>Feature sequence001 486 157 gene locus_tag LOCUS_00010 486 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2204 984 gene locus_tag LOCUS_00020 gene coaBC 2204 984 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_00020 2520 2257 gene locus_tag LOCUS_00030 gene rpoZ 2520 2257 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_00030 3210 2617 gene locus_tag LOCUS_00040 gene gmk 3210 2617 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 protein_id gnl|my_center|LOCUS_00040 3655 3332 gene locus_tag LOCUS_00050 3655 3332 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_00050 4774 4079 gene locus_tag LOCUS_00060 gene pyrF 4774 4079 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_00060 5760 4771 gene locus_tag LOCUS_00070 5760 4771 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_00070 6631 5735 gene locus_tag LOCUS_00080 6631 5735 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_00080 9935 6645 gene locus_tag LOCUS_00090 gene carB 9935 6645 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_00090 11043 9928 gene locus_tag LOCUS_00100 gene carA 11043 9928 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_00100 12350 11073 gene locus_tag LOCUS_00110 12350 11073 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_00110 13309 12374 gene locus_tag LOCUS_00120 13309 12374 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_00120 13935 13306 gene locus_tag LOCUS_00130 gene pyrR 13935 13306 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_00130 14393 14887 gene locus_tag LOCUS_00140 gene bldD 14393 14887 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_00140 15182 15610 gene locus_tag LOCUS_00150 gene nsrR 15182 15610 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031657.1 protein_id gnl|my_center|LOCUS_00150 15699 16961 gene locus_tag LOCUS_00160 15699 16961 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_00160 17433 16993 gene locus_tag LOCUS_00170 17433 16993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20692 17903 gene locus_tag LOCUS_00180 20692 17903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21405 20689 gene locus_tag LOCUS_00190 21405 20689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22403 21528 gene locus_tag LOCUS_00200 22403 21528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22556 23008 gene locus_tag LOCUS_00210 22556 23008 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104384.1 protein_id gnl|my_center|LOCUS_00210 23049 23603 gene locus_tag LOCUS_00220 23049 23603 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224203.1 protein_id gnl|my_center|LOCUS_00220 24766 23885 gene locus_tag LOCUS_00230 gene metF 24766 23885 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_00230 25144 26211 gene locus_tag LOCUS_00240 25144 26211 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_00240 26912 26274 gene locus_tag LOCUS_00250 gene thiE 26912 26274 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976712.1 protein_id gnl|my_center|LOCUS_00250 27264 26890 gene locus_tag LOCUS_00260 27264 26890 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900481.1 protein_id gnl|my_center|LOCUS_00260 28482 27313 gene locus_tag LOCUS_00270 28482 27313 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486236.1 protein_id gnl|my_center|LOCUS_00270 28759 30015 gene locus_tag LOCUS_00280 gene thiO 28759 30015 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_00280 30162 30362 gene locus_tag LOCUS_00290 gene thiS 30162 30362 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_00290 30355 31275 gene locus_tag LOCUS_00300 30355 31275 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_00300 31330 33282 gene locus_tag LOCUS_00310 gene pknB 31330 33282 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_00310 34087 33647 gene locus_tag LOCUS_00320 34087 33647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 35178 34135 gene locus_tag LOCUS_00330 gene alc 35178 34135 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223823.1 protein_id gnl|my_center|LOCUS_00330 36785 35175 gene locus_tag LOCUS_00340 gene allB 36785 35175 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972680.1 protein_id gnl|my_center|LOCUS_00340 37917 36772 gene locus_tag LOCUS_00350 37917 36772 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226428.1 protein_id gnl|my_center|LOCUS_00350 39529 38042 gene locus_tag LOCUS_00360 39529 38042 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727577.1 protein_id gnl|my_center|LOCUS_00360 40119 39625 gene locus_tag LOCUS_00370 40119 39625 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226423.1 protein_id gnl|my_center|LOCUS_00370 40988 40119 gene locus_tag LOCUS_00380 40988 40119 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226422.1 protein_id gnl|my_center|LOCUS_00380 41905 41021 gene locus_tag LOCUS_00390 gene pucL 41905 41021 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223818.1 protein_id gnl|my_center|LOCUS_00390 42231 41908 gene locus_tag LOCUS_00400 gene uraH 42231 41908 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057392.1 protein_id gnl|my_center|LOCUS_00400 42875 42228 gene locus_tag LOCUS_00410 42875 42228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 43129 43986 gene locus_tag LOCUS_00420 43129 43986 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976705.1 protein_id gnl|my_center|LOCUS_00420 44339 44160 gene locus_tag LOCUS_00430 44339 44160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 45373 44471 gene locus_tag LOCUS_00440 45373 44471 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_00440 46645 45446 gene locus_tag LOCUS_00450 46645 45446 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_00450 47316 46708 gene locus_tag LOCUS_00460 47316 46708 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976704.1 protein_id gnl|my_center|LOCUS_00460 47705 48742 gene locus_tag LOCUS_00470 gene aroF 47705 48742 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_00470 50014 48788 gene locus_tag LOCUS_00480 gene thiI 50014 48788 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173822.1 protein_id gnl|my_center|LOCUS_00480 50323 51198 gene locus_tag LOCUS_00490 50323 51198 CDS product MHYT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484657.1 protein_id gnl|my_center|LOCUS_00490 52353 51328 gene locus_tag LOCUS_00500 52353 51328 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_00500 53581 52520 gene locus_tag LOCUS_00510 53581 52520 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230778.1 protein_id gnl|my_center|LOCUS_00510 53717 54628 gene locus_tag LOCUS_00520 53717 54628 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230946.1 protein_id gnl|my_center|LOCUS_00520 54822 57935 gene locus_tag LOCUS_00530 54822 57935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 58437 57970 gene locus_tag LOCUS_00540 58437 57970 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973268.1 protein_id gnl|my_center|LOCUS_00540 58551 59699 gene locus_tag LOCUS_00550 58551 59699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 59696 62155 gene locus_tag LOCUS_00560 59696 62155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 62854 62228 gene locus_tag LOCUS_00570 62854 62228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 63319 63038 gene locus_tag LOCUS_00580 63319 63038 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_00580 63650 63324 gene locus_tag LOCUS_00590 63650 63324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 64560 63700 gene locus_tag LOCUS_00600 64560 63700 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899172.1 protein_id gnl|my_center|LOCUS_00600 67789 64562 gene locus_tag LOCUS_00610 67789 64562 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911743.1 protein_id gnl|my_center|LOCUS_00610 68185 69069 gene locus_tag LOCUS_00620 gene mmuM 68185 69069 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246467.1 protein_id gnl|my_center|LOCUS_00620 69221 69961 gene locus_tag LOCUS_00630 69221 69961 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762866.1 protein_id gnl|my_center|LOCUS_00630 69968 71278 gene locus_tag LOCUS_00640 69968 71278 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897685.1 protein_id gnl|my_center|LOCUS_00640 71473 72537 gene locus_tag LOCUS_00650 71473 72537 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031370.1 protein_id gnl|my_center|LOCUS_00650 74087 72666 gene locus_tag LOCUS_00660 74087 72666 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031600.1 protein_id gnl|my_center|LOCUS_00660 74352 74639 gene locus_tag LOCUS_00670 74352 74639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 74626 75030 gene locus_tag LOCUS_00680 74626 75030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 76055 75207 gene locus_tag LOCUS_00690 76055 75207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 78291 76246 gene locus_tag LOCUS_00700 78291 76246 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060585.1 protein_id gnl|my_center|LOCUS_00700 78607 79647 gene locus_tag LOCUS_00710 78607 79647 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229172.1 protein_id gnl|my_center|LOCUS_00710 79853 80848 gene locus_tag LOCUS_00720 79853 80848 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_00720 80875 83364 gene locus_tag LOCUS_00730 gene hypF 80875 83364 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225635.1 protein_id gnl|my_center|LOCUS_00730 84170 83406 gene locus_tag LOCUS_00740 84170 83406 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977603.1 protein_id gnl|my_center|LOCUS_00740 84366 85121 gene locus_tag LOCUS_00750 84366 85121 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_00750 85276 85740 gene locus_tag LOCUS_00760 85276 85740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 87015 85807 gene locus_tag LOCUS_00770 87015 85807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 87777 87040 gene locus_tag LOCUS_00780 87777 87040 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976690.1 protein_id gnl|my_center|LOCUS_00780 88893 87949 gene locus_tag LOCUS_00790 88893 87949 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976689.1 protein_id gnl|my_center|LOCUS_00790 89603 88929 gene locus_tag LOCUS_00800 89603 88929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 90787 89603 gene locus_tag LOCUS_00810 90787 89603 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256376.1 protein_id gnl|my_center|LOCUS_00810 91224 90784 gene locus_tag LOCUS_00820 91224 90784 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_00820 92070 91303 gene locus_tag LOCUS_00830 92070 91303 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028154.1 protein_id gnl|my_center|LOCUS_00830 93235 92249 gene locus_tag LOCUS_00840 93235 92249 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688696.1 protein_id gnl|my_center|LOCUS_00840 93410 93862 gene locus_tag LOCUS_00850 93410 93862 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728367.1 protein_id gnl|my_center|LOCUS_00850 93885 94097 gene locus_tag LOCUS_00860 93885 94097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 94156 95955 gene locus_tag LOCUS_00870 94156 95955 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_00870 >Feature sequence002 <1 3434 gene locus_tag LOCUS_00880 <1 3434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226365.1:HAMP domain-containing protein 5844 3526 gene locus_tag LOCUS_00890 5844 3526 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_00890 7075 5972 gene locus_tag LOCUS_00900 7075 5972 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_00900 8472 7162 gene locus_tag LOCUS_00910 8472 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 9786 8737 gene locus_tag LOCUS_00920 9786 8737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 10899 10315 gene locus_tag LOCUS_00930 10899 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 11587 12171 gene locus_tag LOCUS_00940 11587 12171 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230285.1 protein_id gnl|my_center|LOCUS_00940 12249 13802 gene locus_tag LOCUS_00950 12249 13802 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230284.1 protein_id gnl|my_center|LOCUS_00950 14896 13910 gene locus_tag LOCUS_00960 14896 13910 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028159.1 protein_id gnl|my_center|LOCUS_00960 16594 15329 gene locus_tag LOCUS_00970 16594 15329 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 protein_id gnl|my_center|LOCUS_00970 17228 18970 gene locus_tag LOCUS_00980 17228 18970 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_00980 19394 19029 gene locus_tag LOCUS_00990 19394 19029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 19751 19545 gene locus_tag LOCUS_01000 19751 19545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 >Feature sequence003 317 114 gene locus_tag LOCUS_01010 317 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 1131 307 gene locus_tag LOCUS_01020 1131 307 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028937.1 protein_id gnl|my_center|LOCUS_01020 1305 1703 gene locus_tag LOCUS_01030 1305 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 2243 2563 gene locus_tag LOCUS_01040 2243 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 2773 3060 gene locus_tag LOCUS_01050 2773 3060 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_01050 4068 3133 gene locus_tag LOCUS_01060 4068 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 4654 4181 gene locus_tag LOCUS_01070 4654 4181 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971523.1 protein_id gnl|my_center|LOCUS_01070 6111 5017 gene locus_tag LOCUS_01080 gene trpD 6111 5017 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_01080 6539 6138 gene locus_tag LOCUS_01090 6539 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 protein_id gnl|my_center|LOCUS_01090 6867 6625 gene locus_tag LOCUS_01100 6867 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 6830 7348 gene locus_tag LOCUS_01110 6830 7348 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_01110 7366 8196 gene locus_tag LOCUS_01120 7366 8196 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_01120 8189 9262 gene locus_tag LOCUS_01130 8189 9262 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_01130 9259 10950 gene locus_tag LOCUS_01140 9259 10950 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_01140 12356 11070 gene locus_tag LOCUS_01150 12356 11070 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 protein_id gnl|my_center|LOCUS_01150 12967 12572 gene locus_tag LOCUS_01160 12967 12572 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_01160 14634 12964 gene locus_tag LOCUS_01170 gene ctaD 14634 12964 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_01170 15293 14631 gene locus_tag LOCUS_01180 gene coxB 15293 14631 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028168.1 protein_id gnl|my_center|LOCUS_01180 15657 16796 gene locus_tag LOCUS_01190 15657 16796 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01190 16859 17134 gene locus_tag LOCUS_01200 16859 17134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01200 18270 17284 gene locus_tag LOCUS_01210 18270 17284 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_01210 19161 18805 gene locus_tag LOCUS_01220 19161 18805 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_01220 19365 20552 gene locus_tag LOCUS_01230 gene nadA 19365 20552 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_01230 21366 20632 gene locus_tag LOCUS_01240 21366 20632 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113130.1 protein_id gnl|my_center|LOCUS_01240 23478 21433 gene locus_tag LOCUS_01250 23478 21433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 25325 23505 gene locus_tag LOCUS_01260 25325 23505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 26045 25485 gene locus_tag LOCUS_01270 26045 25485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_01270 26959 26051 gene locus_tag LOCUS_01280 gene htpX 26959 26051 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_01280 27247 26969 gene locus_tag LOCUS_01290 27247 26969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 protein_id gnl|my_center|LOCUS_01290 28041 27244 gene locus_tag LOCUS_01300 28041 27244 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_01300 28430 28921 gene locus_tag LOCUS_01310 28430 28921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 30533 29325 gene locus_tag LOCUS_01320 30533 29325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 30590 31594 gene locus_tag LOCUS_01330 30590 31594 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_01330 32317 32111 gene locus_tag LOCUS_01340 32317 32111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_01340 32621 33736 gene locus_tag LOCUS_01350 32621 33736 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869456.1 protein_id gnl|my_center|LOCUS_01350 33947 34717 gene locus_tag LOCUS_01360 33947 34717 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028180.1 protein_id gnl|my_center|LOCUS_01360 34831 36324 gene locus_tag LOCUS_01370 34831 36324 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_01370 36490 37869 gene locus_tag LOCUS_01380 gene lpdA 36490 37869 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_01380 37906 39354 gene locus_tag LOCUS_01390 37906 39354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 39525 40481 gene locus_tag LOCUS_01400 39525 40481 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_01400 40593 41327 gene locus_tag LOCUS_01410 40593 41327 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_01410 41505 42239 gene locus_tag LOCUS_01420 gene lipB 41505 42239 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895681.1 protein_id gnl|my_center|LOCUS_01420 42292 43221 gene locus_tag LOCUS_01430 gene lipA 42292 43221 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729704.1 protein_id gnl|my_center|LOCUS_01430 43543 44169 gene locus_tag LOCUS_01440 43543 44169 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_01440 44166 44972 gene locus_tag LOCUS_01450 44166 44972 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_01450 45461 45003 gene locus_tag LOCUS_01460 45461 45003 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_01460 45606 47030 gene locus_tag LOCUS_01470 gene glnA 45606 47030 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223133.1 protein_id gnl|my_center|LOCUS_01470 47553 47251 gene locus_tag LOCUS_01480 47553 47251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 48215 48048 gene locus_tag LOCUS_01490 48215 48048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 48495 48677 gene locus_tag LOCUS_01500 48495 48677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 48859 49248 gene locus_tag LOCUS_01510 48859 49248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 49341 50471 gene locus_tag LOCUS_01520 49341 50471 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950535.1 protein_id gnl|my_center|LOCUS_01520 50587 52119 gene locus_tag LOCUS_01530 50587 52119 CDS product TfuA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003910339.1 protein_id gnl|my_center|LOCUS_01530 52184 53053 gene locus_tag LOCUS_01540 52184 53053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 54153 53113 gene locus_tag LOCUS_01550 54153 53113 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225108.1 protein_id gnl|my_center|LOCUS_01550 55353 54334 gene locus_tag LOCUS_01560 55353 54334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_01560 58470 55471 gene locus_tag LOCUS_01570 58470 55471 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_01570 59332 58532 gene locus_tag LOCUS_01580 59332 58532 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 protein_id gnl|my_center|LOCUS_01580 59747 60685 gene locus_tag LOCUS_01590 59747 60685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 60690 62273 gene locus_tag LOCUS_01600 60690 62273 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963794.1 protein_id gnl|my_center|LOCUS_01600 62286 65165 gene locus_tag LOCUS_01610 62286 65165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 65169 66341 gene locus_tag LOCUS_01620 65169 66341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 66470 69073 gene locus_tag LOCUS_01630 66470 69073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 69135 71012 gene locus_tag LOCUS_01640 69135 71012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 71762 71040 gene locus_tag LOCUS_01650 71762 71040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 protein_id gnl|my_center|LOCUS_01650 72015 72932 gene locus_tag LOCUS_01660 72015 72932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 73408 72887 gene locus_tag LOCUS_01670 73408 72887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 74867 73506 gene locus_tag LOCUS_01680 gene glnA 74867 73506 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_01680 75181 76836 gene locus_tag LOCUS_01690 75181 76836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 77914 76799 gene locus_tag LOCUS_01700 77914 76799 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 protein_id gnl|my_center|LOCUS_01700 77996 79219 gene locus_tag LOCUS_01710 77996 79219 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_01710 79443 81242 gene locus_tag LOCUS_01720 79443 81242 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208946.1 protein_id gnl|my_center|LOCUS_01720 82222 81578 gene locus_tag LOCUS_01730 82222 81578 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140673.1 protein_id gnl|my_center|LOCUS_01730 83741 82230 gene locus_tag LOCUS_01740 83741 82230 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030040.1 protein_id gnl|my_center|LOCUS_01740 84366 85151 gene locus_tag LOCUS_01750 gene panB 84366 85151 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_01750 86754 85573 gene locus_tag LOCUS_01760 86754 85573 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_01760 87531 86818 gene locus_tag LOCUS_01770 gene npdG 87531 86818 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_01770 87577 88170 gene locus_tag LOCUS_01780 87577 88170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028233.1 protein_id gnl|my_center|LOCUS_01780 88543 88283 gene locus_tag LOCUS_01790 88543 88283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 88841 89038 gene locus_tag LOCUS_01800 88841 89038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 89363 89181 gene locus_tag LOCUS_01810 89363 89181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 89465 90313 gene locus_tag LOCUS_01820 gene map 89465 90313 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_01820 92270 90327 gene locus_tag LOCUS_01830 92270 90327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 92485 93102 gene locus_tag LOCUS_01840 92485 93102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 93201 94880 gene locus_tag LOCUS_01850 93201 94880 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086842967.1 protein_id gnl|my_center|LOCUS_01850 95643 94969 gene locus_tag LOCUS_01860 95643 94969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 97076 96081 gene locus_tag LOCUS_01870 97076 96081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 97755 98582 gene locus_tag LOCUS_01880 97755 98582 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031055.1 protein_id gnl|my_center|LOCUS_01880 98573 98779 gene locus_tag LOCUS_01890 98573 98779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 99175 102108 gene locus_tag LOCUS_01900 99175 102108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 102539 102144 gene locus_tag LOCUS_01910 102539 102144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 104818 102830 gene locus_tag LOCUS_01920 104818 102830 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228600.1 protein_id gnl|my_center|LOCUS_01920 105420 104815 gene locus_tag LOCUS_01930 105420 104815 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776436.1 protein_id gnl|my_center|LOCUS_01930 106855 105596 gene locus_tag LOCUS_01940 106855 105596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 108814 107102 gene locus_tag LOCUS_01950 108814 107102 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030705.1 protein_id gnl|my_center|LOCUS_01950 108930 111191 gene locus_tag LOCUS_01960 gene pucD 108930 111191 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226424.1 protein_id gnl|my_center|LOCUS_01960 112948 111245 gene locus_tag LOCUS_01970 112948 111245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 113306 114418 gene locus_tag LOCUS_01980 gene ald 113306 114418 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_01980 115184 114492 gene locus_tag LOCUS_01990 115184 114492 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028218.1 protein_id gnl|my_center|LOCUS_01990 115269 115946 gene locus_tag LOCUS_02000 115269 115946 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_02000 117190 116030 gene locus_tag LOCUS_02010 117190 116030 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_02010 117867 117187 gene locus_tag LOCUS_02020 117867 117187 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325632.1 protein_id gnl|my_center|LOCUS_02020 119906 117864 gene locus_tag LOCUS_02030 119906 117864 CDS product DUF6421 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082817098.1 protein_id gnl|my_center|LOCUS_02030 120192 121928 gene locus_tag LOCUS_02040 120192 121928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 121943 123640 gene locus_tag LOCUS_02050 121943 123640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 123754 124467 gene locus_tag LOCUS_02060 123754 124467 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031658.1 protein_id gnl|my_center|LOCUS_02060 125250 124468 gene locus_tag LOCUS_02070 125250 124468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228167.1 protein_id gnl|my_center|LOCUS_02070 126482 125247 gene locus_tag LOCUS_02080 126482 125247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 127534 126581 gene locus_tag LOCUS_02090 127534 126581 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_02090 128803 127937 gene locus_tag LOCUS_02100 128803 127937 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535503.1 protein_id gnl|my_center|LOCUS_02100 129356 130687 gene locus_tag LOCUS_02110 129356 130687 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_02110 130684 131586 gene locus_tag LOCUS_02120 130684 131586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 131583 133646 gene locus_tag LOCUS_02130 131583 133646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148755187.1 protein_id gnl|my_center|LOCUS_02130 133848 136310 gene locus_tag LOCUS_02140 133848 136310 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027618.1 protein_id gnl|my_center|LOCUS_02140 136461 136892 gene locus_tag LOCUS_02150 136461 136892 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229428.1 protein_id gnl|my_center|LOCUS_02150 136889 137278 gene locus_tag LOCUS_02160 136889 137278 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228185.1 protein_id gnl|my_center|LOCUS_02160 137259 137885 gene locus_tag LOCUS_02170 137259 137885 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561734.1 protein_id gnl|my_center|LOCUS_02170 137989 138783 gene locus_tag LOCUS_02180 137989 138783 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027295.1 protein_id gnl|my_center|LOCUS_02180 138951 139460 gene locus_tag LOCUS_02190 138951 139460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 140397 139603 gene locus_tag LOCUS_02200 140397 139603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 140719 140501 gene locus_tag LOCUS_02210 140719 140501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 141531 140692 gene locus_tag LOCUS_02220 141531 140692 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029566.1 protein_id gnl|my_center|LOCUS_02220 141801 142070 gene locus_tag LOCUS_02230 141801 142070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 142163 142588 gene locus_tag LOCUS_02240 142163 142588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 143349 142711 gene locus_tag LOCUS_02250 143349 142711 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862601.1 protein_id gnl|my_center|LOCUS_02250 143523 144110 gene locus_tag LOCUS_02260 143523 144110 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972709.1 protein_id gnl|my_center|LOCUS_02260 145164 144178 gene locus_tag LOCUS_02270 145164 144178 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094369.1 protein_id gnl|my_center|LOCUS_02270 145587 145312 gene locus_tag LOCUS_02280 145587 145312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 145943 145707 gene locus_tag LOCUS_02290 145943 145707 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_02290 146810 145944 gene locus_tag LOCUS_02300 146810 145944 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_02300 146961 147491 gene locus_tag LOCUS_02310 146961 147491 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 protein_id gnl|my_center|LOCUS_02310 147670 150054 gene locus_tag LOCUS_02320 147670 150054 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222121.1 protein_id gnl|my_center|LOCUS_02320 150206 150427 gene locus_tag LOCUS_02330 150206 150427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 153101 150459 gene locus_tag LOCUS_02340 153101 150459 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_02340 154117 153320 gene locus_tag LOCUS_02350 154117 153320 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_02350 154879 154307 gene locus_tag LOCUS_02360 154879 154307 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976199.1 protein_id gnl|my_center|LOCUS_02360 154985 155305 gene locus_tag LOCUS_02370 154985 155305 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230909.1 protein_id gnl|my_center|LOCUS_02370 156232 155399 gene locus_tag LOCUS_02380 156232 155399 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 protein_id gnl|my_center|LOCUS_02380 157741 156422 gene locus_tag LOCUS_02390 157741 156422 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223659.1 protein_id gnl|my_center|LOCUS_02390 158447 158019 gene locus_tag LOCUS_02400 158447 158019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 158804 159910 gene locus_tag LOCUS_02410 158804 159910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 >Feature sequence004 3007 4683 gene locus_tag LOCUS_02420 3007 4683 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_02420 4726 5091 gene locus_tag LOCUS_02430 4726 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 5171 6166 gene locus_tag LOCUS_02440 5171 6166 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027112.1 protein_id gnl|my_center|LOCUS_02440 6281 7381 gene locus_tag LOCUS_02450 6281 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 7624 10743 gene locus_tag LOCUS_02460 7624 10743 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228172.1 protein_id gnl|my_center|LOCUS_02460 >Feature sequence005 353 1753 gene locus_tag LOCUS_02470 353 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 1859 2536 gene locus_tag LOCUS_02480 1859 2536 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976477.1 protein_id gnl|my_center|LOCUS_02480 3441 3238 gene locus_tag LOCUS_02490 3441 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 4298 3453 gene locus_tag LOCUS_02500 4298 3453 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_02500 4726 4475 gene locus_tag LOCUS_02510 4726 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 4912 5298 gene locus_tag LOCUS_02520 4912 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 5881 5603 gene locus_tag LOCUS_02530 5881 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 6058 6357 gene locus_tag LOCUS_02540 6058 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 6354 6578 gene locus_tag LOCUS_02550 6354 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 6718 6969 gene locus_tag LOCUS_02560 6718 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 7056 8687 gene locus_tag LOCUS_02570 7056 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 8786 8977 gene locus_tag LOCUS_02580 8786 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 8974 9201 gene locus_tag LOCUS_02590 8974 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 9198 10205 gene locus_tag LOCUS_02600 9198 10205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 10240 12417 gene locus_tag LOCUS_02610 10240 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 12480 13106 gene locus_tag LOCUS_02620 12480 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 13100 13366 gene locus_tag LOCUS_02630 13100 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 13398 13838 gene locus_tag LOCUS_02640 13398 13838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 13952 14176 gene locus_tag LOCUS_02650 13952 14176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 14180 14521 gene locus_tag LOCUS_02660 14180 14521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 14532 14975 gene locus_tag LOCUS_02670 14532 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 15277 14912 gene locus_tag LOCUS_02680 15277 14912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 15567 15292 gene locus_tag LOCUS_02690 15567 15292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 16446 15667 gene locus_tag LOCUS_02700 16446 15667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 17390 16566 gene locus_tag LOCUS_02710 17390 16566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 17795 17394 gene locus_tag LOCUS_02720 17795 17394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 18294 17785 gene locus_tag LOCUS_02730 18294 17785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 18705 18298 gene locus_tag LOCUS_02740 18705 18298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 20531 18705 gene locus_tag LOCUS_02750 20531 18705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 21635 20568 gene locus_tag LOCUS_02760 21635 20568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 22341 21646 gene locus_tag LOCUS_02770 22341 21646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 22571 22344 gene locus_tag LOCUS_02780 22571 22344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 23044 22583 gene locus_tag LOCUS_02790 23044 22583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 23571 23110 gene locus_tag LOCUS_02800 23571 23110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 23803 23558 gene locus_tag LOCUS_02810 23803 23558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 23962 24603 gene locus_tag LOCUS_02820 23962 24603 CDS product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727524.1 protein_id gnl|my_center|LOCUS_02820 29358 24658 gene locus_tag LOCUS_02830 29358 24658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 29866 29402 gene locus_tag LOCUS_02840 29866 29402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 30240 29899 gene locus_tag LOCUS_02850 30240 29899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 30842 30261 gene locus_tag LOCUS_02860 30842 30261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 31285 30908 gene locus_tag LOCUS_02870 31285 30908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 31610 31278 gene locus_tag LOCUS_02880 31610 31278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 31964 31623 gene locus_tag LOCUS_02890 31964 31623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 32368 31970 gene locus_tag LOCUS_02900 32368 31970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 33453 32380 gene locus_tag LOCUS_02910 33453 32380 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331462.1 protein_id gnl|my_center|LOCUS_02910 34466 33510 gene locus_tag LOCUS_02920 34466 33510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 35154 34480 gene locus_tag LOCUS_02930 35154 34480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 36008 35262 gene locus_tag LOCUS_02940 36008 35262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 36869 36105 gene locus_tag LOCUS_02950 36869 36105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 38286 36844 gene locus_tag LOCUS_02960 38286 36844 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108668.1 protein_id gnl|my_center|LOCUS_02960 39941 38283 gene locus_tag LOCUS_02970 39941 38283 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389873.1 protein_id gnl|my_center|LOCUS_02970 40471 39962 gene locus_tag LOCUS_02980 40471 39962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 41094 40504 gene locus_tag LOCUS_02990 41094 40504 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389872.1 protein_id gnl|my_center|LOCUS_02990 42010 41657 gene locus_tag LOCUS_03000 42010 41657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 42496 42275 gene locus_tag LOCUS_03010 42496 42275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 43525 42584 gene locus_tag LOCUS_03020 43525 42584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 44777 43641 gene locus_tag LOCUS_03030 44777 43641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 45142 44816 gene locus_tag LOCUS_03040 45142 44816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 45348 45139 gene locus_tag LOCUS_03050 45348 45139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 45643 45341 gene locus_tag LOCUS_03060 45643 45341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 46040 45741 gene locus_tag LOCUS_03070 46040 45741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 46782 45934 gene locus_tag LOCUS_03080 46782 45934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 47707 47009 gene locus_tag LOCUS_03090 47707 47009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 48362 47697 gene locus_tag LOCUS_03100 48362 47697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 49039 48359 gene locus_tag LOCUS_03110 49039 48359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 49902 49036 gene locus_tag LOCUS_03120 49902 49036 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252964.1 protein_id gnl|my_center|LOCUS_03120 50474 49899 gene locus_tag LOCUS_03130 50474 49899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 51031 50477 gene locus_tag LOCUS_03140 51031 50477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 51720 51040 gene locus_tag LOCUS_03150 51720 51040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 52018 51731 gene locus_tag LOCUS_03160 52018 51731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 53528 52038 gene locus_tag LOCUS_03170 53528 52038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 53954 53562 gene locus_tag LOCUS_03180 53954 53562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 54237 53956 gene locus_tag LOCUS_03190 54237 53956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 54670 54431 gene locus_tag LOCUS_03200 54670 54431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 54855 54700 gene locus_tag LOCUS_03210 54855 54700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 55242 55081 gene locus_tag LOCUS_03220 55242 55081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 55682 55323 gene locus_tag LOCUS_03230 55682 55323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 55852 55700 gene locus_tag LOCUS_03240 55852 55700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 56150 55860 gene locus_tag LOCUS_03250 56150 55860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 56572 56291 gene locus_tag LOCUS_03260 56572 56291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 57591 56569 gene locus_tag LOCUS_03270 57591 56569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 58155 58018 gene locus_tag LOCUS_03280 58155 58018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 58415 58152 gene locus_tag LOCUS_03290 58415 58152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 58600 58412 gene locus_tag LOCUS_03300 58600 58412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 59117 58602 gene locus_tag LOCUS_03310 59117 58602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 59453 59121 gene locus_tag LOCUS_03320 59453 59121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 59852 59637 gene locus_tag LOCUS_03330 59852 59637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 61624 59960 gene locus_tag LOCUS_03340 61624 59960 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727486.1 protein_id gnl|my_center|LOCUS_03340 63401 62544 gene locus_tag LOCUS_03350 63401 62544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 63695 63522 gene locus_tag LOCUS_03360 63695 63522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 64172 63738 gene locus_tag LOCUS_03370 64172 63738 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971899.1 protein_id gnl|my_center|LOCUS_03370 64146 64307 gene locus_tag LOCUS_03380 64146 64307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 64947 64282 gene locus_tag LOCUS_03390 64947 64282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 