1 protein_id gnl|my_center|LOCUS_71060 39708 38806 gene locus_tag LOCUS_71070 39708 38806 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027024.1 protein_id gnl|my_center|LOCUS_71070 40499 39741 gene locus_tag LOCUS_71080 40499 39741 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974282.1 protein_id gnl|my_center|LOCUS_71080 41045 40854 gene locus_tag LOCUS_71090 41045 40854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71090 41580 40987 gene locus_tag LOCUS_71100 41580 40987 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742088.1 protein_id gnl|my_center|LOCUS_71100 41708 42451 gene locus_tag LOCUS_71110 41708 42451 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776271.1 protein_id gnl|my_center|LOCUS_71110 43100 42471 gene locus_tag LOCUS_71120 43100 42471 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730380.1 protein_id gnl|my_center|LOCUS_71120 43577 43233 gene locus_tag LOCUS_71130 43577 43233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71130 43926 44339 gene locus_tag LOCUS_71140 43926 44339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71140 >Feature sequence46 434 1528 gene locus_tag LOCUS_71150 434 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71150 1521 2129 gene locus_tag LOCUS_71160 1521 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729189.1 protein_id gnl|my_center|LOCUS_71160 2264 5422 gene locus_tag LOCUS_71170 2264 5422 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729190.1 protein_id gnl|my_center|LOCUS_71170 5498 5986 gene locus_tag LOCUS_71180 5498 5986 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729245.1 protein_id gnl|my_center|LOCUS_71180 5995 7155 gene locus_tag LOCUS_71190 5995 7155 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973241.1 protein_id gnl|my_center|LOCUS_71190 7935 7501 gene locus_tag LOCUS_71200 7935 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71200 8119 8913 gene locus_tag LOCUS_71210 8119 8913 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226234.1 protein_id gnl|my_center|LOCUS_71210 10344 8992 gene locus_tag LOCUS_71220 10344 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71220 11702 10650 gene locus_tag LOCUS_71230 11702 10650 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972380.1 protein_id gnl|my_center|LOCUS_71230 14260 11699 gene locus_tag LOCUS_71240 14260 11699 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031033.1 protein_id gnl|my_center|LOCUS_71240 14622 18092 gene locus_tag LOCUS_71250 14622 18092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71250 18330 19079 gene locus_tag LOCUS_71260 18330 19079 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893654.1 protein_id gnl|my_center|LOCUS_71260 19349 19185 gene locus_tag LOCUS_71270 19349 19185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71270 19415 20044 gene locus_tag LOCUS_71280 19415 20044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896615.1 protein_id gnl|my_center|LOCUS_71280 20134 20364 gene locus_tag LOCUS_71290 20134 20364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71290 20511 21536 gene locus_tag LOCUS_71300 20511 21536 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230778.1 protein_id gnl|my_center|LOCUS_71300 22414 21602 gene locus_tag LOCUS_71310 22414 21602 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_71310 23196 22489 gene locus_tag LOCUS_71320 23196 22489 CDS product DUF4253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230274.1 protein_id gnl|my_center|LOCUS_71320 24323 23352 gene locus_tag LOCUS_71330 24323 23352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71330 24445 26025 gene locus_tag LOCUS_71340 24445 26025 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_71340 26022 26951 gene locus_tag LOCUS_71350 26022 26951 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419701.1 protein_id gnl|my_center|LOCUS_71350 26938 27777 gene locus_tag LOCUS_71360 26938 27777 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113015.1 protein_id gnl|my_center|LOCUS_71360 28296 27802 gene locus_tag LOCUS_71370 28296 27802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229066.1 protein_id gnl|my_center|LOCUS_71370 29658 28372 gene locus_tag LOCUS_71380 29658 28372 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030958.1 protein_id gnl|my_center|LOCUS_71380 31613 29655 gene locus_tag LOCUS_71390 31613 29655 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226499.1 protein_id gnl|my_center|LOCUS_71390 32713 31610 gene locus_tag LOCUS_71400 32713 31610 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742198.1 protein_id gnl|my_center|LOCUS_71400 34292 32988 gene locus_tag LOCUS_71410 gene tuf 34292 32988 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977508.1 protein_id gnl|my_center|LOCUS_71410 35743 34580 gene locus_tag LOCUS_71420 35743 34580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71420 35905 36675 gene locus_tag LOCUS_71430 35905 36675 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199431534.1 protein_id gnl|my_center|LOCUS_71430 36806 38617 gene locus_tag LOCUS_71440 36806 38617 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742071.1 protein_id gnl|my_center|LOCUS_71440 38614 40767 gene locus_tag LOCUS_71450 gene scpA 38614 40767 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_71450 40764 41753 gene locus_tag LOCUS_71460 gene meaB 40764 41753 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_71460 41909 43900 gene locus_tag LOCUS_71470 41909 43900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71470 44585 43965 gene locus_tag LOCUS_71480 44585 43965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223377.1 protein_id gnl|my_center|LOCUS_71480 46158 44572 gene locus_tag LOCUS_71490 46158 44572 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223376.1 protein_id gnl|my_center|LOCUS_71490 47321 46155 gene locus_tag LOCUS_71500 47321 46155 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479620.1 protein_id gnl|my_center|LOCUS_71500 48461 47346 gene locus_tag LOCUS_71510 48461 47346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223374.1 protein_id gnl|my_center|LOCUS_71510 49875 48619 gene locus_tag LOCUS_71520 gene efeB 49875 48619 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730522.1 protein_id gnl|my_center|LOCUS_71520 51011 49872 gene locus_tag LOCUS_71530 51011 49872 CDS product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 protein_id gnl|my_center|LOCUS_71530 51892 51041 gene locus_tag LOCUS_71540 51892 51041 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_71540 52109 53080 gene locus_tag LOCUS_71550 52109 53080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71550 53416 53168 gene locus_tag LOCUS_71560 53416 53168 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033875.1 protein_id gnl|my_center|LOCUS_71560 54489 53446 gene locus_tag LOCUS_71570 54489 53446 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027843.1 protein_id gnl|my_center|LOCUS_71570 54622 55518 gene locus_tag LOCUS_71580 54622 55518 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222522.1 protein_id gnl|my_center|LOCUS_71580 56632 55589 gene locus_tag LOCUS_71590 56632 55589 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028601.1 protein_id gnl|my_center|LOCUS_71590 56911 57690 gene locus_tag LOCUS_71600 56911 57690 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_71600 57788 58435 gene locus_tag LOCUS_71610 57788 58435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71610 >Feature sequence47 1341 364 gene locus_tag LOCUS_71620 1341 364 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027138.1 protein_id gnl|my_center|LOCUS_71620 1735 2655 gene locus_tag LOCUS_71630 1735 2655 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729840.1 protein_id gnl|my_center|LOCUS_71630 2812 3867 gene locus_tag LOCUS_71640 2812 3867 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896752.1 protein_id gnl|my_center|LOCUS_71640 3948 4328 gene locus_tag LOCUS_71650 3948 4328 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029511.1 protein_id gnl|my_center|LOCUS_71650 4466 4681 gene locus_tag LOCUS_71660 4466 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71660 5484 4780 gene locus_tag LOCUS_71670 5484 4780 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730773.1 protein_id gnl|my_center|LOCUS_71670 6119 5670 gene locus_tag LOCUS_71680 6119 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71680 6069 6437 gene locus_tag LOCUS_71690 6069 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71690 7420 6695 gene locus_tag LOCUS_71700 7420 6695 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_71700 8677 7850 gene locus_tag LOCUS_71710 8677 7850 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_71710 9068 8733 gene locus_tag LOCUS_71720 9068 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71720 9067 9702 gene locus_tag LOCUS_71730 9067 9702 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729782.1 protein_id gnl|my_center|LOCUS_71730 10184 9624 gene locus_tag LOCUS_71740 10184 9624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71740 10135 13188 gene locus_tag LOCUS_71750 10135 13188 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223092406.1 protein_id gnl|my_center|LOCUS_71750 13339 13707 gene locus_tag LOCUS_71760 13339 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71760 15410 13929 gene locus_tag LOCUS_71770 15410 13929 CDS product DUF4241 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138051423.1 protein_id gnl|my_center|LOCUS_71770 15761 15958 gene locus_tag LOCUS_71780 15761 15958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71780 16159 17109 gene locus_tag LOCUS_71790 16159 17109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71790 17737 17165 gene locus_tag LOCUS_71800 17737 17165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71800 19146 17854 gene locus_tag LOCUS_71810 19146 17854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71810 21635 19338 gene locus_tag LOCUS_71820 21635 19338 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027019.1 protein_id gnl|my_center|LOCUS_71820 22758 21778 gene locus_tag LOCUS_71830 22758 21778 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140671.1 protein_id gnl|my_center|LOCUS_71830 23331 22858 gene locus_tag LOCUS_71840 23331 22858 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028645.1 protein_id gnl|my_center|LOCUS_71840 23554 24123 gene locus_tag LOCUS_71850 23554 24123 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220205807.1 protein_id gnl|my_center|LOCUS_71850 27070 24251 gene locus_tag LOCUS_71860 27070 24251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71860 27870 27073 gene locus_tag LOCUS_71870 27870 27073 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972022.1 protein_id gnl|my_center|LOCUS_71870 27980 28195 gene locus_tag LOCUS_71880 27980 28195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71880 28199 28777 gene locus_tag LOCUS_71890 28199 28777 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 protein_id gnl|my_center|LOCUS_71890 28852 29727 gene locus_tag LOCUS_71900 28852 29727 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_71900 32971 29813 gene locus_tag LOCUS_71910 32971 29813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71910 33475 33981 gene locus_tag LOCUS_71920 33475 33981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71920 35000 33978 gene locus_tag LOCUS_71930 35000 33978 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225042.1 protein_id gnl|my_center|LOCUS_71930 35125 35958 gene locus_tag LOCUS_71940 35125 35958 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228167.1 protein_id gnl|my_center|LOCUS_71940 36002 36640 gene locus_tag LOCUS_71950 36002 36640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71950 37488 36880 gene locus_tag LOCUS_71960 37488 36880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71960 37585 38382 gene locus_tag LOCUS_71970 37585 38382 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104409.1 protein_id gnl|my_center|LOCUS_71970 39438 38713 gene locus_tag LOCUS_71980 39438 38713 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974330.1 protein_id gnl|my_center|LOCUS_71980 40386 39598 gene locus_tag LOCUS_71990 40386 39598 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_71990 41245 40442 gene locus_tag LOCUS_72000 41245 40442 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731436.1 protein_id gnl|my_center|LOCUS_72000 44359 41519 gene locus_tag LOCUS_72010 44359 41519 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 protein_id gnl|my_center|LOCUS_72010 45039 44359 gene locus_tag LOCUS_72020 45039 44359 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228255.1 protein_id gnl|my_center|LOCUS_72020 47436 45151 gene locus_tag LOCUS_72030 47436 45151 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831565.1 protein_id gnl|my_center|LOCUS_72030 50413 47582 gene locus_tag LOCUS_72040 50413 47582 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727994.1 protein_id gnl|my_center|LOCUS_72040 50606 51403 gene locus_tag LOCUS_72050 50606 51403 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225865.1 protein_id gnl|my_center|LOCUS_72050 51506 52501 gene locus_tag LOCUS_72060 gene cif 51506 52501 CDS product CFTR inhibitory factor Cif inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114004.1 protein_id gnl|my_center|LOCUS_72060 52871 54253 gene locus_tag LOCUS_72070 52871 54253 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 protein_id gnl|my_center|LOCUS_72070 55763 54573 gene locus_tag LOCUS_72080 55763 54573 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401972.1 protein_id gnl|my_center|LOCUS_72080 57086 55791 gene locus_tag LOCUS_72090 57086 55791 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_72090 58115 57450 gene locus_tag LOCUS_72100 58115 57450 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058758.1 protein_id gnl|my_center|LOCUS_72100 58207 59199 gene locus_tag LOCUS_72110 58207 59199 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224988.1 protein_id gnl|my_center|LOCUS_72110 59943 59365 gene locus_tag LOCUS_72120 59943 59365 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978570.1 protein_id gnl|my_center|LOCUS_72120 60036 61256 gene locus_tag LOCUS_72130 60036 61256 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229513.1 protein_id gnl|my_center|LOCUS_72130 61253 61933 gene locus_tag LOCUS_72140 61253 61933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72140 62054 62236 gene locus_tag LOCUS_72150 62054 62236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72150 63326 62295 gene locus_tag LOCUS_72160 63326 62295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72160 63627 63553 gene locus_tag LOCUS_t00660 63627 63553 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 63722 63647 gene locus_tag LOCUS_t00670 63722 63647 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 63900 63827 gene locus_tag LOCUS_t00680 63900 63827 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 65532 63901 gene locus_tag LOCUS_72170 65532 63901 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974879.1 protein_id gnl|my_center|LOCUS_72170 66202 65489 gene locus_tag LOCUS_72180 66202 65489 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973638.1 protein_id gnl|my_center|LOCUS_72180 66249 67190 gene locus_tag LOCUS_72190 66249 67190 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_72190 67187 68017 gene locus_tag LOCUS_72200 67187 68017 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226542.1 protein_id gnl|my_center|LOCUS_72200 68030 68371 gene locus_tag LOCUS_72210 68030 68371 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_72210 68527 69855 gene locus_tag LOCUS_72220 68527 69855 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315434.1 protein_id gnl|my_center|LOCUS_72220 70529 69858 gene locus_tag LOCUS_72230 70529 69858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72230 70580 71737 gene locus_tag LOCUS_72240 70580 71737 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224141.1 protein_id gnl|my_center|LOCUS_72240 71838 71911 gene locus_tag LOCUS_t00690 71838 71911 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 72318 71986 gene locus_tag LOCUS_72250 72318 71986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72250 72445 72693 gene locus_tag LOCUS_72260 72445 72693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72260 72781 73653 gene locus_tag LOCUS_72270 72781 73653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72270 73755 74126 gene locus_tag LOCUS_72280 73755 74126 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546371.1 protein_id gnl|my_center|LOCUS_72280 74317 74640 gene locus_tag LOCUS_72290 74317 74640 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973762.1 protein_id gnl|my_center|LOCUS_72290 74783 74908 gene locus_tag LOCUS_72300 74783 74908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72300 74945 75301 gene locus_tag LOCUS_72310 74945 75301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224779.1 protein_id gnl|my_center|LOCUS_72310 75528 76433 gene locus_tag LOCUS_72320 75528 76433 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729936.1 protein_id gnl|my_center|LOCUS_72320 76678 76397 gene locus_tag LOCUS_72330 76678 76397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72330 77049 78713 gene locus_tag LOCUS_72340 77049 78713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72340 79624 78719 gene locus_tag LOCUS_72350 79624 78719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72350 80410 79964 gene locus_tag LOCUS_72360 80410 79964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72360 80813 81064 gene locus_tag LOCUS_72370 80813 81064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72370 81707 81240 gene locus_tag LOCUS_72380 