65981 64944 gene locus_tag LOCUS_03400 gene moaA 65981 64944 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870335.1 protein_id gnl|my_center|LOCUS_03400 66168 67568 gene locus_tag LOCUS_03410 66168 67568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 68021 67704 gene locus_tag LOCUS_03420 68021 67704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 68581 68018 gene locus_tag LOCUS_03430 68581 68018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 68903 68568 gene locus_tag LOCUS_03440 68903 68568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 69237 68896 gene locus_tag LOCUS_03450 69237 68896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 69662 69240 gene locus_tag LOCUS_03460 69662 69240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 70061 69738 gene locus_tag LOCUS_03470 70061 69738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 70351 70058 gene locus_tag LOCUS_03480 70351 70058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 70865 70341 gene locus_tag LOCUS_03490 70865 70341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 71176 70865 gene locus_tag LOCUS_03500 71176 70865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 71648 71166 gene locus_tag LOCUS_03510 71648 71166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 71915 71652 gene locus_tag LOCUS_03520 71915 71652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 72285 71950 gene locus_tag LOCUS_03530 72285 71950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 72368 73597 gene locus_tag LOCUS_03540 gene tnpB 72368 73597 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886824.1 protein_id gnl|my_center|LOCUS_03540 74108 73767 gene locus_tag LOCUS_03550 74108 73767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 74788 74174 gene locus_tag LOCUS_03560 74788 74174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 75178 74915 gene locus_tag LOCUS_03570 75178 74915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 75283 75534 gene locus_tag LOCUS_03580 75283 75534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 75957 75595 gene locus_tag LOCUS_03590 75957 75595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 76312 75950 gene locus_tag LOCUS_03600 76312 75950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 76583 76305 gene locus_tag LOCUS_03610 76583 76305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 76755 76576 gene locus_tag LOCUS_03620 76755 76576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 76972 76748 gene locus_tag LOCUS_03630 76972 76748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 77153 76965 gene locus_tag LOCUS_03640 77153 76965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 77511 77146 gene locus_tag LOCUS_03650 77511 77146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 77899 77504 gene locus_tag LOCUS_03660 77899 77504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 78393 77908 gene locus_tag LOCUS_03670 78393 77908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 78868 78458 gene locus_tag LOCUS_03680 78868 78458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 79303 78986 gene locus_tag LOCUS_03690 79303 78986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 79461 79300 gene locus_tag LOCUS_03700 79461 79300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 79727 79458 gene locus_tag LOCUS_03710 79727 79458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 80584 79724 gene locus_tag LOCUS_03720 80584 79724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 80841 80581 gene locus_tag LOCUS_03730 80841 80581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 81410 80838 gene locus_tag LOCUS_03740 81410 80838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 81580 81407 gene locus_tag LOCUS_03750 81580 81407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 81810 81577 gene locus_tag LOCUS_03760 81810 81577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 82415 81807 gene locus_tag LOCUS_03770 82415 81807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 83344 82412 gene locus_tag LOCUS_03780 83344 82412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 83533 83763 gene locus_tag LOCUS_03790 83533 83763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 84832 83927 gene locus_tag LOCUS_03800 84832 83927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 85557 84925 gene locus_tag LOCUS_03810 85557 84925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 86024 85557 gene locus_tag LOCUS_03820 86024 85557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 86295 86011 gene locus_tag LOCUS_03830 86295 86011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 86672 86292 gene locus_tag LOCUS_03840 86672 86292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 86871 86662 gene locus_tag LOCUS_03850 86871 86662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 87133 86864 gene locus_tag LOCUS_03860 87133 86864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 87996 87130 gene locus_tag LOCUS_03870 87996 87130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 89756 87996 gene locus_tag LOCUS_03880 89756 87996 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222300.1 protein_id gnl|my_center|LOCUS_03880 89932 89753 gene locus_tag LOCUS_03890 89932 89753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 90558 89929 gene locus_tag LOCUS_03900 90558 89929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 90989 90558 gene locus_tag LOCUS_03910 90989 90558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 91258 90986 gene locus_tag LOCUS_03920 91258 90986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 91518 91255 gene locus_tag LOCUS_03930 91518 91255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 91808 91518 gene locus_tag LOCUS_03940 91808 91518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 92440 91805 gene locus_tag LOCUS_03950 92440 91805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 92825 92433 gene locus_tag LOCUS_03960 92825 92433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 93379 92822 gene locus_tag LOCUS_03970 93379 92822 CDS product HAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028507.1 protein_id gnl|my_center|LOCUS_03970 94460 93537 gene locus_tag LOCUS_03980 94460 93537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 94873 94457 gene locus_tag LOCUS_03990 94873 94457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 95481 94873 gene locus_tag LOCUS_04000 95481 94873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 95768 95478 gene locus_tag LOCUS_04010 95768 95478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 96409 95768 gene locus_tag LOCUS_04020 96409 95768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 96875 96468 gene locus_tag LOCUS_04030 96875 96468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 97279 96872 gene locus_tag LOCUS_04040 97279 96872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 97411 97647 gene locus_tag LOCUS_04050 97411 97647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 97640 98251 gene locus_tag LOCUS_04060 97640 98251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 98771 98328 gene locus_tag LOCUS_04070 98771 98328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 99719 98856 gene locus_tag LOCUS_04080 99719 98856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 99961 99716 gene locus_tag LOCUS_04090 99961 99716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 100299 99958 gene locus_tag LOCUS_04100 100299 99958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 101000 100296 gene locus_tag LOCUS_04110 101000 100296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 101380 100997 gene locus_tag LOCUS_04120 101380 100997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 101969 101373 gene locus_tag LOCUS_04130 101969 101373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 103177 101966 gene locus_tag LOCUS_04140 103177 101966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 103455 103177 gene locus_tag LOCUS_04150 103455 103177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 103649 103452 gene locus_tag LOCUS_04160 103649 103452 CDS product BldC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081896.1 protein_id gnl|my_center|LOCUS_04160 104037 103633 gene locus_tag LOCUS_04170 104037 103633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 104413 104030 gene locus_tag LOCUS_04180 104413 104030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 104655 104410 gene locus_tag LOCUS_04190 104655 104410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 105020 104652 gene locus_tag LOCUS_04200 105020 104652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 105238 105020 gene locus_tag LOCUS_04210 105238 105020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 105651 105235 gene locus_tag LOCUS_04220 105651 105235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 105928 105731 gene locus_tag LOCUS_04230 105928 105731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 106327 106034 gene locus_tag LOCUS_04240 106327 106034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 106578 106327 gene locus_tag LOCUS_04250 106578 106327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 106748 107416 gene locus_tag LOCUS_04260 106748 107416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 107733 107431 gene locus_tag LOCUS_04270 107733 107431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 109029 108025 gene locus_tag LOCUS_04280 109029 108025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 109117 109191 gene locus_tag LOCUS_t00010 109117 109191 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 109545 111080 gene locus_tag LOCUS_04290 109545 111080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 111774 111157 gene locus_tag LOCUS_04300 111774 111157 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970387.1 protein_id gnl|my_center|LOCUS_04300 112246 111875 gene locus_tag LOCUS_04310 112246 111875 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225512.1 protein_id gnl|my_center|LOCUS_04310 113004 112291 gene locus_tag LOCUS_04320 113004 112291 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225513.1 protein_id gnl|my_center|LOCUS_04320 114136 113162 gene locus_tag LOCUS_04330 114136 113162 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225514.1 protein_id gnl|my_center|LOCUS_04330 114184 114384 gene locus_tag LOCUS_04340 114184 114384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 115003 114434 gene locus_tag LOCUS_04350 115003 114434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 115411 115575 gene locus_tag LOCUS_04360 115411 115575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 115628 116401 gene locus_tag LOCUS_04370 115628 116401 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527760.1 protein_id gnl|my_center|LOCUS_04370 117102 116797 gene locus_tag LOCUS_04380 117102 116797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 117083 120667 gene locus_tag LOCUS_04390 117083 120667 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226454.1 protein_id gnl|my_center|LOCUS_04390 120775 121326 gene locus_tag LOCUS_04400 120775 121326 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114630.1 protein_id gnl|my_center|LOCUS_04400 124142 121479 gene locus_tag LOCUS_04410 124142 121479 CDS product exo 1,3/1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229330.1 protein_id gnl|my_center|LOCUS_04410 124812 124396 gene locus_tag LOCUS_04420 124812 124396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 126563 124911 gene locus_tag LOCUS_04430 126563 124911 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731142.1 protein_id gnl|my_center|LOCUS_04430 127205 126663 gene locus_tag LOCUS_04440 127205 126663 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729966.1 protein_id gnl|my_center|LOCUS_04440 127455 127694 gene locus_tag LOCUS_04450 127455 127694 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228830.1 protein_id gnl|my_center|LOCUS_04450 127694 128263 gene locus_tag LOCUS_04460 127694 128263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 128339 129379 gene locus_tag LOCUS_04470 128339 129379 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257000.1 protein_id gnl|my_center|LOCUS_04470 129610 130098 gene locus_tag LOCUS_04480 129610 130098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 130552 130142 gene locus_tag LOCUS_04490 130552 130142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 130782 130603 gene locus_tag LOCUS_04500 130782 130603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 131090 130776 gene locus_tag LOCUS_04510 131090 130776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 131164 133260 gene locus_tag LOCUS_04520 131164 133260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325800.1 protein_id gnl|my_center|LOCUS_04520 133519 133956 gene locus_tag LOCUS_04530 133519 133956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 134478 140171 gene locus_tag LOCUS_04540 134478 140171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 141565 140333 gene locus_tag LOCUS_04550 141565 140333 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 protein_id gnl|my_center|LOCUS_04550 141606 142184 gene locus_tag LOCUS_04560 141606 142184 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972778.1 protein_id gnl|my_center|LOCUS_04560 142776 142312 gene locus_tag LOCUS_04570 142776 142312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 143104 143823 gene locus_tag LOCUS_04580 143104 143823 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978258.1 protein_id gnl|my_center|LOCUS_04580 144046 144447 gene locus_tag LOCUS_04590 144046 144447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 144444 144977 gene locus_tag LOCUS_04600 144444 144977 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226516.1 protein_id gnl|my_center|LOCUS_04600 145377 145144 gene locus_tag LOCUS_04610 145377 145144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 145286 146140 gene locus_tag LOCUS_04620 145286 146140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 147117 146188 gene locus_tag LOCUS_04630 147117 146188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 147393 147680 gene locus_tag LOCUS_04640 147393 147680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 147994 149064 gene locus_tag LOCUS_04650 147994 149064 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_04650 149443 150825 gene locus_tag LOCUS_04660 149443 150825 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228682.1 protein_id gnl|my_center|LOCUS_04660 150896 151813 gene locus_tag LOCUS_04670 150896 151813 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_04670 151826 152827 gene locus_tag LOCUS_04680 151826 152827 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972133.1 protein_id gnl|my_center|LOCUS_04680 152979 154541 gene locus_tag LOCUS_04690 152979 154541 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131344932.1 protein_id gnl|my_center|LOCUS_04690 155144 154716 gene locus_tag LOCUS_04700 155144 154716 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466680.1 protein_id gnl|my_center|LOCUS_04700 155169 155381 gene locus_tag LOCUS_04710 155169 155381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 155629 157248 gene locus_tag LOCUS_04720 155629 157248 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225946.1 protein_id gnl|my_center|LOCUS_04720 158137 157286 gene locus_tag LOCUS_04730 gene mshB 158137 157286 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_04730 159289 158261 gene locus_tag LOCUS_04740 159289 158261 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_04740 160463 159528 gene locus_tag LOCUS_04750 160463 159528 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030134.1 protein_id gnl|my_center|LOCUS_04750 160605 161744 gene locus_tag LOCUS_04760 gene galK 160605 161744 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_04760 162352 161876 gene locus_tag LOCUS_04770 162352 161876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 162579 162376 gene locus_tag LOCUS_04780 162579 162376 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_04780 163737 162958 gene locus_tag LOCUS_04790 163737 162958 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225677.1 protein_id gnl|my_center|LOCUS_04790 165096 163954 gene locus_tag LOCUS_04800 165096 163954 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848418.1 protein_id gnl|my_center|LOCUS_04800 165705 165632 gene locus_tag LOCUS_t00020 165705 165632 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 165929 166234 gene locus_tag LOCUS_04810 165929 166234 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326153.1 protein_id gnl|my_center|LOCUS_04810 166851 166417 gene locus_tag LOCUS_04820 166851 166417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 168135 167032 gene locus_tag LOCUS_04830 168135 167032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 170184 168313 gene locus_tag LOCUS_04840 gene dnaG 170184 168313 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228362.1 protein_id gnl|my_center|LOCUS_04840 170314 171288 gene locus_tag LOCUS_04850 170314 171288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 172608 171373 gene locus_tag LOCUS_04860 172608 171373 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_04860 175489 172829 gene locus_tag LOCUS_04870 gene ppdK 175489 172829 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_04870 176194 176979 gene locus_tag LOCUS_04880 176194 176979 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036395.1 protein_id gnl|my_center|LOCUS_04880 178234 177209 gene locus_tag LOCUS_04890 178234 177209 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_04890 178415 179416 gene locus_tag LOCUS_04900 178415 179416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04900 180364 180029 gene locus_tag LOCUS_04910 180364 180029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 180918 180361 gene locus_tag LOCUS_04920 180918 180361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970379.1 protein_id gnl|my_center|LOCUS_04920 181357 182244 gene locus_tag LOCUS_04930 181357 182244 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230083.1 protein_id gnl|my_center|LOCUS_04930 183314 182433 gene locus_tag LOCUS_04940 183314 182433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029935.1 protein_id gnl|my_center|LOCUS_04940 183711 185405 gene locus_tag LOCUS_04950 183711 185405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 185533 186546 gene locus_tag LOCUS_04960 185533 186546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 186642 187958 gene locus_tag LOCUS_04970 186642 187958 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270408.1 protein_id gnl|my_center|LOCUS_04970 189082 188126 gene locus_tag LOCUS_04980 189082 188126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 189269 190114 gene locus_tag LOCUS_04990 189269 190114 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230668.1 protein_id gnl|my_center|LOCUS_04990 190954 190220 gene locus_tag LOCUS_05000 190954 190220 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_05000 190953 191132 gene locus_tag LOCUS_05010 190953 191132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 192188 191220 gene locus_tag LOCUS_05020 gene ppk2 192188 191220 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978711.1 protein_id gnl|my_center|LOCUS_05020 192335 193132 gene locus_tag LOCUS_05030 192335 193132 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803977.1 protein_id gnl|my_center|LOCUS_05030 194274 193138 gene locus_tag LOCUS_05040 194274 193138 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_05040 194776 195102 gene locus_tag LOCUS_05050 194776 195102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 197415 195181 gene locus_tag LOCUS_05060 197415 195181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 199615 197516 gene locus_tag LOCUS_05070 199615 197516 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_05070 201345 199612 gene locus_tag LOCUS_05080 201345 199612 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_05080 201606 201833 gene locus_tag LOCUS_05090 201606 201833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 201963 202502 gene locus_tag LOCUS_05100 201963 202502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 202696 203535 gene locus_tag LOCUS_05110 202696 203535 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223929.1 protein_id gnl|my_center|LOCUS_05110 203537 203950 gene locus_tag LOCUS_05120 203537 203950 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005123490.1 protein_id gnl|my_center|LOCUS_05120 204403 206508 gene locus_tag LOCUS_05130 204403 206508 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228686.1 protein_id gnl|my_center|LOCUS_05130 207574 206585 gene locus_tag LOCUS_05140 207574 206585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 208257 207574 gene locus_tag LOCUS_05150 208257 207574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 210007 208592 gene locus_tag LOCUS_05160 210007 208592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143229435.1 protein_id gnl|my_center|LOCUS_05160 210243 213380 gene locus_tag LOCUS_05170 210243 213380 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226576.1 protein_id gnl|my_center|LOCUS_05170 215337 213862 gene locus_tag LOCUS_05180 215337 213862 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_05180 215303 215479 gene locus_tag LOCUS_05190 215303 215479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 216455 215556 gene locus_tag LOCUS_05200 216455 215556 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085084614.1 protein_id gnl|my_center|LOCUS_05200 216540 216842 gene locus_tag LOCUS_05210 216540 216842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 216860 217216 gene locus_tag LOCUS_05220 216860 217216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 217393 218022 gene locus_tag LOCUS_05230 217393 218022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 218015 220264 gene locus_tag LOCUS_05240 218015 220264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 220469 221332 gene locus_tag LOCUS_05250 220469 221332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 221405 223240 gene locus_tag LOCUS_05260 221405 223240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 223263 223979 gene locus_tag LOCUS_05270 223263 223979 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_05270 223976 225073 gene locus_tag LOCUS_05280 223976 225073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 225517 226725 gene locus_tag LOCUS_05290 225517 226725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 227935 226787 gene locus_tag LOCUS_05300 227935 226787 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027597.1 protein_id gnl|my_center|LOCUS_05300 229328 227940 gene locus_tag LOCUS_05310 229328 227940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 230616 229984 gene locus_tag LOCUS_05320 230616 229984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 231065 230724 gene locus_tag LOCUS_05330 231065 230724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 232680 231097 gene locus_tag LOCUS_05340 232680 231097 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_05340 234596 232677 gene locus_tag LOCUS_05350 gene glgB 234596 232677 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486244.1 protein_id gnl|my_center|LOCUS_05350 236728 234593 gene locus_tag LOCUS_05360 236728 234593 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031595.1 protein_id gnl|my_center|LOCUS_05360 237680 236838 gene locus_tag LOCUS_05370 237680 236838 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_05370 240073 237677 gene locus_tag LOCUS_05380 240073 237677 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_05380 240587 240081 gene locus_tag LOCUS_05390 240587 240081 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175651.1 protein_id gnl|my_center|LOCUS_05390 241237 240614 gene locus_tag LOCUS_05400 241237 240614 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027476.1 protein_id gnl|my_center|LOCUS_05400 242179 241439 gene locus_tag LOCUS_05410 242179 241439 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170061.1 protein_id gnl|my_center|LOCUS_05410 243736 242414 gene locus_tag LOCUS_05420 243736 242414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 244493 243771 gene locus_tag LOCUS_05430 244493 243771 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920789.1 protein_id gnl|my_center|LOCUS_05430 245746 244493 gene locus_tag LOCUS_05440 245746 244493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 246235 245762 gene locus_tag LOCUS_05450 246235 245762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 246539 246228 gene locus_tag LOCUS_05460 246539 246228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 248685 246541 gene locus_tag LOCUS_05470 gene glgX 248685 246541 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_05470 249026 248682 gene locus_tag LOCUS_05480 249026 248682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 250858 249023 gene locus_tag LOCUS_05490 250858 249023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 251279 250860 gene locus_tag LOCUS_05500 251279 250860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 251893 251279 gene locus_tag LOCUS_05510 251893 251279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 253487 251886 gene locus_tag LOCUS_05520 253487 251886 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947833.1 protein_id gnl|my_center|LOCUS_05520 253879 253499 gene locus_tag LOCUS_05530 253879 253499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 254369 253914 gene locus_tag LOCUS_05540 254369 253914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 254830 254390 gene locus_tag LOCUS_05550 254830 254390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 256576 254930 gene locus_tag LOCUS_05560 gene mdlC 256576 254930 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230262.1 protein_id gnl|my_center|LOCUS_05560 257427 256603 gene locus_tag LOCUS_05570 257427 256603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 257698 257964 gene locus_tag LOCUS_05580 257698 257964 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144139.1 protein_id gnl|my_center|LOCUS_05580 257961 259751 gene locus_tag LOCUS_05590 257961 259751 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_05590 259941 260276 gene locus_tag LOCUS_05600 259941 260276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 260273 260770 gene locus_tag LOCUS_05610 260273 260770 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466823.1 protein_id gnl|my_center|LOCUS_05610 261614 261015 gene locus_tag LOCUS_05620 261614 261015 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_05620 262723 261620 gene locus_tag LOCUS_05630 262723 261620 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_05630 262891 263100 gene locus_tag LOCUS_05640 262891 263100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 264089 263379 gene locus_tag LOCUS_05650 264089 263379 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166534399.1 protein_id gnl|my_center|LOCUS_05650 266102 264279 gene locus_tag LOCUS_05660 266102 264279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 266854 266108 gene locus_tag LOCUS_05670 266854 266108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 protein_id gnl|my_center|LOCUS_05670 267378 266851 gene locus_tag LOCUS_05680 267378 266851 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_05680 269501 267480 gene locus_tag LOCUS_05690 269501 267480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 270133 269741 gene locus_tag LOCUS_05700 270133 269741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 271374 270511 gene locus_tag LOCUS_05710 271374 270511 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228180.1 protein_id gnl|my_center|LOCUS_05710 271776 271387 gene locus_tag LOCUS_05720 271776 271387 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284874.1 protein_id gnl|my_center|LOCUS_05720 272732 271908 gene locus_tag LOCUS_05730 272732 271908 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976615.1 protein_id gnl|my_center|LOCUS_05730 272839 273399 gene locus_tag LOCUS_05740 272839 273399 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227517.1 protein_id gnl|my_center|LOCUS_05740 273585 274802 gene locus_tag LOCUS_05750 273585 274802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 278391 276124 gene locus_tag LOCUS_05760 278391 276124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 280557 278464 gene locus_tag LOCUS_05770 280557 278464 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_05770 282209 280653 gene locus_tag LOCUS_05780 gene pkaE 282209 280653 CDS product serine/threonine protein kinase PkaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028766.1 protein_id gnl|my_center|LOCUS_05780 282505 283617 gene locus_tag LOCUS_05790 282505 283617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05790 284406 283648 gene locus_tag LOCUS_05800 284406 283648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 286324 284420 gene locus_tag LOCUS_05810 286324 284420 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 protein_id gnl|my_center|LOCUS_05810 290457 286324 gene locus_tag LOCUS_05820 gene drmA 290457 286324 CDS product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204892.1 protein_id gnl|my_center|LOCUS_05820 294575 290553 gene locus_tag LOCUS_05830 294575 290553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204891.1 protein_id gnl|my_center|LOCUS_05830 297712 294572 gene locus_tag LOCUS_05840 gene drmD 297712 294572 CDS product DISARM system SNF2-like helicase DrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204890.1 protein_id gnl|my_center|LOCUS_05840 298397 298044 gene locus_tag LOCUS_05850 298397 298044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 298443 300110 gene locus_tag LOCUS_05860 298443 300110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 300278 300661 gene locus_tag LOCUS_05870 300278 300661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 302051 300675 gene locus_tag LOCUS_05880 302051 300675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 305304 302425 gene locus_tag LOCUS_05890 305304 302425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 305775 310385 gene locus_tag LOCUS_05900 305775 310385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 310818 310471 gene locus_tag LOCUS_05910 310818 310471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 311929 311225 gene locus_tag LOCUS_05920 311929 311225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 312142 312720 gene locus_tag LOCUS_05930 312142 312720 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030670.1 protein_id gnl|my_center|LOCUS_05930 312868 313188 gene locus_tag LOCUS_05940 312868 313188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 313185 313496 gene locus_tag LOCUS_05950 313185 313496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 314239 313487 gene locus_tag LOCUS_05960 314239 313487 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742087.1 protein_id gnl|my_center|LOCUS_05960 314492 315202 gene locus_tag LOCUS_05970 314492 315202 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729362.1 protein_id gnl|my_center|LOCUS_05970 315622 317952 gene locus_tag LOCUS_05980 315622 317952 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_05980 317964 320417 gene locus_tag LOCUS_05990 gene nirB 317964 320417 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037170.1 protein_id gnl|my_center|LOCUS_05990 320414 320725 gene locus_tag LOCUS_06000 320414 320725 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190354.1 protein_id gnl|my_center|LOCUS_06000 321071 321274 gene locus_tag LOCUS_06010 321071 321274 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975194.1 protein_id gnl|my_center|LOCUS_06010 323043 321331 gene locus_tag LOCUS_06020 323043 321331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226966.1 protein_id gnl|my_center|LOCUS_06020 324056 323139 gene locus_tag LOCUS_06030 324056 323139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 324164 325150 gene locus_tag LOCUS_06040 324164 325150 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 protein_id gnl|my_center|LOCUS_06040 325183 325581 gene locus_tag LOCUS_06050 325183 325581 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031076.1 protein_id gnl|my_center|LOCUS_06050 325578 326675 gene locus_tag LOCUS_06060 325578 326675 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 protein_id gnl|my_center|LOCUS_06060 326672 327571 gene locus_tag LOCUS_06070 326672 327571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 327571 328596 gene locus_tag LOCUS_06080 327571 328596 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031079.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06080 329235 328510 gene locus_tag LOCUS_06090 329235 328510 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485703.1 protein_id gnl|my_center|LOCUS_06090 329314 329967 gene locus_tag LOCUS_06100 329314 329967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 329960 330775 gene locus_tag LOCUS_06110 329960 330775 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230072.1 protein_id gnl|my_center|LOCUS_06110 331065 331427 gene locus_tag LOCUS_06120 331065 331427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 333052 331649 gene locus_tag LOCUS_06130 333052 331649 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283916.1 protein_id gnl|my_center|LOCUS_06130 333139 334335 gene locus_tag LOCUS_06140 333139 334335 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228776.1 protein_id gnl|my_center|LOCUS_06140 334395 335006 gene locus_tag LOCUS_06150 334395 335006 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220205807.1 protein_id gnl|my_center|LOCUS_06150 335300 334896 gene locus_tag LOCUS_06160 335300 334896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 335251 335664 gene locus_tag LOCUS_06170 335251 335664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 336106 336573 gene locus_tag LOCUS_06180 336106 336573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 338355 336829 gene locus_tag LOCUS_06190 338355 336829 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031786.1 protein_id gnl|my_center|LOCUS_06190 339144 338698 gene locus_tag LOCUS_06200 339144 338698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 340849 339473 gene locus_tag LOCUS_06210 340849 339473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468787.1 protein_id gnl|my_center|LOCUS_06210 341070 341741 gene locus_tag LOCUS_06220 341070 341741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 343442 342345 gene locus_tag LOCUS_06230 343442 342345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 344713 343439 gene locus_tag LOCUS_06240 344713 343439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 347327 344706 gene locus_tag LOCUS_06250 347327 344706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 347498 347340 gene locus_tag LOCUS_06260 347498 347340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 349305 348070 gene locus_tag LOCUS_06270 349305 348070 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228768.1 protein_id gnl|my_center|LOCUS_06270 349625 349302 gene locus_tag LOCUS_06280 349625 349302 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228769.1 protein_id gnl|my_center|LOCUS_06280 350294 349674 gene locus_tag LOCUS_06290 350294 349674 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230676.1 protein_id gnl|my_center|LOCUS_06290 351764 350577 gene locus_tag LOCUS_06300 351764 350577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 355586 352539 gene locus_tag LOCUS_06310 355586 352539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098509933.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06310 357943 355583 gene locus_tag LOCUS_06320 357943 355583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 361971 357940 gene locus_tag LOCUS_06330 361971 357940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 362835 361975 gene locus_tag LOCUS_06340 362835 361975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 366212 363447 gene locus_tag LOCUS_06350 366212 363447 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229233.1 protein_id gnl|my_center|LOCUS_06350 366349 369165 gene locus_tag LOCUS_06360 366349 369165 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225365.1 protein_id gnl|my_center|LOCUS_06360 369256 370050 gene locus_tag LOCUS_06370 369256 370050 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225865.1 protein_id gnl|my_center|LOCUS_06370 370052 370840 gene locus_tag LOCUS_06380 370052 370840 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_06380 371417 372103 gene locus_tag LOCUS_06390 371417 372103 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731436.1 protein_id gnl|my_center|LOCUS_06390 372802 372515 gene locus_tag LOCUS_06400 372802 372515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 372690 373712 gene locus_tag LOCUS_06410 372690 373712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06410 374225 375169 gene locus_tag LOCUS_06420 gene egtD 374225 375169 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027441.1 protein_id gnl|my_center|LOCUS_06420 375206 376087 gene locus_tag LOCUS_06430 375206 376087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 376200 376925 gene locus_tag LOCUS_06440 376200 376925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 378115 376907 gene locus_tag LOCUS_06450 378115 376907 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_06450 378640 379179 gene locus_tag LOCUS_06460 378640 379179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 379281 380558 gene locus_tag LOCUS_06470 379281 380558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 380602 381243 gene locus_tag LOCUS_06480 380602 381243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 381578 381390 gene locus_tag LOCUS_06490 381578 381390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 381502 383313 gene locus_tag LOCUS_06500 381502 383313 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028768.1 protein_id gnl|my_center|LOCUS_06500 383329 383646 gene locus_tag LOCUS_06510 383329 383646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 384432 383563 gene locus_tag LOCUS_06520 384432 383563 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 protein_id gnl|my_center|LOCUS_06520 385028 384429 gene locus_tag LOCUS_06530 gene sigK 385028 384429 CDS product ECF RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314022.1 protein_id gnl|my_center|LOCUS_06530 386530 385109 gene locus_tag LOCUS_06540 386530 385109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 387861 386527 gene locus_tag LOCUS_06550 387861 386527 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270060.1 protein_id gnl|my_center|LOCUS_06550 389306 387915 gene locus_tag LOCUS_06560 389306 387915 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_06560 390128 389520 gene locus_tag LOCUS_06570 390128 389520 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974024.1 protein_id gnl|my_center|LOCUS_06570 390286 391305 gene locus_tag LOCUS_06580 390286 391305 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_06580 391423 391848 gene locus_tag LOCUS_06590 391423 391848 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_06590 392450 391968 gene locus_tag LOCUS_06600 392450 391968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 394008 392443 gene locus_tag LOCUS_06610 394008 392443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 396763 394523 gene locus_tag LOCUS_06620 396763 394523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 397662 396826 gene locus_tag LOCUS_06630 397662 396826 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729466.1 protein_id gnl|my_center|LOCUS_06630 398435 397806 gene locus_tag LOCUS_06640 398435 397806 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027391.1 protein_id gnl|my_center|LOCUS_06640 399651 398503 gene locus_tag LOCUS_06650 gene dgoD 399651 398503 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230776.1 protein_id gnl|my_center|LOCUS_06650 400352 399648 gene locus_tag LOCUS_06660 400352 399648 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230779.1 protein_id gnl|my_center|LOCUS_06660 401127 400381 gene locus_tag LOCUS_06670 401127 400381 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230777.1 protein_id gnl|my_center|LOCUS_06670 402013 401180 gene locus_tag LOCUS_06680 402013 401180 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524829.1 protein_id gnl|my_center|LOCUS_06680 402948 402010 gene locus_tag LOCUS_06690 402948 402010 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530308.1 protein_id gnl|my_center|LOCUS_06690 404246 402951 gene locus_tag LOCUS_06700 404246 402951 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 protein_id gnl|my_center|LOCUS_06700 404922 404767 gene locus_tag LOCUS_06710 404922 404767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 405142 407379 gene locus_tag LOCUS_06720 405142 407379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 408484 407624 gene locus_tag LOCUS_06730 408484 407624 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_06730 408591 409493 gene locus_tag LOCUS_06740 408591 409493 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971873.1 protein_id gnl|my_center|LOCUS_06740 409711 410928 gene locus_tag LOCUS_06750 409711 410928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 411745 411008 gene locus_tag LOCUS_06760 411745 411008 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence006 86 418 gene locus_tag LOCUS_06770 86 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 1210 7293 gene locus_tag LOCUS_06780 1210 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 7290 9338 gene locus_tag LOCUS_06790 7290 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 9439 10059 gene locus_tag LOCUS_06800 9439 10059 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_06800 10076 11119 gene locus_tag LOCUS_06810 10076 11119 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_06810 11243 11488 gene locus_tag LOCUS_06820 11243 11488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 11517 12113 gene locus_tag LOCUS_06830 11517 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 12862 12137 gene locus_tag LOCUS_06840 12862 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 13141 13899 gene locus_tag LOCUS_06850 13141 13899 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_06850 13902 14108 gene locus_tag LOCUS_06860 13902 14108 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_06860 14105 14362 gene locus_tag LOCUS_06870 14105 14362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 14325 14624 gene locus_tag LOCUS_06880 14325 14624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 14749 15018 gene locus_tag LOCUS_06890 14749 15018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 14951 15328 gene locus_tag LOCUS_06900 gene pemK 14951 15328 CDS product type II toxin-antitoxin system toxin endoribonuclease PemK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416110.1 protein_id gnl|my_center|LOCUS_06900 15505 15960 gene locus_tag LOCUS_06910 15505 15960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 15974 16192 gene locus_tag LOCUS_06920 15974 16192 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_06920 16804 16367 gene locus_tag LOCUS_06930 16804 16367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 17933 17166 gene locus_tag LOCUS_06940 17933 17166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 18549 18133 gene locus_tag LOCUS_06950 18549 18133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 18776 19129 gene locus_tag LOCUS_06960 18776 19129 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977977.1 protein_id gnl|my_center|LOCUS_06960 19392 19673 gene locus_tag LOCUS_06970 19392 19673 CDS product MSMEG_0570 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 protein_id gnl|my_center|LOCUS_06970 19670 21166 gene locus_tag LOCUS_06980 19670 21166 CDS product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 protein_id gnl|my_center|LOCUS_06980 21170 21985 gene locus_tag LOCUS_06990 21170 21985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 22245 22757 gene locus_tag LOCUS_07000 22245 22757 CDS product MSMEG_0572 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891993.1 protein_id gnl|my_center|LOCUS_07000 22766 23818 gene locus_tag LOCUS_07010 22766 23818 CDS product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 protein_id gnl|my_center|LOCUS_07010 23824 25530 gene locus_tag LOCUS_07020 23824 25530 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891988.1 protein_id gnl|my_center|LOCUS_07020 25527 26378 gene locus_tag LOCUS_07030 25527 26378 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104253.1 protein_id gnl|my_center|LOCUS_07030 26503 27321 gene locus_tag LOCUS_07040 26503 27321 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727037.1 protein_id gnl|my_center|LOCUS_07040 27506 28576 gene locus_tag LOCUS_07050 27506 28576 CDS product MSMEG_0565 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876802.1 protein_id gnl|my_center|LOCUS_07050 30058 28706 gene locus_tag LOCUS_07060 30058 28706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 31174 30140 gene locus_tag LOCUS_07070 31174 30140 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410743.1 protein_id gnl|my_center|LOCUS_07070 32100 31186 gene locus_tag LOCUS_07080 32100 31186 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892059.1 protein_id gnl|my_center|LOCUS_07080 32921 32097 gene locus_tag LOCUS_07090 32921 32097 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973038.1 protein_id gnl|my_center|LOCUS_07090 33811 32918 gene locus_tag LOCUS_07100 33811 32918 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312137.1 protein_id gnl|my_center|LOCUS_07100 35009 33843 gene locus_tag LOCUS_07110 35009 33843 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145123.1 protein_id gnl|my_center|LOCUS_07110 36600 34984 gene locus_tag LOCUS_07120 36600 34984 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355196.1 protein_id gnl|my_center|LOCUS_07120 36721 37371 gene locus_tag LOCUS_07130 36721 37371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 38166 37630 gene locus_tag LOCUS_07140 38166 37630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 38707 38387 gene locus_tag LOCUS_07150 38707 38387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 39004 39402 gene locus_tag LOCUS_07160 39004 39402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 39760 39434 gene locus_tag LOCUS_07170 39760 39434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 40972 39866 gene locus_tag LOCUS_07180 gene menC 40972 39866 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_07180 42107 41124 gene locus_tag LOCUS_07190 42107 41124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 protein_id gnl|my_center|LOCUS_07190 43279 42104 gene locus_tag LOCUS_07200 43279 42104 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_07200 44831 43389 gene locus_tag LOCUS_07210 44831 43389 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206172.1 protein_id gnl|my_center|LOCUS_07210 44915 45760 gene locus_tag LOCUS_07220 44915 45760 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223077.1 protein_id gnl|my_center|LOCUS_07220 45761 46501 gene locus_tag LOCUS_07230 45761 46501 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028262.1 protein_id gnl|my_center|LOCUS_07230 46498 47772 gene locus_tag LOCUS_07240 46498 47772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 48548 48853 gene locus_tag LOCUS_07250 48548 48853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 50071 49052 gene locus_tag LOCUS_07260 50071 49052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 51236 50931 gene locus_tag LOCUS_07270 51236 50931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 51961 51242 gene locus_tag LOCUS_07280 51961 51242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 52863 52630 gene locus_tag LOCUS_07290 52863 52630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 52867 53175 gene locus_tag LOCUS_07300 52867 53175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 53995 53564 gene locus_tag LOCUS_07310 53995 53564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 54169 54342 gene locus_tag LOCUS_07320 54169 54342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 54326 55045 gene locus_tag LOCUS_07330 54326 55045 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031806.1 protein_id gnl|my_center|LOCUS_07330 55165 55689 gene locus_tag LOCUS_07340 55165 55689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 56545 55901 gene locus_tag LOCUS_07350 gene absA2 56545 55901 CDS product two component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028838.1 protein_id gnl|my_center|LOCUS_07350 57766 56546 gene locus_tag LOCUS_07360 57766 56546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 57879 58790 gene locus_tag LOCUS_07370 57879 58790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973601.1 protein_id gnl|my_center|LOCUS_07370 58787 59548 gene locus_tag LOCUS_07380 58787 59548 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 protein_id gnl|my_center|LOCUS_07380 59588 59821 gene locus_tag LOCUS_07390 59588 59821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 64345 59873 gene locus_tag LOCUS_07400 64345 59873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 65276 64527 gene locus_tag LOCUS_07410 65276 64527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 66235 65273 gene locus_tag LOCUS_07420 66235 65273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 67160 67699 gene locus_tag LOCUS_07430 67160 67699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 68067 67771 gene locus_tag LOCUS_07440 68067 67771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 69170 68154 gene locus_tag LOCUS_07450 69170 68154 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167468068.1 protein_id gnl|my_center|LOCUS_07450 71615 69273 gene locus_tag LOCUS_07460 71615 69273 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224095.1 protein_id gnl|my_center|LOCUS_07460 73733 71697 gene locus_tag LOCUS_07470 73733 71697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 74441 73917 gene locus_tag LOCUS_07480 74441 73917 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_07480 74588 77968 gene locus_tag LOCUS_07490 74588 77968 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 protein_id gnl|my_center|LOCUS_07490 78864 78052 gene locus_tag LOCUS_07500 78864 78052 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 protein_id gnl|my_center|LOCUS_07500 79841 78861 gene locus_tag LOCUS_07510 79841 78861 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 protein_id gnl|my_center|LOCUS_07510 80060 80575 gene locus_tag LOCUS_07520 80060 80575 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_07520 80572 82575 gene locus_tag LOCUS_07530 80572 82575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 85278 82702 gene locus_tag LOCUS_07540 85278 82702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 86869 85583 gene locus_tag LOCUS_07550 86869 85583 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_07550 88205 86994 gene locus_tag LOCUS_07560 88205 86994 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_07560 88310 89758 gene locus_tag LOCUS_07570 88310 89758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 90747 89749 gene locus_tag LOCUS_07580 90747 89749 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973161.1 protein_id gnl|my_center|LOCUS_07580 90959 92941 gene locus_tag LOCUS_07590 90959 92941 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729974.1 protein_id gnl|my_center|LOCUS_07590 92938 93759 gene locus_tag LOCUS_07600 92938 93759 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894144.1 protein_id gnl|my_center|LOCUS_07600 94140 93976 gene locus_tag LOCUS_07610 94140 93976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 94368 94943 gene locus_tag LOCUS_07620 94368 94943 CDS product IS607-like element IS1602 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414146.1 protein_id gnl|my_center|LOCUS_07620 94940 96286 gene locus_tag LOCUS_07630 gene tnpB 94940 96286 CDS product IS607 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083165449.1 protein_id gnl|my_center|LOCUS_07630 96456 97109 gene locus_tag LOCUS_07640 96456 97109 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_07640 97106 98686 gene locus_tag LOCUS_07650 97106 98686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 98948 99259 gene locus_tag LOCUS_07660 98948 99259 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_07660 99276 100088 gene locus_tag LOCUS_07670 99276 100088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030505.1 protein_id gnl|my_center|LOCUS_07670 100354 101733 gene locus_tag LOCUS_07680 100354 101733 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230392.1 protein_id gnl|my_center|LOCUS_07680 102112 101807 gene locus_tag LOCUS_07690 102112 101807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 102191 104743 gene locus_tag LOCUS_07700 gene valS 102191 104743 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_07700 104822 106162 gene locus_tag LOCUS_07710 104822 106162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 106361 106795 gene locus_tag LOCUS_07720 gene dut 106361 106795 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_07720 106818 107486 gene locus_tag LOCUS_07730 106818 107486 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 protein_id gnl|my_center|LOCUS_07730 107547 107936 gene locus_tag LOCUS_07740 107547 107936 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_07740 107933 108697 gene locus_tag LOCUS_07750 107933 108697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 109584 108922 gene locus_tag LOCUS_07760 109584 108922 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_07760 110252 109584 gene locus_tag LOCUS_07770 110252 109584 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_07770 110376 112406 gene locus_tag LOCUS_07780 110376 112406 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973119.1 protein_id gnl|my_center|LOCUS_07780 112403 113668 gene locus_tag LOCUS_07790 112403 113668 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_07790 114134 115354 gene locus_tag LOCUS_07800 114134 115354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 115414 115953 gene locus_tag LOCUS_07810 115414 115953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 116210 116659 gene locus_tag LOCUS_07820 116210 116659 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620822.1 protein_id gnl|my_center|LOCUS_07820 117529 116768 gene locus_tag LOCUS_07830 117529 116768 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803977.1 protein_id gnl|my_center|LOCUS_07830 118047 118625 gene locus_tag LOCUS_07840 118047 118625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07840 118714 119001 gene locus_tag LOCUS_07850 118714 119001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 120019 119027 gene locus_tag LOCUS_07860 120019 119027 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971796.1 protein_id gnl|my_center|LOCUS_07860 120166 121026 gene locus_tag LOCUS_07870 120166 121026 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_07870 121810 121160 gene locus_tag LOCUS_07880 121810 121160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 122633 122031 gene locus_tag LOCUS_07890 122633 122031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 123384 122641 gene locus_tag LOCUS_07900 123384 122641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 123739 124494 gene locus_tag LOCUS_07910 123739 124494 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 protein_id gnl|my_center|LOCUS_07910 124779 127568 gene locus_tag LOCUS_07920 gene acnA 124779 127568 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_07920 127798 128997 gene locus_tag LOCUS_07930 127798 128997 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_07930 129057 129782 gene locus_tag LOCUS_07940 129057 129782 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731052.1 protein_id gnl|my_center|LOCUS_07940 130014 131135 gene locus_tag LOCUS_07950 130014 131135 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897421.1 protein_id gnl|my_center|LOCUS_07950 131240 132016 gene locus_tag LOCUS_07960 131240 132016 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224454.1 protein_id gnl|my_center|LOCUS_07960 132013 133266 gene locus_tag LOCUS_07970 132013 133266 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 protein_id gnl|my_center|LOCUS_07970 133331 134533 gene locus_tag LOCUS_07980 133331 134533 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224456.1 protein_id gnl|my_center|LOCUS_07980 135373 134564 gene locus_tag LOCUS_07990 135373 134564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 135810 137768 gene locus_tag LOCUS_08000 gene dxs 135810 137768 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_08000 137892 139367 gene locus_tag LOCUS_08010 137892 139367 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972907.1 protein_id gnl|my_center|LOCUS_08010 139440 140501 gene locus_tag LOCUS_08020 139440 140501 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228701.1 protein_id gnl|my_center|LOCUS_08020 141834 140587 gene locus_tag LOCUS_08030 141834 140587 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_08030 142433 141831 gene locus_tag LOCUS_08040 142433 141831 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_08040 143164 144201 gene locus_tag LOCUS_08050 gene hemE 143164 144201 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_08050 145522 144209 gene locus_tag LOCUS_08060 145522 144209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 145725 147173 gene locus_tag LOCUS_08070 gene hemG 145725 147173 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_08070 147224 147925 gene locus_tag LOCUS_08080 147224 147925 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_08080 148102 148752 gene locus_tag LOCUS_08090 148102 148752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 149017 148796 gene locus_tag LOCUS_08100 149017 148796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 149571 149167 gene locus_tag LOCUS_08110 gene msrB 149571 149167 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224520.1 protein_id gnl|my_center|LOCUS_08110 149757 150854 gene locus_tag LOCUS_08120 gene ligD 149757 150854 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_08120 151042 151536 gene locus_tag LOCUS_08130 151042 151536 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730834.1 protein_id gnl|my_center|LOCUS_08130 152934 151657 gene locus_tag LOCUS_08140 152934 151657 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742198.1 protein_id gnl|my_center|LOCUS_08140 154383 153196 gene locus_tag LOCUS_08150 154383 153196 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930093.1 protein_id gnl|my_center|LOCUS_08150 154596 155966 gene locus_tag LOCUS_08160 154596 155966 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031093.1 protein_id gnl|my_center|LOCUS_08160 156685 156083 gene locus_tag LOCUS_08170 156685 156083 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972077.1 protein_id gnl|my_center|LOCUS_08170 156758 157573 gene locus_tag LOCUS_08180 156758 157573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 158777 157617 gene locus_tag LOCUS_08190 158777 157617 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031122.1 protein_id gnl|my_center|LOCUS_08190 159496 158774 gene locus_tag LOCUS_08200 159496 158774 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030623.1 protein_id gnl|my_center|LOCUS_08200 161683 159551 gene locus_tag LOCUS_08210 gene glgX 161683 159551 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224463.1 protein_id gnl|my_center|LOCUS_08210 162468 162040 gene locus_tag LOCUS_08220 162468 162040 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_08220 163560 162673 gene locus_tag LOCUS_08230 163560 162673 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727741.1 protein_id gnl|my_center|LOCUS_08230 165390 163762 gene locus_tag LOCUS_08240 165390 163762 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_08240 165534 166091 gene locus_tag LOCUS_08250 gene sigK 165534 166091 CDS product ECF RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466900.1 protein_id gnl|my_center|LOCUS_08250 166088 167200 gene locus_tag LOCUS_08260 166088 167200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 167463 168335 gene locus_tag LOCUS_08270 167463 168335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 169175 168540 gene locus_tag LOCUS_08280 169175 168540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 169802 169356 gene locus_tag LOCUS_08290 169802 169356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 170719 169799 gene locus_tag LOCUS_08300 170719 169799 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_08300 170955 171536 gene locus_tag LOCUS_08310 170955 171536 CDS product chloramphenicol phosphotransferase CPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899406.1 protein_id gnl|my_center|LOCUS_08310 172099 171692 gene locus_tag LOCUS_08320 172099 171692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 172347 172096 gene locus_tag LOCUS_08330 172347 172096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 172518 173441 gene locus_tag LOCUS_08340 172518 173441 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_08340 173446 173679 gene locus_tag LOCUS_08350 173446 173679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 174691 173996 gene locus_tag LOCUS_08360 174691 173996 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066904909.1 protein_id gnl|my_center|LOCUS_08360 174769 177303 gene locus_tag LOCUS_08370 gene xdh 174769 177303 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_08370 177300 178217 gene locus_tag LOCUS_08380 177300 178217 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640561.1 protein_id gnl|my_center|LOCUS_08380 179022 178165 gene locus_tag LOCUS_08390 179022 178165 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030650.1 protein_id gnl|my_center|LOCUS_08390 179956 179228 gene locus_tag LOCUS_08400 179956 179228 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_08400 180176 180033 gene locus_tag LOCUS_08410 180176 180033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972819.1 protein_id gnl|my_center|LOCUS_08410 181855 180173 gene locus_tag LOCUS_08420 gene sirA 181855 180173 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_08420 183088 182270 gene locus_tag LOCUS_08430 183088 182270 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110556.1 protein_id gnl|my_center|LOCUS_08430 183075 183293 gene locus_tag LOCUS_08440 183075 183293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 184348 183290 gene locus_tag LOCUS_08450 184348 183290 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230546.1 protein_id gnl|my_center|LOCUS_08450 184503 185612 gene locus_tag LOCUS_08460 184503 185612 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230545.1 protein_id gnl|my_center|LOCUS_08460 185996 186931 gene locus_tag LOCUS_08470 185996 186931 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972813.1 protein_id gnl|my_center|LOCUS_08470 187043 188296 gene locus_tag LOCUS_08480 187043 188296 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_08480 188515 189615 gene locus_tag LOCUS_08490 gene rsgA 188515 189615 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_08490 190351 190040 gene locus_tag LOCUS_08500 190351 190040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 191379 190474 gene locus_tag LOCUS_08510 191379 190474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 193693 192026 gene locus_tag LOCUS_08520 193693 192026 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027283.1 protein_id gnl|my_center|LOCUS_08520 193756 195381 gene locus_tag LOCUS_08530 193756 195381 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484466.1 protein_id gnl|my_center|LOCUS_08530 195472 197145 gene locus_tag LOCUS_08540 195472 197145 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971785.1 protein_id gnl|my_center|LOCUS_08540 199609 197177 gene locus_tag LOCUS_08550 199609 197177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 201161 199785 gene locus_tag LOCUS_08560 201161 199785 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_08560 202567 201164 gene locus_tag LOCUS_08570 gene fdrA 202567 201164 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098407.1 protein_id gnl|my_center|LOCUS_08570 203841 202927 gene locus_tag LOCUS_08580 203841 202927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 203999 205564 gene locus_tag LOCUS_08590 203999 205564 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393615.1 protein_id gnl|my_center|LOCUS_08590 206077 205640 gene locus_tag LOCUS_08600 206077 205640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 206770 206084 gene locus_tag LOCUS_08610 206770 206084 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411885.1 protein_id gnl|my_center|LOCUS_08610 207789 207115 gene locus_tag LOCUS_08620 207789 207115 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222779.1 protein_id gnl|my_center|LOCUS_08620 207890 208312 gene locus_tag LOCUS_08630 207890 208312 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230629.1 protein_id gnl|my_center|LOCUS_08630 209645 208440 gene locus_tag LOCUS_08640 209645 208440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 210157 209642 gene locus_tag LOCUS_08650 210157 209642 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222096.1 protein_id gnl|my_center|LOCUS_08650 210605 211975 gene locus_tag LOCUS_08660 210605 211975 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977375.1 protein_id gnl|my_center|LOCUS_08660 211972 212883 gene locus_tag LOCUS_08670 211972 212883 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_08670 212962 213480 gene locus_tag LOCUS_08680 212962 213480 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_08680 213535 215925 gene locus_tag LOCUS_08690 213535 215925 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807632.1 protein_id gnl|my_center|LOCUS_08690 216177 215995 gene locus_tag LOCUS_08700 216177 215995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 217119 216190 gene locus_tag LOCUS_08710 gene cydB 217119 216190 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 protein_id gnl|my_center|LOCUS_08710 218667 217129 gene locus_tag LOCUS_08720 218667 217129 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_08720 219655 218873 gene locus_tag LOCUS_08730 219655 218873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 219567 219965 gene locus_tag LOCUS_08740 219567 219965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 220541 221308 gene locus_tag LOCUS_08750 220541 221308 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259307.1 protein_id gnl|my_center|LOCUS_08750 221532 222434 gene locus_tag LOCUS_08760 221532 222434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 223166 222504 gene locus_tag LOCUS_08770 223166 222504 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285024.1 protein_id gnl|my_center|LOCUS_08770 224703 223291 gene locus_tag LOCUS_08780 224703 223291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 224972 227083 gene locus_tag LOCUS_08790 224972 227083 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067631220.1 protein_id gnl|my_center|LOCUS_08790 227080 228933 gene locus_tag LOCUS_08800 227080 228933 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258126.1 protein_id gnl|my_center|LOCUS_08800 229145 229714 gene locus_tag LOCUS_08810 229145 229714 CDS product IS607-like element IS1602 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950774.1 protein_id gnl|my_center|LOCUS_08810 229711 230931 gene locus_tag LOCUS_08820 gene tnpB 229711 230931 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886824.1 protein_id gnl|my_center|LOCUS_08820 231280 231672 gene locus_tag LOCUS_08830 231280 231672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 231930 232238 gene locus_tag LOCUS_08840 231930 232238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 236307 232348 gene locus_tag LOCUS_08850 236307 232348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086837825.1 protein_id gnl|my_center|LOCUS_08850 237114 238082 gene locus_tag LOCUS_08860 gene pip 237114 238082 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925856.1 protein_id gnl|my_center|LOCUS_08860 240063 238300 gene locus_tag LOCUS_08870 240063 238300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 240863 242989 gene locus_tag LOCUS_08880 240863 242989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 243464 243039 gene locus_tag LOCUS_08890 243464 243039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 243439 243609 gene locus_tag LOCUS_08900 243439 243609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 244767 243715 gene locus_tag LOCUS_08910 244767 243715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 245006 246331 gene locus_tag LOCUS_08920 245006 246331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 246687 246385 gene locus_tag LOCUS_08930 246687 246385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 246805 247269 gene locus_tag LOCUS_08940 246805 247269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 249300 247276 gene locus_tag LOCUS_08950 249300 247276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 250272 249757 gene locus_tag LOCUS_08960 250272 249757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08960 250716 250303 gene locus_tag LOCUS_08970 250716 250303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08970 251930 250734 gene locus_tag LOCUS_08980 251930 250734 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222135.1 protein_id gnl|my_center|LOCUS_08980 252316 252005 gene locus_tag LOCUS_08990 252316 252005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 253245 252364 gene locus_tag LOCUS_09000 253245 252364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 254737 253316 gene locus_tag LOCUS_09010 254737 253316 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_09010 257633 254811 gene locus_tag LOCUS_09020 257633 254811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 258259 259713 gene locus_tag LOCUS_09030 258259 259713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 260493 259864 gene locus_tag LOCUS_09040 260493 259864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 260845 260991 gene locus_tag LOCUS_09050 260845 260991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 260964 261176 gene locus_tag LOCUS_09060 260964 261176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 261157 262476 gene locus_tag LOCUS_09070 261157 262476 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728197.1 protein_id gnl|my_center|LOCUS_09070 262473 264011 gene locus_tag LOCUS_09080 262473 264011 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728196.1 protein_id gnl|my_center|LOCUS_09080 265364 264123 gene locus_tag LOCUS_09090 265364 264123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 265878 265357 gene locus_tag LOCUS_09100 265878 265357 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838322.1 protein_id gnl|my_center|LOCUS_09100 266303 265875 gene locus_tag LOCUS_09110 266303 265875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 266731 266300 gene locus_tag LOCUS_09120 266731 266300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 267593 266769 gene locus_tag LOCUS_09130 267593 266769 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224126.1 protein_id gnl|my_center|LOCUS_09130 268729 267719 gene locus_tag LOCUS_09140 268729 267719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 268985 270154 gene locus_tag LOCUS_09150 268985 270154 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_09150 270223 270420 gene locus_tag LOCUS_09160 270223 270420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 270482 270835 gene locus_tag LOCUS_09170 270482 270835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 271190 270852 gene locus_tag LOCUS_09180 271190 270852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 271455 272363 gene locus_tag LOCUS_09190 gene arcC 271455 272363 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_09190 272487 273593 gene locus_tag LOCUS_09200 272487 273593 CDS product ring-opening amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393610.1 protein_id gnl|my_center|LOCUS_09200 273755 274327 gene locus_tag LOCUS_09210 273755 274327 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027875.1 protein_id gnl|my_center|LOCUS_09210 274591 275472 gene locus_tag LOCUS_09220 274591 275472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 275554 276732 gene locus_tag LOCUS_09230 gene aroC 275554 276732 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_09230 276729 277235 gene locus_tag LOCUS_09240 276729 277235 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027814.1 protein_id gnl|my_center|LOCUS_09240 277232 278308 gene locus_tag LOCUS_09250 gene aroB 277232 278308 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_09250 278447 278878 gene locus_tag LOCUS_09260 gene aroQ 278447 278878 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052141.1 protein_id gnl|my_center|LOCUS_09260 278878 279642 gene locus_tag LOCUS_09270 278878 279642 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 protein_id gnl|my_center|LOCUS_09270 281956 279686 gene locus_tag LOCUS_09280 281956 279686 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_09280 282249 283853 gene locus_tag LOCUS_09290 282249 283853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09290 284040 285611 gene locus_tag LOCUS_09300 284040 285611 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973724.1 protein_id gnl|my_center|LOCUS_09300 285909 285634 gene locus_tag LOCUS_09310 285909 285634 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727177.1 protein_id gnl|my_center|LOCUS_09310 286304 286128 gene locus_tag LOCUS_09320 286304 286128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 286270 286638 gene locus_tag LOCUS_09330 286270 286638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 286694 287035 gene locus_tag LOCUS_09340 286694 287035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 287032 287502 gene locus_tag LOCUS_09350 287032 287502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 288838 287642 gene locus_tag LOCUS_09360 288838 287642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 290355 289357 gene locus_tag LOCUS_09370 290355 289357 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_09370 290522 291742 gene locus_tag LOCUS_09380 290522 291742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 protein_id gnl|my_center|LOCUS_09380 292056 292937 gene locus_tag LOCUS_09390 292056 292937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 293172 293705 gene locus_tag LOCUS_09400 293172 293705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 293695 295458 gene locus_tag LOCUS_09410 293695 295458 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053633.1 protein_id gnl|my_center|LOCUS_09410 295654 296307 gene locus_tag LOCUS_09420 295654 296307 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013585.1 protein_id gnl|my_center|LOCUS_09420 297655 296270 gene locus_tag LOCUS_09430 297655 296270 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_09430 298694 297660 gene locus_tag LOCUS_09440 298694 297660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 299686 298691 gene locus_tag LOCUS_09450 299686 298691 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_09450 300700 299747 gene locus_tag LOCUS_09460 300700 299747 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_09460 301926 300709 gene locus_tag LOCUS_09470 301926 300709 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_09470 302207 303574 gene locus_tag LOCUS_09480 302207 303574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 303571 304920 gene locus_tag LOCUS_09490 gene hfsF 303571 304920 CDS product polysaccharide biosynthesis protein HsfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920284.1 protein_id gnl|my_center|LOCUS_09490 306990 305971 gene locus_tag LOCUS_09500 306990 305971 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703802.1 protein_id gnl|my_center|LOCUS_09500 307933 306983 gene locus_tag LOCUS_09510 307933 306983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 308336 308067 gene locus_tag LOCUS_09520 308336 308067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 308245 309312 gene locus_tag LOCUS_09530 308245 309312 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_09530 309309 310289 gene locus_tag LOCUS_09540 gene rfbB 309309 310289 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_09540 312655 310298 gene locus_tag LOCUS_09550 312655 310298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 313451 312756 gene locus_tag LOCUS_09560 313451 312756 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_09560 313709 314869 gene locus_tag LOCUS_09570 gene rffA 313709 314869 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 protein_id gnl|my_center|LOCUS_09570 314869 315672 gene locus_tag LOCUS_09580 314869 315672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 316624 315701 gene locus_tag LOCUS_09590 316624 315701 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_09590 319409 317025 gene locus_tag LOCUS_09600 319409 317025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 320791 319532 gene locus_tag LOCUS_09610 320791 319532 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257976.1 protein_id gnl|my_center|LOCUS_09610 320790 321107 gene locus_tag LOCUS_09620 320790 321107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 321128 322663 gene locus_tag LOCUS_09630 321128 322663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 323137 323919 gene locus_tag LOCUS_09640 323137 323919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 323988 324632 gene locus_tag LOCUS_09650 323988 324632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09650 325529 324813 gene locus_tag LOCUS_09660 325529 324813 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_09660 327227 325806 gene locus_tag LOCUS_09670 327227 325806 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031455.1 protein_id gnl|my_center|LOCUS_09670 327437 328270 gene locus_tag LOCUS_09680 327437 328270 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031456.1 protein_id gnl|my_center|LOCUS_09680 329057 328311 gene locus_tag LOCUS_09690 329057 328311 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_09690 330112 329159 gene locus_tag LOCUS_09700 330112 329159 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_09700 330616 331296 gene locus_tag LOCUS_09710 330616 331296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 331314 334535 gene locus_tag LOCUS_09720 331314 334535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 336092 334551 gene locus_tag LOCUS_09730 336092 334551 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384516.1 protein_id gnl|my_center|LOCUS_09730 336676 336332 gene locus_tag LOCUS_09740 336676 336332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 337054 343869 gene locus_tag LOCUS_09750 337054 343869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 344459 344779 gene locus_tag LOCUS_09760 344459 344779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 345599 345246 gene locus_tag LOCUS_09770 345599 345246 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081659.1 protein_id gnl|my_center|LOCUS_09770 345737 347350 gene locus_tag LOCUS_09780 345737 347350 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850841.1 protein_id gnl|my_center|LOCUS_09780 347347 349035 gene locus_tag LOCUS_09790 347347 349035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 349165 350226 gene locus_tag LOCUS_09800 349165 350226 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029875.1 protein_id gnl|my_center|LOCUS_09800 350516 353197 gene locus_tag LOCUS_09810 350516 353197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 351536 351611 gene locus_tag LOCUS_t00030 351536 351611 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 353462 354676 gene locus_tag LOCUS_09820 353462 354676 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495359.1 protein_id gnl|my_center|LOCUS_09820 355572 354928 gene locus_tag LOCUS_09830 355572 354928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 355891 356187 gene locus_tag LOCUS_09840 355891 356187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 356268 357677 gene locus_tag LOCUS_09850 356268 357677 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_09850 357790 359004 gene locus_tag LOCUS_09860 357790 359004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 360586 359060 gene locus_tag LOCUS_09870 360586 359060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09870 362355 360862 gene locus_tag LOCUS_09880 362355 360862 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230396.1 protein_id gnl|my_center|LOCUS_09880 362560 363687 gene locus_tag LOCUS_09890 362560 363687 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_09890 363722 368002 gene locus_tag LOCUS_09900 363722 368002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 368186 368740 gene locus_tag