81707 81240 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925634.1 protein_id gnl|my_center|LOCUS_72380 82591 81749 gene locus_tag LOCUS_72390 82591 81749 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328848.1 protein_id gnl|my_center|LOCUS_72390 82737 83798 gene locus_tag LOCUS_72400 82737 83798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72400 86712 83842 gene locus_tag LOCUS_72410 86712 83842 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222149.1 protein_id gnl|my_center|LOCUS_72410 89004 86812 gene locus_tag LOCUS_72420 89004 86812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72420 89786 89004 gene locus_tag LOCUS_72430 89786 89004 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284384.1 protein_id gnl|my_center|LOCUS_72430 90982 89858 gene locus_tag LOCUS_72440 90982 89858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72440 91037 92032 gene locus_tag LOCUS_72450 91037 92032 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225042.1 protein_id gnl|my_center|LOCUS_72450 93314 92103 gene locus_tag LOCUS_72460 93314 92103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72460 93458 94051 gene locus_tag LOCUS_72470 93458 94051 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529190.1 protein_id gnl|my_center|LOCUS_72470 94071 94391 gene locus_tag LOCUS_72480 94071 94391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72480 95334 94561 gene locus_tag LOCUS_72490 95334 94561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72490 95817 95473 gene locus_tag LOCUS_72500 95817 95473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72500 96268 97689 gene locus_tag LOCUS_72510 96268 97689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72510 97796 98248 gene locus_tag LOCUS_72520 97796 98248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72520 98776 98267 gene locus_tag LOCUS_72530 98776 98267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029512.1 protein_id gnl|my_center|LOCUS_72530 98835 99803 gene locus_tag LOCUS_72540 98835 99803 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_72540 100070 99822 gene locus_tag LOCUS_72550 100070 99822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72550 100961 100137 gene locus_tag LOCUS_72560 100961 100137 CDS product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029509.1 protein_id gnl|my_center|LOCUS_72560 101188 102105 gene locus_tag LOCUS_72570 101188 102105 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877762.1 protein_id gnl|my_center|LOCUS_72570 >Feature sequence48 372 184 gene locus_tag LOCUS_72580 372 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72580 1768 464 gene locus_tag LOCUS_72590 gene tyrS 1768 464 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_72590 2583 1885 gene locus_tag LOCUS_72600 2583 1885 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_72600 4010 2565 gene locus_tag LOCUS_72610 gene argH 4010 2565 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_72610 4969 4415 gene locus_tag LOCUS_72620 4969 4415 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_72620 5883 4936 gene locus_tag LOCUS_72630 gene argF 5883 4936 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776178.1 protein_id gnl|my_center|LOCUS_72630 7067 5880 gene locus_tag LOCUS_72640 7067 5880 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408163.1 protein_id gnl|my_center|LOCUS_72640 8017 7064 gene locus_tag LOCUS_72650 gene argB 8017 7064 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977246.1 protein_id gnl|my_center|LOCUS_72650 9168 8014 gene locus_tag LOCUS_72660 gene argJ 9168 8014 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_72660 10249 9215 gene locus_tag LOCUS_72670 gene argC 10249 9215 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_72670 10416 12068 gene locus_tag LOCUS_72680 10416 12068 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_72680 12241 12606 gene locus_tag LOCUS_72690 12241 12606 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226809.1 protein_id gnl|my_center|LOCUS_72690 12672 13979 gene locus_tag LOCUS_72700 12672 13979 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030908.1 protein_id gnl|my_center|LOCUS_72700 14045 15358 gene locus_tag LOCUS_72710 14045 15358 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030908.1 protein_id gnl|my_center|LOCUS_72710 15518 17719 gene locus_tag LOCUS_72720 15518 17719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72720 18715 17777 gene locus_tag LOCUS_72730 18715 17777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72730 19012 22188 gene locus_tag LOCUS_72740 19012 22188 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742126.1 protein_id gnl|my_center|LOCUS_72740 25266 22696 gene locus_tag LOCUS_72750 gene pheT 25266 22696 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093159782.1 protein_id gnl|my_center|LOCUS_72750 26366 25266 gene locus_tag LOCUS_72760 gene pheS 26366 25266 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_72760 27577 26483 gene locus_tag LOCUS_72770 27577 26483 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 protein_id gnl|my_center|LOCUS_72770 28519 27686 gene locus_tag LOCUS_72780 28519 27686 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_72780 28973 28590 gene locus_tag LOCUS_72790 gene rplT 28973 28590 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776197.1 protein_id gnl|my_center|LOCUS_72790 29189 28995 gene locus_tag LOCUS_72800 gene rpmI 29189 28995 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058702.1 protein_id gnl|my_center|LOCUS_72800 29969 29397 gene locus_tag LOCUS_72810 gene infC 29969 29397 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_72810 31142 30300 gene locus_tag LOCUS_72820 31142 30300 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_72820 32290 31139 gene locus_tag LOCUS_72830 32290 31139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72830 33478 32465 gene locus_tag LOCUS_72840 33478 32465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72840 33981 33496 gene locus_tag LOCUS_72850 33981 33496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72850 36694 34022 gene locus_tag LOCUS_72860 gene alaS 36694 34022 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_72860 36956 36696 gene locus_tag LOCUS_72870 36956 36696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72870 37408 36953 gene locus_tag LOCUS_72880 37408 36953 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977323.1 protein_id gnl|my_center|LOCUS_72880 38829 37504 gene locus_tag LOCUS_72890 38829 37504 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_72890 39328 38846 gene locus_tag LOCUS_72900 39328 38846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72900 41558 39801 gene locus_tag LOCUS_72910 gene aspS 41558 39801 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027660890.1 protein_id gnl|my_center|LOCUS_72910 42811 41555 gene locus_tag LOCUS_72920 gene hisS 42811 41555 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325801.1 protein_id gnl|my_center|LOCUS_72920 43512 42811 gene locus_tag LOCUS_72930 43512 42811 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_72930 43785 44648 gene locus_tag LOCUS_72940 43785 44648 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227106.1 protein_id gnl|my_center|LOCUS_72940 44694 45938 gene locus_tag LOCUS_72950 44694 45938 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_72950 47254 46307 gene locus_tag LOCUS_72960 47254 46307 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029967.1 protein_id gnl|my_center|LOCUS_72960 47491 48501 gene locus_tag LOCUS_72970 47491 48501 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 protein_id gnl|my_center|LOCUS_72970 50894 48714 gene locus_tag LOCUS_72980 gene relA 50894 48714 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_72980 51846 51331 gene locus_tag LOCUS_72990 51846 51331 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_72990 53073 51961 gene locus_tag LOCUS_73000 gene secF 53073 51961 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_73000 54839 53073 gene locus_tag LOCUS_73010 gene secD 54839 53073 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 protein_id gnl|my_center|LOCUS_73010 55239 54883 gene locus_tag LOCUS_73020 55239 54883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73020 56595 55546 gene locus_tag LOCUS_73030 gene ruvB 56595 55546 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_73030 57250 56630 gene locus_tag LOCUS_73040 gene ruvA 57250 56630 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_73040 58103 57447 gene locus_tag LOCUS_73050 gene ruvC 58103 57447 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_73050 59325 58150 gene locus_tag LOCUS_73060 59325 58150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73060 60128 59373 gene locus_tag LOCUS_73070 60128 59373 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_73070 60743 60132 gene locus_tag LOCUS_73080 gene pdxT 60743 60132 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_73080 61248 60823 gene locus_tag LOCUS_73090 61248 60823 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230986.1 protein_id gnl|my_center|LOCUS_73090 62260 61349 gene locus_tag LOCUS_73100 gene pdxS 62260 61349 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939476.1 protein_id gnl|my_center|LOCUS_73100 63386 62379 gene locus_tag LOCUS_73110 63386 62379 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_73110 64056 63517 gene locus_tag LOCUS_73120 64056 63517 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_73120 65180 64053 gene locus_tag LOCUS_73130 65180 64053 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_73130 66133 65177 gene locus_tag LOCUS_73140 66133 65177 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_73140 66756 66130 gene locus_tag LOCUS_73150 66756 66130 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_73150 67072 69132 gene locus_tag LOCUS_73160 67072 69132 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400860.1 protein_id gnl|my_center|LOCUS_73160 69379 71043 gene locus_tag LOCUS_73170 69379 71043 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 protein_id gnl|my_center|LOCUS_73170 71612 73744 gene locus_tag LOCUS_73180 71612 73744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804311.1 protein_id gnl|my_center|LOCUS_73180 74259 73786 gene locus_tag LOCUS_73190 74259 73786 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_73190 74504 75073 gene locus_tag LOCUS_73200 74504 75073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73200 77129 75153 gene locus_tag LOCUS_73210 gene thrS 77129 75153 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_73210 77822 77262 gene locus_tag LOCUS_73220 77822 77262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73220 80189 77889 gene locus_tag LOCUS_73230 80189 77889 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729203.1 protein_id gnl|my_center|LOCUS_73230 80323 80832 gene locus_tag LOCUS_73240 80323 80832 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028826.1 protein_id gnl|my_center|LOCUS_73240 81837 80857 gene locus_tag LOCUS_73250 81837 80857 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943863.1 protein_id gnl|my_center|LOCUS_73250 82464 81940 gene locus_tag LOCUS_73260 82464 81940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73260 83514 82561 gene locus_tag LOCUS_73270 83514 82561 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222679.1 protein_id gnl|my_center|LOCUS_73270 84749 83772 gene locus_tag LOCUS_73280 84749 83772 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222236.1 protein_id gnl|my_center|LOCUS_73280 85482 84817 gene locus_tag LOCUS_73290 85482 84817 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522757.1 protein_id gnl|my_center|LOCUS_73290 88228 86066 gene locus_tag LOCUS_73300 88228 86066 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_73300 88365 88973 gene locus_tag LOCUS_73310 88365 88973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73310 90164 89007 gene locus_tag LOCUS_73320 90164 89007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73320 91130 90333 gene locus_tag LOCUS_73330 91130 90333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73330 91045 91593 gene locus_tag LOCUS_73340 91045 91593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73340 92151 91702 gene locus_tag LOCUS_73350 92151 91702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73350 93006 92374 gene locus_tag LOCUS_73360 93006 92374 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878199.1 protein_id gnl|my_center|LOCUS_73360 93609 93292 gene locus_tag LOCUS_73370 93609 93292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73370 93796 94188 gene locus_tag LOCUS_73380 93796 94188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73380 94201 94656 gene locus_tag LOCUS_73390 94201 94656 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972459.1 protein_id gnl|my_center|LOCUS_73390 96678 94759 gene locus_tag LOCUS_73400 96678 94759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73400 96910 97914 gene locus_tag LOCUS_73410 96910 97914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73410 >Feature sequence49 <1 622 gene locus_tag LOCUS_73420 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024119813.1:alpha/beta hydrolase 911 2047 gene locus_tag LOCUS_73430 911 2047 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027559.1 protein_id gnl|my_center|LOCUS_73430 2044 2706 gene locus_tag LOCUS_73440 2044 2706 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_73440 2790 3503 gene locus_tag LOCUS_73450 2790 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73450 3497 4288 gene locus_tag LOCUS_73460 3497 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73460 4285 5058 gene locus_tag LOCUS_73470 4285 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73470 5130 5900 gene locus_tag LOCUS_73480 5130 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972674.1 protein_id gnl|my_center|LOCUS_73480 6162 5800 gene locus_tag LOCUS_73490 6162 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73490 6870 6163 gene locus_tag LOCUS_73500 6870 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73500 6893 7132 gene locus_tag LOCUS_73510 6893 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73510 7590 7946 gene locus_tag LOCUS_73520 7590 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73520 7974 8468 gene locus_tag LOCUS_73530 7974 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73530 9291 8947 gene locus_tag LOCUS_73540 9291 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73540 9534 10562 gene locus_tag LOCUS_73550 9534 10562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73550 10599 11237 gene locus_tag LOCUS_73560 10599 11237 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862601.1 protein_id gnl|my_center|LOCUS_73560 11878 11456 gene locus_tag LOCUS_73570 11878 11456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73570 12660 12262 gene locus_tag LOCUS_73580 12660 12262 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974464.1 protein_id gnl|my_center|LOCUS_73580 12752 13741 gene locus_tag LOCUS_73590 12752 13741 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029688.1 protein_id gnl|my_center|LOCUS_73590 13945 14583 gene locus_tag LOCUS_73600 13945 14583 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112715.1 protein_id gnl|my_center|LOCUS_73600 14664 15422 gene locus_tag LOCUS_73610 14664 15422 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_73610 15435 16085 gene locus_tag LOCUS_73620 15435 16085 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014416.1 protein_id gnl|my_center|LOCUS_73620 16114 16518 gene locus_tag LOCUS_73630 16114 16518 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_73630 16523 17944 gene locus_tag LOCUS_73640 16523 17944 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112740.1 protein_id gnl|my_center|LOCUS_73640 19004 17907 gene locus_tag LOCUS_73650 19004 17907 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043376805.1 protein_id gnl|my_center|LOCUS_73650 19392 19045 gene locus_tag LOCUS_73660 19392 19045 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_73660 20655 19405 gene locus_tag LOCUS_73670 20655 19405 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259422.1 protein_id gnl|my_center|LOCUS_73670 20927 20652 gene locus_tag LOCUS_73680 20927 20652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73680 22354 20954 gene locus_tag LOCUS_73690 22354 20954 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007445862.1 protein_id gnl|my_center|LOCUS_73690 22821 22600 gene locus_tag LOCUS_73700 22821 22600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73700 23371 22901 gene locus_tag LOCUS_73710 23371 22901 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230691.1 protein_id gnl|my_center|LOCUS_73710 23645 23325 gene locus_tag LOCUS_73720 23645 23325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73720 23974 24306 gene locus_tag LOCUS_73730 23974 24306 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413663.1 protein_id gnl|my_center|LOCUS_73730 25528 24284 gene locus_tag LOCUS_73740 25528 24284 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_73740 26434 25682 gene locus_tag LOCUS_73750 26434 25682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73750 27306 26632 gene locus_tag LOCUS_73760 27306 26632 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_73760 28412 27303 gene locus_tag LOCUS_73770 28412 27303 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742181.1 protein_id gnl|my_center|LOCUS_73770 28560 29171 gene locus_tag LOCUS_73780 28560 29171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73780 29175 29618 gene locus_tag LOCUS_73790 29175 29618 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225078.1 protein_id gnl|my_center|LOCUS_73790 30115 