LOCUS_09910 368186 368740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 369476 368778 gene locus_tag LOCUS_09920 369476 368778 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_09920 369818 370288 gene locus_tag LOCUS_09930 369818 370288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 370356 371507 gene locus_tag LOCUS_09940 370356 371507 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030090.1 protein_id gnl|my_center|LOCUS_09940 374280 371530 gene locus_tag LOCUS_09950 374280 371530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 375155 374274 gene locus_tag LOCUS_09960 375155 374274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 375462 376031 gene locus_tag LOCUS_09970 375462 376031 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_09970 378305 376065 gene locus_tag LOCUS_09980 378305 376065 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 protein_id gnl|my_center|LOCUS_09980 378479 379834 gene locus_tag LOCUS_09990 378479 379834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 381186 380314 gene locus_tag LOCUS_10000 381186 380314 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_10000 382173 381190 gene locus_tag LOCUS_10010 382173 381190 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_10010 383003 382380 gene locus_tag LOCUS_10020 383003 382380 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028578.1 protein_id gnl|my_center|LOCUS_10020 383080 384669 gene locus_tag LOCUS_10030 383080 384669 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_10030 384672 386729 gene locus_tag LOCUS_10040 384672 386729 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229660.1 protein_id gnl|my_center|LOCUS_10040 386729 387769 gene locus_tag LOCUS_10050 386729 387769 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222886.1 protein_id gnl|my_center|LOCUS_10050 387775 388944 gene locus_tag LOCUS_10060 387775 388944 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_10060 389107 389547 gene locus_tag LOCUS_10070 389107 389547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 389846 390274 gene locus_tag LOCUS_10080 389846 390274 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239004.1 protein_id gnl|my_center|LOCUS_10080 392306 390480 gene locus_tag LOCUS_10090 392306 390480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 393878 392727 gene locus_tag LOCUS_10100 393878 392727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 394935 393985 gene locus_tag LOCUS_10110 394935 393985 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 protein_id gnl|my_center|LOCUS_10110 395039 396601 gene locus_tag LOCUS_10120 395039 396601 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223948.1 protein_id gnl|my_center|LOCUS_10120 396839 397477 gene locus_tag LOCUS_10130 396839 397477 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972222.1 protein_id gnl|my_center|LOCUS_10130 398130 397537 gene locus_tag LOCUS_10140 398130 397537 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226517.1 protein_id gnl|my_center|LOCUS_10140 398285 398767 gene locus_tag LOCUS_10150 398285 398767 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971366.1 protein_id gnl|my_center|LOCUS_10150 399077 398817 gene locus_tag LOCUS_10160 399077 398817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 400004 399153 gene locus_tag LOCUS_10170 400004 399153 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_10170 400319 400077 gene locus_tag LOCUS_10180 400319 400077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 401549 400743 gene locus_tag LOCUS_10190 401549 400743 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_10190 403510 401546 gene locus_tag LOCUS_10200 403510 401546 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 protein_id gnl|my_center|LOCUS_10200 405107 403515 gene locus_tag LOCUS_10210 405107 403515 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974603.1 protein_id gnl|my_center|LOCUS_10210 405043 405342 gene locus_tag LOCUS_10220 405043 405342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 407039 405240 gene locus_tag LOCUS_10230 407039 405240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 408497 407139 gene locus_tag LOCUS_10240 408497 407139 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975885.1 protein_id gnl|my_center|LOCUS_10240 408867 411632 gene locus_tag LOCUS_10250 408867 411632 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_10250 411852 412790 gene locus_tag LOCUS_10260 411852 412790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 412861 414165 gene locus_tag LOCUS_10270 412861 414165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 414162 414461 gene locus_tag LOCUS_10280 414162 414461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 415732 414539 gene locus_tag LOCUS_10290 415732 414539 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027320.1 protein_id gnl|my_center|LOCUS_10290 415935 416303 gene locus_tag LOCUS_10300 415935 416303 CDS product DUF5335 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880739.1 protein_id gnl|my_center|LOCUS_10300 416472 416909 gene locus_tag LOCUS_10310 416472 416909 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_10310 417950 416970 gene locus_tag LOCUS_10320 417950 416970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 419144 418188 gene locus_tag LOCUS_10330 419144 418188 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730373.1 protein_id gnl|my_center|LOCUS_10330 420294 419464 gene locus_tag LOCUS_10340 420294 419464 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192727398.1 protein_id gnl|my_center|LOCUS_10340 421186 420311 gene locus_tag LOCUS_10350 421186 420311 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728191.1 protein_id gnl|my_center|LOCUS_10350 421348 421974 gene locus_tag LOCUS_10360 421348 421974 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056875.1 protein_id gnl|my_center|LOCUS_10360 422665 421997 gene locus_tag LOCUS_10370 422665 421997 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225955710.1 protein_id gnl|my_center|LOCUS_10370 423184 423762 gene locus_tag LOCUS_10380 423184 423762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 423975 424919 gene locus_tag LOCUS_10390 423975 424919 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529113.1 protein_id gnl|my_center|LOCUS_10390 425666 425016 gene locus_tag LOCUS_10400 425666 425016 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526504.1 protein_id gnl|my_center|LOCUS_10400 426059 425829 gene locus_tag LOCUS_10410 426059 425829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 425958 426797 gene locus_tag LOCUS_10420 425958 426797 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031087.1 protein_id gnl|my_center|LOCUS_10420 426928 427515 gene locus_tag LOCUS_10430 426928 427515 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225955710.1 protein_id gnl|my_center|LOCUS_10430 428233 427601 gene locus_tag LOCUS_10440 428233 427601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 428369 428758 gene locus_tag LOCUS_10450 428369 428758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 428799 429017 gene locus_tag LOCUS_10460 428799 429017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 429209 429478 gene locus_tag LOCUS_10470 429209 429478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 430165 430569 gene locus_tag LOCUS_10480 430165 430569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 430902 432194 gene locus_tag LOCUS_10490 430902 432194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 433023 432724 gene locus_tag LOCUS_10500 433023 432724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10500 433224 433463 gene locus_tag LOCUS_10510 433224 433463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 435038 433437 gene locus_tag LOCUS_10520 435038 433437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 435306 435836 gene locus_tag LOCUS_10530 435306 435836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 435959 437152 gene locus_tag LOCUS_10540 435959 437152 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_10540 437291 438064 gene locus_tag LOCUS_10550 437291 438064 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_10550 438061 438756 gene locus_tag LOCUS_10560 438061 438756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 438764 440494 gene locus_tag LOCUS_10570 438764 440494 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027655.1 protein_id gnl|my_center|LOCUS_10570 440752 441045 gene locus_tag LOCUS_10580 440752 441045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 441038 442648 gene locus_tag LOCUS_10590 441038 442648 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 protein_id gnl|my_center|LOCUS_10590 443960 442767 gene locus_tag LOCUS_10600 443960 442767 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889484.1 protein_id gnl|my_center|LOCUS_10600 444733 444077 gene locus_tag LOCUS_10610 444733 444077 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225902.1 protein_id gnl|my_center|LOCUS_10610 445833 444730 gene locus_tag LOCUS_10620 445833 444730 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 protein_id gnl|my_center|LOCUS_10620 445965 447452 gene locus_tag LOCUS_10630 445965 447452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103962448.1 protein_id gnl|my_center|LOCUS_10630 449282 447594 gene locus_tag LOCUS_10640 gene polX 449282 447594 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_10640 450370 449396 gene locus_tag LOCUS_10650 450370 449396 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930069.1 protein_id gnl|my_center|LOCUS_10650 450823 450449 gene locus_tag LOCUS_10660 gene catR 450823 450449 CDS product catDE operon transcriptional regulator CatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242888.1 protein_id gnl|my_center|LOCUS_10660 450883 451272 gene locus_tag LOCUS_10670 450883 451272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 452345 451407 gene locus_tag LOCUS_10680 452345 451407 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_10680 453305 452430 gene locus_tag LOCUS_10690 453305 452430 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776970.1 protein_id gnl|my_center|LOCUS_10690 453990 453346 gene locus_tag LOCUS_10700 453990 453346 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776971.1 protein_id gnl|my_center|LOCUS_10700 454975 454004 gene locus_tag LOCUS_10710 454975 454004 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776972.1 protein_id gnl|my_center|LOCUS_10710 455088 456233 gene locus_tag LOCUS_10720 455088 456233 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030660.1 protein_id gnl|my_center|LOCUS_10720 457217 456243 gene locus_tag LOCUS_10730 457217 456243 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845576.1 protein_id gnl|my_center|LOCUS_10730 457577 457248 gene locus_tag LOCUS_10740 457577 457248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 457627 458970 gene locus_tag LOCUS_10750 457627 458970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 459111 459764 gene locus_tag LOCUS_10760 gene pnuC 459111 459764 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088340.1 protein_id gnl|my_center|LOCUS_10760 459761 460876 gene locus_tag LOCUS_10770 459761 460876 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_10770 461848 460892 gene locus_tag LOCUS_10780 461848 460892 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_10780 461872 463014 gene locus_tag LOCUS_10790 461872 463014 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104159.1 protein_id gnl|my_center|LOCUS_10790 463394 464875 gene locus_tag LOCUS_10800 463394 464875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 465274 466041 gene locus_tag LOCUS_10810 465274 466041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 466041 466703 gene locus_tag LOCUS_10820 466041 466703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 466760 467803 gene locus_tag LOCUS_10830 466760 467803 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_10830 467915 468058 gene locus_tag LOCUS_10840 467915 468058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 471626 468264 gene locus_tag LOCUS_10850 471626 468264 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_10850 471992 473326 gene locus_tag LOCUS_10860 471992 473326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 474794 473604 gene locus_tag LOCUS_10870 474794 473604 CDS product TIGR03118 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928497.1 protein_id gnl|my_center|LOCUS_10870 475593 477101 gene locus_tag LOCUS_10880 475593 477101 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776894.1 protein_id gnl|my_center|LOCUS_10880 477180 477977 gene locus_tag LOCUS_10890 477180 477977 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_10890 478110 479018 gene locus_tag LOCUS_10900 478110 479018 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230684.1 protein_id gnl|my_center|LOCUS_10900 479015 479794 gene locus_tag LOCUS_10910 479015 479794 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969653.1 protein_id gnl|my_center|LOCUS_10910 480090 480455 gene locus_tag LOCUS_10920 480090 480455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 481213 480527 gene locus_tag LOCUS_10930 481213 480527 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228758.1 protein_id gnl|my_center|LOCUS_10930 483047 481323 gene locus_tag LOCUS_10940 gene araD 483047 481323 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028032.1 protein_id gnl|my_center|LOCUS_10940 484220 483099 gene locus_tag LOCUS_10950 484220 483099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731583.1 protein_id gnl|my_center|LOCUS_10950 484414 485871 gene locus_tag LOCUS_10960 484414 485871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731144.1 protein_id gnl|my_center|LOCUS_10960 486620 485898 gene locus_tag LOCUS_10970 486620 485898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027585.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10970 486546 486764 gene locus_tag LOCUS_10980 486546 486764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 487562 487002 gene locus_tag LOCUS_10990 487562 487002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 488963 487698 gene locus_tag LOCUS_11000 488963 487698 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894372.1 protein_id gnl|my_center|LOCUS_11000 489888 489061 gene locus_tag LOCUS_11010 489888 489061 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_11010 490448 490684 gene locus_tag LOCUS_11020 490448 490684 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_11020 490823 491728 gene locus_tag LOCUS_11030 490823 491728 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_11030 493027 491816 gene locus_tag LOCUS_11040 493027 491816 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031811.1 protein_id gnl|my_center|LOCUS_11040 493547 493335 gene locus_tag LOCUS_11050 493547 493335 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_11050 493807 493595 gene locus_tag LOCUS_11060 493807 493595 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_11060 494155 493943 gene locus_tag LOCUS_11070 494155 493943 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_11070 494967 494146 gene locus_tag LOCUS_11080 494967 494146 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028937.1 protein_id gnl|my_center|LOCUS_11080 495328 496137 gene locus_tag LOCUS_11090 495328 496137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 497358 496306 gene locus_tag LOCUS_11100 497358 496306 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_11100 497556 498422 gene locus_tag LOCUS_11110 497556 498422 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_11110 500650 498509 gene locus_tag LOCUS_11120 500650 498509 CDS product NACHT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204072091.1 protein_id gnl|my_center|LOCUS_11120 501587 500781 gene locus_tag LOCUS_11130 501587 500781 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 protein_id gnl|my_center|LOCUS_11130 501788 502639 gene locus_tag LOCUS_11140 501788 502639 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028933.1 protein_id gnl|my_center|LOCUS_11140 504147 502687 gene locus_tag LOCUS_11150 504147 502687 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224336.1 protein_id gnl|my_center|LOCUS_11150 504283 505185 gene locus_tag LOCUS_11160 504283 505185 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978137.1 protein_id gnl|my_center|LOCUS_11160 505562 507226 gene locus_tag LOCUS_11170 505562 507226 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028751.1 protein_id gnl|my_center|LOCUS_11170 507475 508725 gene locus_tag LOCUS_11180 507475 508725 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892540.1 protein_id gnl|my_center|LOCUS_11180 508926 510278 gene locus_tag LOCUS_11190 508926 510278 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_11190 510348 511538 gene locus_tag LOCUS_11200 gene hutI 510348 511538 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028748.1 protein_id gnl|my_center|LOCUS_11200 511711 511478 gene locus_tag LOCUS_11210 511711 511478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 511947 513302 gene locus_tag LOCUS_11220 511947 513302 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026992.1 protein_id gnl|my_center|LOCUS_11220 513299 514216 gene locus_tag LOCUS_11230 513299 514216 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026993.1 protein_id gnl|my_center|LOCUS_11230 514218 515117 gene locus_tag LOCUS_11240 514218 515117 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896545.1 protein_id gnl|my_center|LOCUS_11240 515582 515223 gene locus_tag LOCUS_11250 515582 515223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 516269 515595 gene locus_tag LOCUS_11260 516269 515595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 516313 517134 gene locus_tag LOCUS_11270 516313 517134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 517190 518386 gene locus_tag LOCUS_11280 517190 518386 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086421.1 protein_id gnl|my_center|LOCUS_11280 518513 518638 gene locus_tag LOCUS_11290 518513 518638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 519048 520961 gene locus_tag LOCUS_11300 519048 520961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 521149 522582 gene locus_tag LOCUS_11310 521149 522582 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109667839.1 protein_id gnl|my_center|LOCUS_11310 522564 523604 gene locus_tag LOCUS_11320 522564 523604 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_11320 523622 524602 gene locus_tag LOCUS_11330 523622 524602 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_11330 524628 525476 gene locus_tag LOCUS_11340 524628 525476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 527096 526053 gene locus_tag LOCUS_11350 527096 526053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 528131 527100 gene locus_tag LOCUS_11360 528131 527100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 529284 528277 gene locus_tag LOCUS_11370 529284 528277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 529468 530691 gene locus_tag LOCUS_11380 529468 530691 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165521786.1 protein_id gnl|my_center|LOCUS_11380 530709 531791 gene locus_tag LOCUS_11390 530709 531791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 531788 532837 gene locus_tag LOCUS_11400 531788 532837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 532999 532925 gene locus_tag LOCUS_t00040 532999 532925 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 533084 533011 gene locus_tag LOCUS_t00050 533084 533011 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 533228 533157 gene locus_tag LOCUS_t00060 533228 533157 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 533312 533239 gene locus_tag LOCUS_t00070 533312 533239 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 533630 533821 gene locus_tag LOCUS_11410 533630 533821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 533838 535658 gene locus_tag LOCUS_11420 gene glmS 533838 535658 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976011.1 protein_id gnl|my_center|LOCUS_11420 537033 535813 gene locus_tag LOCUS_11430 537033 535813 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029659.1 protein_id gnl|my_center|LOCUS_11430 537092 538096 gene locus_tag LOCUS_11440 537092 538096 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029658.1 protein_id gnl|my_center|LOCUS_11440 538153 539109 gene locus_tag LOCUS_11450 538153 539109 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027413.1 protein_id gnl|my_center|LOCUS_11450 540674 539253 gene locus_tag LOCUS_11460 540674 539253 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_11460 540890 541852 gene locus_tag LOCUS_11470 540890 541852 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529611.1 protein_id gnl|my_center|LOCUS_11470 542232 544703 gene locus_tag LOCUS_11480 542232 544703 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_11480 544703 545698 gene locus_tag LOCUS_11490 544703 545698 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 protein_id gnl|my_center|LOCUS_11490 545905 545738 gene locus_tag LOCUS_11500 545905 545738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 545880 547052 gene locus_tag LOCUS_11510 545880 547052 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226510.1 protein_id gnl|my_center|LOCUS_11510 548697 547129 gene locus_tag LOCUS_11520 548697 547129 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026811.1 protein_id gnl|my_center|LOCUS_11520 549196 548882 gene locus_tag LOCUS_11530 549196 548882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 550563 549328 gene locus_tag LOCUS_11540 gene glgC 550563 549328 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805186.1 protein_id gnl|my_center|LOCUS_11540 550655 551830 gene locus_tag LOCUS_11550 gene glgA 550655 551830 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805185.1 protein_id gnl|my_center|LOCUS_11550 552134 551937 gene locus_tag LOCUS_11560 552134 551937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 552230 552946 gene locus_tag LOCUS_11570 gene pgeF 552230 552946 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173521163.1 protein_id gnl|my_center|LOCUS_11570 554408 553041 gene locus_tag LOCUS_11580 554408 553041 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223158.1 protein_id gnl|my_center|LOCUS_11580 554819 556075 gene locus_tag LOCUS_11590 554819 556075 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104242.1 protein_id gnl|my_center|LOCUS_11590 556066 556710 gene locus_tag LOCUS_11600 556066 556710 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726958.1 protein_id gnl|my_center|LOCUS_11600 557563 556820 gene locus_tag LOCUS_11610 557563 556820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 558138 557908 gene locus_tag LOCUS_11620 558138 557908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 558022 558597 gene locus_tag LOCUS_11630 558022 558597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 558594 560087 gene locus_tag LOCUS_11640 558594 560087 CDS product NADH-quinone oxidoreductase subunit NuoF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326195.1 protein_id gnl|my_center|LOCUS_11640 561145 560168 gene locus_tag LOCUS_11650 561145 560168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 561732 561142 gene locus_tag LOCUS_11660 561732 561142 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224412.1 protein_id gnl|my_center|LOCUS_11660 561891 562505 gene locus_tag LOCUS_11670 561891 562505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 563326 562652 gene locus_tag LOCUS_11680 563326 562652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 565065 563323 gene locus_tag LOCUS_11690 565065 563323 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759730.1 protein_id gnl|my_center|LOCUS_11690 566155 565055 gene locus_tag LOCUS_11700 566155 565055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 569183 566283 gene locus_tag LOCUS_11710 569183 566283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 570071 569415 gene locus_tag LOCUS_11720 570071 569415 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028311.1 protein_id gnl|my_center|LOCUS_11720 570197 571387 gene locus_tag LOCUS_11730 570197 571387 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_11730 571399 571590 gene locus_tag LOCUS_11740 571399 571590 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971465.1 protein_id gnl|my_center|LOCUS_11740 572346 571798 gene locus_tag LOCUS_11750 572346 571798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 572762 572343 gene locus_tag LOCUS_11760 572762 572343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 573078 575000 gene locus_tag LOCUS_11770 573078 575000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11770 575314 575174 gene locus_tag LOCUS_11780 575314 575174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 575629 576804 gene locus_tag LOCUS_11790 575629 576804 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226143.1 protein_id gnl|my_center|LOCUS_11790 576801 577946 gene locus_tag LOCUS_11800 576801 577946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 578319 580202 gene locus_tag LOCUS_11810 578319 580202 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_11810 581312 580293 gene locus_tag LOCUS_11820 581312 580293 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484222.1 protein_id gnl|my_center|LOCUS_11820 582675 581443 gene locus_tag LOCUS_11830 582675 581443 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931723.1 protein_id gnl|my_center|LOCUS_11830 584687 582876 gene locus_tag LOCUS_11840 584687 582876 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028097.1 protein_id gnl|my_center|LOCUS_11840 584799 585794 gene locus_tag LOCUS_11850 584799 585794 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 protein_id gnl|my_center|LOCUS_11850 585984 586373 gene locus_tag LOCUS_11860 585984 586373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 586658 586942 gene locus_tag LOCUS_11870 586658 586942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 587149 587691 gene locus_tag LOCUS_11880 587149 587691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 588037 588708 gene locus_tag LOCUS_11890 588037 588708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 589621 588701 gene locus_tag LOCUS_11900 589621 588701 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204051675.1 protein_id gnl|my_center|LOCUS_11900 591523 589679 gene locus_tag LOCUS_11910 591523 589679 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_11910 592980 591535 gene locus_tag LOCUS_11920 592980 591535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 593323 593045 gene locus_tag LOCUS_11930 593323 593045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 594797 593337 gene locus_tag LOCUS_11940 594797 593337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 595174 594908 gene locus_tag LOCUS_11950 595174 594908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 595772 595311 gene locus_tag LOCUS_11960 595772 595311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 595933 596205 gene locus_tag LOCUS_11970 595933 596205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 596380 597327 gene locus_tag LOCUS_11980 596380 597327 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763736.1 protein_id gnl|my_center|LOCUS_11980 597329 598141 gene locus_tag LOCUS_11990 597329 598141 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146599.1 protein_id gnl|my_center|LOCUS_11990 598183 599352 gene locus_tag LOCUS_12000 598183 599352 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898850.1 protein_id gnl|my_center|LOCUS_12000 599352 600668 gene locus_tag LOCUS_12010 599352 600668 CDS product TfuA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900327.1 protein_id gnl|my_center|LOCUS_12010 600722 601951 gene locus_tag LOCUS_12020 600722 601951 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_12020 602090 602016 gene locus_tag LOCUS_t00080 602090 602016 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 602181 602110 gene locus_tag LOCUS_t00090 602181 602110 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 602284 602211 gene locus_tag LOCUS_t00100 602284 602211 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 603096 602440 gene locus_tag LOCUS_12030 603096 602440 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443162.1 protein_id gnl|my_center|LOCUS_12030 603228 604340 gene locus_tag LOCUS_12040 gene dusB 603228 604340 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028387.1 protein_id gnl|my_center|LOCUS_12040 607015 604532 gene locus_tag LOCUS_12050 607015 604532 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_12050 607172 607834 gene locus_tag LOCUS_12060 607172 607834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 607961 608734 gene locus_tag LOCUS_12070 607961 608734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 protein_id gnl|my_center|LOCUS_12070 608904 609227 gene locus_tag LOCUS_12080 608904 609227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 609930 609199 gene locus_tag LOCUS_12090 609930 609199 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223255.1 protein_id gnl|my_center|LOCUS_12090 610544 610137 gene locus_tag LOCUS_12100 610544 610137 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 protein_id gnl|my_center|LOCUS_12100 610684 612219 gene locus_tag LOCUS_12110 610684 612219 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_12110 612311 613693 gene locus_tag LOCUS_12120 612311 613693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 614043 615341 gene locus_tag LOCUS_12130 614043 615341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 615344 616063 gene locus_tag LOCUS_12140 615344 616063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729189.1 protein_id gnl|my_center|LOCUS_12140 616063 619371 gene locus_tag LOCUS_12150 616063 619371 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729190.1 protein_id gnl|my_center|LOCUS_12150 619610 620668 gene locus_tag LOCUS_12160 619610 620668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225298.1 protein_id gnl|my_center|LOCUS_12160 620872 621036 gene locus_tag LOCUS_12170 620872 621036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 621310 621735 gene locus_tag LOCUS_12180 621310 621735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978009.1 protein_id gnl|my_center|LOCUS_12180 622692 621793 gene locus_tag LOCUS_12190 622692 621793 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974666.1 protein_id gnl|my_center|LOCUS_12190 624536 623031 gene locus_tag LOCUS_12200 624536 623031 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030606.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence007 417 818 gene locus_tag LOCUS_12210 417 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 910 1101 gene locus_tag LOCUS_12220 910 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 2761 1175 gene locus_tag LOCUS_12230 2761 1175 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 protein_id gnl|my_center|LOCUS_12230 2931 3767 gene locus_tag LOCUS_12240 2931 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 4060 3986 gene locus_tag LOCUS_t00110 4060 3986 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7182 4282 gene locus_tag LOCUS_12250 7182 4282 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_12250 8560 7544 gene locus_tag LOCUS_12260 8560 7544 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 protein_id gnl|my_center|LOCUS_12260 9097 8687 gene locus_tag LOCUS_12270 9097 8687 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_12270 10230 9160 gene locus_tag LOCUS_12280 10230 9160 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_12280 10313 11644 gene locus_tag LOCUS_12290 10313 11644 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_12290 11641 12222 gene locus_tag LOCUS_12300 11641 12222 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973778.1 protein_id gnl|my_center|LOCUS_12300 12389 13399 gene locus_tag LOCUS_12310 12389 13399 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230440.1 protein_id gnl|my_center|LOCUS_12310 14073 13429 gene locus_tag LOCUS_12320 14073 13429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 14645 14067 gene locus_tag LOCUS_12330 14645 14067 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_12330 14747 15925 gene locus_tag LOCUS_12340 14747 15925 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486346.1 protein_id gnl|my_center|LOCUS_12340 15922 17232 gene locus_tag LOCUS_12350 15922 17232 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_12350 18509 17271 gene locus_tag LOCUS_12360 18509 17271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 19085 18891 gene locus_tag LOCUS_12370 19085 18891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 19399 19130 gene locus_tag LOCUS_12380 19399 19130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 19930 19532 gene locus_tag LOCUS_12390 19930 19532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 20854 19982 gene locus_tag LOCUS_12400 20854 19982 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028576.1 protein_id gnl|my_center|LOCUS_12400 22920 20851 gene locus_tag LOCUS_12410 22920 20851 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_12410 23183 24169 gene locus_tag LOCUS_12420 23183 24169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 24385 24176 gene locus_tag LOCUS_12430 24385 24176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 24309 24554 gene locus_tag LOCUS_12440 24309 24554 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077315.1 protein_id gnl|my_center|LOCUS_12440 25643 24660 gene locus_tag LOCUS_12450 gene nudC 25643 24660 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_12450 25835 27025 gene locus_tag LOCUS_12460 25835 27025 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054234.1 protein_id gnl|my_center|LOCUS_12460 27022 28761 gene locus_tag LOCUS_12470 27022 28761 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038167.1 protein_id gnl|my_center|LOCUS_12470 28758 30563 gene locus_tag LOCUS_12480 28758 30563 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030750.1 protein_id gnl|my_center|LOCUS_12480 30560 31666 gene locus_tag LOCUS_12490 30560 31666 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038170.1 protein_id gnl|my_center|LOCUS_12490 31992 32387 gene locus_tag LOCUS_12500 31992 32387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 32689 32525 gene locus_tag LOCUS_12510 32689 32525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 32851 34248 gene locus_tag LOCUS_12520 32851 34248 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_12520 38110 34268 gene locus_tag LOCUS_12530 38110 34268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 41465 38235 gene locus_tag LOCUS_12540 gene adnA 41465 38235 CDS product ATP-dependent DNA helicase AdnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003905015.1 protein_id gnl|my_center|LOCUS_12540 41674 42651 gene locus_tag LOCUS_12550 41674 42651 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969887.1 protein_id gnl|my_center|LOCUS_12550 43122 45380 gene locus_tag LOCUS_12560 43122 45380 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316462.1 protein_id gnl|my_center|LOCUS_12560 48292 45560 gene locus_tag LOCUS_12570 48292 45560 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 protein_id gnl|my_center|LOCUS_12570 51617 48645 gene locus_tag LOCUS_12580 51617 48645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 51994 51689 gene locus_tag LOCUS_12590 51994 51689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 52365 51991 gene locus_tag LOCUS_12600 52365 51991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 53671 52490 gene locus_tag LOCUS_12610 gene mycP 53671 52490 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977220.1 protein_id gnl|my_center|LOCUS_12610 54699 53665 gene locus_tag LOCUS_12620 54699 53665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 56068 54689 gene locus_tag LOCUS_12630 56068 54689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 56781 56062 gene locus_tag LOCUS_12640 56781 56062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 56906 57400 gene locus_tag LOCUS_12650 56906 57400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 57400 57705 gene locus_tag LOCUS_12660 57400 57705 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921216.1 protein_id gnl|my_center|LOCUS_12660 58957 57785 gene locus_tag LOCUS_12670 gene moeZ 58957 57785 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_12670 60040 59078 gene locus_tag LOCUS_12680 60040 59078 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030094.1 protein_id gnl|my_center|LOCUS_12680 60367 60900 gene locus_tag LOCUS_12690 60367 60900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 62120 61182 gene locus_tag LOCUS_12700 62120 61182 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227088.1 protein_id gnl|my_center|LOCUS_12700 62292 63206 gene locus_tag LOCUS_12710 62292 63206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 63270 63503 gene locus_tag LOCUS_12720 63270 63503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 63615 64235 gene locus_tag LOCUS_12730 63615 64235 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_12730 64395 64625 gene locus_tag LOCUS_12740 64395 64625 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223016.1 protein_id gnl|my_center|LOCUS_12740 65831 65175 gene locus_tag LOCUS_12750 65831 65175 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12750 66097 68064 gene locus_tag LOCUS_12760 66097 68064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 68252 69130 gene locus_tag LOCUS_12770 68252 69130 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_12770 70175 69174 gene locus_tag LOCUS_12780 70175 69174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 70869 70177 gene locus_tag LOCUS_12790 70869 70177 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_12790 71537 70953 gene locus_tag LOCUS_12800 71537 70953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973817.1 protein_id gnl|my_center|LOCUS_12800 71691 72089 gene locus_tag LOCUS_12810 71691 72089 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223006.1 protein_id gnl|my_center|LOCUS_12810 75610 72101 gene locus_tag LOCUS_12820 75610 72101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 77347 75821 gene locus_tag LOCUS_12830 77347 75821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 77525 78217 gene locus_tag LOCUS_12840 77525 78217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226052.1 protein_id gnl|my_center|LOCUS_12840 78404 78988 gene locus_tag LOCUS_12850 78404 78988 CDS product DUF6529 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226053.1 protein_id gnl|my_center|LOCUS_12850 79976 79032 gene locus_tag LOCUS_12860 79976 79032 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_12860 80115 80684 gene locus_tag LOCUS_12870 80115 80684 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229469.1 protein_id gnl|my_center|LOCUS_12870 82063 81041 gene locus_tag LOCUS_12880 82063 81041 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027748.1 protein_id gnl|my_center|LOCUS_12880 82204 83469 gene locus_tag LOCUS_12890 82204 83469 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_12890 83459 83971 gene locus_tag LOCUS_12900 83459 83971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 84152 85291 gene locus_tag LOCUS_12910 84152 85291 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_12910 85784 85398 gene locus_tag LOCUS_12920 85784 85398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 87556 85898 gene locus_tag LOCUS_12930 87556 85898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 88282 87755 gene locus_tag LOCUS_12940 88282 87755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 88935 88279 gene locus_tag LOCUS_12950 gene sigE 88935 88279 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_12950 89156 89806 gene locus_tag LOCUS_12960 89156 89806 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469700.1 protein_id gnl|my_center|LOCUS_12960 91283 89844 gene locus_tag LOCUS_12970 91283 89844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 91556 91389 gene locus_tag LOCUS_12980 91556 91389 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 protein_id gnl|my_center|LOCUS_12980 91700 91888 gene locus_tag LOCUS_12990 91700 91888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 92452 91892 gene locus_tag LOCUS_13000 92452 91892 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973834.1 protein_id gnl|my_center|LOCUS_13000 93042 92464 gene locus_tag LOCUS_13010 93042 92464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 93126 93410 gene locus_tag LOCUS_13020 93126 93410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 94081 93488 gene locus_tag LOCUS_13030 94081 93488 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088046.1 protein_id gnl|my_center|LOCUS_13030 94796 94092 gene locus_tag LOCUS_13040 94796 94092 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101572.1 protein_id gnl|my_center|LOCUS_13040 95860 94829 gene locus_tag LOCUS_13050 95860 94829 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088246.1 protein_id gnl|my_center|LOCUS_13050 95970 96449 gene locus_tag LOCUS_13060 95970 96449 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 protein_id gnl|my_center|LOCUS_13060 97940 96516 gene locus_tag LOCUS_13070 97940 96516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 98432 101173 gene locus_tag LOCUS_13080 98432 101173 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 protein_id gnl|my_center|LOCUS_13080 101197 101691 gene locus_tag LOCUS_13090 101197 101691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 102457 101744 gene locus_tag LOCUS_13100 102457 101744 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972011.1 protein_id gnl|my_center|LOCUS_13100 102844 103533 gene locus_tag LOCUS_13110 102844 103533 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974767.1 protein_id gnl|my_center|LOCUS_13110 104393 103545 gene locus_tag LOCUS_13120 104393 103545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 104707 104558 gene locus_tag LOCUS_13130 104707 104558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 105717 104893 gene locus_tag LOCUS_13140 105717 104893 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084069.1 protein_id gnl|my_center|LOCUS_13140 106719 105958 gene locus_tag LOCUS_13150 106719 105958 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_13150 108033 106954 gene locus_tag LOCUS_13160 gene dapE 108033 106954 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_13160 108862 108026 gene locus_tag LOCUS_13170 108862 108026 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_13170 108919 109749 gene locus_tag LOCUS_13180 108919 109749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319978.1 protein_id gnl|my_center|LOCUS_13180 110445 109786 gene locus_tag LOCUS_13190 110445 109786 CDS product DUF4178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862941.1 protein_id gnl|my_center|LOCUS_13190 111536 110457 gene locus_tag LOCUS_13200 gene dapC 111536 110457 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222936.1 protein_id gnl|my_center|LOCUS_13200 111965 111639 gene locus_tag LOCUS_13210 111965 111639 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_13210 112098 112292 gene locus_tag LOCUS_13220 112098 112292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 112403 113503 gene locus_tag LOCUS_13230 112403 113503 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_13230 113666 114418 gene locus_tag LOCUS_13240 113666 114418 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_13240 114492 117014 gene locus_tag LOCUS_13250 114492 117014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 117025 119100 gene locus_tag LOCUS_13260 117025 119100 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727542.1 protein_id gnl|my_center|LOCUS_13260 119168 121063 gene locus_tag LOCUS_13270 119168 121063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 121113 122501 gene locus_tag LOCUS_13280 gene cysS 121113 122501 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_13280 122585 123259 gene locus_tag LOCUS_13290 122585 123259 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285566.1 protein_id gnl|my_center|LOCUS_13290 123435 123677 gene locus_tag LOCUS_13300 123435 123677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 124428 123733 gene locus_tag LOCUS_13310 124428 123733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 125978 124710 gene locus_tag LOCUS_13320 125978 124710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 127537 126482 gene locus_tag LOCUS_13330 127537 126482 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030985.1 protein_id gnl|my_center|LOCUS_13330 128170 127709 gene locus_tag LOCUS_13340 128170 127709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 128907 128254 gene locus_tag LOCUS_13350 128907 128254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 129835 128945 gene locus_tag LOCUS_13360 gene mshB 129835 128945 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_13360 129927 131990 gene locus_tag LOCUS_13370 129927 131990 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_13370 133886 132135 gene locus_tag LOCUS_13380 133886 132135 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027610.1 protein_id gnl|my_center|LOCUS_13380 135579 133888 gene locus_tag LOCUS_13390 135579 133888 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 protein_id gnl|my_center|LOCUS_13390 135758 135991 gene locus_tag LOCUS_13400 135758 135991 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 protein_id gnl|my_center|LOCUS_13400 135993 136553 gene locus_tag LOCUS_13410 135993 136553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 138065 136734 gene locus_tag LOCUS_13420 138065 136734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 138647 138519 gene locus_tag LOCUS_13430 138647 138519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 138755 139054 gene locus_tag LOCUS_13440 138755 139054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 139449 139321 gene locus_tag LOCUS_13450 139449 139321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 140801 140673 gene locus_tag LOCUS_13460 140801 140673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 141765 141637 gene locus_tag LOCUS_13470 141765 141637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 143293 142022 gene locus_tag LOCUS_13480 143293 142022 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_13480 143494 143303 gene locus_tag LOCUS_13490 143494 143303 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085690.1 protein_id gnl|my_center|LOCUS_13490 144108 143491 gene locus_tag LOCUS_13500 144108 143491 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224770.1 protein_id gnl|my_center|LOCUS_13500 145552 144245 gene locus_tag LOCUS_13510 145552 144245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 146013 147488 gene locus_tag LOCUS_13520 146013 147488 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_13520 148367 147630 gene locus_tag LOCUS_13530 148367 147630 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225083.1 protein_id gnl|my_center|LOCUS_13530 150349 148427 gene locus_tag LOCUS_13540 150349 148427 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225082.1 protein_id gnl|my_center|LOCUS_13540 150981 150346 gene locus_tag LOCUS_13550 150981 150346 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 protein_id gnl|my_center|LOCUS_13550 151340 152419 gene locus_tag LOCUS_13560 151340 152419 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 protein_id gnl|my_center|LOCUS_13560 152576 153775 gene locus_tag LOCUS_13570 152576 153775 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487464.1 protein_id gnl|my_center|LOCUS_13570 153772 155340 gene locus_tag LOCUS_13580 153772 155340 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229350.1 protein_id gnl|my_center|LOCUS_13580 155347 155796 gene locus_tag LOCUS_13590 155347 155796 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731060.1 protein_id gnl|my_center|LOCUS_13590 156032 156847 gene locus_tag LOCUS_13600 156032 156847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_13600 156857 158764 gene locus_tag LOCUS_13610 156857 158764 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_13610 158764 159537 gene locus_tag LOCUS_13620 158764 159537 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_13620 159686 160513 gene locus_tag LOCUS_13630 159686 160513 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469478.1 protein_id gnl|my_center|LOCUS_13630 160707 161228 gene locus_tag LOCUS_13640 160707 161228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 162574 161309 gene locus_tag LOCUS_13650 162574 161309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 165245 163239 gene locus_tag LOCUS_13660 165245 163239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 165715 165326 gene locus_tag LOCUS_13670 165715 165326 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896546.1 protein_id gnl|my_center|LOCUS_13670 167135 166044 gene locus_tag LOCUS_13680 167135 166044 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229059.1 protein_id gnl|my_center|LOCUS_13680 167803 167132 gene locus_tag LOCUS_13690 167803 167132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 170572 167810 gene locus_tag LOCUS_13700 170572 167810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 173052 170569 gene locus_tag LOCUS_13710 173052 170569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 176599 173099 gene locus_tag LOCUS_13720 176599 173099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 176950 176663 gene locus_tag LOCUS_13730 176950 176663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 178072 177050 gene locus_tag LOCUS_13740 178072 177050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 180380 178857 gene locus_tag LOCUS_13750 180380 178857 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868284.1 protein_id gnl|my_center|LOCUS_13750 181092 180526 gene locus_tag LOCUS_13760 181092 180526 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978343.1 protein_id gnl|my_center|LOCUS_13760 181174 182043 gene locus_tag LOCUS_13770 181174 182043 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907735.1 protein_id gnl|my_center|LOCUS_13770 182043 182459 gene locus_tag LOCUS_13780 182043 182459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 183710 182634 gene locus_tag LOCUS_13790 gene ychF 183710 182634 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_13790 183785 185407 gene locus_tag LOCUS_13800 183785 185407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 185452 186129 gene locus_tag LOCUS_13810 185452 186129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 186134 186676 gene locus_tag LOCUS_13820 186134 186676 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 protein_id gnl|my_center|LOCUS_13820 187816 186845 gene locus_tag LOCUS_13830 187816 186845 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 protein_id gnl|my_center|LOCUS_13830 188002 189159 gene locus_tag LOCUS_13840 188002 189159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 189185 190396 gene locus_tag LOCUS_13850 gene xseA 189185 190396 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 protein_id gnl|my_center|LOCUS_13850 190434 190673 gene locus_tag LOCUS_13860 190434 190673 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229792.1 protein_id gnl|my_center|LOCUS_13860 191356 190802 gene locus_tag LOCUS_13870 191356 190802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 192050 191484 gene locus_tag LOCUS_13880 192050 191484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 192022 192222 gene locus_tag LOCUS_13890 192022 192222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 192234 193268 gene locus_tag LOCUS_13900 gene glpX 192234 193268 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_13900 194004 193312 gene locus_tag LOCUS_13910 194004 193312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 194175 194591 gene locus_tag LOCUS_13920 194175 194591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 <195845 194618 gene locus_tag LOCUS_13930 <195845 194618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028914.1:MFS transporter >Feature sequence008 774 469 gene locus_tag LOCUS_13940 774 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 989 2644 gene locus_tag LOCUS_13950 989 2644 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_13950 2725 4263 gene locus_tag LOCUS_13960 2725 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 4306 6102 gene locus_tag LOCUS_13970 4306 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 6227 7612 gene locus_tag LOCUS_13980 6227 7612 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_13980 9740 7740 gene locus_tag LOCUS_13990 9740 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 10604 9855 gene locus_tag LOCUS_14000 10604 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 11071 10898 gene locus_tag LOCUS_14010 11071 10898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 10994 11668 gene locus_tag LOCUS_14020 gene afsQ1 10994 11668 CDS product two-component system response regulator AfsQ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974066.1 protein_id gnl|my_center|LOCUS_14020 11665 13101 gene locus_tag LOCUS_14030 11665 13101 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031729.1 protein_id gnl|my_center|LOCUS_14030 13098 13823 gene locus_tag LOCUS_14040 13098 13823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 15439 14174 gene locus_tag LOCUS_14050 15439 14174 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_14050 16515 15754 gene locus_tag LOCUS_14060 16515 15754 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_14060 18500 16698 gene locus_tag LOCUS_14070 18500 16698 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_14070 19372 18869 gene locus_tag LOCUS_14080 19372 18869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229818.1 protein_id gnl|my_center|LOCUS_14080 19484 21022 gene locus_tag LOCUS_14090 19484 21022 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091320726.1 protein_id gnl|my_center|LOCUS_14090 21019 21630 gene locus_tag LOCUS_14100 21019 21630 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487124.1 protein_id gnl|my_center|LOCUS_14100 23190 21763 gene locus_tag LOCUS_14110 23190 21763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 24116 23520 gene locus_tag LOCUS_14120 24116 23520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 24296 25138 gene locus_tag LOCUS_14130 24296 25138 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028937.1 protein_id gnl|my_center|LOCUS_14130 25120 25320 gene locus_tag LOCUS_14140 25120 25320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14140 25337 25531 gene locus_tag LOCUS_14150 25337 25531 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_14150 27282 25732 gene locus_tag LOCUS_14160 27282 25732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 28047 27547 gene locus_tag LOCUS_14170 gene greA 28047 27547 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_14170 28568 28137 gene locus_tag LOCUS_14180 28568 28137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 28701 29603 gene locus_tag LOCUS_14190 gene mca 28701 29603 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444314.1 protein_id gnl|my_center|LOCUS_14190 29638 29916 gene locus_tag LOCUS_14200 29638 29916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 29944 30285 gene locus_tag LOCUS_14210 29944 30285 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888479.1 protein_id gnl|my_center|LOCUS_14210 31536 30403 gene locus_tag LOCUS_14220 31536 30403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 31729 32364 gene locus_tag LOCUS_14230 31729 32364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 32607 36986 gene locus_tag LOCUS_14240 32607 36986 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886065.1 protein_id gnl|my_center|LOCUS_14240 37066 37218 gene locus_tag LOCUS_14250 37066 37218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 37470 38159 gene locus_tag LOCUS_14260 37470 38159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14260 38152 38616 gene locus_tag LOCUS_14270 38152 38616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14270 39567 38626 gene locus_tag LOCUS_14280 39567 38626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224152.1 protein_id gnl|my_center|LOCUS_14280 40037 41062 gene locus_tag LOCUS_14290 40037 41062 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030691.1 protein_id gnl|my_center|LOCUS_14290 45415 41243 gene locus_tag LOCUS_14300 45415 41243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 47150 45618 gene locus_tag LOCUS_14310 47150 45618 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228517.1 protein_id gnl|my_center|LOCUS_14310 47886 47158 gene locus_tag LOCUS_14320 47886 47158 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230642.1 protein_id gnl|my_center|LOCUS_14320 48035 49411 gene locus_tag LOCUS_14330 48035 49411 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_14330 49701 50279 gene locus_tag LOCUS_14340 49701 50279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 50279 51154 gene locus_tag LOCUS_14350 50279 51154 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027858.1 protein_id gnl|my_center|LOCUS_14350 51344 53308 gene locus_tag LOCUS_14360 51344 53308 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_14360 55531 53330 gene locus_tag LOCUS_14370 55531 53330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 56183 55704 gene locus_tag LOCUS_14380 56183 55704 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028667.1 protein_id gnl|my_center|LOCUS_14380 56286 57386 gene locus_tag LOCUS_14390 gene hppD 56286 57386 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975883.1 protein_id gnl|my_center|LOCUS_14390 57719 58252 gene locus_tag LOCUS_14400 57719 58252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14400 58252 59733 gene locus_tag LOCUS_14410 58252 59733 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_14410 60609 59761 gene locus_tag LOCUS_14420 60609 59761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 60973 61821 gene locus_tag LOCUS_14430 60973 61821 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_14430 61829 62023 gene locus_tag LOCUS_14440 61829 62023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 62115 62372 gene locus_tag LOCUS_14450 62115 62372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 65265 62569 gene locus_tag LOCUS_14460 65265 62569 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 protein_id gnl|my_center|LOCUS_14460 65397 65828 gene locus_tag LOCUS_14470 65397 65828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 67101 65887 gene locus_tag LOCUS_14480 gene ilvA 67101 65887 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_14480 68435 67260 gene locus_tag LOCUS_14490 68435 67260 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 protein_id gnl|my_center|LOCUS_14490 69085 68432 gene locus_tag LOCUS_14500 69085 68432 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230194.1 protein_id gnl|my_center|LOCUS_14500 69174 70604 gene locus_tag LOCUS_14510 69174 70604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 71714 70707 gene locus_tag LOCUS_14520 71714 70707 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_14520 72977 71775 gene locus_tag LOCUS_14530 72977 71775 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_14530 73148 74617 gene locus_tag LOCUS_14540 73148 74617 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878358.1 protein_id gnl|my_center|LOCUS_14540 74802 76760 gene locus_tag LOCUS_14550 74802 76760 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_14550 77227 77397 gene locus_tag LOCUS_14560 77227 77397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 77473 77904 gene locus_tag LOCUS_14570 77473 77904 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027303.1 protein_id gnl|my_center|LOCUS_14570 79133 77988 gene locus_tag LOCUS_14580 79133 77988 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_14580 79248 80426 gene locus_tag LOCUS_14590 79248 80426 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224798.1 protein_id gnl|my_center|LOCUS_14590 82013 80634 gene locus_tag LOCUS_14600 82013 80634 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_14600 82288 83274 gene locus_tag LOCUS_14610 82288 83274 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975733.1 protein_id gnl|my_center|LOCUS_14610 83333 84679 gene locus_tag LOCUS_14620 83333 84679 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084957161.1 protein_id gnl|my_center|LOCUS_14620 84828 86048 gene locus_tag LOCUS_14630 84828 86048 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_14630 86474 86064 gene locus_tag LOCUS_14640 86474 86064 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_14640 86857 86612 gene locus_tag LOCUS_14650 86857 86612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 87851 87060 gene locus_tag LOCUS_14660 87851 87060 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975728.1 protein_id gnl|my_center|LOCUS_14660 88704 88630 gene locus_tag LOCUS_t00120 88704 88630 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 90260 88941 gene locus_tag LOCUS_14670 90260 88941 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 protein_id gnl|my_center|LOCUS_14670 90645 91439 gene locus_tag LOCUS_14680 90645 91439 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406360.1 protein_id gnl|my_center|LOCUS_14680 91492 92115 gene locus_tag LOCUS_14690 91492 92115 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_14690 93040 92129 gene locus_tag LOCUS_14700 93040 92129 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_14700 93609 93037 gene locus_tag LOCUS_14710 93609 93037 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_14710 94149 93721 gene locus_tag LOCUS_14720 94149 93721 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229928.1 protein_id gnl|my_center|LOCUS_14720 95484 94207 gene locus_tag LOCUS_14730 gene eno 95484 94207 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_14730 96643 95669 gene locus_tag LOCUS_14740 96643 95669 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975711.1 protein_id gnl|my_center|LOCUS_14740 97283 96645 gene locus_tag LOCUS_14750 97283 96645 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975710.1 protein_id gnl|my_center|LOCUS_14750 100964 97392 gene locus_tag LOCUS_14760 gene mfd 100964 97392 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_14760 101342 102034 gene locus_tag LOCUS_14770 101342 102034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 102118 103326 gene locus_tag LOCUS_14780 102118 103326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 104434 103346 gene locus_tag LOCUS_14790 104434 103346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 104747 106009 gene locus_tag LOCUS_14800 104747 106009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 106006 107544 gene locus_tag LOCUS_14810 106006 107544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 107541 108833 gene locus_tag LOCUS_14820 107541 108833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 108886 109731 gene locus_tag LOCUS_14830 108886 109731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 110169 111611 gene locus_tag LOCUS_14840 110169 111611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 111608 112714 gene locus_tag LOCUS_14850 111608 112714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 114047 112803 gene locus_tag LOCUS_14860 114047 112803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 115045 114062 gene locus_tag LOCUS_14870 115045 114062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 116013 115042 gene locus_tag LOCUS_14880 116013 115042 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331969.1 protein_id gnl|my_center|LOCUS_14880 117466 116531 gene locus_tag LOCUS_14890 117466 116531 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971541.1 protein_id gnl|my_center|LOCUS_14890 117596 118852 gene locus_tag LOCUS_14900 117596 118852 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027428.1 protein_id gnl|my_center|LOCUS_14900 119673 120584 gene locus_tag LOCUS_14910 119673 120584 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218604714.1 protein_id gnl|my_center|LOCUS_14910 121320 120868 gene locus_tag LOCUS_14920 121320 120868 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229488.1 protein_id gnl|my_center|LOCUS_14920 121414 122274 gene locus_tag LOCUS_14930 121414 122274 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229489.1 protein_id gnl|my_center|LOCUS_14930 122277 122705 gene locus_tag LOCUS_14940 122277 122705 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229490.1 protein_id gnl|my_center|LOCUS_14940 123702 122851 gene locus_tag LOCUS_14950 123702 122851 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230740.1 protein_id gnl|my_center|LOCUS_14950 124531 124229 gene locus_tag LOCUS_14960 124531 124229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 125297 124548 gene locus_tag LOCUS_14970 125297 124548 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862685.1 protein_id gnl|my_center|LOCUS_14970 126378 125647 gene locus_tag LOCUS_14980 126378 125647 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971433.1 protein_id gnl|my_center|LOCUS_14980 126737 126363 gene locus_tag LOCUS_14990 126737 126363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 126828 127691 gene locus_tag LOCUS_15000 126828 127691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 127728 128411 gene locus_tag LOCUS_15010 127728 128411 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222233.1 protein_id gnl|my_center|LOCUS_15010 129365 128427 gene locus_tag LOCUS_15020 gene cynR 129365 128427 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112831.1 protein_id gnl|my_center|LOCUS_15020 129552 130151 gene locus_tag LOCUS_15030 gene cynT 129552 130151 CDS product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107081.1 protein_id gnl|my_center|LOCUS_15030 130271 130741 gene locus_tag LOCUS_15040 gene cynS 130271 130741 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072180.1 protein_id gnl|my_center|LOCUS_15040 130979 130776 gene locus_tag LOCUS_15050 130979 130776 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_15050 131192 130989 gene locus_tag LOCUS_15060 131192 130989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 132016 131180 gene locus_tag LOCUS_15070 132016 131180 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028316.1 protein_id gnl|my_center|LOCUS_15070 132253 132750 gene locus_tag LOCUS_15080 132253 132750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 132944 133351 gene locus_tag LOCUS_15090 132944 133351 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974528.1 protein_id gnl|my_center|LOCUS_15090 133396 134505 gene locus_tag LOCUS_15100 133396 134505 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029664.1 protein_id gnl|my_center|LOCUS_15100 134758 135645 gene locus_tag LOCUS_15110 134758 135645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 136384 135962 gene locus_tag LOCUS_15120 136384 135962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 136549 136803 gene locus_tag LOCUS_15130 136549 136803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 138126 136864 gene locus_tag LOCUS_15140 138126 136864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 139153 138239 gene locus_tag LOCUS_15150 gene cysD 139153 138239 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466878.1 protein_id gnl|my_center|LOCUS_15150 140070 139177 gene locus_tag LOCUS_15160 140070 139177 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061144.1 protein_id gnl|my_center|LOCUS_15160 141444 140092 gene locus_tag LOCUS_15170 141444 140092 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978484.1 protein_id gnl|my_center|LOCUS_15170 142522 141926 gene locus_tag LOCUS_15180 gene pth 142522 141926 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_15180 143327 142728 gene locus_tag LOCUS_15190 143327 142728 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975690.1 protein_id gnl|my_center|LOCUS_15190 144680 143421 gene locus_tag LOCUS_15200 144680 143421 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227319.1 protein_id gnl|my_center|LOCUS_15200 146077 145016 gene locus_tag LOCUS_15210 146077 145016 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_15210 147600 146074 gene locus_tag LOCUS_15220 gene glmU 147600 146074 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_15220 147888 147815 gene locus_tag LOCUS_t00130 147888 147815 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 148322 149263 gene locus_tag LOCUS_15230 148322 149263 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 protein_id gnl|my_center|LOCUS_15230 149421 150536 gene locus_tag LOCUS_15240 149421 150536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 150610 152703 gene locus_tag LOCUS_15250 150610 152703 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_15250 152696 153589 gene locus_tag LOCUS_15260 152696 153589 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_15260 155161 153665 gene locus_tag LOCUS_15270 155161 153665 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978319.1 protein_id gnl|my_center|LOCUS_15270 156037 155255 gene locus_tag LOCUS_15280 156037 155255 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028784.1 protein_id gnl|my_center|LOCUS_15280 156093 156899 gene locus_tag LOCUS_15290 156093 156899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 158749 156926 gene locus_tag LOCUS_15300 158749 156926 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_15300 159758 158805 gene locus_tag LOCUS_15310 159758 158805 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028794.1 protein_id gnl|my_center|LOCUS_15310 159998 160429 gene locus_tag LOCUS_15320 159998 160429 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224026.1 protein_id gnl|my_center|LOCUS_15320 161376 160507 gene locus_tag LOCUS_15330 gene rsmA 161376 160507 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_15330 161564 163615 gene locus_tag LOCUS_15340 161564 163615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 163612 165285 gene locus_tag LOCUS_15350 163612 165285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 166299 165418 gene locus_tag LOCUS_15360 166299 165418 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_15360 168089 166296 gene locus_tag LOCUS_15370 gene metG 168089 166296 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467759.1 protein_id gnl|my_center|LOCUS_15370 169478 168225 gene locus_tag LOCUS_15380 169478 168225 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_15380 169560 171137 gene locus_tag LOCUS_15390 169560 171137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 172000 171134 gene locus_tag LOCUS_15400 172000 171134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence009 135 1265 gene locus_tag LOCUS_15410 135 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1500 2690 gene locus_tag LOCUS_15420 1500 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 2870 3472 gene locus_tag LOCUS_15430 2870 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204026379.1 protein_id gnl|my_center|LOCUS_15430 4226 3567 gene locus_tag LOCUS_15440 4226 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 5532 4417 gene locus_tag LOCUS_15450 gene manA 5532 4417 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_15450 6122 8086 gene locus_tag LOCUS_15460 6122 8086 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031541.1 protein_id gnl|my_center|LOCUS_15460 8439 8744 gene locus_tag LOCUS_15470 8439 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 8900 9790 gene locus_tag LOCUS_15480 8900 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 11357 9972 gene locus_tag LOCUS_15490 11357 9972 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_15490 11800 11501 gene locus_tag LOCUS_15500 11800 11501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 11871 12311 gene locus_tag LOCUS_15510 11871 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 12457 13431 gene locus_tag LOCUS_15520 12457 13431 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_15520 13428 14273 gene locus_tag LOCUS_15530 13428 14273 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_15530 14270 15103 gene locus_tag LOCUS_15540 14270 15103 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_15540 15100 15537 gene locus_tag LOCUS_15550 15100 15537 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_15550 15673 16221 gene locus_tag LOCUS_15560 15673 16221 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977284.1 protein_id gnl|my_center|LOCUS_15560 17311 16259 gene locus_tag LOCUS_15570 17311 16259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 18308 17535 gene locus_tag LOCUS_15580 18308 17535 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 protein_id gnl|my_center|LOCUS_15580 19128 18400 gene locus_tag LOCUS_15590 gene recO 19128 18400 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_15590 19318 20895 gene locus_tag LOCUS_15600 19318 20895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 20892 21614 gene locus_tag LOCUS_15610 20892 21614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 21778 22251 gene locus_tag LOCUS_15620 21778 22251 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977367.1 protein_id gnl|my_center|LOCUS_15620 22508 23308 gene locus_tag LOCUS_15630 22508 23308 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 protein_id gnl|my_center|LOCUS_15630 23305 24552 gene locus_tag LOCUS_15640 gene rocD 23305 24552 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727654.1 protein_id gnl|my_center|LOCUS_15640 26191 24605 gene locus_tag LOCUS_15650 26191 24605 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143814.1 protein_id gnl|my_center|LOCUS_15650 27268 26504 gene locus_tag LOCUS_15660 27268 26504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 28432 27509 gene locus_tag LOCUS_15670 28432 27509 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_15670 28749 29072 gene locus_tag LOCUS_15680 28749 29072 CDS product CU044_2847 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227643.1 protein_id gnl|my_center|LOCUS_15680 29074 35535 gene locus_tag LOCUS_15690 29074 35535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 36329 35736 gene locus_tag LOCUS_15700 36329 35736 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729092.1 protein_id gnl|my_center|LOCUS_15700 36464 37381 gene locus_tag LOCUS_15710 36464 37381 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031765.1 protein_id gnl|my_center|LOCUS_15710 38007 37480 gene locus_tag LOCUS_15720 38007 37480 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182765.1 protein_id gnl|my_center|LOCUS_15720 38301 38522 gene locus_tag LOCUS_15730 38301 38522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 38756 38983 gene locus_tag LOCUS_15740 38756 38983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 39132 39839 gene locus_tag LOCUS_15750 39132 39839 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230648.1 protein_id gnl|my_center|LOCUS_15750 41157 39859 gene locus_tag LOCUS_15760 41157 39859 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_15760 41495 42502 gene locus_tag LOCUS_15770 gene blaPEN-bpc 41495 42502 CDS product PEN family class A beta-lactamase, Bpc-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551611.1 protein_id gnl|my_center|LOCUS_15770 42865 43695 gene locus_tag LOCUS_15780 42865 43695 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972011.1 protein_id gnl|my_center|LOCUS_15780 45665 43977 gene locus_tag LOCUS_15790 gene leuA 45665 43977 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285511.1 protein_id gnl|my_center|LOCUS_15790 46138 46383 gene locus_tag LOCUS_15800 46138 46383 CDS product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224533.1 protein_id gnl|my_center|LOCUS_15800 46957 48627 gene locus_tag LOCUS_15810 gene ctaD 46957 48627 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971911.1 protein_id gnl|my_center|LOCUS_15810 49329 48637 gene locus_tag LOCUS_15820 gene urtE 49329 48637 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112317.1 protein_id gnl|my_center|LOCUS_15820 50258 49329 gene locus_tag LOCUS_15830 gene urtD 50258 49329 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894359.1 protein_id gnl|my_center|LOCUS_15830 51507 50326 gene locus_tag LOCUS_15840 gene urtC 51507 50326 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728737.1 protein_id gnl|my_center|LOCUS_15840 52370 51504 gene locus_tag LOCUS_15850 gene urtB 52370 51504 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856680.1 protein_id gnl|my_center|LOCUS_15850 53862 52630 gene locus_tag LOCUS_15860 gene urtA 53862 52630 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728738.1 protein_id gnl|my_center|LOCUS_15860 54283 53960 gene locus_tag LOCUS_15870 54283 53960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 54188 54490 gene locus_tag LOCUS_15880 54188 54490 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409305.1 protein_id gnl|my_center|LOCUS_15880 54522 54860 gene locus_tag LOCUS_15890 54522 54860 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230176.1 protein_id gnl|my_center|LOCUS_15890 54853 56574 gene locus_tag LOCUS_15900 54853 56574 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895080.1 protein_id gnl|my_center|LOCUS_15900 56589 57398 gene locus_tag LOCUS_15910 56589 57398 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803981.1 protein_id gnl|my_center|LOCUS_15910 57388 58089 gene locus_tag LOCUS_15920 gene ureG 57388 58089 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230173.1 protein_id gnl|my_center|LOCUS_15920 58336 59154 gene locus_tag LOCUS_15930 58336 59154 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230172.1 protein_id gnl|my_center|LOCUS_15930 59664 59972 gene locus_tag LOCUS_15940 59664 59972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 59984 61786 gene locus_tag LOCUS_15950 59984 61786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 61835 62107 gene locus_tag LOCUS_15960 61835 62107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 63031 62120 gene locus_tag LOCUS_15970 63031 62120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 64132 63221 gene locus_tag LOCUS_15980 gene era 64132 63221 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228396.1 protein_id gnl|my_center|LOCUS_15980 64592 64176 gene locus_tag LOCUS_15990 64592 64176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 64652 65815 gene locus_tag LOCUS_16000 64652 65815 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224105.1 protein_id gnl|my_center|LOCUS_16000 65973 68405 gene locus_tag LOCUS_16010 65973 68405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 68512 68865 gene locus_tag LOCUS_16020 68512 68865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 68957 69883 gene locus_tag LOCUS_16030 68957 69883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 69880 70269 gene locus_tag LOCUS_16040 69880 70269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 70440 70841 gene locus_tag LOCUS_16050 70440 70841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 70838 71173 gene locus_tag LOCUS_16060 70838 71173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 71379 81779 gene locus_tag LOCUS_16070 71379 81779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 81776 82615 gene locus_tag LOCUS_16080 81776 82615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 82885 83472 gene locus_tag LOCUS_16090 82885 83472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 84219 83644 gene locus_tag LOCUS_16100 84219 83644 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 protein_id gnl|my_center|LOCUS_16100 85280 84273 gene locus_tag LOCUS_16110 85280 84273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 85687 85277 gene locus_tag LOCUS_16120 85687 85277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 85941 88307 gene locus_tag LOCUS_16130 85941 88307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 88997 88308 gene locus_tag LOCUS_16140 88997 88308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 90477 89131 gene locus_tag LOCUS_16150 90477 89131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 91847 90753 gene locus_tag LOCUS_16160 91847 90753 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230788.1 protein_id gnl|my_center|LOCUS_16160 92988 91879 gene locus_tag LOCUS_16170 92988 91879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 93299 92985 gene locus_tag LOCUS_16180 93299 92985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 97803 93826 gene locus_tag LOCUS_16190 97803 93826 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224114.1 protein_id gnl|my_center|LOCUS_16190 98021 99505 gene locus_tag LOCUS_16200 gene eccD 98021 99505 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224120.1 protein_id gnl|my_center|LOCUS_16200 99958 99551 gene locus_tag LOCUS_16210 99958 99551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 100790 99990 gene locus_tag LOCUS_16220 100790 99990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 101129 100827 gene locus_tag LOCUS_16230 101129 