29921 gene locus_tag LOCUS_73800 30115 29921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73800 32652 30286 gene locus_tag LOCUS_73810 32652 30286 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208256196.1 protein_id gnl|my_center|LOCUS_73810 33426 32935 gene locus_tag LOCUS_73820 33426 32935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73820 33690 33517 gene locus_tag LOCUS_73830 33690 33517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73830 33659 34774 gene locus_tag LOCUS_73840 33659 34774 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152802079.1 protein_id gnl|my_center|LOCUS_73840 35555 34827 gene locus_tag LOCUS_73850 35555 34827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_73850 37305 35575 gene locus_tag LOCUS_73860 37305 35575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73860 38258 37302 gene locus_tag LOCUS_73870 38258 37302 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820410.1 protein_id gnl|my_center|LOCUS_73870 39496 38654 gene locus_tag LOCUS_73880 39496 38654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73880 41586 40135 gene locus_tag LOCUS_73890 41586 40135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73890 41714 41926 gene locus_tag LOCUS_73900 41714 41926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73900 42733 42458 gene locus_tag LOCUS_73910 42733 42458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73910 43301 42969 gene locus_tag LOCUS_73920 43301 42969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73920 43888 43526 gene locus_tag LOCUS_73930 43888 43526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73930 44313 44657 gene locus_tag LOCUS_73940 44313 44657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73940 44859 45323 gene locus_tag LOCUS_73950 44859 45323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73950 45881 45453 gene locus_tag LOCUS_73960 45881 45453 CDS product DUF417 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077743720.1 protein_id gnl|my_center|LOCUS_73960 47109 46714 gene locus_tag LOCUS_73970 47109 46714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73970 47360 47097 gene locus_tag LOCUS_73980 47360 47097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73980 47606 47409 gene locus_tag LOCUS_73990 47606 47409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73990 47972 48133 gene locus_tag LOCUS_74000 47972 48133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74000 48217 48684 gene locus_tag LOCUS_74010 gene msrA 48217 48684 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897888.1 protein_id gnl|my_center|LOCUS_74010 49259 48792 gene locus_tag LOCUS_74020 49259 48792 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859290.1 protein_id gnl|my_center|LOCUS_74020 49704 49988 gene locus_tag LOCUS_74030 49704 49988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74030 51142 50018 gene locus_tag LOCUS_74040 51142 50018 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033518021.1 protein_id gnl|my_center|LOCUS_74040 51337 51176 gene locus_tag LOCUS_74050 51337 51176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74050 51771 51439 gene locus_tag LOCUS_74060 51771 51439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74060 53241 52297 gene locus_tag LOCUS_74070 53241 52297 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729840.1 protein_id gnl|my_center|LOCUS_74070 53883 53512 gene locus_tag LOCUS_74080 53883 53512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74080 54514 54194 gene locus_tag LOCUS_74090 54514 54194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74090 55332 54511 gene locus_tag LOCUS_74100 55332 54511 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223384.1 protein_id gnl|my_center|LOCUS_74100 55921 55325 gene locus_tag LOCUS_74110 55921 55325 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223383.1 protein_id gnl|my_center|LOCUS_74110 56291 56857 gene locus_tag LOCUS_74120 56291 56857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74120 56985 57572 gene locus_tag LOCUS_74130 56985 57572 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921968.1 protein_id gnl|my_center|LOCUS_74130 58234 58112 gene locus_tag LOCUS_74140 58234 58112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74140 59182 58409 gene locus_tag LOCUS_74150 59182 58409 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_74150 59584 60312 gene locus_tag LOCUS_74160 59584 60312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74160 61237 60983 gene locus_tag LOCUS_74170 61237 60983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74170 61645 61277 gene locus_tag LOCUS_74180 61645 61277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74180 62441 62016 gene locus_tag LOCUS_74190 62441 62016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74190 62859 63266 gene locus_tag LOCUS_74200 62859 63266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_74200 63508 63263 gene locus_tag LOCUS_74210 63508 63263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_74210 64639 63695 gene locus_tag LOCUS_74220 64639 63695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74220 65717 64749 gene locus_tag LOCUS_74230 65717 64749 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037062758.1 protein_id gnl|my_center|LOCUS_74230 65817 66146 gene locus_tag LOCUS_74240 65817 66146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74240 66440 66949 gene locus_tag LOCUS_74250 66440 66949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74250 67103 67930 gene locus_tag LOCUS_74260 67103 67930 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246384.1 protein_id gnl|my_center|LOCUS_74260 68002 68499 gene locus_tag LOCUS_74270 68002 68499 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285193.1 protein_id gnl|my_center|LOCUS_74270 68496 69788 gene locus_tag LOCUS_74280 68496 69788 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227556.1 protein_id gnl|my_center|LOCUS_74280 70353 69835 gene locus_tag LOCUS_74290 70353 69835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972086.1 protein_id gnl|my_center|LOCUS_74290 70660 71913 gene locus_tag LOCUS_74300 gene nhaA 70660 71913 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029088.1 protein_id gnl|my_center|LOCUS_74300 72568 71957 gene locus_tag LOCUS_74310 72568 71957 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230054.1 protein_id gnl|my_center|LOCUS_74310 73284 72565 gene locus_tag LOCUS_74320 73284 72565 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870668.1 protein_id gnl|my_center|LOCUS_74320 73488 74723 gene locus_tag LOCUS_74330 73488 74723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230051.1 protein_id gnl|my_center|LOCUS_74330 75734 74742 gene locus_tag LOCUS_74340 75734 74742 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029199.1 protein_id gnl|my_center|LOCUS_74340 75959 76432 gene locus_tag LOCUS_74350 75959 76432 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898082.1 protein_id gnl|my_center|LOCUS_74350 77164 76487 gene locus_tag LOCUS_74360 77164 76487 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029202.1 protein_id gnl|my_center|LOCUS_74360 77335 78672 gene locus_tag LOCUS_74370 77335 78672 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849057.1 protein_id gnl|my_center|LOCUS_74370 78684 79205 gene locus_tag LOCUS_74380 78684 79205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159394617.1 protein_id gnl|my_center|LOCUS_74380 79289 80407 gene locus_tag LOCUS_74390 79289 80407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74390 80624 81286 gene locus_tag LOCUS_74400 80624 81286 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731458.1 protein_id gnl|my_center|LOCUS_74400 81283 81504 gene locus_tag LOCUS_74410 81283 81504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731457.1 protein_id gnl|my_center|LOCUS_74410 81980 81513 gene locus_tag LOCUS_74420 81980 81513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74420 82685 82134 gene locus_tag LOCUS_74430 82685 82134 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891449.1 protein_id gnl|my_center|LOCUS_74430 84724 83894 gene locus_tag LOCUS_74440 84724 83894 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530928.1 protein_id gnl|my_center|LOCUS_74440 85736 84765 gene locus_tag LOCUS_74450 85736 84765 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973989.1 protein_id gnl|my_center|LOCUS_74450 85857 86513 gene locus_tag LOCUS_74460 85857 86513 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222994.1 protein_id gnl|my_center|LOCUS_74460 87145 86624 gene locus_tag LOCUS_74470 87145 86624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74470 87598 88536 gene locus_tag LOCUS_74480 87598 88536 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228296.1 protein_id gnl|my_center|LOCUS_74480 88637 89383 gene locus_tag LOCUS_74490 88637 89383 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223914.1 protein_id gnl|my_center|LOCUS_74490 91225 90047 gene locus_tag LOCUS_74500 91225 90047 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 protein_id gnl|my_center|LOCUS_74500 91880 91305 gene locus_tag LOCUS_74510 91880 91305 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284050.1 protein_id gnl|my_center|LOCUS_74510 92708 93127 gene locus_tag LOCUS_74520 92708 93127 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083170.1 protein_id gnl|my_center|LOCUS_74520 93246 93518 gene locus_tag LOCUS_74530 93246 93518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74530 >Feature sequence50 762 1787 gene locus_tag LOCUS_74540 762 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74540 2822 1893 gene locus_tag LOCUS_74550 2822 1893 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977187.1 protein_id gnl|my_center|LOCUS_74550 4287 2929 gene locus_tag LOCUS_74560 gene pafA 4287 2929 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_74560 5146 4361 gene locus_tag LOCUS_74570 gene prcA 5146 4361 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_74570 5984 5169 gene locus_tag LOCUS_74580 gene prcB 5984 5169 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_74580 6240 7607 gene locus_tag LOCUS_74590 6240 7607 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486252.1 protein_id gnl|my_center|LOCUS_74590 7594 8484 gene locus_tag LOCUS_74600 7594 8484 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030240.1 protein_id gnl|my_center|LOCUS_74600 8481 9407 gene locus_tag LOCUS_74610 8481 9407 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722383.1 protein_id gnl|my_center|LOCUS_74610 9404 10465 gene locus_tag LOCUS_74620 9404 10465 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173056.1 protein_id gnl|my_center|LOCUS_74620 10468 11721 gene locus_tag LOCUS_74630 10468 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74630 11856 13004 gene locus_tag LOCUS_74640 11856 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74640 12964 15705 gene locus_tag LOCUS_74650 12964 15705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74650 15964 15755 gene locus_tag LOCUS_74660 15964 15755 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_74660 16356 17141 gene locus_tag LOCUS_74670 16356 17141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_74670 18661 17144 gene locus_tag LOCUS_74680 18661 17144 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028009.1 protein_id gnl|my_center|LOCUS_74680 19344 18784 gene locus_tag LOCUS_74690 19344 18784 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897489.1 protein_id gnl|my_center|LOCUS_74690 20893 19376 gene locus_tag LOCUS_74700 gene dop 20893 19376 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_74700 22962 21199 gene locus_tag LOCUS_74710 gene arc 22962 21199 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_74710 24030 23173 gene locus_tag LOCUS_74720 24030 23173 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_74720 24194 25300 gene locus_tag LOCUS_74730 24194 25300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74730 26593 25331 gene locus_tag LOCUS_74740 26593 25331 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_74740 27562 26687 gene locus_tag LOCUS_74750 27562 26687 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225340.1 protein_id gnl|my_center|LOCUS_74750 27638 28228 gene locus_tag LOCUS_74760 27638 28228 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209080.1 protein_id gnl|my_center|LOCUS_74760 29894 28317 gene locus_tag LOCUS_74770 29894 28317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74770 31325 30156 gene locus_tag LOCUS_74780 31325 30156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74780 31519 32418 gene locus_tag LOCUS_74790 31519 32418 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_74790 32624 33769 gene locus_tag LOCUS_74800 32624 33769 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_74800 33822 34505 gene locus_tag LOCUS_74810 33822 34505 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_74810 34619 35437 gene locus_tag LOCUS_74820 34619 35437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_74820 35434 37974 gene locus_tag LOCUS_74830 35434 37974 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_74830 39070 38057 gene locus_tag LOCUS_74840 39070 38057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74840 40174 39149 gene locus_tag LOCUS_74850 40174 39149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_74850 41201 40230 gene locus_tag LOCUS_74860 41201 40230 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_74860 41167 41340 gene locus_tag LOCUS_74870 41167 41340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74870 43105 41333 gene locus_tag LOCUS_74880 43105 41333 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_74880 44154 43159 gene locus_tag LOCUS_74890 44154 43159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_74890 44946 44470 gene locus_tag LOCUS_74900 44946 44470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977282.1 protein_id gnl|my_center|LOCUS_74900 45773 45132 gene locus_tag LOCUS_74910 45773 45132 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_74910 49406 45942 gene locus_tag LOCUS_74920 gene metH 49406 45942 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_74920 49590 50444 gene locus_tag LOCUS_74930 gene parJ 49590 50444 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_74930 51269 50478 gene locus_tag LOCUS_74940 51269 50478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74940 52429 51266 gene locus_tag LOCUS_74950 52429 51266 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028682.1 protein_id gnl|my_center|LOCUS_74950 52788 52426 gene locus_tag LOCUS_74960 gene nirD 52788 52426 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401341.1 protein_id gnl|my_center|LOCUS_74960 55259 52785 gene locus_tag LOCUS_74970 gene nirB 55259 52785 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223029.1 protein_id gnl|my_center|LOCUS_74970 56659 55256 gene locus_tag LOCUS_74980 56659 55256 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223027.1 protein_id gnl|my_center|LOCUS_74980 58677 56656 gene locus_tag LOCUS_74990 58677 56656 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_74990 60281 58917 gene locus_tag LOCUS_75000 60281 58917 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085590.1 protein_id gnl|my_center|LOCUS_75000 60531 60971 gene locus_tag LOCUS_75010 gene def 60531 60971 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_75010 61217 62086 gene locus_tag LOCUS_75020 61217 62086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75020 63305 62094 gene locus_tag LOCUS_75030 gene mshC 63305 62094 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_75030 64090 63341 gene locus_tag LOCUS_75040 64090 63341 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388471.1 protein_id gnl|my_center|LOCUS_75040 64919 64158 gene locus_tag LOCUS_75050 64919 64158 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270002.1 protein_id gnl|my_center|LOCUS_75050 65547 64969 gene locus_tag LOCUS_75060 65547 64969 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_75060 66258 65557 gene locus_tag LOCUS_75070 66258 65557 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_75070 67073 66255 gene locus_tag LOCUS_75080 67073 66255 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977503.1 protein_id gnl|my_center|LOCUS_75080 67109 68044 gene locus_tag LOCUS_75090 67109 68044 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285031.1 protein_id gnl|my_center|LOCUS_75090 68579 69526 gene locus_tag LOCUS_75100 68579 69526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75100 72365 69591 gene locus_tag LOCUS_75110 72365 69591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75110 73118 72375 gene locus_tag LOCUS_75120 73118 72375 CDS product malonyl CoA-ACP transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403326.1 protein_id gnl|my_center|LOCUS_75120 77386 73115 gene locus_tag LOCUS_75130 77386 73115 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727624.1 protein_id gnl|my_center|LOCUS_75130 78266 77436 gene locus_tag LOCUS_75140 78266 77436 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226872.1 protein_id gnl|my_center|LOCUS_75140 79252 78266 gene locus_tag LOCUS_75150 79252 78266 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226871.1 protein_id gnl|my_center|LOCUS_75150 80556 79270 gene locus_tag LOCUS_75160 80556 79270 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226870.1 protein_id gnl|my_center|LOCUS_75160 80778 81755 gene locus_tag LOCUS_75170 80778 81755 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 protein_id gnl|my_center|LOCUS_75170 82526 81762 gene locus_tag LOCUS_75180 gene fabI 82526 81762 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_75180 83186 82566 gene locus_tag LOCUS_75190 gene fabG 83186 82566 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_75190 83348 84841 gene locus_tag LOCUS_75200 83348 84841 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 protein_id gnl|my_center|LOCUS_75200 84841 86211 gene locus_tag LOCUS_75210 84841 86211 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_75210 86460 86245 gene locus_tag LOCUS_75220 86460 86245 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_75220 86464 86868 gene locus_tag LOCUS_75230 86464 86868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75230 87328 87071 gene locus_tag LOCUS_75240 87328 87071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_75240 88098 87382 gene locus_tag LOCUS_75250 88098 87382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_75250 89107 88118 gene locus_tag LOCUS_75260 gene moaA 89107 88118 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_75260 89354 90508 gene locus_tag LOCUS_75270 89354 90508 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015557.1 protein_id gnl|my_center|LOCUS_75270 >Feature sequence51 885 190 gene locus_tag LOCUS_75280 885 190 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900586.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_75280 1677 913 gene locus_tag LOCUS_75290 1677 913 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_75290 3061 1682 gene locus_tag LOCUS_75300 3061 1682 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 protein_id gnl|my_center|LOCUS_75300 4404 3058 gene locus_tag LOCUS_75310 4404 3058 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876257.1 protein_id gnl|my_center|LOCUS_75310 4536 5264 gene locus_tag LOCUS_75320 4536 5264 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466719.1 protein_id gnl|my_center|LOCUS_75320 5311 6117 gene locus_tag LOCUS_75330 5311 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_75330 6170 6364 gene locus_tag LOCUS_75340 6170 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75340 6504 8282 gene locus_tag LOCUS_75350 6504 8282 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 protein_id gnl|my_center|LOCUS_75350 8671 10014 gene locus_tag LOCUS_75360 8671 10014 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727478.1 protein_id gnl|my_center|LOCUS_75360 10083 11231 gene locus_tag LOCUS_75370 gene hutI 10083 11231 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892542.1 protein_id gnl|my_center|LOCUS_75370 11465 12400 gene locus_tag LOCUS_75380 11465 12400 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_75380 12694 14010 gene locus_tag LOCUS_75390 12694 14010 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_75390 14007 14345 gene locus_tag LOCUS_75400 14007 14345 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_75400 14350 16662 gene locus_tag LOCUS_75410 14350 16662 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_75410 16813 19926 gene locus_tag LOCUS_75420 16813 19926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75420 19923 20342 gene locus_tag LOCUS_75430 19923 20342 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_75430 20361 20720 gene locus_tag LOCUS_75440 20361 20720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75440 20701 21285 gene locus_tag LOCUS_75450 20701 21285 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_75450 21710 24640 gene locus_tag LOCUS_75460 21710 24640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_75460 24637 25059 gene locus_tag LOCUS_75470 24637 25059 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_75470 25161 25604 gene locus_tag LOCUS_75480 25161 25604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75480 25585 26175 gene locus_tag LOCUS_75490 25585 26175 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_75490 26423 27778 gene locus_tag LOCUS_75500 26423 27778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75500 27993 29522 gene locus_tag LOCUS_75510 gene ffh 27993 29522 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_75510 29767 30219 gene locus_tag LOCUS_75520 29767 30219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75520 30221 30463 gene locus_tag LOCUS_75530 30221 30463 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_75530 30573 31091 gene locus_tag LOCUS_75540 gene rimM 30573 31091 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142459073.1 protein_id gnl|my_center|LOCUS_75540 31104 31928 gene locus_tag LOCUS_75550 gene trmD 31104 31928 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973399.1 protein_id gnl|my_center|LOCUS_75550 32101 32463 gene locus_tag LOCUS_75560 gene rplS 32101 32463 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973398.1 protein_id gnl|my_center|LOCUS_75560 32602 33423 gene locus_tag LOCUS_75570 gene lepB 32602 33423 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973395.1 protein_id gnl|my_center|LOCUS_75570 33434 34027 gene locus_tag LOCUS_75580 33434 34027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75580 34082 34831 gene locus_tag LOCUS_75590 34082 34831 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414713.1 protein_id gnl|my_center|LOCUS_75590 34871 35194 gene locus_tag LOCUS_75600 34871 35194 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_75600 35273 36187 gene locus_tag LOCUS_75610 35273 36187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75610 37082 36150 gene locus_tag LOCUS_75620 37082 36150 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223859.1 protein_id gnl|my_center|LOCUS_75620 38295 37084 gene locus_tag LOCUS_75630 gene dprA 38295 37084 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_75630 39947 38295 gene locus_tag LOCUS_75640 39947 38295 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030329.1 protein_id gnl|my_center|LOCUS_75640 40302 39949 gene locus_tag LOCUS_75650 40302 39949 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_75650 40583 41995 gene locus_tag LOCUS_75660 40583 41995 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224515.1 protein_id gnl|my_center|LOCUS_75660 43190 41880 gene locus_tag LOCUS_75670 43190 41880 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_75670 43272 44036 gene locus_tag LOCUS_75680 43272 44036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75680 44359 45306 gene locus_tag LOCUS_75690 gene rpsB 44359 45306 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_75690 45425 46258 gene locus_tag LOCUS_75700 gene tsf 45425 46258 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973385.1 protein_id gnl|my_center|LOCUS_75700 46311 47081 gene locus_tag LOCUS_75710 gene pyrH 46311 47081 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973384.1 protein_id gnl|my_center|LOCUS_75710 47091 47648 gene locus_tag LOCUS_75720 gene frr 47091 47648 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_75720 47864 48730 gene locus_tag LOCUS_75730 47864 48730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75730 49803 48784 gene locus_tag LOCUS_75740 49803 48784 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200269.1 protein_id gnl|my_center|LOCUS_75740 49904 51022 gene locus_tag LOCUS_75750 gene rlmN 49904 51022 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_75750 53312 51180 gene locus_tag LOCUS_75760 53312 51180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75760 54182 53520 gene locus_tag LOCUS_75770 54182 53520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75770 55063 54179 gene locus_tag LOCUS_75780 55063 54179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75780 55200 56063 gene locus_tag LOCUS_75790 55200 56063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75790 56152 56982 gene locus_tag LOCUS_75800 56152 56982 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114860.1 protein_id gnl|my_center|LOCUS_75800 56979 57665 gene locus_tag LOCUS_75810 56979 57665 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258352.1 protein_id gnl|my_center|LOCUS_75810 58132 57644 gene locus_tag LOCUS_75820 58132 57644 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_75820 58347 59780 gene locus_tag LOCUS_75830 58347 59780 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_75830 59830 60978 gene locus_tag LOCUS_75840 59830 60978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_75840 61010 62269 gene locus_tag LOCUS_75850 61010 62269 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030369.1 protein_id gnl|my_center|LOCUS_75850 62304 63167 gene locus_tag LOCUS_75860 62304 63167 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894683.1 protein_id gnl|my_center|LOCUS_75860 63164 63952 gene locus_tag LOCUS_75870 63164 63952 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894682.1 protein_id gnl|my_center|LOCUS_75870 63972 65366 gene locus_tag LOCUS_75880 63972 65366 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_75880 66257 65385 gene locus_tag LOCUS_75890 66257 65385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75890 67536 66298 gene locus_tag LOCUS_75900 67536 66298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75900 68401 67598 gene locus_tag LOCUS_75910 68401 67598 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731346.1 protein_id gnl|my_center|LOCUS_75910 69321 68596 gene locus_tag LOCUS_75920 69321 68596 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612370.1 protein_id gnl|my_center|LOCUS_75920 69404 69859 gene locus_tag LOCUS_75930 69404 69859 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531762.1 protein_id gnl|my_center|LOCUS_75930 70594 69941 gene locus_tag LOCUS_75940 70594 69941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75940 70860 71711 gene locus_tag LOCUS_75950 70860 71711 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_75950 72388 71726 gene locus_tag LOCUS_75960 gene leuE 72388 71726 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192135.1 protein_id gnl|my_center|LOCUS_75960 72508 73896 gene locus_tag LOCUS_75970 72508 73896 CDS product selenium-binding family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392113.1 protein_id gnl|my_center|LOCUS_75970 73893 74513 gene locus_tag LOCUS_75980 73893 74513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256632.1 protein_id gnl|my_center|LOCUS_75980 74598 75332 gene locus_tag LOCUS_75990 74598 75332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75990 75402 78554 gene locus_tag LOCUS_76000 75402 78554 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222149.1 protein_id gnl|my_center|LOCUS_76000 79328 78564 gene locus_tag LOCUS_76010 79328 78564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 protein_id gnl|my_center|LOCUS_76010 80302 79325 gene locus_tag LOCUS_76020 80302 79325 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 protein_id gnl|my_center|LOCUS_76020 80699 82039 gene locus_tag LOCUS_76030 80699 82039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76030 82044 83477 gene locus_tag LOCUS_76040 82044 83477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76040 83868 85442 gene locus_tag LOCUS_76050 83868 85442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76050 85468 87084 gene locus_tag LOCUS_76060 85468 87084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76060 87363 88691 gene locus_tag LOCUS_76070 87363 88691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76070 89117 88707 gene locus_tag LOCUS_76080 89117 88707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76080 90259 89153 gene locus_tag LOCUS_76090 90259 89153 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225761.1 protein_id gnl|my_center|LOCUS_76090 >Feature sequence52 1135 353 gene locus_tag LOCUS_76100 1135 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76100 2685 2071 gene locus_tag LOCUS_76110 2685 2071 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971926.1 protein_id gnl|my_center|LOCUS_76110 2781 3347 gene locus_tag LOCUS_76120 2781 3347 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870827.1 protein_id gnl|my_center|LOCUS_76120 3520 3732 gene locus_tag LOCUS_76130 3520 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76130 >Feature sequence53 934 500 gene locus_tag LOCUS_76140 934 500 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_76140 1636 1319 gene locus_tag LOCUS_76150 1636 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76150 2056 2361 gene locus_tag LOCUS_76160 2056 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76160 4831 2522 gene locus_tag LOCUS_76170 4831 2522 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_76170 4961 5989 gene locus_tag LOCUS_76180 4961 5989 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_76180 6061 6234 gene locus_tag LOCUS_76190 6061 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76190 7898 6474 gene locus_tag LOCUS_76200 7898 6474 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226634.1 protein_id gnl|my_center|LOCUS_76200 8461 7895 gene locus_tag LOCUS_76210 8461 7895 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226757.1 protein_id gnl|my_center|LOCUS_76210 8742 9128 gene locus_tag LOCUS_76220 8742 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76220 10210 9125 gene locus_tag LOCUS_76230 10210 9125 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028949.1 protein_id gnl|my_center|LOCUS_76230 10311 11495 gene locus_tag LOCUS_76240 10311 11495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76240 12328 11810 gene locus_tag LOCUS_76250 12328 11810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76250 13059 12418 gene locus_tag LOCUS_76260 13059 12418 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285503.1 protein_id gnl|my_center|LOCUS_76260 13611 13264 gene locus_tag LOCUS_76270 13611 13264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76270 14210 13818 gene locus_tag LOCUS_76280 14210 13818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76280 14399 15244 gene locus_tag LOCUS_76290 14399 15244 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226941.1 protein_id gnl|my_center|LOCUS_76290 15545 16135 gene locus_tag LOCUS_76300 15545 16135 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972709.1 protein_id gnl|my_center|LOCUS_76300 17461 16541 gene locus_tag LOCUS_76310 17461 16541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028200.1 protein_id gnl|my_center|LOCUS_76310 17947 17555 gene locus_tag LOCUS_76320 17947 17555 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729797.1 protein_id gnl|my_center|LOCUS_76320 18117 19052 gene locus_tag LOCUS_76330 18117 19052 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729798.1 protein_id gnl|my_center|LOCUS_76330 19540 19142 gene locus_tag LOCUS_76340 19540 19142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76340 19939 19577 gene locus_tag LOCUS_76350 19939 19577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76350 20628 20194 gene locus_tag LOCUS_76360 20628 20194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76360 20941 21705 gene locus_tag LOCUS_76370 20941 21705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76370 22392 22051 gene locus_tag LOCUS_76380 22392 22051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76380 22675 24105 gene locus_tag LOCUS_76390 22675 24105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76390 24102 24668 gene locus_tag LOCUS_76400 24102 24668 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027345.1 protein_id gnl|my_center|LOCUS_76400 25638 24934 gene locus_tag LOCUS_76410 25638 24934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976844.1 protein_id gnl|my_center|LOCUS_76410 25887 26333 gene locus_tag LOCUS_76420 25887 26333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76420 26948 26881 gene locus_tag LOCUS_t00700 26948 26881 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 27595 26993 gene locus_tag LOCUS_76430 27595 26993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76430 28180 27725 gene locus_tag LOCUS_76440 28180 27725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76440 29205 28963 gene locus_tag LOCUS_76450 29205 28963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76450 29609 29397 gene locus_tag LOCUS_76460 29609 29397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76460 30036 29620 gene locus_tag LOCUS_76470 30036 29620 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729797.1 protein_id gnl|my_center|LOCUS_76470 30319 31212 gene locus_tag LOCUS_76480 30319 31212 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402219.1 protein_id gnl|my_center|LOCUS_76480 31603 32361 gene locus_tag LOCUS_76490 31603 32361 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230740.1 protein_id gnl|my_center|LOCUS_76490 32899 32477 gene locus_tag LOCUS_76500 32899 32477 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087865.1 protein_id gnl|my_center|LOCUS_76500 33021 33785 gene locus_tag LOCUS_76510 33021 33785 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_76510 34531 34013 gene locus_tag LOCUS_76520 34531 34013 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089439.1 protein_id gnl|my_center|LOCUS_76520 35294 34623 gene locus_tag LOCUS_76530 35294 34623 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028048.1 protein_id gnl|my_center|LOCUS_76530 35382 35552 gene locus_tag LOCUS_76540 35382 35552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76540 36690 35584 gene locus_tag LOCUS_76550 36690 35584 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_76550 36804 37283 gene locus_tag LOCUS_76560 36804 37283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76560 37504 38124 gene locus_tag LOCUS_76570 37504 38124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76570 38163 38702 gene locus_tag LOCUS_76580 38163 38702 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027345.1 protein_id gnl|my_center|LOCUS_76580 38872 39837 gene locus_tag LOCUS_76590 38872 39837 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029137.1 protein_id gnl|my_center|LOCUS_76590 39830 41032 gene locus_tag LOCUS_76600 39830 