100827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 101332 101775 gene locus_tag LOCUS_16240 101332 101775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 102746 101922 gene locus_tag LOCUS_16250 102746 101922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 104113 102743 gene locus_tag LOCUS_16260 104113 102743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 104322 105758 gene locus_tag LOCUS_16270 gene eccB 104322 105758 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 protein_id gnl|my_center|LOCUS_16270 105936 106268 gene locus_tag LOCUS_16280 105936 106268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 106295 106606 gene locus_tag LOCUS_16290 106295 106606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 106672 107055 gene locus_tag LOCUS_16300 106672 107055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 107077 108387 gene locus_tag LOCUS_16310 107077 108387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 109926 108589 gene locus_tag LOCUS_16320 gene argG 109926 108589 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972108.1 protein_id gnl|my_center|LOCUS_16320 110748 110440 gene locus_tag LOCUS_16330 110748 110440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 112141 110828 gene locus_tag LOCUS_16340 112141 110828 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_16340 112617 112138 gene locus_tag LOCUS_16350 gene ybeY 112617 112138 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976270.1 protein_id gnl|my_center|LOCUS_16350 113702 112626 gene locus_tag LOCUS_16360 113702 112626 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_16360 114174 113830 gene locus_tag LOCUS_16370 114174 113830 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_16370 114322 114927 gene locus_tag LOCUS_16380 114322 114927 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975326.1 protein_id gnl|my_center|LOCUS_16380 114924 115667 gene locus_tag LOCUS_16390 114924 115667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 116470 115745 gene locus_tag LOCUS_16400 116470 115745 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_16400 117623 116484 gene locus_tag LOCUS_16410 gene dnaJ 117623 116484 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_16410 118634 117624 gene locus_tag LOCUS_16420 gene hrcA 118634 117624 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_16420 118636 118848 gene locus_tag LOCUS_16430 118636 118848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 118892 119836 gene locus_tag LOCUS_16440 118892 119836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 119840 120682 gene locus_tag LOCUS_16450 119840 120682 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_16450 120762 121355 gene locus_tag LOCUS_16460 120762 121355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 122666 121449 gene locus_tag LOCUS_16470 gene hemW 122666 121449 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_16470 124690 122858 gene locus_tag LOCUS_16480 gene lepA 124690 122858 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083190386.1 protein_id gnl|my_center|LOCUS_16480 125075 125347 gene locus_tag LOCUS_16490 gene rpsT 125075 125347 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_16490 125635 128967 gene locus_tag LOCUS_16500 125635 128967 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484982.1 protein_id gnl|my_center|LOCUS_16500 128964 131663 gene locus_tag LOCUS_16510 128964 131663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 131698 132675 gene locus_tag LOCUS_16520 131698 132675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_16520 132705 133454 gene locus_tag LOCUS_16530 132705 133454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_16530 134914 133967 gene locus_tag LOCUS_16540 gene holA 134914 133967 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485035.1 protein_id gnl|my_center|LOCUS_16540 135262 135411 gene locus_tag LOCUS_16550 135262 135411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 137766 135607 gene locus_tag LOCUS_16560 137766 135607 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228464.1 protein_id gnl|my_center|LOCUS_16560 139225 138494 gene locus_tag LOCUS_16570 139225 138494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 141116 140262 gene locus_tag LOCUS_16580 141116 140262 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_16580 142413 141205 gene locus_tag LOCUS_16590 gene hutI 142413 141205 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068174090.1 protein_id gnl|my_center|LOCUS_16590 144702 143176 gene locus_tag LOCUS_16600 gene hflX 144702 143176 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_16600 145533 144778 gene locus_tag LOCUS_16610 145533 144778 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976449.1 protein_id gnl|my_center|LOCUS_16610 145780 147369 gene locus_tag LOCUS_16620 gene aceB 145780 147369 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030763.1 protein_id gnl|my_center|LOCUS_16620 147366 148847 gene locus_tag LOCUS_16630 147366 148847 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057464.1 protein_id gnl|my_center|LOCUS_16630 148847 150226 gene locus_tag LOCUS_16640 148847 150226 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_16640 150234 151508 gene locus_tag LOCUS_16650 150234 151508 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_16650 151505 152245 gene locus_tag LOCUS_16660 gene allR 151505 152245 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_16660 152915 152292 gene locus_tag LOCUS_16670 152915 152292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 153971 153051 gene locus_tag LOCUS_16680 153971 153051 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876395.1 protein_id gnl|my_center|LOCUS_16680 154598 154134 gene locus_tag LOCUS_16690 154598 154134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 155059 154595 gene locus_tag LOCUS_16700 155059 154595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 154977 155240 gene locus_tag LOCUS_16710 154977 155240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 155887 155303 gene locus_tag LOCUS_16720 155887 155303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 157736 156924 gene locus_tag LOCUS_16730 157736 156924 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031563.1 protein_id gnl|my_center|LOCUS_16730 158822 157869 gene locus_tag LOCUS_16740 158822 157869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 159557 159006 gene locus_tag LOCUS_16750 159557 159006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 159842 160522 gene locus_tag LOCUS_16760 159842 160522 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_16760 160519 161817 gene locus_tag LOCUS_16770 160519 161817 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027197.1 protein_id gnl|my_center|LOCUS_16770 161883 162380 gene locus_tag LOCUS_16780 161883 162380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 163202 162465 gene locus_tag LOCUS_16790 163202 162465 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028771.1 protein_id gnl|my_center|LOCUS_16790 164087 163329 gene locus_tag LOCUS_16800 164087 163329 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967206.1 protein_id gnl|my_center|LOCUS_16800 166419 164101 gene locus_tag LOCUS_16810 166419 164101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112509.1 protein_id gnl|my_center|LOCUS_16810 167341 166487 gene locus_tag LOCUS_16820 gene dapF 167341 166487 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_16820 168303 167353 gene locus_tag LOCUS_16830 gene miaA 168303 167353 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_16830 168830 168303 gene locus_tag LOCUS_16840 168830 168303 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_16840 169738 168962 gene locus_tag LOCUS_16850 169738 168962 CDS product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 protein_id gnl|my_center|LOCUS_16850 171175 170006 gene locus_tag LOCUS_16860 171175 170006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 171535 171308 gene locus_tag LOCUS_16870 171535 171308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 171620 172054 gene locus_tag LOCUS_16880 171620 172054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 173689 172190 gene locus_tag LOCUS_16890 gene miaB 173689 172190 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_16890 173864 174619 gene locus_tag LOCUS_16900 173864 174619 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_16900 174799 175653 gene locus_tag LOCUS_16910 174799 175653 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012471745.1 protein_id gnl|my_center|LOCUS_16910 175729 176394 gene locus_tag LOCUS_16920 175729 176394 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894110.1 protein_id gnl|my_center|LOCUS_16920 176391 177254 gene locus_tag LOCUS_16930 176391 177254 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224233.1 protein_id gnl|my_center|LOCUS_16930 178101 177298 gene locus_tag LOCUS_16940 178101 177298 CDS product IS5/IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006130399.1 protein_id gnl|my_center|LOCUS_16940 178324 178803 gene locus_tag LOCUS_16950 178324 178803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 178728 179123 gene locus_tag LOCUS_16960 178728 179123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 179130 179336 gene locus_tag LOCUS_16970 179130 179336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16970 180004 180213 gene locus_tag LOCUS_16980 180004 180213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 180483 180869 gene locus_tag LOCUS_16990 180483 180869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 180941 181498 gene locus_tag LOCUS_17000 180941 181498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 181507 183369 gene locus_tag LOCUS_17010 181507 183369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851158.1 protein_id gnl|my_center|LOCUS_17010 184449 186371 gene locus_tag LOCUS_17020 184449 186371 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972490.1 protein_id gnl|my_center|LOCUS_17020 188235 186616 gene locus_tag LOCUS_17030 gene rny 188235 186616 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_17030 188681 189646 gene locus_tag LOCUS_17040 188681 189646 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031568.1 protein_id gnl|my_center|LOCUS_17040 190226 189648 gene locus_tag LOCUS_17050 190226 189648 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 protein_id gnl|my_center|LOCUS_17050 191010 190408 gene locus_tag LOCUS_17060 191010 190408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 192143 191055 gene locus_tag LOCUS_17070 gene recA 192143 191055 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_17070 192627 192433 gene locus_tag LOCUS_17080 192627 192433 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973258.1 protein_id gnl|my_center|LOCUS_17080 193221 192733 gene locus_tag LOCUS_17090 193221 192733 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467800.1 protein_id gnl|my_center|LOCUS_17090 193396 198180 gene locus_tag LOCUS_17100 193396 198180 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727880.1 protein_id gnl|my_center|LOCUS_17100 198849 198193 gene locus_tag LOCUS_17110 198849 198193 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976477.1 protein_id gnl|my_center|LOCUS_17110 200327 198936 gene locus_tag LOCUS_17120 200327 198936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 200536 201879 gene locus_tag LOCUS_17130 200536 201879 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227859.1 protein_id gnl|my_center|LOCUS_17130 201882 202892 gene locus_tag LOCUS_17140 201882 202892 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776529.1 protein_id gnl|my_center|LOCUS_17140 202889 203740 gene locus_tag LOCUS_17150 202889 203740 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028676.1 protein_id gnl|my_center|LOCUS_17150 203794 205275 gene locus_tag LOCUS_17160 203794 205275 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031132272.1 protein_id gnl|my_center|LOCUS_17160 206998 205319 gene locus_tag LOCUS_17170 206998 205319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 208350 207172 gene locus_tag LOCUS_17180 208350 207172 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013003532.1 protein_id gnl|my_center|LOCUS_17180 208669 209118 gene locus_tag LOCUS_17190 208669 209118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 209126 209917 gene locus_tag LOCUS_17200 209126 209917 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_17200 210377 210012 gene locus_tag LOCUS_17210 210377 210012 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973269.1 protein_id gnl|my_center|LOCUS_17210 211131 210634 gene locus_tag LOCUS_17220 211131 210634 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_17220 211733 211128 gene locus_tag LOCUS_17230 gene pgsA 211733 211128 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_17230 213058 211730 gene locus_tag LOCUS_17240 gene rimO 213058 211730 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_17240 214013 213264 gene locus_tag LOCUS_17250 214013 213264 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973273.1 protein_id gnl|my_center|LOCUS_17250 216680 214113 gene locus_tag LOCUS_17260 216680 214113 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113701643.1 protein_id gnl|my_center|LOCUS_17260 216836 218335 gene locus_tag LOCUS_17270 216836 218335 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_17270 218576 218391 gene locus_tag LOCUS_17280 218576 218391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 219429 218665 gene locus_tag LOCUS_17290 219429 218665 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_17290 220308 219496 gene locus_tag LOCUS_17300 gene kduI 220308 219496 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230722.1 protein_id gnl|my_center|LOCUS_17300 221216 220410 gene locus_tag LOCUS_17310 221216 220410 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976948.1 protein_id gnl|my_center|LOCUS_17310 222025 221258 gene locus_tag LOCUS_17320 222025 221258 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 protein_id gnl|my_center|LOCUS_17320 223170 222019 gene locus_tag LOCUS_17330 223170 222019 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010210634.1 protein_id gnl|my_center|LOCUS_17330 224606 223290 gene locus_tag LOCUS_17340 224606 223290 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325939.1 protein_id gnl|my_center|LOCUS_17340 225515 224634 gene locus_tag LOCUS_17350 225515 224634 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976934.1 protein_id gnl|my_center|LOCUS_17350 226408 225527 gene locus_tag LOCUS_17360 226408 225527 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976933.1 protein_id gnl|my_center|LOCUS_17360 226670 227590 gene locus_tag LOCUS_17370 226670 227590 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976924.1 protein_id gnl|my_center|LOCUS_17370 227692 229023 gene locus_tag LOCUS_17380 227692 229023 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226279.1 protein_id gnl|my_center|LOCUS_17380 230876 229191 gene locus_tag LOCUS_17390 230876 229191 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_17390 232000 231128 gene locus_tag LOCUS_17400 gene dapA 232000 231128 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_17400 232538 233278 gene locus_tag LOCUS_17410 232538 233278 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973878.1 protein_id gnl|my_center|LOCUS_17410 234137 233286 gene locus_tag LOCUS_17420 234137 233286 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027867.1 protein_id gnl|my_center|LOCUS_17420 234280 235677 gene locus_tag LOCUS_17430 234280 235677 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535091.1 protein_id gnl|my_center|LOCUS_17430 235719 236297 gene locus_tag LOCUS_17440 235719 236297 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222357.1 protein_id gnl|my_center|LOCUS_17440 236537 237121 gene locus_tag LOCUS_17450 236537 237121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 237763 237191 gene locus_tag LOCUS_17460 237763 237191 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_17460 237836 238408 gene locus_tag LOCUS_17470 237836 238408 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029568.1 protein_id gnl|my_center|LOCUS_17470 238753 239631 gene locus_tag LOCUS_17480 238753 239631 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402865.1 protein_id gnl|my_center|LOCUS_17480 240564 239719 gene locus_tag LOCUS_17490 gene dapB 240564 239719 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081787.1 protein_id gnl|my_center|LOCUS_17490 242020 240710 gene locus_tag LOCUS_17500 242020 240710 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_17500 244332 242017 gene locus_tag LOCUS_17510 244332 242017 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_17510 245011 244742 gene locus_tag LOCUS_17520 gene rpsO 245011 244742 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_17520 246160 245171 gene locus_tag LOCUS_17530 246160 245171 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_17530 247195 246254 gene locus_tag LOCUS_17540 gene truB 247195 246254 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 protein_id gnl|my_center|LOCUS_17540 248258 247236 gene locus_tag LOCUS_17550 248258 247236 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728486.1 protein_id gnl|my_center|LOCUS_17550 248752 248258 gene locus_tag LOCUS_17560 gene rbfA 248752 248258 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_17560 249123 248824 gene locus_tag LOCUS_17570 249123 248824 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228120.1 protein_id gnl|my_center|LOCUS_17570 252401 249213 gene locus_tag LOCUS_17580 252401 249213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 252903 252553 gene locus_tag LOCUS_17590 252903 252553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 253843 252830 gene locus_tag LOCUS_17600 gene nusA 253843 252830 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_17600 254370 253855 gene locus_tag LOCUS_17610 gene rimP 254370 253855 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_17610 254557 255066 gene locus_tag LOCUS_17620 254557 255066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 255063 255539 gene locus_tag LOCUS_17630 255063 255539 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030399.1 protein_id gnl|my_center|LOCUS_17630 255631 255822 gene locus_tag LOCUS_17640 255631 255822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 257709 255964 gene locus_tag LOCUS_17650 257709 255964 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223963.1 protein_id gnl|my_center|LOCUS_17650 257635 257943 gene locus_tag LOCUS_17660 257635 257943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 257953 259275 gene locus_tag LOCUS_17670 257953 259275 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_17670 260631 259417 gene locus_tag LOCUS_17680 260631 259417 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_17680 261313 260633 gene locus_tag LOCUS_17690 261313 260633 CDS product copper homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230268.1 protein_id gnl|my_center|LOCUS_17690 262121 261510 gene locus_tag LOCUS_17700 262121 261510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 263229 262480 gene locus_tag LOCUS_17710 263229 262480 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097911.1 protein_id gnl|my_center|LOCUS_17710 263382 263726 gene locus_tag LOCUS_17720 263382 263726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 264053 264751 gene locus_tag LOCUS_17730 264053 264751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 264951 265253 gene locus_tag LOCUS_17740 264951 265253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 265274 265654 gene locus_tag LOCUS_17750 265274 265654 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404903.1 protein_id gnl|my_center|LOCUS_17750 265892 268249 gene locus_tag LOCUS_17760 265892 268249 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_17760 268246 269184 gene locus_tag LOCUS_17770 268246 269184 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_17770 269181 269717 gene locus_tag LOCUS_17780 269181 269717 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_17780 269761 270123 gene locus_tag LOCUS_17790 269761 270123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 270615 271346 gene locus_tag LOCUS_17800 270615 271346 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064806.1 protein_id gnl|my_center|LOCUS_17800 271450 272100 gene locus_tag LOCUS_17810 271450 272100 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973445.1 protein_id gnl|my_center|LOCUS_17810 272550 275084 gene locus_tag LOCUS_17820 272550 275084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 275457 275810 gene locus_tag LOCUS_17830 275457 275810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 276298 275894 gene locus_tag LOCUS_17840 276298 275894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 276596 278185 gene locus_tag LOCUS_17850 276596 278185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 279780 278182 gene locus_tag LOCUS_17860 279780 278182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 282188 280413 gene locus_tag LOCUS_17870 282188 280413 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028953.1 protein_id gnl|my_center|LOCUS_17870 282364 283536 gene locus_tag LOCUS_17880 282364 283536 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975437.1 protein_id gnl|my_center|LOCUS_17880 284196 283558 gene locus_tag LOCUS_17890 284196 283558 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728638.1 protein_id gnl|my_center|LOCUS_17890 284659 284462 gene locus_tag LOCUS_17900 284659 284462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 284658 285371 gene locus_tag LOCUS_17910 284658 285371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 285991 285455 gene locus_tag LOCUS_17920 285991 285455 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_17920 288317 286065 gene locus_tag LOCUS_17930 288317 286065 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_17930 288452 289090 gene locus_tag LOCUS_17940 288452 289090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17940 289094 291772 gene locus_tag LOCUS_17950 289094 291772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 292220 295849 gene locus_tag LOCUS_17960 292220 295849 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031481.1 protein_id gnl|my_center|LOCUS_17960 296027 296350 gene locus_tag LOCUS_17970 296027 296350 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141202.1 protein_id gnl|my_center|LOCUS_17970 296347 297417 gene locus_tag LOCUS_17980 296347 297417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 299931 297418 gene locus_tag LOCUS_17990 299931 297418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 300821 299925 gene locus_tag LOCUS_18000 300821 299925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 302416 300818 gene locus_tag LOCUS_18010 302416 300818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 302682 304061 gene locus_tag LOCUS_18020 302682 304061 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123282.1 protein_id gnl|my_center|LOCUS_18020 304557 304063 gene locus_tag LOCUS_18030 304557 304063 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_18030 305339 304554 gene locus_tag LOCUS_18040 305339 304554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_18040 306192 305374 gene locus_tag LOCUS_18050 306192 305374 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_18050 307853 306264 gene locus_tag LOCUS_18060 307853 306264 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030952.1 protein_id gnl|my_center|LOCUS_18060 309082 308033 gene locus_tag LOCUS_18070 309082 308033 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225630519.1 protein_id gnl|my_center|LOCUS_18070 310443 309274 gene locus_tag LOCUS_18080 gene ispG 310443 309274 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031167.1 protein_id gnl|my_center|LOCUS_18080 311893 310583 gene locus_tag LOCUS_18090 gene dxr 311893 310583 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_18090 312176 313315 gene locus_tag LOCUS_18100 312176 313315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 313367 314506 gene locus_tag LOCUS_18110 313367 314506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 316076 314649 gene locus_tag LOCUS_18120 316076 314649 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030384.1 protein_id gnl|my_center|LOCUS_18120 316304 316948 gene locus_tag LOCUS_18130 316304 316948 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222801.1 protein_id gnl|my_center|LOCUS_18130 318440 316902 gene locus_tag LOCUS_18140 318440 316902 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223101.1 protein_id gnl|my_center|LOCUS_18140 318586 319983 gene locus_tag LOCUS_18150 gene gabT 318586 319983 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973349.1 protein_id gnl|my_center|LOCUS_18150 320152 320391 gene locus_tag LOCUS_18160 320152 320391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 321663 320410 gene locus_tag LOCUS_18170 321663 320410 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031800.1 protein_id gnl|my_center|LOCUS_18170 323168 321870 gene locus_tag LOCUS_18180 323168 321870 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878137.1 protein_id gnl|my_center|LOCUS_18180 324827 323247 gene locus_tag LOCUS_18190 324827 323247 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 protein_id gnl|my_center|LOCUS_18190 326122 324824 gene locus_tag LOCUS_18200 326122 324824 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_18200 327725 326271 gene locus_tag LOCUS_18210 327725 326271 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029391.1 protein_id gnl|my_center|LOCUS_18210 327876 328664 gene locus_tag LOCUS_18220 327876 328664 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029392.1 protein_id gnl|my_center|LOCUS_18220 328898 330511 gene locus_tag LOCUS_18230 328898 330511 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228411.1 protein_id gnl|my_center|LOCUS_18230 330763 332292 gene locus_tag LOCUS_18240 330763 332292 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031038.1 protein_id gnl|my_center|LOCUS_18240 334654 332423 gene locus_tag LOCUS_18250 gene katG 334654 332423 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027206.1 protein_id gnl|my_center|LOCUS_18250 335121 334684 gene locus_tag LOCUS_18260 335121 334684 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978301.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence010 1010 1663 gene locus_tag LOCUS_18270 1010 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1647 2822 gene locus_tag LOCUS_18280 1647 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 3007 3321 gene locus_tag LOCUS_18290 3007 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 3452 3527 gene locus_tag LOCUS_t00140 3452 3527 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4438 3833 gene locus_tag LOCUS_18300 4438 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 4560 4886 gene locus_tag LOCUS_18310 4560 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 5756 5100 gene locus_tag LOCUS_18320 5756 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 7255 5744 gene locus_tag LOCUS_18330 7255 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 7938 7264 gene locus_tag LOCUS_18340 7938 7264 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389739.1 protein_id gnl|my_center|LOCUS_18340 9537 8545 gene locus_tag LOCUS_18350 9537 8545 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058916821.1 protein_id gnl|my_center|LOCUS_18350 10819 9677 gene locus_tag LOCUS_18360 10819 9677 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 protein_id gnl|my_center|LOCUS_18360 12494 11103 gene locus_tag LOCUS_18370 12494 11103 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_18370 14859 12541 gene locus_tag LOCUS_18380 gene yicI 14859 12541 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027547.1 protein_id gnl|my_center|LOCUS_18380 15715 14876 gene locus_tag LOCUS_18390 15715 14876 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804051.1 protein_id gnl|my_center|LOCUS_18390 16608 15712 gene locus_tag LOCUS_18400 16608 15712 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775733.1 protein_id gnl|my_center|LOCUS_18400 17921 16605 gene locus_tag LOCUS_18410 17921 16605 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804049.1 protein_id gnl|my_center|LOCUS_18410 19938 17914 gene locus_tag LOCUS_18420 19938 17914 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030394.1 protein_id gnl|my_center|LOCUS_18420 20959 19940 gene locus_tag LOCUS_18430 20959 19940 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803804.1 protein_id gnl|my_center|LOCUS_18430 21305 22180 gene locus_tag LOCUS_18440 21305 22180 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_18440 22372 25566 gene locus_tag LOCUS_18450 22372 25566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 28868 25626 gene locus_tag LOCUS_18460 28868 25626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 29936 29097 gene locus_tag LOCUS_18470 29936 29097 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_18470 30162 33482 gene locus_tag LOCUS_18480 30162 33482 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_18480 33492 33794 gene locus_tag LOCUS_18490 33492 33794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 33794 35395 gene locus_tag LOCUS_18500 33794 35395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 36546 35443 gene locus_tag LOCUS_18510 36546 35443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 36904 36521 gene locus_tag LOCUS_18520 36904 36521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 37215 36916 gene locus_tag LOCUS_18530 37215 36916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 37602 37234 gene locus_tag LOCUS_18540 37602 37234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 37713 39080 gene locus_tag LOCUS_18550 37713 39080 CDS product DUF6430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975543.1 protein_id gnl|my_center|LOCUS_18550 39471 39139 gene locus_tag LOCUS_18560 39471 39139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 40490 39801 gene locus_tag LOCUS_18570 40490 39801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975214.1 protein_id gnl|my_center|LOCUS_18570 40843 40487 gene locus_tag LOCUS_18580 40843 40487 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226694.1 protein_id gnl|my_center|LOCUS_18580 41026 43869 gene locus_tag LOCUS_18590 41026 43869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 45059 44220 gene locus_tag LOCUS_18600 45059 44220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 45108 45755 gene locus_tag LOCUS_18610 45108 45755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 47050 45731 gene locus_tag LOCUS_18620 47050 45731 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728306.1 protein_id gnl|my_center|LOCUS_18620 48150 47128 gene locus_tag LOCUS_18630 48150 47128 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929295.1 protein_id gnl|my_center|LOCUS_18630 49043 48150 gene locus_tag LOCUS_18640 49043 48150 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020472.1 protein_id gnl|my_center|LOCUS_18640 49862 49242 gene locus_tag LOCUS_18650 49862 49242 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228649.1 protein_id gnl|my_center|LOCUS_18650 49978 51891 gene locus_tag LOCUS_18660 49978 51891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 52337 52167 gene locus_tag LOCUS_18670 52337 52167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 53047 52550 gene locus_tag LOCUS_18680 53047 52550 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029169.1 protein_id gnl|my_center|LOCUS_18680 54016 53090 gene locus_tag LOCUS_18690 54016 53090 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731608.1 protein_id gnl|my_center|LOCUS_18690 54153 55085 gene locus_tag LOCUS_18700 54153 55085 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688696.1 protein_id gnl|my_center|LOCUS_18700 55197 55493 gene locus_tag LOCUS_18710 55197 55493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 55490 55699 gene locus_tag LOCUS_18720 55490 55699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 55717 56220 gene locus_tag LOCUS_18730 55717 56220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 56950 56729 gene locus_tag LOCUS_18740 56950 56729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 57290 57991 gene locus_tag LOCUS_18750 57290 57991 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027478.1 protein_id gnl|my_center|LOCUS_18750 58051 58884 gene locus_tag LOCUS_18760 58051 58884 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222998.1 protein_id gnl|my_center|LOCUS_18760 59223 60389 gene locus_tag LOCUS_18770 59223 60389 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742067.1 protein_id gnl|my_center|LOCUS_18770 61249 60542 gene locus_tag LOCUS_18780 61249 60542 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027476.1 protein_id gnl|my_center|LOCUS_18780 62221 61283 gene locus_tag LOCUS_18790 62221 61283 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228564.1 protein_id gnl|my_center|LOCUS_18790 62894 62274 gene locus_tag LOCUS_18800 62894 62274 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027478.1 protein_id gnl|my_center|LOCUS_18800 63047 63517 gene locus_tag LOCUS_18810 63047 63517 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 protein_id gnl|my_center|LOCUS_18810 64580 63969 gene locus_tag LOCUS_18820 64580 63969 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228567.1 protein_id gnl|my_center|LOCUS_18820 64725 65459 gene locus_tag LOCUS_18830 64725 65459 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977890.1 protein_id gnl|my_center|LOCUS_18830 65492 66115 gene locus_tag LOCUS_18840 65492 66115 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228569.1 protein_id gnl|my_center|LOCUS_18840 67680 66478 gene locus_tag LOCUS_18850 67680 66478 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224039.1 protein_id gnl|my_center|LOCUS_18850 67664 67879 gene locus_tag LOCUS_18860 67664 67879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 68287 67937 gene locus_tag LOCUS_18870 68287 67937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 68929 68438 gene locus_tag LOCUS_18880 68929 68438 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029169.1 protein_id gnl|my_center|LOCUS_18880 69729 68926 gene locus_tag LOCUS_18890 69729 68926 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466752.1 protein_id gnl|my_center|LOCUS_18890 70691 69726 gene locus_tag LOCUS_18900 70691 69726 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223936.1 protein_id gnl|my_center|LOCUS_18900 71572 70703 gene locus_tag LOCUS_18910 71572 70703 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223937.1 protein_id gnl|my_center|LOCUS_18910 72108 71605 gene locus_tag LOCUS_18920 72108 71605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223938.1 protein_id gnl|my_center|LOCUS_18920 72889 72638 gene locus_tag LOCUS_18930 72889 72638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 73514 73984 gene locus_tag LOCUS_18940 73514 73984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 74048 75793 gene locus_tag LOCUS_18950 74048 75793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 76424 76029 gene locus_tag LOCUS_18960 gene dndE 76424 76029 CDS product DNA sulfur modification protein DndE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296384.1 protein_id gnl|my_center|LOCUS_18960 78405 76414 gene locus_tag LOCUS_18970 gene dndD 78405 76414 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_18970 79915 78392 gene locus_tag LOCUS_18980 gene dndC 79915 78392 CDS product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 protein_id gnl|my_center|LOCUS_18980 81042 79912 gene locus_tag LOCUS_18990 gene dndB 81042 79912 CDS product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134924.1 protein_id gnl|my_center|LOCUS_18990 81119 82264 gene locus_tag LOCUS_19000 gene dndA 81119 82264 CDS product cysteine desulfurase DndA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109917.1 protein_id gnl|my_center|LOCUS_19000 83709 82261 gene locus_tag LOCUS_19010 83709 82261 CDS product DNA phosphorothioation-associated putative methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727533.1 protein_id gnl|my_center|LOCUS_19010 84202 83720 gene locus_tag LOCUS_19020 84202 83720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 86271 84199 gene locus_tag LOCUS_19030 86271 84199 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202291.1 protein_id gnl|my_center|LOCUS_19030 86450 86268 gene locus_tag LOCUS_19040 86450 86268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 88602 86467 gene locus_tag LOCUS_19050 88602 86467 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779460.1 protein_id gnl|my_center|LOCUS_19050 90863 88602 gene locus_tag LOCUS_19060 90863 88602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 91717 92244 gene locus_tag LOCUS_19070 91717 92244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 92720 92526 gene locus_tag LOCUS_19080 92720 92526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 93041 92787 gene locus_tag LOCUS_19090 93041 92787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19090 93438 93196 gene locus_tag LOCUS_19100 93438 93196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 93775 94290 gene locus_tag LOCUS_19110 93775 94290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 94724 94440 gene locus_tag LOCUS_19120 94724 94440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 95245 95550 gene locus_tag LOCUS_19130 95245 95550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 95627 96484 gene locus_tag LOCUS_19140 95627 96484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 97428 96757 gene locus_tag LOCUS_19150 97428 96757 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813962.1 protein_id gnl|my_center|LOCUS_19150 97451 98125 gene locus_tag LOCUS_19160 97451 98125 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222233.1 protein_id gnl|my_center|LOCUS_19160 98250 98774 gene locus_tag LOCUS_19170 98250 98774 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396860.1 protein_id gnl|my_center|LOCUS_19170 99385 100725 gene locus_tag LOCUS_19180 99385 100725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 103203 101011 gene locus_tag LOCUS_19190 103203 101011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 104201 103200 gene locus_tag LOCUS_19200 104201 103200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 105526 104198 gene locus_tag LOCUS_19210 105526 104198 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027699.1 protein_id gnl|my_center|LOCUS_19210 106523 105585 gene locus_tag LOCUS_19220 106523 105585 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029194.1 protein_id gnl|my_center|LOCUS_19220 107529 106864 gene locus_tag LOCUS_19230 107529 106864 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729087.1 protein_id gnl|my_center|LOCUS_19230 108169 107684 gene locus_tag LOCUS_19240 108169 107684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19240 108771 109799 gene locus_tag LOCUS_19250 108771 109799 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032541.1 protein_id gnl|my_center|LOCUS_19250 109796 111019 gene locus_tag LOCUS_19260 109796 111019 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026800.1 protein_id gnl|my_center|LOCUS_19260 111023 111511 gene locus_tag LOCUS_19270 111023 111511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026801.1 protein_id gnl|my_center|LOCUS_19270 111508 112554 gene locus_tag LOCUS_19280 111508 112554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026802.1 protein_id gnl|my_center|LOCUS_19280 112551 113285 gene locus_tag LOCUS_19290 112551 113285 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978487.1 protein_id gnl|my_center|LOCUS_19290 113398 114201 gene locus_tag LOCUS_19300 113398 114201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 115169 114504 gene locus_tag LOCUS_19310 115169 114504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 115667 115215 gene locus_tag LOCUS_19320 115667 115215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 115683 116402 gene locus_tag LOCUS_19330 115683 116402 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974330.1 protein_id gnl|my_center|LOCUS_19330 119262 116449 gene locus_tag LOCUS_19340 119262 116449 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972050.1 protein_id gnl|my_center|LOCUS_19340 119782 119456 gene locus_tag LOCUS_19350 119782 119456 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029816.1 protein_id gnl|my_center|LOCUS_19350 120213 119779 gene locus_tag LOCUS_19360 120213 119779 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972017.1 protein_id gnl|my_center|LOCUS_19360 121566 120358 gene locus_tag LOCUS_19370 121566 120358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 121790 121563 gene locus_tag LOCUS_19380 121790 121563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 123455 121800 gene locus_tag LOCUS_19390 123455 121800 CDS product lanthionine synthetase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026975.1 protein_id gnl|my_center|LOCUS_19390 126616 123452 gene locus_tag LOCUS_19400 126616 123452 CDS product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031312.1 protein_id gnl|my_center|LOCUS_19400 126880 126716 gene locus_tag LOCUS_19410 126880 126716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 127186 129171 gene locus_tag LOCUS_19420 127186 129171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230344.1 protein_id gnl|my_center|LOCUS_19420 129649 129203 gene locus_tag LOCUS_19430 129649 129203 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222738.1 protein_id gnl|my_center|LOCUS_19430 130881 130045 gene locus_tag LOCUS_19440 130881 130045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 131756 130857 gene locus_tag LOCUS_19450 131756 130857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 132090 133049 gene locus_tag LOCUS_19460 132090 133049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 133356 135491 gene locus_tag LOCUS_19470 133356 135491 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918421.1 protein_id gnl|my_center|LOCUS_19470 135498 136772 gene locus_tag LOCUS_19480 135498 136772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 137619 136834 gene locus_tag LOCUS_19490 137619 136834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 137816 138424 gene locus_tag LOCUS_19500 137816 138424 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226186.1 protein_id gnl|my_center|LOCUS_19500 138539 139219 gene locus_tag LOCUS_19510 138539 139219 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027476.1 protein_id gnl|my_center|LOCUS_19510 140907 139321 gene locus_tag LOCUS_19520 140907 139321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 141427 140909 gene locus_tag LOCUS_19530 141427 140909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 144320 141447 gene locus_tag LOCUS_19540 144320 141447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 144482 146881 gene locus_tag LOCUS_19550 144482 146881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 146978 147415 gene locus_tag LOCUS_19560 146978 147415 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228553.1 protein_id gnl|my_center|LOCUS_19560 147412 148326 gene locus_tag LOCUS_19570 147412 148326 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812933.1 protein_id gnl|my_center|LOCUS_19570 151908 148342 gene locus_tag LOCUS_19580 151908 148342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 152196 151936 gene locus_tag LOCUS_19590 152196 151936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 153196 152138 gene locus_tag LOCUS_19600 153196 152138 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027358.1 protein_id gnl|my_center|LOCUS_19600 154082 153513 gene locus_tag LOCUS_19610 154082 153513 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971771.1 protein_id gnl|my_center|LOCUS_19610 154689 154267 gene locus_tag LOCUS_19620 154689 154267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 154989 155456 gene locus_tag LOCUS_19630 154989 155456 CDS product DUF4383 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466936.1 protein_id gnl|my_center|LOCUS_19630 156016 155639 gene locus_tag LOCUS_19640 156016 155639 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_19640 156708 156085 gene locus_tag LOCUS_19650 156708 156085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 157692 156784 gene locus_tag LOCUS_19660 gene murQ 157692 156784 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029570.1 protein_id gnl|my_center|LOCUS_19660 158851 157838 gene locus_tag LOCUS_19670 158851 157838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 159855 158848 gene locus_tag LOCUS_19680 159855 158848 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879267.1 protein_id gnl|my_center|LOCUS_19680 160937 159852 gene locus_tag LOCUS_19690 160937 159852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085658.1 protein_id gnl|my_center|LOCUS_19690 161861 160941 gene locus_tag LOCUS_19700 161861 160941 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980619.1 protein_id gnl|my_center|LOCUS_19700 162895 161858 gene locus_tag LOCUS_19710 162895 161858 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225593.1 protein_id gnl|my_center|LOCUS_19710 164677 162899 gene locus_tag LOCUS_19720 164677 162899 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043792085.1 protein_id gnl|my_center|LOCUS_19720 165691 164885 gene locus_tag LOCUS_19730 165691 164885 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_19730 167673 165946 gene locus_tag LOCUS_19740 gene lysS 167673 165946 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975532.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence011 100 693 gene locus_tag LOCUS_19750 100 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1206 721 gene locus_tag LOCUS_19760 1206 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1487 1936 gene locus_tag LOCUS_19770 1487 1936 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_19770 3919 2093 gene locus_tag LOCUS_19780 gene asnB 3919 2093 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223784.1 protein_id gnl|my_center|LOCUS_19780 4805 4170 gene locus_tag LOCUS_19790 4805 4170 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224090.1 protein_id gnl|my_center|LOCUS_19790 5280 6383 gene locus_tag LOCUS_19800 5280 6383 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227012.1 protein_id gnl|my_center|LOCUS_19800 6559 8853 gene locus_tag LOCUS_19810 6559 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 10121 8901 gene locus_tag LOCUS_19820 10121 8901 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208142.1 protein_id gnl|my_center|LOCUS_19820 10392 10760 gene locus_tag LOCUS_19830 10392 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 10860 11441 gene locus_tag LOCUS_19840 10860 11441 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972866.1 protein_id gnl|my_center|LOCUS_19840 11555 12004 gene locus_tag LOCUS_19850 11555 12004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 11997 13004 gene locus_tag LOCUS_19860 11997 13004 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_19860 15023 13191 gene locus_tag LOCUS_19870 15023 13191 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031326.1 protein_id gnl|my_center|LOCUS_19870 19233 15061 gene locus_tag LOCUS_19880 gene cobN 19233 15061 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410648.1 protein_id gnl|my_center|LOCUS_19880 19501 21531 gene locus_tag LOCUS_19890 19501 21531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 22236 23276 gene locus_tag LOCUS_19900 22236 23276 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224183.1 protein_id gnl|my_center|LOCUS_19900 24395 23310 gene locus_tag LOCUS_19910 24395 23310 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390744.1 protein_id gnl|my_center|LOCUS_19910 24708 25082 gene locus_tag LOCUS_19920 24708 25082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19920 25100 26134 gene locus_tag LOCUS_19930 25100 26134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19930 27185 26295 gene locus_tag LOCUS_19940 27185 26295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 27700 27218 gene locus_tag LOCUS_19950 27700 27218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229068.1 protein_id gnl|my_center|LOCUS_19950 27878 29281 gene locus_tag LOCUS_19960 27878 29281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 29486 29319 gene locus_tag LOCUS_19970 29486 29319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 29858 29682 gene locus_tag LOCUS_19980 29858 29682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 30132 29956 gene locus_tag LOCUS_19990 30132 29956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 30419 30240 gene locus_tag LOCUS_20000 30419 30240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 30615 30445 gene locus_tag LOCUS_20010 30615 30445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence012 2302 137 gene locus_tag LOCUS_20020 2302 137 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 protein_id gnl|my_center|LOCUS_20020 5610 2302 gene locus_tag LOCUS_20030 5610 2302 CDS product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226577.1 protein_id gnl|my_center|LOCUS_20030 5807 6325 gene locus_tag LOCUS_20040 5807 6325 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_20040 6322 7440 gene locus_tag LOCUS_20050 6322 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 10551 7612 gene locus_tag LOCUS_20060 10551 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 11085 10834 gene locus_tag LOCUS_20070 11085 10834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 14026 11075 gene locus_tag LOCUS_20080 14026 11075 CDS product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226577.1 protein_id gnl|my_center|LOCUS_20080 14399 15235 gene locus_tag LOCUS_20090 14399 15235 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228821.1 protein_id gnl|my_center|LOCUS_20090 17380 15299 gene locus_tag LOCUS_20100 17380 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 18068 17388 gene locus_tag LOCUS_20110 18068 17388 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_20110 18804 18049 gene locus_tag LOCUS_20120 gene cobM 18804 18049 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228819.1 protein_id gnl|my_center|LOCUS_20120 20314 18884 gene locus_tag LOCUS_20130 20314 18884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 21941 20394 gene locus_tag LOCUS_20140 21941 20394 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028009.1 protein_id gnl|my_center|LOCUS_20140 22537 21935 gene locus_tag LOCUS_20150 gene cobO 22537 21935 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976969.1 protein_id gnl|my_center|LOCUS_20150 24979 22595 gene locus_tag LOCUS_20160 24979 22595 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976970.1 protein_id gnl|my_center|LOCUS_20160 25984 25220 gene locus_tag LOCUS_20170 25984 25220 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 protein_id gnl|my_center|LOCUS_20170 26219 26007 gene locus_tag LOCUS_20180 26219 26007 CDS product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228805.1 protein_id gnl|my_center|LOCUS_20180 26623 27204 gene locus_tag LOCUS_20190 26623 27204 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897489.1 protein_id gnl|my_center|LOCUS_20190 28068 27241 gene locus_tag LOCUS_20200 28068 27241 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977267.1 protein_id gnl|my_center|LOCUS_20200 28779 28123 gene locus_tag LOCUS_20210 28779 28123 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027847.1 protein_id gnl|my_center|LOCUS_20210 29816 28776 gene locus_tag LOCUS_20220 29816 28776 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325822.1 protein_id gnl|my_center|LOCUS_20220 30367 32058 gene locus_tag LOCUS_20230 30367 32058 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027136.1 protein_id gnl|my_center|LOCUS_20230 32263 32493 gene locus_tag LOCUS_20240 32263 32493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 33237 32632 gene locus_tag LOCUS_20250 33237 32632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 33534 34910 gene locus_tag LOCUS_20260 33534 34910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468787.1 protein_id gnl|my_center|LOCUS_20260 35255 36397 gene locus_tag LOCUS_20270 35255 36397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 37132 36482 gene locus_tag LOCUS_20280 37132 36482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 38382 37135 gene locus_tag LOCUS_20290 38382 37135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 38520 38954 gene locus_tag LOCUS_20300 38520 38954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 39613 39239 gene locus_tag LOCUS_20310 39613 39239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 39707 40609 gene locus_tag LOCUS_20320 39707 40609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 40606 40944 gene locus_tag LOCUS_20330 40606 40944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 41076 41594 gene locus_tag LOCUS_20340 41076 41594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 41885 41646 gene locus_tag LOCUS_20350 41885 41646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 42066 42395 gene locus_tag LOCUS_20360 42066 42395 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429484.1 protein_id gnl|my_center|LOCUS_20360 42392 42811 gene locus_tag LOCUS_20370 42392 42811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 42832 44040 gene locus_tag LOCUS_20380 42832 44040 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_20380 44149 44919 gene locus_tag LOCUS_20390 44149 44919 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325650.1 protein_id gnl|my_center|LOCUS_20390 45941 44937 gene locus_tag LOCUS_20400 gene hpnH 45941 44937 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_20400 46693 45938 gene locus_tag LOCUS_20410 46693 45938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 48696 46690 gene locus_tag LOCUS_20420 gene shc 48696 46690 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_20420 49808 48798 gene locus_tag LOCUS_20430 49808 48798 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223417.1 protein_id gnl|my_center|LOCUS_20430 51142 49805 gene locus_tag LOCUS_20440 gene hpnE 51142 49805 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_20440 51996 51139 gene locus_tag LOCUS_20450 gene hpnD 51996 51139 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_20450 52778 51993 gene locus_tag LOCUS_20460 gene hpnC 52778 51993 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 protein_id gnl|my_center|LOCUS_20460 53787 53089 gene locus_tag LOCUS_20470 53787 53089 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484635.1 protein_id gnl|my_center|LOCUS_20470 53940 55040 gene locus_tag LOCUS_20480 53940 55040 CDS product galactosyldiacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484813.1 protein_id gnl|my_center|LOCUS_20480 55872 55009 gene locus_tag LOCUS_20490 55872 55009 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027243.1 protein_id gnl|my_center|LOCUS_20490 56747 55869 gene locus_tag LOCUS_20500 56747 55869 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977140.1 protein_id gnl|my_center|LOCUS_20500 57028 57426 gene locus_tag LOCUS_20510 57028 57426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 57596 58264 gene locus_tag LOCUS_20520 57596 58264 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775986.1 protein_id gnl|my_center|LOCUS_20520 58261 59100 gene locus_tag LOCUS_20530 58261 59100 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775985.1 protein_id gnl|my_center|LOCUS_20530 59206 59532 gene locus_tag LOCUS_20540 59206 59532 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226217.1 protein_id gnl|my_center|LOCUS_20540 59590 60351 gene locus_tag LOCUS_20550 59590 60351 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031612.1 protein_id gnl|my_center|LOCUS_20550 60761 61405 gene locus_tag LOCUS_20560 60761 61405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 61826 61629 gene locus_tag LOCUS_20570 61826 61629 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224345.1 protein_id gnl|my_center|LOCUS_20570 62020 61823 gene locus_tag LOCUS_20580 62020 61823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 62463 62017 gene locus_tag LOCUS_20590 62463 62017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 62800 64371 gene locus_tag LOCUS_20600 62800 64371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 64065 63967 gene locus_tag LOCUS_t00150 64065 63967 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 64441 64827 gene locus_tag LOCUS_20610 64441 64827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 64943 66130 gene locus_tag LOCUS_20620 64943 66130 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028027.1 protein_id gnl|my_center|LOCUS_20620 66184 66516 gene locus_tag LOCUS_20630 66184 66516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 69697 66611 gene locus_tag LOCUS_20640 69697 66611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 70265 70065 gene locus_tag LOCUS_20650 70265 70065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 70489 71616 gene locus_tag LOCUS_20660 70489 71616 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_20660 71613 73142 gene locus_tag LOCUS_20670 71613 73142 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028557.1 protein_id gnl|my_center|LOCUS_20670 73132 74094 gene locus_tag LOCUS_20680 73132 74094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20680 74177 75121 gene locus_tag LOCUS_20690 74177 75121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20690 75149 76057 gene locus_tag LOCUS_20700 75149 76057 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028558.1 protein_id gnl|my_center|LOCUS_20700 76123 76443 gene locus_tag LOCUS_20710 gene rbsD 76123 76443 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028559.1 protein_id gnl|my_center|LOCUS_20710 77391 76600 gene locus_tag LOCUS_20720 77391 76600 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030363.1 protein_id gnl|my_center|LOCUS_20720 77897 77589 gene locus_tag LOCUS_20730 77897 77589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 77851 79689 gene locus_tag LOCUS_20740 77851 79689 CDS product glycoside hydrolase family 18 chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030211.1 protein_id gnl|my_center|LOCUS_20740 80131 79928 gene locus_tag LOCUS_20750 80131 79928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 80432 82813 gene locus_tag LOCUS_20760 80432 82813 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223450.1 protein_id gnl|my_center|LOCUS_20760 82867 83238 gene locus_tag LOCUS_20770 82867 83238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 83441 84427 gene locus_tag LOCUS_20780 83441 84427 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_20780 84702 85229 gene locus_tag LOCUS_20790 84702 85229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 87019 85256 gene locus_tag LOCUS_20800 87019 85256 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338607.1 protein_id gnl|my_center|LOCUS_20800 87351 87148 gene locus_tag LOCUS_20810 87351 87148 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891980.1 protein_id gnl|my_center|LOCUS_20810 88608 87712 gene locus_tag LOCUS_20820 88608 87712 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031333.1 protein_id gnl|my_center|LOCUS_20820 90104 88605 gene locus_tag LOCUS_20830 90104 88605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 90350 90649 gene locus_tag LOCUS_20840 90350 90649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 90940 92205 gene locus_tag LOCUS_20850 90940 92205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 94528 93389 gene locus_tag LOCUS_20860 94528 93389 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_20860 94731 95576 gene locus_tag LOCUS_20870 94731 95576 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467152.1 protein_id gnl|my_center|LOCUS_20870 95816 96877 gene locus_tag LOCUS_20880 95816 96877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 97140 100520 gene locus_tag LOCUS_20890 97140 100520 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728047.1 protein_id gnl|my_center|LOCUS_20890 101146 100586 gene locus_tag LOCUS_20900 101146 100586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 101335 102255 gene locus_tag LOCUS_20910 101335 102255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 102284 102937 gene locus_tag LOCUS_20920 102284 102937 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227810.1 protein_id gnl|my_center|LOCUS_20920 103073 103759 gene locus_tag LOCUS_20930 103073 103759 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085510.1 protein_id gnl|my_center|LOCUS_20930 103756 105357 gene locus_tag LOCUS_20940 103756 105357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085511.1 protein_id gnl|my_center|LOCUS_20940 105430 106788 gene locus_tag LOCUS_20950 105430 106788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 106861 107484 gene locus_tag LOCUS_20960 106861 107484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence013 1337 582 gene locus_tag LOCUS_20970 1337 582 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072477587.1 protein_id gnl|my_center|LOCUS_20970 2196 1855 gene locus_tag LOCUS_20980 2196 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2195 2425 gene locus_tag LOCUS_20990 2195 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 3074 3886 gene locus_tag LOCUS_21000 3074 3886 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031583.1 protein_id gnl|my_center|LOCUS_21000 4737 4084 gene locus_tag LOCUS_21010 4737 4084 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930016.1 protein_id gnl|my_center|LOCUS_21010 5863 4715 gene locus_tag LOCUS_21020 5863 4715 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_21020 6031 7875 gene locus_tag LOCUS_21030 6031 7875 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 protein_id gnl|my_center|LOCUS_21030 8782 7937 gene locus_tag LOCUS_21040 8782 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 9839 8760 gene locus_tag LOCUS_21050 9839 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 12712 10040 gene locus_tag LOCUS_21060 12712 10040 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225440415.1 protein_id gnl|my_center|LOCUS_21060 13278 13009 gene locus_tag LOCUS_21070 13278 13009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 14614 13517 gene locus_tag LOCUS_21080 14614 13517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 15669 14611 gene locus_tag LOCUS_21090 15669 14611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 15922 15761 gene locus_tag LOCUS_21100 15922 15761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 16974 16090 gene locus_tag LOCUS_21110 16974 16090 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027450.1 protein_id gnl|my_center|LOCUS_21110 17057 17620 gene locus_tag LOCUS_21120 17057 17620 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222994.1 protein_id gnl|my_center|LOCUS_21120 18035 17691 gene locus_tag LOCUS_21130 18035 17691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 19159 18170 gene locus_tag LOCUS_21140 19159 18170 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487139.1 protein_id gnl|my_center|LOCUS_21140 19351 19722 gene locus_tag LOCUS_21150 19351 19722 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225099.1 protein_id gnl|my_center|LOCUS_21150 19790 20128 gene locus_tag LOCUS_21160 19790 20128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 20966 20223 gene locus_tag LOCUS_21170 20966 20223 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031670.1 protein_id gnl|my_center|LOCUS_21170 22301 21195 gene locus_tag LOCUS_21180 22301 21195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 23731 22745 gene locus_tag LOCUS_21190 23731 22745 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229250.1 protein_id gnl|my_center|LOCUS_21190 24151 23870 gene locus_tag LOCUS_21200 24151 23870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 24051 24620 gene locus_tag LOCUS_21210 24051 24620 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227981.1 protein_id gnl|my_center|LOCUS_21210 25249 24593 gene locus_tag LOCUS_21220 25249 24593 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227982.1 protein_id gnl|my_center|LOCUS_21220 26385 25246 gene locus_tag LOCUS_21230 26385 25246 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227983.1 protein_id gnl|my_center|LOCUS_21230 27142 28128 gene locus_tag LOCUS_21240 27142 28128 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_21240 28122 28997 gene locus_tag LOCUS_21250 28122 28997 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 protein_id gnl|my_center|LOCUS_21250 29052 30698 gene locus_tag LOCUS_21260 29052 30698 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803820.1 protein_id gnl|my_center|LOCUS_21260 30739 31443 gene locus_tag LOCUS_21270 30739 31443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 31471 33684 gene locus_tag LOCUS_21280 gene aguA 31471 33684 CDS product xylan alpha-(1->2)-glucuronosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082543.1 protein_id gnl|my_center|LOCUS_21280 33867 34784 gene locus_tag LOCUS_21290 33867 34784 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225890812.1 protein_id gnl|my_center|LOCUS_21290 34833 35711 gene locus_tag LOCUS_21300 34833 35711 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730108.1 protein_id gnl|my_center|LOCUS_21300 36004 38052 gene locus_tag LOCUS_21310 36004 38052 CDS product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201368745.1 protein_id gnl|my_center|LOCUS_21310 39573 38203 gene locus_tag LOCUS_21320 39573 38203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 40242 39805 gene locus_tag LOCUS_21330 40242 39805 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898000.1 protein_id gnl|my_center|LOCUS_21330 40365 41042 gene locus_tag LOCUS_21340 40365 41042 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223216.1 protein_id gnl|my_center|LOCUS_21340 41285 42355 gene locus_tag LOCUS_21350 41285 42355 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085410.1 protein_id gnl|my_center|LOCUS_21350 43466 42642 gene locus_tag LOCUS_21360 43466 42642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 44035 47172 gene locus_tag LOCUS_21370 44035 47172 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226159.1 protein_id gnl|my_center|LOCUS_21370 47257 47595 gene locus_tag LOCUS_21380 47257 47595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 47588 47788 gene locus_tag LOCUS_21390 47588 47788 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978159.1 protein_id gnl|my_center|LOCUS_21390 48187 48423 gene locus_tag LOCUS_21400 48187 48423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 48676 49881 gene locus_tag LOCUS_21410 48676 49881 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226999.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence014 965 21 gene locus_tag LOCUS_21420 965 21 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225890812.1 protein_id gnl|my_center|LOCUS_21420 1361 1942 gene locus_tag LOCUS_21430 1361 1942 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978343.1 protein_id gnl|my_center|LOCUS_21430 1973 3172 gene locus_tag LOCUS_21440 1973 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978628.1 protein_id gnl|my_center|LOCUS_21440 7337 3207 gene locus_tag LOCUS_21450 7337 3207 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172623.1 protein_id gnl|my_center|LOCUS_21450 8745 7363 gene locus_tag LOCUS_21460 8745 7363 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011319592.1 protein_id gnl|my_center|LOCUS_21460 9095 11434 gene locus_tag LOCUS_21470 9095 11434 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_21470 11595 11443 gene locus_tag LOCUS_21480 11595 11443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 12070 11588 gene locus_tag LOCUS_21490 12070 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 12264 12067 gene locus_tag LOCUS_21500 12264 12067 CDS product DUF5999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977451.1 protein_id gnl|my_center|LOCUS_21500 12959 12591 gene locus_tag LOCUS_21510 12959 12591 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_21510 15250 12956 gene locus_tag LOCUS_21520 15250 12956 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027618.1 protein_id gnl|my_center|LOCUS_21520 15419 16369 gene locus_tag LOCUS_21530 15419 16369 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943314.1 protein_id gnl|my_center|LOCUS_21530 16366 16986 gene locus_tag LOCUS_21540 16366 16986 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726717.1 protein_id gnl|my_center|LOCUS_21540 17110 17460 gene locus_tag LOCUS_21550 17110 17460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 18264 17464 gene locus_tag LOCUS_21560 18264 17464 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296694.1 protein_id gnl|my_center|LOCUS_21560 18511 19980 gene locus_tag LOCUS_21570 18511 19980 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978484.1 protein_id gnl|my_center|LOCUS_21570 19980 21047 gene locus_tag LOCUS_21580 19980 21047 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_21580 21044 22012 gene locus_tag LOCUS_21590 gene rfbB 21044 22012 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_21590 22009 22884 gene locus_tag LOCUS_21600 gene rfbD 22009 22884 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222918.1 protein_id gnl|my_center|LOCUS_21600 22884 24428 gene locus_tag LOCUS_21610 22884 24428 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103941653.1 protein_id gnl|my_center|LOCUS_21610 24425 25369 gene locus_tag LOCUS_21620 24425 25369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 25518 26696 gene locus_tag LOCUS_21630 25518 26696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 26693 27451 gene locus_tag LOCUS_21640 26693 27451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 28481 27474 gene locus_tag LOCUS_21650 28481 27474 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043607342.1 protein_id gnl|my_center|LOCUS_21650 28517 29119 gene locus_tag LOCUS_21660 28517 29119 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776120.1 protein_id gnl|my_center|LOCUS_21660 29116 30156 gene locus_tag LOCUS_21670 29116 30156 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227740.1 protein_id gnl|my_center|LOCUS_21670 31328 30378 gene locus_tag LOCUS_21680 31328 30378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 31997 31419 gene locus_tag LOCUS_21690 31997 31419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 32282 33415 gene locus_tag LOCUS_21700 32282 33415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 33412 34752 gene locus_tag LOCUS_21710 33412 34752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 35524 34769 gene locus_tag LOCUS_21720 35524 34769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029192.1 protein_id gnl|my_center|LOCUS_21720 36517 35684 gene locus_tag LOCUS_21730 gene phnE 36517 35684 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302225.1 protein_id gnl|my_center|LOCUS_21730 36714 36514 gene locus_tag LOCUS_21740 36714 36514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 38536 37022 gene locus_tag LOCUS_21750 38536 37022 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030460.1 protein_id gnl|my_center|LOCUS_21750 39671 38700 gene locus_tag LOCUS_21760 39671 38700 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_21760 39738 40190 gene locus_tag LOCUS_21770 39738 40190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 40187 40648 gene locus_tag LOCUS_21780 40187 40648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229734.1 protein_id gnl|my_center|LOCUS_21780 41193 40786 gene locus_tag LOCUS_21790 41193 40786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 41408 42526 gene locus_tag LOCUS_21800 41408 42526 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222881.1 protein_id gnl|my_center|LOCUS_21800 42523 43185 gene locus_tag LOCUS_21810 42523 43185 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222882.1 protein_id gnl|my_center|LOCUS_21810 43779 43216 gene locus_tag LOCUS_21820 43779 43216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 44049 44792 gene locus_tag LOCUS_21830 44049 44792 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_21830 44806 45078 gene locus_tag LOCUS_21840 44806 45078 CDS product DUF6295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226838.1 protein_id gnl|my_center|LOCUS_21840 45265 45068 gene locus_tag LOCUS_21850 45265 45068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 45910 45362 gene locus_tag LOCUS_21860 45910 45362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 47001 45907 gene locus_tag LOCUS_21870 47001 45907 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_21870 47196 48563 gene locus_tag LOCUS_21880 47196 48563 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946005.1 protein_id gnl|my_center|LOCUS_21880 49889 48792 gene locus_tag LOCUS_21890 49889 48792 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_21890 50593 49886 gene locus_tag LOCUS_21900 50593 49886 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289363.1 protein_id gnl|my_center|LOCUS_21900 52035 50590 gene locus_tag LOCUS_21910 52035 50590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 53243 52032 gene locus_tag LOCUS_21920 53243 52032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 54465 53344 gene locus_tag LOCUS_21930 54465 53344 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257505.1 protein_id gnl|my_center|LOCUS_21930 55622 54462 gene locus_tag LOCUS_21940 55622 54462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 56602 55619 gene locus_tag LOCUS_21950 56602 55619 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061733.1 protein_id gnl|my_center|LOCUS_21950 57636 56602 gene locus_tag LOCUS_21960 57636 56602 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_21960 61763 57771 gene locus_tag LOCUS_21970 61763 57771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 62690 62031 gene locus_tag LOCUS_21980 62690 62031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878513.1 protein_id gnl|my_center|LOCUS_21980 62872 63477 gene locus_tag LOCUS_21990 62872 63477 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229701.1 protein_id gnl|my_center|LOCUS_21990 63678 65483 gene locus_tag LOCUS_22000 63678 65483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 66641 65565 gene locus_tag LOCUS_22010 66641 65565 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_22010 68488 66638 gene locus_tag LOCUS_22020 68488 66638 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_22020 70470 68845 gene locus_tag LOCUS_22030 70470 68845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 70610 71026 gene locus_tag LOCUS_22040 70610 71026 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974348.1 protein_id gnl|my_center|LOCUS_22040 71086 71616 gene locus_tag LOCUS_22050 71086 71616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 71613 72209 gene locus_tag LOCUS_22060 71613 72209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22060 72202 73158 gene locus_tag LOCUS_22070 72202 73158 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 protein_id gnl|my_center|LOCUS_22070 74173 73217 gene locus_tag LOCUS_22080 74173 73217 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222332.1 protein_id gnl|my_center|LOCUS_22080 76173 74359 gene locus_tag LOCUS_22090 76173 74359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 77303 76578 gene locus_tag LOCUS_22100 77303 76578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 77481 77777 gene locus_tag LOCUS_22110 77481 77777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 77971 79371 gene locus_tag LOCUS_22120 77971 79371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 79368 80255 gene locus_tag LOCUS_22130 79368 80255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 80257 80781 gene locus_tag LOCUS_22140 80257 80781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 80778 82739 gene locus_tag LOCUS_22150 80778 82739 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029758.1 protein_id gnl|my_center|LOCUS_22150 82939 84537 gene locus_tag LOCUS_22160 82939 84537 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_22160 84534 86042 gene locus_tag LOCUS_22170 84534 86042 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029760.1 protein_id gnl|my_center|LOCUS_22170 86209 87063 gene locus_tag LOCUS_22180 gene htpX 86209 87063 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_22180 88560 87340 gene locus_tag LOCUS_22190 88560 87340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 89308 88565 gene locus_tag LOCUS_22200 89308 88565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 90232 89570 gene locus_tag LOCUS_22210 90232 89570 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_22210 91386 90313 gene locus_tag LOCUS_22220 91386 90313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 92269 91778 gene locus_tag LOCUS_22230 92269 91778 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_22230 92411 92493 gene locus_tag LOCUS_t00160 92411 92493 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 92884 93531 gene locus_tag LOCUS_22240 92884 93531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 94920 93544 gene locus_tag LOCUS_22250 94920 93544 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227938.1 protein_id gnl|my_center|LOCUS_22250 95117 94920 gene locus_tag LOCUS_22260 95117 94920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 95538 95143 gene locus_tag LOCUS_22270 95538 95143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 96137 96430 gene locus_tag LOCUS_22280 96137 96430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 96636 97157 gene locus_tag LOCUS_22290 96636 97157 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804308.1 protein_id gnl|my_center|LOCUS_22290 97635 97129 gene locus_tag LOCUS_22300 97635 97129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 98191 100002 gene locus_tag LOCUS_22310 98191 100002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 100464 100192 gene locus_tag LOCUS_22320 100464 100192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 101519 100566 gene locus_tag LOCUS_22330 101519 100566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 101889 103382 gene locus_tag LOCUS_22340 101889 103382 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028042.1 protein_id gnl|my_center|LOCUS_22340 103744 104322 gene locus_tag LOCUS_22350 103744 104322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 104319 106973 gene locus_tag LOCUS_22360 104319 106973 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029396.1 protein_id gnl|my_center|LOCUS_22360 106970 107863 gene locus_tag LOCUS_22370 106970 107863 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029395.1 protein_id gnl|my_center|LOCUS_22370 107877 108398 gene locus_tag LOCUS_22380 107877 108398 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973682.1 protein_id gnl|my_center|LOCUS_22380 108591 108809 gene locus_tag LOCUS_22390 108591 108809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 109071 109144 gene locus_tag LOCUS_t00170 109071 109144 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 109360 109434 gene locus_tag LOCUS_t00180 109360 109434 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 109511 109675 gene locus_tag LOCUS_22400 gene rpmG 109511 109675 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005152047.1 protein_id gnl|my_center|LOCUS_22400 110097 110546 gene locus_tag LOCUS_22410 110097 110546 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285884.1 protein_id gnl|my_center|LOCUS_22410 110550 110978 gene locus_tag LOCUS_22420 110550 110978 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_22420 111006 112199 gene locus_tag LOCUS_22430 111006 112199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 112500 113570 gene locus_tag LOCUS_22440 112500 113570 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_22440 114318 113656 gene locus_tag LOCUS_22450 114318 113656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 117352 114467 gene locus_tag LOCUS_22460 117352 114467 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 protein_id gnl|my_center|LOCUS_22460 117720 117547 gene locus_tag LOCUS_22470 117720 117547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 117952 118923 gene locus_tag LOCUS_22480 gene deoC 117952 118923 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_22480 118936 120393 gene locus_tag LOCUS_22490 118936 120393 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_22490 120386 120595 gene locus_tag LOCUS_22500 120386 120595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 120588 121457 gene locus_tag LOCUS_22510 120588 121457 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_22510 124258 121613 gene locus_tag LOCUS_22520 124258 121613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 125024 124446 gene locus_tag LOCUS_22530 125024 124446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 125175 125384 gene locus_tag LOCUS_22540 125175 125384 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222993.1 protein_id gnl|my_center|LOCUS_22540 125360 125557 gene locus_tag LOCUS_22550 125360 125557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 125542 126213 gene locus_tag LOCUS_22560 gene lipB 125542 126213 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618236.1 protein_id gnl|my_center|LOCUS_22560 127892 126342 gene locus_tag LOCUS_22570 127892 126342 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230797.1 protein_id gnl|my_center|LOCUS_22570 129010 128021 gene locus_tag LOCUS_22580 129010 128021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 129082 131544 gene locus_tag LOCUS_22590 129082 131544 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 protein_id gnl|my_center|LOCUS_22590 132158 131619 gene locus_tag LOCUS_22600 132158 131619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 132463 132158 gene locus_tag LOCUS_22610 132463 132158 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224339.1 protein_id gnl|my_center|LOCUS_22610 132951 133313 gene locus_tag LOCUS_22620 132951 133313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 134235 133348 gene locus_tag LOCUS_22630 134235 133348 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029030.1 protein_id gnl|my_center|LOCUS_22630 134173 134427 gene locus_tag LOCUS_22640 134173 134427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 134929 134381 gene locus_tag LOCUS_22650 134929 134381 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_22650 135918 135010 gene locus_tag LOCUS_22660 135918 135010 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_22660 136184 136693 gene locus_tag LOCUS_22670 136184 136693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 140122 136955 gene locus_tag LOCUS_22680 140122 136955 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104583.1 protein_id gnl|my_center|LOCUS_22680 140360 142273 gene locus_tag LOCUS_22690 gene dnaK 140360 142273 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144248.1 protein_id gnl|my_center|LOCUS_22690 142478 143191 gene locus_tag LOCUS_22700 142478 143191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 143191 144171 gene locus_tag LOCUS_22710 143191 144171 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_22710 144183 144503 gene locus_tag LOCUS_22720 144183 144503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 144485 147169 gene locus_tag LOCUS_22730 gene clpB 144485 147169 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_22730 147366 148022 gene locus_tag LOCUS_22740 147366 148022 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 protein_id gnl|my_center|LOCUS_22740 148103 148702 gene locus_tag LOCUS_22750 148103 148702 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859221.1 protein_id gnl|my_center|LOCUS_22750 148977 152267 gene locus_tag LOCUS_22760 148977 152267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 153428 152415 gene locus_tag LOCUS_22770 153428 152415 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 protein_id gnl|my_center|LOCUS_22770 153745 154938 gene locus_tag LOCUS_22780 153745 154938 CDS product NarK/NasA family nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026930.1 protein_id gnl|my_center|LOCUS_22780 155004 158786 gene locus_tag LOCUS_22790 155004 158786 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972444.1 protein_id gnl|my_center|LOCUS_22790 158786 160438 gene locus_tag LOCUS_22800 gene narH 158786 160438 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 protein_id gnl|my_center|LOCUS_22800 160435 161160 gene locus_tag LOCUS_22810 gene narJ 160435 161160 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026934.1 protein_id gnl|my_center|LOCUS_22810 161157 161894 gene locus_tag LOCUS_22820 gene narI 161157 161894 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 protein_id gnl|my_center|LOCUS_22820 162913 161900 gene locus_tag LOCUS_22830 162913 161900 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227097.1 protein_id gnl|my_center|LOCUS_22830 163938 163000 gene locus_tag LOCUS_22840 163938 163000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 164489 163929 gene locus_tag LOCUS_22850 164489 163929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 164992 166470 gene locus_tag LOCUS_22860 164992 166470 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028880.1 protein_id gnl|my_center|LOCUS_22860 166653 167474 gene locus_tag LOCUS_22870 166653 167474 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096460324.1 protein_id gnl|my_center|LOCUS_22870 168220 167507 gene locus_tag LOCUS_22880 168220 167507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 168849 168229 gene locus_tag LOCUS_22890 168849 168229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 169111 168842 gene locus_tag LOCUS_22900 169111 168842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228535.1 protein_id gnl|my_center|LOCUS_22900 169455 170003 gene locus_tag LOCUS_22910 169455 170003 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 protein_id gnl|my_center|LOCUS_22910 170000 170524 gene locus_tag LOCUS_22920 170000 170524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 170994 172583 gene locus_tag LOCUS_22930 170994 172583 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275275.1 protein_id gnl|my_center|LOCUS_22930 172783 175650 gene locus_tag LOCUS_22940 172783 175650 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486544.1 protein_id gnl|my_center|LOCUS_22940 175715 175975 gene locus_tag LOCUS_22950 175715 175975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 175960 176367 gene locus_tag LOCUS_22960 175960 176367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 177409 176486 gene locus_tag LOCUS_22970 177409 176486 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223696.1 protein_id gnl|my_center|LOCUS_22970 177610 179652 gene locus_tag LOCUS_22980 177610 179652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 179888 180853 gene locus_tag LOCUS_22990 179888 180853 CDS product DUF6454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227986.