41032 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029136.1 protein_id gnl|my_center|LOCUS_76600 41038 42330 gene locus_tag LOCUS_76610 41038 42330 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029135.1 protein_id gnl|my_center|LOCUS_76610 42327 43001 gene locus_tag LOCUS_76620 42327 43001 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_76620 43274 43020 gene locus_tag LOCUS_76630 43274 43020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76630 44146 43463 gene locus_tag LOCUS_76640 44146 43463 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975521.1 protein_id gnl|my_center|LOCUS_76640 44208 45647 gene locus_tag LOCUS_76650 44208 45647 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031600.1 protein_id gnl|my_center|LOCUS_76650 46673 45693 gene locus_tag LOCUS_76660 46673 45693 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_76660 46903 46670 gene locus_tag LOCUS_76670 46903 46670 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_76670 47373 46897 gene locus_tag LOCUS_76680 47373 46897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223906.1 protein_id gnl|my_center|LOCUS_76680 47907 47494 gene locus_tag LOCUS_76690 47907 47494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76690 48088 48906 gene locus_tag LOCUS_76700 48088 48906 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_76700 49564 48941 gene locus_tag LOCUS_76710 49564 48941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76710 50591 49683 gene locus_tag LOCUS_76720 50591 49683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049871458.1 protein_id gnl|my_center|LOCUS_76720 50793 52466 gene locus_tag LOCUS_76730 50793 52466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76730 53140 52484 gene locus_tag LOCUS_76740 53140 52484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76740 53183 53261 gene locus_tag LOCUS_t00710 53183 53261 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 53940 53275 gene locus_tag LOCUS_76750 53940 53275 CDS product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727524.1 protein_id gnl|my_center|LOCUS_76750 54337 55239 gene locus_tag LOCUS_76760 54337 55239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76760 55559 56374 gene locus_tag LOCUS_76770 55559 56374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76770 57396 56497 gene locus_tag LOCUS_76780 57396 56497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76780 57804 58709 gene locus_tag LOCUS_76790 57804 58709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76790 59381 58716 gene locus_tag LOCUS_76800 59381 58716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76800 59675 61084 gene locus_tag LOCUS_76810 59675 61084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76810 61171 62454 gene locus_tag LOCUS_76820 61171 62454 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227739.1 protein_id gnl|my_center|LOCUS_76820 62451 63509 gene locus_tag LOCUS_76830 62451 63509 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227740.1 protein_id gnl|my_center|LOCUS_76830 63708 65804 gene locus_tag LOCUS_76840 63708 65804 CDS product SGNH hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624217.1 protein_id gnl|my_center|LOCUS_76840 65919 66212 gene locus_tag LOCUS_76850 65919 66212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76850 66386 66850 gene locus_tag LOCUS_76860 66386 66850 CDS product DUF1348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 protein_id gnl|my_center|LOCUS_76860 67713 66895 gene locus_tag LOCUS_76870 67713 66895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229827.1 protein_id gnl|my_center|LOCUS_76870 67913 68620 gene locus_tag LOCUS_76880 67913 68620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76880 68637 68975 gene locus_tag LOCUS_76890 68637 68975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76890 69038 71254 gene locus_tag LOCUS_76900 69038 71254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76900 71571 71299 gene locus_tag LOCUS_76910 71571 71299 CDS product DUF1876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408522.1 protein_id gnl|my_center|LOCUS_76910 71684 72529 gene locus_tag LOCUS_76920 71684 72529 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_76920 73231 72536 gene locus_tag LOCUS_76930 73231 72536 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978707.1 protein_id gnl|my_center|LOCUS_76930 73819 73376 gene locus_tag LOCUS_76940 73819 73376 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079498.1 protein_id gnl|my_center|LOCUS_76940 74475 73873 gene locus_tag LOCUS_76950 74475 73873 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 protein_id gnl|my_center|LOCUS_76950 74747 74418 gene locus_tag LOCUS_76960 74747 74418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76960 74891 75625 gene locus_tag LOCUS_76970 74891 75625 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081930.1 protein_id gnl|my_center|LOCUS_76970 75792 76406 gene locus_tag LOCUS_76980 75792 76406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76980 76836 76426 gene locus_tag LOCUS_76990 76836 76426 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974764.1 protein_id gnl|my_center|LOCUS_76990 76938 77762 gene locus_tag LOCUS_77000 76938 77762 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028257.1 protein_id gnl|my_center|LOCUS_77000 77927 81820 gene locus_tag LOCUS_77010 gene hrpA 77927 81820 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_77010 81911 82591 gene locus_tag LOCUS_77020 81911 82591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77020 82760 83566 gene locus_tag LOCUS_77030 82760 83566 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027230.1 protein_id gnl|my_center|LOCUS_77030 83965 84705 gene locus_tag LOCUS_77040 83965 84705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77040 85705 84959 gene locus_tag LOCUS_77050 85705 84959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77050 >Feature sequence54 642 226 gene locus_tag LOCUS_77060 642 226 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730338.1 protein_id gnl|my_center|LOCUS_77060 1336 695 gene locus_tag LOCUS_77070 1336 695 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_77070 2909 1473 gene locus_tag LOCUS_77080 2909 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77080 3393 4442 gene locus_tag LOCUS_77090 3393 4442 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027358.1 protein_id gnl|my_center|LOCUS_77090 5818 4481 gene locus_tag LOCUS_77100 5818 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77100 6538 5993 gene locus_tag LOCUS_77110 6538 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972776.1 protein_id gnl|my_center|LOCUS_77110 8295 6547 gene locus_tag LOCUS_77120 8295 6547 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030684.1 protein_id gnl|my_center|LOCUS_77120 8427 8813 gene locus_tag LOCUS_77130 8427 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77130 9066 9254 gene locus_tag LOCUS_77140 9066 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77140 9920 11101 gene locus_tag LOCUS_77150 9920 11101 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730643.1 protein_id gnl|my_center|LOCUS_77150 12547 11192 gene locus_tag LOCUS_77160 12547 11192 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_77160 13337 12660 gene locus_tag LOCUS_77170 13337 12660 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_77170 13755 14015 gene locus_tag LOCUS_77180 13755 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77180 14152 15627 gene locus_tag LOCUS_77190 14152 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77190 17942 15636 gene locus_tag LOCUS_77200 17942 15636 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225496.1 protein_id gnl|my_center|LOCUS_77200 18934 17939 gene locus_tag LOCUS_77210 18934 17939 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225497.1 protein_id gnl|my_center|LOCUS_77210 19470 18931 gene locus_tag LOCUS_77220 19470 18931 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225498.1 protein_id gnl|my_center|LOCUS_77220 19595 20293 gene locus_tag LOCUS_77230 19595 20293 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225499.1 protein_id gnl|my_center|LOCUS_77230 20624 20262 gene locus_tag LOCUS_77240 20624 20262 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224159.1 protein_id gnl|my_center|LOCUS_77240 22116 20734 gene locus_tag LOCUS_77250 22116 20734 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230107.1 protein_id gnl|my_center|LOCUS_77250 24161 22320 gene locus_tag LOCUS_77260 24161 22320 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284089.1 protein_id gnl|my_center|LOCUS_77260 25696 24401 gene locus_tag LOCUS_77270 25696 24401 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525362.1 protein_id gnl|my_center|LOCUS_77270 26237 26410 gene locus_tag LOCUS_77280 26237 26410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77280 26743 26528 gene locus_tag LOCUS_77290 26743 26528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77290 26633 28717 gene locus_tag LOCUS_77300 26633 28717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77300 28805 30019 gene locus_tag LOCUS_77310 28805 30019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77310 30022 33912 gene locus_tag LOCUS_77320 30022 33912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77320 34673 33915 gene locus_tag LOCUS_77330 34673 33915 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200823401.1 protein_id gnl|my_center|LOCUS_77330 36301 34985 gene locus_tag LOCUS_77340 36301 34985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084962.1 protein_id gnl|my_center|LOCUS_77340 36702 36310 gene locus_tag LOCUS_77350 36702 36310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77350 37705 36761 gene locus_tag LOCUS_77360 37705 36761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77360 40015 37916 gene locus_tag LOCUS_77370 40015 37916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77370 40382 40212 gene locus_tag LOCUS_77380 40382 40212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77380 40831 40743 gene locus_tag LOCUS_t00720 40831 40743 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41049 42359 gene locus_tag LOCUS_77390 41049 42359 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_77390 42454 43074 gene locus_tag LOCUS_77400 42454 43074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77400 43286 45241 gene locus_tag LOCUS_77410 43286 45241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77410 45757 45572 gene locus_tag LOCUS_77420 45757 45572 CDS product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977152.1 protein_id gnl|my_center|LOCUS_77420 45942 48716 gene locus_tag LOCUS_77430 gene topA 45942 48716 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_77430 48800 50164 gene locus_tag LOCUS_77440 48800 50164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77440 50431 52404 gene locus_tag LOCUS_77450 50431 52404 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230508.1 protein_id gnl|my_center|LOCUS_77450 52992 54176 gene locus_tag LOCUS_77460 52992 54176 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_77460 54357 55190 gene locus_tag LOCUS_77470 54357 55190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77470 55187 56731 gene locus_tag LOCUS_77480 55187 56731 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_77480 56818 56894 gene locus_tag LOCUS_t00730 56818 56894 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 57132 56962 gene locus_tag LOCUS_77490 57132 56962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77490 57831 58151 gene locus_tag LOCUS_77500 57831 58151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77500 >Feature sequence55 721 113 gene locus_tag LOCUS_77510 721 113 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486466.1 protein_id gnl|my_center|LOCUS_77510 1852 839 gene locus_tag LOCUS_77520 1852 839 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225254.1 protein_id gnl|my_center|LOCUS_77520 3438 2014 gene locus_tag LOCUS_77530 3438 2014 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_77530 4453 3635 gene locus_tag LOCUS_77540 4453 3635 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971512.1 protein_id gnl|my_center|LOCUS_77540 4916 4461 gene locus_tag LOCUS_77550 4916 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77550 5052 6674 gene locus_tag LOCUS_77560 5052 6674 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226873.1 protein_id gnl|my_center|LOCUS_77560 6804 7727 gene locus_tag LOCUS_77570 6804 7727 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_77570 8327 7809 gene locus_tag LOCUS_77580 8327 7809 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862546.1 protein_id gnl|my_center|LOCUS_77580 8457 9917 gene locus_tag LOCUS_77590 8457 9917 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_77590 10728 10045 gene locus_tag LOCUS_77600 10728 10045 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228368.1 protein_id gnl|my_center|LOCUS_77600 10804 11448 gene locus_tag LOCUS_77610 10804 11448 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467496.1 protein_id gnl|my_center|LOCUS_77610 11466 12155 gene locus_tag LOCUS_77620 11466 12155 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222233.1 protein_id gnl|my_center|LOCUS_77620 12300 12148 gene locus_tag LOCUS_77630 12300 12148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77630 12783 12322 gene locus_tag LOCUS_77640 12783 12322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77640 13009 13758 gene locus_tag LOCUS_77650 13009 13758 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_77650 14613 13780 gene locus_tag LOCUS_77660 14613 13780 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_77660 15573 14737 gene locus_tag LOCUS_77670 15573 14737 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226056.1 protein_id gnl|my_center|LOCUS_77670 15730 16146 gene locus_tag LOCUS_77680 15730 16146 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729021.1 protein_id gnl|my_center|LOCUS_77680 16387 17046 gene locus_tag LOCUS_77690 16387 17046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77690 17190 17558 gene locus_tag LOCUS_77700 17190 17558 CDS product ClpX C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226927.1 protein_id gnl|my_center|LOCUS_77700 18874 18062 gene locus_tag LOCUS_77710 18874 18062 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_77710 19752 18991 gene locus_tag LOCUS_77720 gene fabG 19752 18991 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_77720 20604 19960 gene locus_tag LOCUS_77730 20604 19960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77730 20789 21655 gene locus_tag LOCUS_77740 20789 21655 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223929.1 protein_id gnl|my_center|LOCUS_77740 21652 22062 gene locus_tag LOCUS_77750 21652 22062 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005123490.1 protein_id gnl|my_center|LOCUS_77750 22125 23264 gene locus_tag LOCUS_77760 22125 23264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77760 23369 24580 gene locus_tag LOCUS_77770 23369 24580 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031624.1 protein_id gnl|my_center|LOCUS_77770 24640 25149 gene locus_tag LOCUS_77780 24640 25149 CDS product HAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028507.1 protein_id gnl|my_center|LOCUS_77780 25371 25171 gene locus_tag LOCUS_77790 25371 25171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77790 >Feature sequence56 132 758 gene locus_tag LOCUS_77800 132 758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230956.1 protein_id gnl|my_center|LOCUS_77800 755 2314 gene locus_tag LOCUS_77810 755 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77810 3052 2444 gene locus_tag LOCUS_77820 3052 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77820 2940 3158 gene locus_tag LOCUS_77830 2940 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77830 4454 3177 gene locus_tag LOCUS_77840 4454 3177 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027197.1 protein_id gnl|my_center|LOCUS_77840 5050 4451 gene locus_tag LOCUS_77850 5050 4451 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_77850 5226 5708 gene locus_tag LOCUS_77860 5226 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77860 5766 6365 gene locus_tag LOCUS_77870 5766 6365 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029464.1 protein_id gnl|my_center|LOCUS_77870 6362 7210 gene locus_tag LOCUS_77880 6362 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974822.1 protein_id gnl|my_center|LOCUS_77880 7195 8052 gene locus_tag LOCUS_77890 7195 8052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029465.1 protein_id gnl|my_center|LOCUS_77890 8049 9527 gene locus_tag LOCUS_77900 8049 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77900 9518 10219 gene locus_tag LOCUS_77910 9518 10219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77910 10644 10300 gene locus_tag LOCUS_77920 10644 10300 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234476.1 protein_id gnl|my_center|LOCUS_77920 10725 11714 gene locus_tag LOCUS_77930 10725 11714 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142819.1 protein_id gnl|my_center|LOCUS_77930 11743 12366 gene locus_tag LOCUS_77940 11743 12366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77940 13413 12397 gene locus_tag LOCUS_77950 13413 12397 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227740.1 protein_id gnl|my_center|LOCUS_77950 14741 13410 gene locus_tag LOCUS_77960 14741 13410 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103941653.1 protein_id gnl|my_center|LOCUS_77960 15630 14743 gene locus_tag LOCUS_77970 15630 14743 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227738.1 protein_id gnl|my_center|LOCUS_77970 15890 16291 gene locus_tag LOCUS_77980 15890 16291 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229959.1 protein_id gnl|my_center|LOCUS_77980 16693 16373 gene locus_tag LOCUS_77990 16693 16373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776245.1 protein_id gnl|my_center|LOCUS_77990 17484 16768 gene locus_tag LOCUS_78000 17484 16768 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_78000 18802 17774 gene locus_tag LOCUS_78010 18802 17774 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_78010 18975 19844 gene locus_tag LOCUS_78020 18975 19844 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467732.1 protein_id gnl|my_center|LOCUS_78020 21169 19883 gene locus_tag LOCUS_78030 21169 19883 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227115.1 protein_id gnl|my_center|LOCUS_78030 21231 21743 gene locus_tag LOCUS_78040 gene tamR 21231 21743 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_78040 22558 21791 gene locus_tag LOCUS_78050 gene map 22558 21791 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972570.1 protein_id gnl|my_center|LOCUS_78050 22632 22892 gene locus_tag LOCUS_78060 22632 22892 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972569.1 protein_id gnl|my_center|LOCUS_78060 23976 22981 gene locus_tag LOCUS_78070 23976 22981 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392461.1 protein_id gnl|my_center|LOCUS_78070 25135 24167 gene locus_tag LOCUS_78080 25135 24167 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015613.1 protein_id gnl|my_center|LOCUS_78080 25991 25161 gene locus_tag LOCUS_78090 25991 25161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383246.1 protein_id gnl|my_center|LOCUS_78090 27019 25991 gene locus_tag LOCUS_78100 27019 25991 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009675.1 protein_id gnl|my_center|LOCUS_78100 28026 27028 gene locus_tag LOCUS_78110 28026 27028 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_78110 28103 28354 gene locus_tag LOCUS_78120 28103 28354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78120 29064 28300 gene locus_tag LOCUS_78130 29064 28300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78130 >Feature sequence57 985 23 gene locus_tag LOCUS_78140 985 23 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226103.1 protein_id gnl|my_center|LOCUS_78140 1819 1115 gene locus_tag LOCUS_78150 1819 1115 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112720.1 protein_id gnl|my_center|LOCUS_78150 2612 1836 gene locus_tag LOCUS_78160 gene pstB 2612 1836 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974830.1 protein_id gnl|my_center|LOCUS_78160 3500 2616 gene locus_tag LOCUS_78170 gene pstA 3500 2616 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_78170 4477 3497 gene locus_tag LOCUS_78180 gene pstC 4477 3497 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029460.1 protein_id gnl|my_center|LOCUS_78180 5589 4483 gene locus_tag LOCUS_78190 gene pstS 5589 4483 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974827.1 protein_id gnl|my_center|LOCUS_78190 5733 6209 gene locus_tag LOCUS_78200 5733 6209 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_78200 6343 7017 gene locus_tag LOCUS_78210 6343 7017 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_78210 7878 7093 gene locus_tag LOCUS_78220 gene hisN 7878 7093 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_78220 7959 8396 gene locus_tag LOCUS_78230 7959 8396 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977512.1 protein_id gnl|my_center|LOCUS_78230 9506 8412 gene locus_tag LOCUS_78240 gene rsgA 9506 8412 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 protein_id gnl|my_center|LOCUS_78240 10854 9550 gene locus_tag LOCUS_78250 gene aroA 10854 9550 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_78250 10929 11699 gene locus_tag LOCUS_78260 10929 11699 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_78260 11837 12169 gene locus_tag LOCUS_78270 11837 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78270 12939 12166 gene locus_tag LOCUS_78280 12939 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78280 13066 13794 gene locus_tag LOCUS_78290 gene sigR 13066 13794 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_78290 13791 14057 gene locus_tag LOCUS_78300 gene rsrA 13791 14057 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973755.1 protein_id gnl|my_center|LOCUS_78300 14092 15003 gene locus_tag LOCUS_78310 14092 15003 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113113.1 protein_id gnl|my_center|LOCUS_78310 15324 16676 gene locus_tag LOCUS_78320 15324 16676 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030117.1 protein_id gnl|my_center|LOCUS_78320 16673 17947 gene locus_tag LOCUS_78330 16673 17947 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495247.1 protein_id gnl|my_center|LOCUS_78330 18076 18465 gene locus_tag LOCUS_78340 18076 18465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78340 18992 18615 gene locus_tag LOCUS_78350 18992 18615 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_78350 21013 19367 gene locus_tag LOCUS_78360 21013 19367 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908709.1 protein_id gnl|my_center|LOCUS_78360 22142 21102 gene locus_tag LOCUS_78370 gene bioB 22142 21102 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057907.1 protein_id gnl|my_center|LOCUS_78370 22864 22139 gene locus_tag LOCUS_78380 gene bioD 22864 22139 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742103.1 protein_id gnl|my_center|LOCUS_78380 23606 22878 gene locus_tag LOCUS_78390 23606 22878 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973740.1 protein_id gnl|my_center|LOCUS_78390 24754 23603 gene locus_tag LOCUS_78400 24754 23603 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728881.1 protein_id gnl|my_center|LOCUS_78400 24772 26313 gene locus_tag LOCUS_78410 24772 26313 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_78410 26580 26326 gene locus_tag LOCUS_78420 26580 26326 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_78420 27860 26868 gene locus_tag LOCUS_78430 27860 26868 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_78430 27942 28394 gene locus_tag LOCUS_78440 27942 28394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030132.1 protein_id gnl|my_center|LOCUS_78440 29186 28407 gene locus_tag LOCUS_78450 29186 28407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78450 29629 29204 gene locus_tag LOCUS_78460 29629 29204 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_78460 30284 29853 gene locus_tag LOCUS_78470 gene sodN 30284 29853 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_78470 30338 30649 gene locus_tag LOCUS_78480 30338 30649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78480 31149 30607 gene locus_tag LOCUS_78490 31149 30607 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 protein_id gnl|my_center|LOCUS_78490 31440 32603 gene locus_tag LOCUS_78500 31440 32603 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_78500 32928 34280 gene locus_tag LOCUS_78510 32928 34280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029632.1 protein_id gnl|my_center|LOCUS_78510 34338 35063 gene locus_tag LOCUS_78520 34338 35063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78520 35120 36082 gene locus_tag LOCUS_78530 35120 36082 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228445.1 protein_id gnl|my_center|LOCUS_78530 36262 36122 gene locus_tag LOCUS_78540 36262 36122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78540 37081 36290 gene locus_tag LOCUS_78550 37081 36290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78550 37899 37078 gene locus_tag LOCUS_78560 37899 37078 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486398.1 protein_id gnl|my_center|LOCUS_78560 38210 38037 gene locus_tag LOCUS_78570 38210 38037 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_78570 41885 38283 gene locus_tag LOCUS_78580 41885 38283 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_78580 42914 42273 gene locus_tag LOCUS_78590 42914 42273 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366894.1 protein_id gnl|my_center|LOCUS_78590 43003 43563 gene locus_tag LOCUS_78600 43003 43563 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230395.1 protein_id gnl|my_center|LOCUS_78600 43859 45121 gene locus_tag LOCUS_78610 43859 45121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78610 45175 46242 gene locus_tag LOCUS_78620 45175 46242 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173480.1 protein_id gnl|my_center|LOCUS_78620 46543 47169 gene locus_tag LOCUS_78630 46543 47169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78630 47198 47857 gene locus_tag LOCUS_78640 47198 47857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78640 48984 47926 gene locus_tag LOCUS_78650 48984 47926 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 protein_id gnl|my_center|LOCUS_78650 49197 50093 gene locus_tag LOCUS_78660 49197 50093 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876665.1 protein_id gnl|my_center|LOCUS_78660 52716 50350 gene locus_tag LOCUS_78670 52716 50350 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027316.1 protein_id gnl|my_center|LOCUS_78670 53456 52716 gene locus_tag LOCUS_78680 53456 52716 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978139.1 protein_id gnl|my_center|LOCUS_78680 53650 54837 gene locus_tag LOCUS_78690 53650 54837 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_78690 >Feature sequence58 7 363 gene locus_tag LOCUS_78700 7 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78700 3641 1044 gene locus_tag LOCUS_78710 3641 1044 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_78710 4191 6236 gene locus_tag LOCUS_78720 4191 6236 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031595.1 protein_id gnl|my_center|LOCUS_78720 6268 8001 gene locus_tag LOCUS_78730 gene treS 6268 8001 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031594.1 protein_id gnl|my_center|LOCUS_78730 7998 9347 gene locus_tag LOCUS_78740 7998 9347 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224469.1 protein_id gnl|my_center|LOCUS_78740 9424 11565 gene locus_tag LOCUS_78750 gene glgB 9424 11565 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_78750 12054 13745 gene locus_tag LOCUS_78760 gene sppA 12054 13745 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727691.1 protein_id gnl|my_center|LOCUS_78760 13762 14292 gene locus_tag LOCUS_78770 gene aac(2')-Ie 13762 14292 CDS product aminoglycoside N-acetyltransferase AAC(2')-Ie inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908954.1 protein_id gnl|my_center|LOCUS_78770 14405 14959 gene locus_tag LOCUS_78780 14405 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78780 14956 15819 gene locus_tag LOCUS_78790 14956 15819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78790 16330 15839 gene locus_tag LOCUS_78800 16330 15839 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109035270.1 protein_id gnl|my_center|LOCUS_78800 17631 16717 gene locus_tag LOCUS_78810 17631 16717 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020544063.1 protein_id gnl|my_center|LOCUS_78810 18330 17668 gene locus_tag LOCUS_78820 18330 17668 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 protein_id gnl|my_center|LOCUS_78820 19004 18327 gene locus_tag LOCUS_78830 19004 18327 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972858.1 protein_id gnl|my_center|LOCUS_78830 20077 19001 gene locus_tag LOCUS_78840 20077 19001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972859.1 protein_id gnl|my_center|LOCUS_78840 20388 21695 gene locus_tag LOCUS_78850 20388 21695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78850 23021 21849 gene locus_tag LOCUS_78860 23021 21849 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_78860 23574 23149 gene locus_tag LOCUS_78870 23574 23149 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224383.1 protein_id gnl|my_center|LOCUS_78870 24497 23574 gene locus_tag LOCUS_78880 24497 23574 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224382.1 protein_id gnl|my_center|LOCUS_78880 25764 24592 gene locus_tag LOCUS_78890 25764 24592 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730958.1 protein_id gnl|my_center|LOCUS_78890 26834 25764 gene locus_tag LOCUS_78900 26834 25764 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224380.1 protein_id gnl|my_center|LOCUS_78900 27145 27747 gene locus_tag LOCUS_78910 27145 27747 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976494.1 protein_id gnl|my_center|LOCUS_78910 27837 28997 gene locus_tag LOCUS_78920 27837 28997 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224421.1 protein_id gnl|my_center|LOCUS_78920 29935 29033 gene locus_tag LOCUS_78930 29935 29033 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877762.1 protein_id gnl|my_center|LOCUS_78930 30174 30845 gene locus_tag LOCUS_78940 30174 30845 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223733.1 protein_id gnl|my_center|LOCUS_78940 31880 30846 gene locus_tag LOCUS_78950 31880 30846 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974245.1 protein_id gnl|my_center|LOCUS_78950 31984 32943 gene locus_tag LOCUS_78960 31984 32943 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000362.1 protein_id gnl|my_center|LOCUS_78960 33758 32886 gene locus_tag LOCUS_78970 33758 32886 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223735.1 protein_id gnl|my_center|LOCUS_78970 34802 33888 gene locus_tag LOCUS_78980 34802 33888 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223734.1 protein_id gnl|my_center|LOCUS_78980 35104 34799 gene locus_tag LOCUS_78990 35104 34799 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803725.1 protein_id gnl|my_center|LOCUS_78990 35894 35142 gene locus_tag LOCUS_79000 35894 35142 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027048.1 protein_id gnl|my_center|LOCUS_79000 37204 35930 gene locus_tag LOCUS_79010 37204 35930 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876247.1 protein_id gnl|my_center|LOCUS_79010 38094 37237 gene locus_tag LOCUS_79020 38094 37237 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028618.1 protein_id gnl|my_center|LOCUS_79020 38350 39552 gene locus_tag LOCUS_79030 38350 39552 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020115335.1 protein_id gnl|my_center|LOCUS_79030 39897 40865 gene locus_tag LOCUS_79040 39897 40865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79040 42149 41124 gene locus_tag LOCUS_79050 gene gmd 42149 41124 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284917.1 protein_id gnl|my_center|LOCUS_79050 42409 43653 gene locus_tag LOCUS_79060 42409 43653 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_79060 43735 44448 gene locus_tag LOCUS_79070 43735 44448 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_79070 44445 45506 gene locus_tag LOCUS_79080 44445 45506 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_79080 46197 45613 gene locus_tag LOCUS_79090 46197 45613 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192781106.1 protein_id gnl|my_center|LOCUS_79090 46517 47011 gene locus_tag LOCUS_79100 46517 47011 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726631.1 protein_id gnl|my_center|LOCUS_79100 47112 47306 gene locus_tag LOCUS_79110 47112 47306 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062259.1 protein_id gnl|my_center|LOCUS_79110 47357 48442 gene locus_tag LOCUS_79120 47357 48442 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_79120 >Feature sequence59 886 1380 gene locus_tag LOCUS_79130 886 1380 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085913.1 protein_id gnl|my_center|LOCUS_79130 2449 1370 gene locus_tag LOCUS_79140 2449 1370 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169618726.1 protein_id gnl|my_center|LOCUS_79140 2829 2455 gene locus_tag LOCUS_79150 2829 2455 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357080.1 protein_id gnl|my_center|LOCUS_79150 3427 2840 gene locus_tag LOCUS_79160 3427 2840 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063830.1 protein_id gnl|my_center|LOCUS_79160 3641 4465 gene locus_tag LOCUS_79170 3641 4465 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229343.1 protein_id gnl|my_center|LOCUS_79170 4940 4512 gene locus_tag LOCUS_79180 4940 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79180 5326 4961 gene locus_tag LOCUS_79190 5326 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79190 5594 6412 gene locus_tag LOCUS_79200 5594 6412 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115127.1 protein_id gnl|my_center|LOCUS_79200 6576 6968 gene locus_tag LOCUS_79210 6576 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79210 7059 7559 gene locus_tag LOCUS_79220 7059 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79220 7578 8255 gene locus_tag LOCUS_79230 7578 8255 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_79230 8252 9658 gene locus_tag LOCUS_79240 8252 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79240 10417 9680 gene locus_tag LOCUS_79250 10417 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79250 10574 11407 gene locus_tag LOCUS_79260 10574 11407 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727421.1 protein_id gnl|my_center|LOCUS_79260 11915 11457 gene locus_tag LOCUS_79270 11915 11457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977365.1 protein_id gnl|my_center|LOCUS_79270 12338 11970 gene locus_tag LOCUS_79280 12338 11970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79280 12561 12319 gene locus_tag LOCUS_79290 12561 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79290 13415 12558 gene locus_tag LOCUS_79300 13415 12558 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030972.1 protein_id gnl|my_center|LOCUS_79300 13932 13408 gene locus_tag LOCUS_79310 13932 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79310 14333 13938 gene locus_tag LOCUS_79320 14333 13938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79320 14571 14338 gene locus_tag LOCUS_79330 14571 14338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79330 15382 14597 gene locus_tag LOCUS_79340 15382 14597 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972477.1 protein_id gnl|my_center|LOCUS_79340 15794 15384 gene locus_tag LOCUS_79350 15794 15384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79350 17233 15944 gene locus_tag LOCUS_79360 17233 15944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79360 17887 17240 gene locus_tag LOCUS_79370 17887 17240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79370 18185 18706 gene locus_tag LOCUS_79380 18185 18706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79380 18703 19023 gene locus_tag LOCUS_79390 18703 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79390 19020 19205 gene locus_tag LOCUS_79400 19020 19205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79400 19202 19504 gene locus_tag LOCUS_79410 19202 19504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79410 19501 20133 gene locus_tag LOCUS_79420 19501 20133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79420 20130 20732 gene locus_tag LOCUS_79430 20130 20732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79430 20937 21359 gene locus_tag LOCUS_79440 20937 21359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79440 22594 21350 gene locus_tag LOCUS_79450 22594 21350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79450 23102 22635 gene locus_tag LOCUS_79460 23102 22635 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971719.1 protein_id gnl|my_center|LOCUS_79460 24289 23132 gene locus_tag LOCUS_79470 24289 23132 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_79470 24507 25880 gene locus_tag LOCUS_79480 24507 25880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79480 26358 25921 gene locus_tag LOCUS_79490 26358 25921 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028745.1 protein_id gnl|my_center|LOCUS_79490 26526 28151 gene locus_tag LOCUS_79500 26526 28151 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730593.1 protein_id gnl|my_center|LOCUS_79500 29671 28424 gene locus_tag LOCUS_79510 29671 28424 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896733.1 protein_id gnl|my_center|LOCUS_79510 30013 29774 gene locus_tag LOCUS_79520 30013 29774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79520 31326 30097 gene locus_tag LOCUS_79530 31326 30097 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070937859.1 protein_id gnl|my_center|LOCUS_79530 31426 32019 gene locus_tag LOCUS_79540 31426 32019 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947468.1 protein_id gnl|my_center|LOCUS_79540 33196 32006 gene locus_tag LOCUS_79550 33196 32006 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226524.1 protein_id gnl|my_center|LOCUS_79550 33379 33894 gene locus_tag LOCUS_79560 33379 33894 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002136.1 protein_id gnl|my_center|LOCUS_79560 33968 34924 gene locus_tag LOCUS_79570 33968 34924 CDS product DUF1152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641995.1 protein_id gnl|my_center|LOCUS_79570 35854 35306 gene locus_tag LOCUS_79580 35854 35306 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529753.1 protein_id gnl|my_center|LOCUS_79580 36125 36733 gene locus_tag LOCUS_79590 36125 36733 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463838.1 protein_id gnl|my_center|LOCUS_79590 36819 38336 gene locus_tag LOCUS_79600 36819 38336 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975611.1 protein_id gnl|my_center|LOCUS_79600 40932 38449 gene locus_tag LOCUS_79610 gene valS 40932 38449 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_79610 41288 42364 gene locus_tag LOCUS_79620 41288 42364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79620 42605 42372 gene locus_tag LOCUS_79630 42605 42372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79630 42493 42906 gene locus_tag LOCUS_79640 42493 42906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79640 43029 44741 gene locus_tag LOCUS_79650 43029 44741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79650 45672 44806 gene locus_tag LOCUS_79660 45672 44806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79660 46652 45669 gene locus_tag LOCUS_79670 46652 45669 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_79670 46720 47376 gene locus_tag LOCUS_79680 46720 47376 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226070.1 protein_id gnl|my_center|LOCUS_79680 >Feature sequence60 641 93 gene locus_tag LOCUS_79690 641 93 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222249.1 protein_id gnl|my_center|LOCUS_79690 710 1621 gene locus_tag LOCUS_79700 710 1621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222248.1 protein_id gnl|my_center|LOCUS_79700 1618 3225 gene locus_tag LOCUS_79710 1618 3225 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228541.1 protein_id gnl|my_center|LOCUS_79710 3388 3822 gene locus_tag LOCUS_79720 3388 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79720 3947 5761 gene locus_tag LOCUS_79730 3947 5761 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776624.1 protein_id gnl|my_center|LOCUS_79730 5835 6863 gene locus_tag LOCUS_79740 5835 6863 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028801.1 protein_id gnl|my_center|LOCUS_79740 6860 7624 gene locus_tag LOCUS_79750 gene cbiQ 6860 7624 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_79750 7621 8388 gene locus_tag LOCUS_79760 7621 8388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_79760 8427 8771 gene locus_tag LOCUS_79770 8427 8771 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229185.1 protein_id gnl|my_center|LOCUS_79770 8805 9584 gene locus_tag LOCUS_79780 8805 9584 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063198.1 protein_id gnl|my_center|LOCUS_79780 9709 10473 gene locus_tag LOCUS_79790 9709 10473 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808209.1 protein_id gnl|my_center|LOCUS_79790 10560 11183 gene locus_tag LOCUS_79800 10560 11183 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223255.1 protein_id gnl|my_center|LOCUS_79800 11359 11844 gene locus_tag LOCUS_79810 11359 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79810 13028 11928 gene locus_tag LOCUS_79820 gene serC 13028 11928 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_79820 14502 13396 gene locus_tag LOCUS_79830 14502 13396 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_79830 14672 15331 gene locus_tag LOCUS_79840 gene pdxH 14672 15331 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522643.1 protein_id gnl|my_center|LOCUS_79840 16023 15376 gene locus_tag LOCUS_79850 16023 15376 CDS product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227026.1 protein_id gnl|my_center|LOCUS_79850 16101 16814 gene locus_tag LOCUS_79860 16101 16814 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_79860 >Feature sequence61 <1 1657 gene locus_tag LOCUS_79870 <1 1657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161102907.1:SpoIIE family protein phosphatase 1764 2540 gene locus_tag LOCUS_79880 1764 2540 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 protein_id gnl|my_center|LOCUS_79880 2580 2741 gene locus_tag LOCUS_79890 2580 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79890 3908 2763 gene locus_tag LOCUS_79900 3908 2763 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896599.1 protein_id gnl|my_center|LOCUS_79900 4842 3985 gene locus_tag LOCUS_79910 4842 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79910 5001 5837 gene locus_tag LOCUS_79920 5001 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79920 5865 6785 gene locus_tag LOCUS_79930 5865 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79930 6868 8040 gene locus_tag LOCUS_79940 6868 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79940 8185 9330 gene locus_tag LOCUS_79950 8185 9330 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897409.1 protein_id gnl|my_center|LOCUS_79950 11776 9902 gene locus_tag LOCUS_79960 11776 9902 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030396.1 protein_id gnl|my_center|LOCUS_79960 12601 11870 gene locus_tag LOCUS_79970 12601 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79970 12715 13257 gene locus_tag LOCUS_79980 12715 13257 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_79980 13241 14011 gene locus_tag LOCUS_79990 13241 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79990 15058 14036 gene locus_tag LOCUS_80000 15058 14036 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_80000 16451 15237 gene locus_tag LOCUS_80010 16451 15237 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_80010 16645 16718 gene locus_tag LOCUS_t00740 16645 16718 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 16767 17051 gene locus_tag LOCUS_80020 gene secE 16767 17051 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974317.1 protein_id gnl|my_center|LOCUS_80020 17107 17877 gene locus_tag LOCUS_80030 gene nusG 17107 17877 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222524.1 protein_id gnl|my_center|LOCUS_80030 17994 18425 gene locus_tag LOCUS_80040 gene rplK 17994 18425 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776394.1 protein_id gnl|my_center|LOCUS_80040 18572 19321 gene locus_tag LOCUS_80050 gene rplA 18572 19321 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_80050 19734 20567 gene locus_tag LOCUS_80060 19734 20567 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028543.1 protein_id gnl|my_center|LOCUS_80060 20797 21321 gene locus_tag LOCUS_80070 gene rplJ 20797 21321 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_80070 21403 21795 gene locus_tag LOCUS_80080 gene rplL 21403 21795 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403353.1 protein_id gnl|my_center|LOCUS_80080 21955 22452 gene locus_tag LOCUS_80090 21955 22452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80090 22449 22955 gene locus_tag LOCUS_80100 22449 22955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80100 >Feature sequence62 2242 827 gene locus_tag LOCUS_80110 2242 827 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197109.1 protein_id gnl|my_center|LOCUS_80110 3084 3335 gene locus_tag LOCUS_80120 3084 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80120 3996 3349 gene locus_tag LOCUS_80130 3996 3349 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729106.1 protein_id gnl|my_center|LOCUS_80130 4159 5151 gene locus_tag LOCUS_80140 4159 5151 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894933.1 protein_id gnl|my_center|LOCUS_80140 6702 5161 gene locus_tag LOCUS_80150 6702 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80150 7034 7417 gene locus_tag LOCUS_80160 7034 7417 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975801.1 protein_id gnl|my_center|LOCUS_80160 8359 7478 gene locus_tag LOCUS_80170 8359 7478 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228190.1 protein_id gnl|my_center|LOCUS_80170 8554 9546 gene locus_tag LOCUS_80180 8554 9546 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411849.1 protein_id gnl|my_center|LOCUS_80180 9575 10480 gene locus_tag LOCUS_80190 9575 10480 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230013.1 protein_id gnl|my_center|LOCUS_80190 10477 11064 gene locus_tag LOCUS_80200 10477 11064 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893937.1 protein_id gnl|my_center|LOCUS_80200 11169 11594 gene locus_tag LOCUS_80210 11169 11594 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229490.1 protein_id gnl|my_center|LOCUS_80210 12615 11611 gene locus_tag LOCUS_80220 12615 11611 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230440.1 protein_id gnl|my_center|LOCUS_80220 13063 12668 gene locus_tag LOCUS_80230 13063 12668 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728621.1 protein_id gnl|my_center|LOCUS_80230 13139 13306 gene locus_tag LOCUS_80240 13139 13306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80240 13321 13971 gene locus_tag LOCUS_80250 13321 13971 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 protein_id gnl|my_center|LOCUS_80250 15086 14040 gene locus_tag LOCUS_80260 15086 14040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80260 16345 15152 gene locus_tag LOCUS_80270 16345 15152 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226160.1 protein_id gnl|my_center|LOCUS_80270 16430 17011 gene locus_tag LOCUS_80280 16430 17011 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222865.1 protein_id gnl|my_center|LOCUS_80280 17356 17907 gene locus_tag LOCUS_80290 17356 17907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80290 19016 17913 gene locus_tag LOCUS_80300 19016 17913 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230996.1 protein_id gnl|my_center|LOCUS_80300 19136 20368 gene locus_tag LOCUS_80310 19136 20368 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804430.1 protein_id gnl|my_center|LOCUS_80310 21386 20448 gene locus_tag LOCUS_80320 21386 20448 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729296.1 protein_id gnl|my_center|LOCUS_80320 22890 21637 gene locus_tag LOCUS_80330 22890 21637 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227743.1 protein_id gnl|my_center|LOCUS_80330 23149 24036 gene locus_tag LOCUS_80340 23149 24036 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977140.1 protein_id gnl|my_center|LOCUS_80340 26177 24057 gene locus_tag LOCUS_80350 26177 24057 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111053.1 protein_id gnl|my_center|LOCUS_80350 26248 27621 gene locus_tag LOCUS_80360 26248 27621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80360 28149 27799 gene locus_tag LOCUS_80370 28149 27799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80370 30202 28475 gene locus_tag LOCUS_80380 30202 28475 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027406.1 protein_id gnl|my_center|LOCUS_80380 30317 30868 gene locus_tag LOCUS_80390 30317 30868 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_80390 31420 30893 gene locus_tag LOCUS_80400 31420 30893 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_80400 31692 33089 gene locus_tag LOCUS_80410 31692 33089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80410 >Feature sequence63 234 1202 gene locus_tag LOCUS_80420 234 1202 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029709.1 protein_id gnl|my_center|LOCUS_80420 1224 2165 gene locus_tag LOCUS_80430 1224 2165 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974413.1 protein_id gnl|my_center|LOCUS_80430 2166 2360 gene locus_tag LOCUS_80440 2166 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80440 2635 3021 gene locus_tag LOCUS_80450 2635 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80450 3096 3461 gene locus_tag LOCUS_80460 3096 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80460 3509 3901 gene locus_tag LOCUS_80470 3509 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80470 3961 7239 gene locus_tag LOCUS_80480 3961 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80480 7253 7924 gene locus_tag LOCUS_80490 7253 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80490 7921 8910 gene locus_tag LOCUS_80500 7921 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80500 10458 8971 gene locus_tag LOCUS_80510 10458 8971 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_80510 11460 10525 gene locus_tag LOCUS_80520 11460 10525 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469674.1 protein_id gnl|my_center|LOCUS_80520 11793 11578 gene locus_tag LOCUS_80530 11793 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80530 13379 11790 gene locus_tag LOCUS_80540 13379 11790 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_80540 13704 14480 gene locus_tag LOCUS_80550 13704 14480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_80550 14450 16033 gene locus_tag LOCUS_80560 14450 16033 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029630.1 protein_id gnl|my_center|LOCUS_80560 16146 18782 gene locus_tag LOCUS_80570 16146 18782 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068577.1 protein_id gnl|my_center|LOCUS_80570 19726 18920 gene locus_tag LOCUS_80580 gene fdhD 19726 18920 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_80580 19887 20714 gene locus_tag LOCUS_80590 19887 20714 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_80590 20772 21284 gene locus_tag LOCUS_80600 20772 21284 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056202.1 protein_id gnl|my_center|LOCUS_80600 21354 22349 gene locus_tag LOCUS_80610 21354 22349 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029954.1 protein_id gnl|my_center|LOCUS_80610 22394 23488 gene locus_tag LOCUS_80620 22394 23488 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_80620 23590 23769 gene locus_tag LOCUS_80630 23590 23769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80630 23783 24268 gene locus_tag LOCUS_80640 gene bfr 23783 24268 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976703.1 protein_id gnl|my_center|LOCUS_80640 24604 25272 gene locus_tag LOCUS_80650 24604 25272 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 protein_id gnl|my_center|LOCUS_80650 25309 26577 gene locus_tag LOCUS_80660 gene draK 25309 26577 CDS product two-component system sensor histidine kinase DraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028744.1 protein_id gnl|my_center|LOCUS_80660 27047 26550 gene locus_tag LOCUS_80670 27047 26550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80670 27267 28244 gene locus_tag LOCUS_80680 27267 28244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80680 28323 29570 gene locus_tag LOCUS_80690 28323 29570 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219537380.1 protein_id gnl|my_center|LOCUS_80690 29563 30105 gene locus_tag LOCUS_80700 gene purE 29563 30105 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_80700 >Feature sequence64 423 154 gene locus_tag LOCUS_80710 423 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80710 1425 436 gene locus_tag LOCUS_80720 1425 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80720 1673 2029 gene locus_tag LOCUS_80730 1673 2029 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028740.1 protein_id gnl|my_center|LOCUS_80730 2293 2688 gene locus_tag LOCUS_80740 2293 2688 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974572.1 protein_id gnl|my_center|LOCUS_80740 3998 3312 gene locus_tag LOCUS_80750 3998 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80750 5279 4383 gene locus_tag LOCUS_80760 5279 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80760 6069 5389 gene locus_tag LOCUS_80770 6069 5389 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099999872.1 protein_id gnl|my_center|LOCUS_80770 6190 7575 gene locus_tag LOCUS_80780 6190 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80780 7751 11044 gene locus_tag LOCUS_80790 7751 11044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80790 10953 11279 gene locus_tag LOCUS_80800 10953 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80800 12762 11737 gene locus_tag LOCUS_80810 12762 11737 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 protein_id gnl|my_center|LOCUS_80810 16613 13077 gene locus_tag LOCUS_80820 16613 13077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80820 16686 17042 gene locus_tag LOCUS_80830 16686 17042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80830 17039 17929 gene locus_tag LOCUS_80840 17039 17929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80840 18411 18803 gene locus_tag LOCUS_80850 18411 18803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80850 19096 19491 gene locus_tag LOCUS_80860 19096 19491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80860 19914 20768 gene locus_tag LOCUS_80870 19914 20768 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727008.1 protein_id gnl|my_center|LOCUS_80870 20931 21806 gene locus_tag LOCUS_80880 20931 21806 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080689.1 protein_id gnl|my_center|LOCUS_80880 21874 22455 gene locus_tag LOCUS_80890 21874 22455 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222876.1 protein_id gnl|my_center|LOCUS_80890 22765 23415 gene locus_tag LOCUS_80900 22765 23415 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222233.1 protein_id gnl|my_center|LOCUS_80900 23567 23938 gene locus_tag LOCUS_80910 23567 23938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80910 24163 24513 gene locus_tag LOCUS_80920 24163 24513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80920 24878 25309 gene locus_tag LOCUS_80930 24878 25309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80930 25946 26299 gene locus_tag LOCUS_80940 25946 26299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80940 26594 27544 gene locus_tag LOCUS_80950 26594 27544 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230336.1 protein_id gnl|my_center|LOCUS_80950 28600 27764 gene locus_tag LOCUS_80960 28600 27764 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727788.1 protein_id gnl|my_center|LOCUS_80960 28632 29504 gene locus_tag LOCUS_80970 28632 29504 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727787.1 protein_id gnl|my_center|LOCUS_80970 >Feature sequence65 1620 94 gene locus_tag LOCUS_80980 1620 94 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972412.1 protein_id gnl|my_center|LOCUS_80980 3117 1777 gene locus_tag LOCUS_80990 3117 1777 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776795.1 protein_id gnl|my_center|LOCUS_80990 3384 4691 gene locus_tag LOCUS_81000 3384 4691 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776795.1 protein_id gnl|my_center|LOCUS_81000 4896 7661 gene locus_tag LOCUS_81010 4896 7661 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_81010 7750 9321 gene locus_tag LOCUS_81020 7750 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81020 9531 10685 gene locus_tag LOCUS_81030 9531 10685 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_81030 10682 11623 gene locus_tag LOCUS_81040 10682 11623 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031014.1 protein_id gnl|my_center|LOCUS_81040 11620 12492 gene locus_tag LOCUS_81050 11620 12492 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_81050 12489 13142 gene locus_tag LOCUS_81060 12489 13142 CDS product EboA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028850.1 protein_id gnl|my_center|LOCUS_81060 13142 14035 gene locus_tag LOCUS_81070 13142 14035 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031017.1 protein_id gnl|my_center|LOCUS_81070 14113 19851 gene locus_tag LOCUS_81080 14113 19851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81080 20129 21295 gene locus_tag LOCUS_81090 gene eboE 20129 21295 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028848.1 protein_id gnl|my_center|LOCUS_81090 21292 22656 gene locus_tag LOCUS_81100 21292 22656 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_81100 <23462 22835 gene locus_tag LOCUS_81110 <23462 22835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013981.1:HNH endonuclease signature motif containing protein >Feature sequence66 60 245 gene locus_tag LOCUS_81120 60 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81120 797 459 gene locus_tag LOCUS_81130 797 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81130 1135 839 gene locus_tag LOCUS_81140 1135 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81140 1807 1466 gene locus_tag LOCUS_81150 1807 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81150 3223 2003 gene locus_tag LOCUS_81160 3223 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81160 3750 4061 gene locus_tag LOCUS_81170 3750 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_81170 4990 4820 gene locus_tag LOCUS_81180 4990 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81180 5248 5078 gene locus_tag LOCUS_81190 5248 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81190 5465 6931 gene locus_tag LOCUS_81200 5465 6931 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_81200 7623 7315 gene locus_tag LOCUS_81210 7623 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81210 8328 7672 gene locus_tag LOCUS_81220 8328 7672 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227659.1 protein_id gnl|my_center|LOCUS_81220 9142 8444 gene locus_tag LOCUS_81230 9142 8444 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229004.1 protein_id gnl|my_center|LOCUS_81230 9237 9656 gene locus_tag LOCUS_81240 9237 9656 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229003.1 protein_id gnl|my_center|LOCUS_81240 10794 9724 gene locus_tag LOCUS_81250 10794 9724 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966730.1 protein_id gnl|my_center|LOCUS_81250 11292 11071 gene locus_tag LOCUS_81260 11292 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81260 11453 11872 gene locus_tag LOCUS_81270 11453 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81270 12104 12820 gene locus_tag LOCUS_81280 12104 12820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81280 12998 13126 gene locus_tag LOCUS_81290 12998 13126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81290 14214 13183 gene locus_tag LOCUS_81300 14214 13183 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140036.1 protein_id gnl|my_center|LOCUS_81300 15245 14772 gene locus_tag LOCUS_81310 15245 14772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81310 15347 16288 gene locus_tag LOCUS_81320 15347 16288 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390572.1 protein_id gnl|my_center|LOCUS_81320 17033 16524 gene locus_tag LOCUS_81330 17033 16524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81330 17413 17270 gene locus_tag LOCUS_81340 17413 17270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81340 >Feature sequence67 187 1107 gene locus_tag LOCUS_81350 187 1107 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029709.1 protein_id gnl|my_center|LOCUS_81350 1107 2024 gene locus_tag LOCUS_81360 1107 2024 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974413.1 protein_id gnl|my_center|LOCUS_81360 2035 2253 gene locus_tag LOCUS_81370 2035 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81370 2285 2728 gene locus_tag LOCUS_81380 2285 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81380 2725 3126 gene locus_tag LOCUS_81390 2725 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81390 3126 3557 gene locus_tag LOCUS_81400 3126 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81400 3554 6445 gene locus_tag LOCUS_81410 3554 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81410 6456 7142 gene locus_tag LOCUS_81420 6456 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81420 7169 8152 gene locus_tag LOCUS_81430 7169 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81430 8286 8555 gene locus_tag LOCUS_81440 8286 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81440 13337 8565 gene locus_tag LOCUS_81450 13337 8565 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029700.1 protein_id gnl|my_center|LOCUS_81450 11871 11782 gene locus_tag LOCUS_t00750 11871 11782 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14126 14785 gene locus_tag LOCUS_81460 14126 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029707.1 protein_id gnl|my_center|LOCUS_81460 14787 15596 gene locus_tag LOCUS_81470 14787 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974416.1 protein_id gnl|my_center|LOCUS_81470 >Feature sequence68 352 2274 gene locus_tag LOCUS_81480 352 2274 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_81480 2484 2984 gene locus_tag LOCUS_81490 2484 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81490 4639 3326 gene locus_tag LOCUS_81500 gene lysA 4639 3326 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230687.1 protein_id gnl|my_center|LOCUS_81500 5139 4636 gene locus_tag LOCUS_81510 5139 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81510 5353 6168 gene locus_tag LOCUS_81520 5353 6168 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227682.1 protein_id gnl|my_center|LOCUS_81520 7701 6178 gene locus_tag LOCUS_81530 7701 6178 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898298.1 protein_id gnl|my_center|LOCUS_81530 7826 8488 gene locus_tag LOCUS_81540 7826 8488 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235666617.1 protein_id gnl|my_center|LOCUS_81540 8592 9236 gene locus_tag LOCUS_81550 8592 9236 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918344.1 protein_id gnl|my_center|LOCUS_81550 9793 11622 gene locus_tag LOCUS_81560 9793 11622 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742222.1 protein_id gnl|my_center|LOCUS_81560 11756 12193 gene locus_tag LOCUS_81570 11756 12193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81570 12839 12210 gene locus_tag LOCUS_81580 12839 12210 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224723.1 protein_id gnl|my_center|LOCUS_81580 13112 14104 gene locus_tag LOCUS_81590 13112 14104 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_81590 >Feature sequence69 195 863 gene locus_tag LOCUS_81600 195 863 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224283.1 protein_id gnl|my_center|LOCUS_81600 1679 876 gene locus_tag LOCUS_81610 1679 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81610 2299 1676 gene locus_tag LOCUS_81620 2299 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81620 2556 3332 gene locus_tag LOCUS_81630 2556 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81630 3555 3911 gene locus_tag LOCUS_81640 3555 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81640 4012 4497 gene locus_tag LOCUS_81650 4012 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81650 4598 4978 gene locus_tag LOCUS_81660 4598 4978 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229003.1 protein_id gnl|my_center|LOCUS_81660 5978 5007 gene locus_tag LOCUS_81670 5978 5007 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_81670 6346 6002 gene locus_tag LOCUS_81680 6346 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_81680 7203 6340 gene locus_tag LOCUS_81690 7203 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_81690 8209 7388 gene locus_tag LOCUS_81700 8209 7388 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976615.1 protein_id gnl|my_center|LOCUS_81700 8286 8864 gene locus_tag LOCUS_81710 8286 8864 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227517.1 protein_id gnl|my_center|LOCUS_81710 9480 8929 gene locus_tag LOCUS_81720 9480 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81720 10097 9477 gene locus_tag LOCUS_81730 10097 9477 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284396.1 protein_id gnl|my_center|LOCUS_81730 >Feature sequence70 271 3225 gene locus_tag LOCUS_81740 271 3225 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 protein_id gnl|my_center|LOCUS_81740 4422 3943 gene locus_tag LOCUS_81750 4422 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81750 5388 4501 gene locus_tag LOCUS_81760 5388 4501 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222914.1 protein_id gnl|my_center|LOCUS_81760 5698 6126 gene locus_tag LOCUS_81770 5698 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81770 7165 6272 gene locus_tag LOCUS_81780 7165 6272 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027004.1 protein_id gnl|my_center|LOCUS_81780 7341 8261 gene locus_tag LOCUS_81790 7341 8261 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786554.1 protein_id gnl|my_center|LOCUS_81790 8410 9006 gene locus_tag LOCUS_81800 8410 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81800 9544 9035 gene locus_tag LOCUS_81810 9544 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81810 >Feature sequence71 1077 2540 gene locus_tag LOCUS_81820 1077 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81820 4275 2515 gene locus_tag LOCUS_81830 4275 2515 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142567766.1 protein_id gnl|my_center|LOCUS_81830 5220 4390 gene locus_tag LOCUS_81840 5220 4390 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 protein_id gnl|my_center|LOCUS_81840 5435 6931 gene locus_tag LOCUS_81850 5435 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81850 7000 7740 gene locus_tag LOCUS_81860 7000 7740 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087139.1 protein_id gnl|my_center|LOCUS_81860 8643 7744 gene locus_tag LOCUS_81870 8643 7744 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227049.1 protein_id gnl|my_center|LOCUS_81870 >Feature sequence72 330 175 gene locus_tag LOCUS_81880 330 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81880 463 1755 gene locus_tag LOCUS_81890 463 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81890 3154 1877 gene locus_tag LOCUS_81900 3154 1877 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_81900 3972 3355 gene locus_tag LOCUS_81910 3972 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81910 4368 3997 gene locus_tag LOCUS_81920 4368 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81920 4452 5834 gene locus_tag LOCUS_81930 4452 5834 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 protein_id gnl|my_center|LOCUS_81930 6088 6642 gene locus_tag LOCUS_81940 6088 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81940 6962 8065 gene locus_tag LOCUS_81950 6962 8065 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229881.1 protein_id gnl|my_center|LOCUS_81950 >Feature sequence73 544 4473 gene locus_tag LOCUS_81960 544 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81960 4715 4470 gene locus_tag LOCUS_81970 4715 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81970 4621 6555 gene locus_tag LOCUS_81980 4621 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81980 >Feature sequence74 142 33 gene locus_tag LOCUS_r00010 142 33 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3317 222 gene locus_tag LOCUS_r00020 3317 222 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence75 1666 147 gene locus_tag LOCUS_r00030 1666 147 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence76 1300 59 gene locus_tag LOCUS_81990 1300 59 CDS product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901078.1 protein_id gnl|my_center|LOCUS_81990 >Feature sequence77 >Feature sequence78 1261 35 gene locus_tag LOCUS_82000 1261 35 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206612254.1 protein_id gnl|my_center|LOCUS_82000 >Feature sequence79 >Feature sequence80 >Feature sequence81 >Feature sequence82 >Feature sequence83 >Feature sequence84 <1 932 gene locus_tag LOCUS_82010 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225826.1:ABC transporter permease >Feature sequence85 >Feature sequence86 774 100 gene locus_tag LOCUS_82020 774 100 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029635.1 protein_id gnl|my_center|LOCUS_82020 >Feature sequence87 294 124 gene locus_tag LOCUS_82030 294 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82030 401 640 gene locus_tag LOCUS_82040 401 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82040 >Feature sequence88 95 664 gene locus_tag LOCUS_82050 95 664 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_82050 >Feature sequence89 >Feature sequence90 >Feature sequence91 >Feature sequence92 >Feature sequence93 >Feature sequence94 >Feature sequence95 >Feature sequence96 <554 28 gene locus_tag LOCUS_82060 <554 28 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145764452.1:IS3 family transposase >Feature sequence97 <1 517 gene locus_tag LOCUS_82070 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029792.1:DNA-directed RNA polymerase subunit beta