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence015 43 1227 gene locus_tag LOCUS_23000 43 1227 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270458.1 protein_id gnl|my_center|LOCUS_23000 2880 1396 gene locus_tag LOCUS_23010 2880 1396 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_23010 3054 5144 gene locus_tag LOCUS_23020 3054 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 5587 7074 gene locus_tag LOCUS_23030 5587 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 7177 8064 gene locus_tag LOCUS_23040 7177 8064 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228840.1 protein_id gnl|my_center|LOCUS_23040 8139 8972 gene locus_tag LOCUS_23050 8139 8972 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263481.1 protein_id gnl|my_center|LOCUS_23050 9326 9826 gene locus_tag LOCUS_23060 9326 9826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 10325 9897 gene locus_tag LOCUS_23070 10325 9897 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184978408.1 protein_id gnl|my_center|LOCUS_23070 11416 11589 gene locus_tag LOCUS_23080 11416 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 13258 11984 gene locus_tag LOCUS_23090 gene dcm 13258 11984 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230932.1 protein_id gnl|my_center|LOCUS_23090 13342 13845 gene locus_tag LOCUS_23100 13342 13845 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 protein_id gnl|my_center|LOCUS_23100 14791 14033 gene locus_tag LOCUS_23110 14791 14033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 16712 14898 gene locus_tag LOCUS_23120 16712 14898 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230933.1 protein_id gnl|my_center|LOCUS_23120 18138 16720 gene locus_tag LOCUS_23130 18138 16720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109210242.1 protein_id gnl|my_center|LOCUS_23130 18248 18946 gene locus_tag LOCUS_23140 18248 18946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230935.1 protein_id gnl|my_center|LOCUS_23140 19954 18965 gene locus_tag LOCUS_23150 19954 18965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 20406 20951 gene locus_tag LOCUS_23160 20406 20951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 21355 21152 gene locus_tag LOCUS_23170 21355 21152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 22226 21369 gene locus_tag LOCUS_23180 22226 21369 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_23180 22464 23000 gene locus_tag LOCUS_23190 22464 23000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 23015 23302 gene locus_tag LOCUS_23200 23015 23302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 23357 23572 gene locus_tag LOCUS_23210 23357 23572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 23569 24717 gene locus_tag LOCUS_23220 gene tgmC 23569 24717 CDS product ATP-grasp peptide maturase system methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028638.1 protein_id gnl|my_center|LOCUS_23220 24791 26011 gene locus_tag LOCUS_23230 24791 26011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 26333 26019 gene locus_tag LOCUS_23240 26333 26019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 26492 26842 gene locus_tag LOCUS_23250 26492 26842 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229138.1 protein_id gnl|my_center|LOCUS_23250 27836 27063 gene locus_tag LOCUS_23260 27836 27063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 28087 28878 gene locus_tag LOCUS_23270 28087 28878 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229343.1 protein_id gnl|my_center|LOCUS_23270 29026 29886 gene locus_tag LOCUS_23280 29026 29886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 29983 30258 gene locus_tag LOCUS_23290 29983 30258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 30801 30442 gene locus_tag LOCUS_23300 30801 30442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 31051 31545 gene locus_tag LOCUS_23310 31051 31545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 31868 32455 gene locus_tag LOCUS_23320 31868 32455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 33353 32580 gene locus_tag LOCUS_23330 33353 32580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 33583 33900 gene locus_tag LOCUS_23340 33583 33900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 34230 33907 gene locus_tag LOCUS_23350 34230 33907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 34490 34711 gene locus_tag LOCUS_23360 34490 34711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 34711 35475 gene locus_tag LOCUS_23370 34711 35475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 35447 37039 gene locus_tag LOCUS_23380 35447 37039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23380 37858 37013 gene locus_tag LOCUS_23390 37858 37013 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028635.1 protein_id gnl|my_center|LOCUS_23390 38439 37897 gene locus_tag LOCUS_23400 38439 37897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143647548.1 protein_id gnl|my_center|LOCUS_23400 38785 38408 gene locus_tag LOCUS_23410 38785 38408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 39155 39418 gene locus_tag LOCUS_23420 39155 39418 CDS product putative ATP-grasp-modified RiPP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742351.1 protein_id gnl|my_center|LOCUS_23420 39429 40364 gene locus_tag LOCUS_23430 gene tgmB 39429 40364 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028637.1 protein_id gnl|my_center|LOCUS_23430 40371 41510 gene locus_tag LOCUS_23440 gene tgmC 40371 41510 CDS product ATP-grasp peptide maturase system methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028638.1 protein_id gnl|my_center|LOCUS_23440 41999 44959 gene locus_tag LOCUS_23450 41999 44959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 45029 45448 gene locus_tag LOCUS_23460 45029 45448 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225078.1 protein_id gnl|my_center|LOCUS_23460 45892 45491 gene locus_tag LOCUS_23470 45892 45491 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974896.1 protein_id gnl|my_center|LOCUS_23470 46753 46115 gene locus_tag LOCUS_23480 46753 46115 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 protein_id gnl|my_center|LOCUS_23480 46826 47233 gene locus_tag LOCUS_23490 46826 47233 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222198.1 protein_id gnl|my_center|LOCUS_23490 47230 47679 gene locus_tag LOCUS_23500 47230 47679 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153437081.1 protein_id gnl|my_center|LOCUS_23500 47918 48679 gene locus_tag LOCUS_23510 47918 48679 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224285.1 protein_id gnl|my_center|LOCUS_23510 49940 48846 gene locus_tag LOCUS_23520 49940 48846 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_23520 50043 50504 gene locus_tag LOCUS_23530 50043 50504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 51513 50536 gene locus_tag LOCUS_23540 51513 50536 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026990.1 protein_id gnl|my_center|LOCUS_23540 52509 51919 gene locus_tag LOCUS_23550 52509 51919 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027617.1 protein_id gnl|my_center|LOCUS_23550 52840 52490 gene locus_tag LOCUS_23560 52840 52490 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_23560 53262 52837 gene locus_tag LOCUS_23570 53262 52837 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977672.1 protein_id gnl|my_center|LOCUS_23570 55882 53294 gene locus_tag LOCUS_23580 55882 53294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 56665 57843 gene locus_tag LOCUS_23590 56665 57843 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223404.1 protein_id gnl|my_center|LOCUS_23590 58800 57937 gene locus_tag LOCUS_23600 58800 57937 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026999.1 protein_id gnl|my_center|LOCUS_23600 58896 59792 gene locus_tag LOCUS_23610 58896 59792 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978567.1 protein_id gnl|my_center|LOCUS_23610 59950 60252 gene locus_tag LOCUS_23620 59950 60252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 61029 60301 gene locus_tag LOCUS_23630 61029 60301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 60932 61672 gene locus_tag LOCUS_23640 60932 61672 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417961.1 protein_id gnl|my_center|LOCUS_23640 61695 64049 gene locus_tag LOCUS_23650 61695 64049 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027316.1 protein_id gnl|my_center|LOCUS_23650 64114 65745 gene locus_tag LOCUS_23660 gene pgi 64114 65745 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_23660 67434 66067 gene locus_tag LOCUS_23670 67434 66067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence016 1775 141 gene locus_tag LOCUS_23680 1775 141 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_23680 1998 1810 gene locus_tag LOCUS_23690 1998 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 3000 2197 gene locus_tag LOCUS_23700 3000 2197 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974056.1 protein_id gnl|my_center|LOCUS_23700 3893 3075 gene locus_tag LOCUS_23710 3893 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 4015 4644 gene locus_tag LOCUS_23720 4015 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 5957 4755 gene locus_tag LOCUS_23730 5957 4755 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224575.1 protein_id gnl|my_center|LOCUS_23730 6489 6028 gene locus_tag LOCUS_23740 gene mmpR5 6489 6028 CDS product siderophore transport transcriptional regulator MmpR5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403442.1 protein_id gnl|my_center|LOCUS_23740 6657 7838 gene locus_tag LOCUS_23750 gene kynU 6657 7838 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029138.1 protein_id gnl|my_center|LOCUS_23750 7866 8162 gene locus_tag LOCUS_23760 7866 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 8162 8470 gene locus_tag LOCUS_23770 8162 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 8951 8499 gene locus_tag LOCUS_23780 8951 8499 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727858.1 protein_id gnl|my_center|LOCUS_23780 9163 10563 gene locus_tag LOCUS_23790 9163 10563 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222832.1 protein_id gnl|my_center|LOCUS_23790 11854 10577 gene locus_tag LOCUS_23800 11854 10577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 12444 12130 gene locus_tag LOCUS_23810 12444 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 13438 12506 gene locus_tag LOCUS_23820 13438 12506 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229860.1 protein_id gnl|my_center|LOCUS_23820 13943 13422 gene locus_tag LOCUS_23830 13943 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 14672 14232 gene locus_tag LOCUS_23840 14672 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 16164 14764 gene locus_tag LOCUS_23850 16164 14764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973466.1 protein_id gnl|my_center|LOCUS_23850 18018 16270 gene locus_tag LOCUS_23860 18018 16270 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_23860 18206 18520 gene locus_tag LOCUS_23870 18206 18520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 18531 19076 gene locus_tag LOCUS_23880 18531 19076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 23892 19114 gene locus_tag LOCUS_23890 23892 19114 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029700.1 protein_id gnl|my_center|LOCUS_23890 24417 24788 gene locus_tag LOCUS_23900 24417 24788 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_23900 25374 26075 gene locus_tag LOCUS_23910 25374 26075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029707.1 protein_id gnl|my_center|LOCUS_23910 26077 26868 gene locus_tag LOCUS_23920 26077 26868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974416.1 protein_id gnl|my_center|LOCUS_23920 26983 28290 gene locus_tag LOCUS_23930 26983 28290 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029708.1 protein_id gnl|my_center|LOCUS_23930 28290 29204 gene locus_tag LOCUS_23940 28290 29204 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029709.1 protein_id gnl|my_center|LOCUS_23940 29197 30132 gene locus_tag LOCUS_23950 29197 30132 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974413.1 protein_id gnl|my_center|LOCUS_23950 30133 30369 gene locus_tag LOCUS_23960 30133 30369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 30417 30782 gene locus_tag LOCUS_23970 30417 30782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 30779 31225 gene locus_tag LOCUS_23980 30779 31225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 31254 34409 gene locus_tag LOCUS_23990 31254 34409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 34535 35251 gene locus_tag LOCUS_24000 34535 35251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 35248 36183 gene locus_tag LOCUS_24010 35248 36183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973954.1 protein_id gnl|my_center|LOCUS_24010 36392 37042 gene locus_tag LOCUS_24020 36392 37042 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284363.1 protein_id gnl|my_center|LOCUS_24020 38001 37495 gene locus_tag LOCUS_24030 38001 37495 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058688.1 protein_id gnl|my_center|LOCUS_24030 39593 37998 gene locus_tag LOCUS_24040 39593 37998 CDS product DNA-3-methyladenine glycosylase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878186.1 protein_id gnl|my_center|LOCUS_24040 40796 39852 gene locus_tag LOCUS_24050 40796 39852 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469674.1 protein_id gnl|my_center|LOCUS_24050 42712 41114 gene locus_tag LOCUS_24060 42712 41114 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_24060 42820 43638 gene locus_tag LOCUS_24070 42820 43638 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_24070 43690 45246 gene locus_tag LOCUS_24080 43690 45246 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029630.1 protein_id gnl|my_center|LOCUS_24080 45387 48095 gene locus_tag LOCUS_24090 45387 48095 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068577.1 protein_id gnl|my_center|LOCUS_24090 49177 48179 gene locus_tag LOCUS_24100 gene fdhD 49177 48179 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_24100 51384 49174 gene locus_tag LOCUS_24110 51384 49174 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229107.1 protein_id gnl|my_center|LOCUS_24110 51597 52421 gene locus_tag LOCUS_24120 51597 52421 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_24120 52516 53028 gene locus_tag LOCUS_24130 52516 53028 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222885.1 protein_id gnl|my_center|LOCUS_24130 53062 54054 gene locus_tag LOCUS_24140 53062 54054 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029954.1 protein_id gnl|my_center|LOCUS_24140 54172 55257 gene locus_tag LOCUS_24150 54172 55257 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_24150 55310 55930 gene locus_tag LOCUS_24160 55310 55930 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_24160 56125 56304 gene locus_tag LOCUS_24170 56125 56304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 56321 56815 gene locus_tag LOCUS_24180 gene bfr 56321 56815 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976703.1 protein_id gnl|my_center|LOCUS_24180 57071 57739 gene locus_tag LOCUS_24190 57071 57739 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 protein_id gnl|my_center|LOCUS_24190 57751 59022 gene locus_tag LOCUS_24200 gene draK 57751 59022 CDS product two-component system sensor histidine kinase DraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028744.1 protein_id gnl|my_center|LOCUS_24200 59679 59065 gene locus_tag LOCUS_24210 59679 59065 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028743.1 protein_id gnl|my_center|LOCUS_24210 59866 60825 gene locus_tag LOCUS_24220 59866 60825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 60922 62091 gene locus_tag LOCUS_24230 60922 62091 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219537380.1 protein_id gnl|my_center|LOCUS_24230 62091 62612 gene locus_tag LOCUS_24240 gene purE 62091 62612 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_24240 64184 62865 gene locus_tag LOCUS_24250 64184 62865 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_24250 64360 65523 gene locus_tag LOCUS_24260 64360 65523 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_24260 66567 65689 gene locus_tag LOCUS_24270 66567 65689 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230141.1 protein_id gnl|my_center|LOCUS_24270 67035 66616 gene locus_tag LOCUS_24280 67035 66616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 67786 67316 gene locus_tag LOCUS_24290 67786 67316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 68400 67942 gene locus_tag LOCUS_24300 68400 67942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 68691 68509 gene locus_tag LOCUS_24310 68691 68509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 69651 68719 gene locus_tag LOCUS_24320 69651 68719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 73338 69796 gene locus_tag LOCUS_24330 73338 69796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 75967 73346 gene locus_tag LOCUS_24340 75967 73346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 76280 79138 gene locus_tag LOCUS_24350 76280 79138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 80380 79394 gene locus_tag LOCUS_24360 80380 79394 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_24360 81606 80554 gene locus_tag LOCUS_24370 81606 80554 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226355.1 protein_id gnl|my_center|LOCUS_24370 81883 83346 gene locus_tag LOCUS_24380 81883 83346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 85071 83434 gene locus_tag LOCUS_24390 85071 83434 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027264.1 protein_id gnl|my_center|LOCUS_24390 86064 85474 gene locus_tag LOCUS_24400 86064 85474 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534996.1 protein_id gnl|my_center|LOCUS_24400 86266 87693 gene locus_tag LOCUS_24410 86266 87693 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_24410 87846 88676 gene locus_tag LOCUS_24420 87846 88676 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224066.1 protein_id gnl|my_center|LOCUS_24420 91354 89069 gene locus_tag LOCUS_24430 91354 89069 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518812.1 protein_id gnl|my_center|LOCUS_24430 92967 91498 gene locus_tag LOCUS_24440 92967 91498 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326400.1 protein_id gnl|my_center|LOCUS_24440 93137 92964 gene locus_tag LOCUS_24450 93137 92964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 93070 94125 gene locus_tag LOCUS_24460 93070 94125 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393321.1 protein_id gnl|my_center|LOCUS_24460 95793 94267 gene locus_tag LOCUS_24470 95793 94267 CDS product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 protein_id gnl|my_center|LOCUS_24470 96082 98112 gene locus_tag LOCUS_24480 96082 98112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 96112 96210 gene locus_tag LOCUS_t00190 96112 96210 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 98109 98738 gene locus_tag LOCUS_24490 98109 98738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 98880 99614 gene locus_tag LOCUS_24500 98880 99614 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_24500 99721 100779 gene locus_tag LOCUS_24510 99721 100779 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972242.1 protein_id gnl|my_center|LOCUS_24510 100757 101524 gene locus_tag LOCUS_24520 100757 101524 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_24520 101852 102730 gene locus_tag LOCUS_24530 101852 102730 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_24530 103419 102775 gene locus_tag LOCUS_24540 103419 102775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 103686 104192 gene locus_tag LOCUS_24550 103686 104192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 105701 104226 gene locus_tag LOCUS_24560 105701 104226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 107051 105852 gene locus_tag LOCUS_24570 107051 105852 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870809.1 protein_id gnl|my_center|LOCUS_24570 107659 107114 gene locus_tag LOCUS_24580 107659 107114 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878469.1 protein_id gnl|my_center|LOCUS_24580 107914 108762 gene locus_tag LOCUS_24590 107914 108762 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_24590 108755 109339 gene locus_tag LOCUS_24600 108755 109339 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222749.1 protein_id gnl|my_center|LOCUS_24600 110170 109367 gene locus_tag LOCUS_24610 110170 109367 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419190.1 protein_id gnl|my_center|LOCUS_24610 111641 110574 gene locus_tag LOCUS_24620 111641 110574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 113626 111773 gene locus_tag LOCUS_24630 113626 111773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 115871 114078 gene locus_tag LOCUS_24640 115871 114078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 118094 116106 gene locus_tag LOCUS_24650 118094 116106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 118728 121082 gene locus_tag LOCUS_24660 118728 121082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 121159 122073 gene locus_tag LOCUS_24670 121159 122073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 123086 122139 gene locus_tag LOCUS_24680 123086 122139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 124105 123083 gene locus_tag LOCUS_24690 124105 123083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 124338 125231 gene locus_tag LOCUS_24700 124338 125231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 125233 126330 gene locus_tag LOCUS_24710 125233 126330 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257788.1 protein_id gnl|my_center|LOCUS_24710 127214 126276 gene locus_tag LOCUS_24720 127214 126276 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_24720 127406 128431 gene locus_tag LOCUS_24730 127406 128431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 128428 129372 gene locus_tag LOCUS_24740 128428 129372 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_24740 129455 130558 gene locus_tag LOCUS_24750 129455 130558 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_24750 130630 131553 gene locus_tag LOCUS_24760 130630 131553 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 protein_id gnl|my_center|LOCUS_24760 131870 131736 gene locus_tag LOCUS_24770 131870 131736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 132073 134757 gene locus_tag LOCUS_24780 132073 134757 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455006.1 protein_id gnl|my_center|LOCUS_24780 136170 134875 gene locus_tag LOCUS_24790 136170 134875 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028727.1 protein_id gnl|my_center|LOCUS_24790 137207 136167 gene locus_tag LOCUS_24800 gene cofD 137207 136167 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_24800 137356 139707 gene locus_tag LOCUS_24810 137356 139707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 139963 140220 gene locus_tag LOCUS_24820 139963 140220 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975777.1 protein_id gnl|my_center|LOCUS_24820 140509 143586 gene locus_tag LOCUS_24830 140509 143586 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028725.1 protein_id gnl|my_center|LOCUS_24830 143583 145019 gene locus_tag LOCUS_24840 143583 145019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 145437 145042 gene locus_tag LOCUS_24850 145437 145042 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063628643.1 protein_id gnl|my_center|LOCUS_24850 145783 145517 gene locus_tag LOCUS_24860 145783 145517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 145728 146096 gene locus_tag LOCUS_24870 145728 146096 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975781.1 protein_id gnl|my_center|LOCUS_24870 146228 147595 gene locus_tag LOCUS_24880 146228 147595 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_24880 147592 147765 gene locus_tag LOCUS_24890 147592 147765 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975784.1 protein_id gnl|my_center|LOCUS_24890 147762 148883 gene locus_tag LOCUS_24900 147762 148883 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980330.1 protein_id gnl|my_center|LOCUS_24900 148948 149913 gene locus_tag LOCUS_24910 148948 149913 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_24910 150299 150135 gene locus_tag LOCUS_24920 150299 150135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 150358 150543 gene locus_tag LOCUS_24930 150358 150543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 150578 150793 gene locus_tag LOCUS_24940 150578 150793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 151157 150813 gene locus_tag LOCUS_24950 151157 150813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 151262 152689 gene locus_tag LOCUS_24960 gene ahcY 151262 152689 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_24960 152772 154022 gene locus_tag LOCUS_24970 gene ahcY 152772 154022 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058222.1 protein_id gnl|my_center|LOCUS_24970 155329 153992 gene locus_tag LOCUS_24980 155329 153992 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730643.1 protein_id gnl|my_center|LOCUS_24980 156696 155623 gene locus_tag LOCUS_24990 156696 155623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 156744 157733 gene locus_tag LOCUS_25000 156744 157733 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731132.1 protein_id gnl|my_center|LOCUS_25000 159633 157981 gene locus_tag LOCUS_25010 159633 157981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 160551 159973 gene locus_tag LOCUS_25020 160551 159973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 163521 160747 gene locus_tag LOCUS_25030 163521 160747 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228172.1 protein_id gnl|my_center|LOCUS_25030 163592 167275 gene locus_tag LOCUS_25040 163592 167275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 167859 167410 gene locus_tag LOCUS_25050 167859 167410 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326890.1 protein_id gnl|my_center|LOCUS_25050 168127 168675 gene locus_tag LOCUS_25060 168127 168675 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227140.1 protein_id gnl|my_center|LOCUS_25060 168778 169014 gene locus_tag LOCUS_25070 168778 169014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 169011 169514 gene locus_tag LOCUS_25080 169011 169514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 169866 170900 gene locus_tag LOCUS_25090 169866 170900 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747155.1 protein_id gnl|my_center|LOCUS_25090 172310 170931 gene locus_tag LOCUS_25100 172310 170931 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731131.1 protein_id gnl|my_center|LOCUS_25100 173470 172310 gene locus_tag LOCUS_25110 173470 172310 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113004.1 protein_id gnl|my_center|LOCUS_25110 174669 173494 gene locus_tag LOCUS_25120 174669 173494 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139569.1 protein_id gnl|my_center|LOCUS_25120 175325 174666 gene locus_tag LOCUS_25130 175325 174666 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092089.1 protein_id gnl|my_center|LOCUS_25130 176731 175322 gene locus_tag LOCUS_25140 176731 175322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495859.1 protein_id gnl|my_center|LOCUS_25140 177036 177713 gene locus_tag LOCUS_25150 gene mtrA 177036 177713 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_25150 177756 179522 gene locus_tag LOCUS_25160 gene mtrB 177756 179522 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028715.1 protein_id gnl|my_center|LOCUS_25160 179512 181287 gene locus_tag LOCUS_25170 gene lpqB 179512 181287 CDS product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088448.1 protein_id gnl|my_center|LOCUS_25170 181451 182317 gene locus_tag LOCUS_25180 181451 182317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 182502 183224 gene locus_tag LOCUS_25190 182502 183224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 183968 184639 gene locus_tag LOCUS_25200 gene raiA 183968 184639 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229726.1 protein_id gnl|my_center|LOCUS_25200 184776 185480 gene locus_tag LOCUS_25210 184776 185480 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_25210 186908 185625 gene locus_tag LOCUS_25220 186908 185625 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028712.1 protein_id gnl|my_center|LOCUS_25220 187260 186973 gene locus_tag LOCUS_25230 187260 186973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 187586 190387 gene locus_tag LOCUS_25240 gene secA 187586 190387 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_25240 191277 190585 gene locus_tag LOCUS_25250 191277 190585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 193131 191446 gene locus_tag LOCUS_25260 193131 191446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 193902 193162 gene locus_tag LOCUS_25270 193902 193162 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230307.1 protein_id gnl|my_center|LOCUS_25270 194060 195094 gene locus_tag LOCUS_25280 194060 195094 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092074.1 protein_id gnl|my_center|LOCUS_25280 195136 195372 gene locus_tag LOCUS_25290 195136 195372 CDS product PTS glucose/sucrose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975905.1 protein_id gnl|my_center|LOCUS_25290 195396 195857 gene locus_tag LOCUS_25300 195396 195857 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977435.1 protein_id gnl|my_center|LOCUS_25300 196030 196287 gene locus_tag LOCUS_25310 196030 196287 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973180.1 protein_id gnl|my_center|LOCUS_25310 196304 197980 gene locus_tag LOCUS_25320 gene ptsP 196304 197980 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977434.1 protein_id gnl|my_center|LOCUS_25320 198140 199861 gene locus_tag LOCUS_25330 198140 199861 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_25330 200117 200806 gene locus_tag LOCUS_25340 200117 200806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 201149 201652 gene locus_tag LOCUS_25350 201149 201652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028709.1 protein_id gnl|my_center|LOCUS_25350 201698 202336 gene locus_tag LOCUS_25360 201698 202336 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_25360 202777 203484 gene locus_tag LOCUS_25370 202777 203484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 203531 204478 gene locus_tag LOCUS_25380 203531 204478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 204674 206671 gene locus_tag LOCUS_25390 204674 206671 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943296.1 protein_id gnl|my_center|LOCUS_25390 206793 208673 gene locus_tag LOCUS_25400 206793 208673 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_25400 209820 208852 gene locus_tag LOCUS_25410 209820 208852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 210326 209895 gene locus_tag LOCUS_25420 210326 209895 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225249.1 protein_id gnl|my_center|LOCUS_25420 212024 210465 gene locus_tag LOCUS_25430 212024 210465 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222690.1 protein_id gnl|my_center|LOCUS_25430 212368 217251 gene locus_tag LOCUS_25440 212368 217251 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_25440 218319 217288 gene locus_tag LOCUS_25450 218319 217288 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031256.1 protein_id gnl|my_center|LOCUS_25450 218402 219520 gene locus_tag LOCUS_25460 gene prfB 218402 219520 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_25460 219789 219598 gene locus_tag LOCUS_25470 219789 219598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975842.1 protein_id gnl|my_center|LOCUS_25470 220025 220714 gene locus_tag LOCUS_25480 gene ftsE 220025 220714 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_25480 220751 221659 gene locus_tag LOCUS_25490 gene ftsX 220751 221659 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_25490 221682 222149 gene locus_tag LOCUS_25500 gene smpB 221682 222149 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_25500 222163 224160 gene locus_tag LOCUS_25510 222163 224160 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284244.1 protein_id gnl|my_center|LOCUS_25510 224793 225168 gene locus_tag LOCUS_tm00010 224793 225168 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 225945 225325 gene locus_tag LOCUS_25520 225945 225325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 226692 226042 gene locus_tag LOCUS_25530 226692 226042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 228114 227047 gene locus_tag LOCUS_25540 228114 227047 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028175.1 protein_id gnl|my_center|LOCUS_25540 228828 228433 gene locus_tag LOCUS_25550 228828 228433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 228728 229798 gene locus_tag LOCUS_25560 228728 229798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 229914 232115 gene locus_tag LOCUS_25570 229914 232115 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089385.1 protein_id gnl|my_center|LOCUS_25570 232348 234246 gene locus_tag LOCUS_25580 232348 234246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 234468 234599 gene locus_tag LOCUS_25590 234468 234599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 234837 236114 gene locus_tag LOCUS_25600 234837 236114 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841211.1 protein_id gnl|my_center|LOCUS_25600 236155 240453 gene locus_tag LOCUS_25610 236155 240453 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229292.1 protein_id gnl|my_center|LOCUS_25610 240450 241700 gene locus_tag LOCUS_25620 240450 241700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 242429 241641 gene locus_tag LOCUS_25630 242429 241641 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229286.1 protein_id gnl|my_center|LOCUS_25630 243650 242487 gene locus_tag LOCUS_25640 gene tmaT 243650 242487 CDS product trehalose corynomycolate mycolyl acetyltransferase TmaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015440.1 protein_id gnl|my_center|LOCUS_25640 244369 243881 gene locus_tag LOCUS_25650 244369 243881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224277.1 protein_id gnl|my_center|LOCUS_25650 244713 244489 gene locus_tag LOCUS_25660 244713 244489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 245061 245909 gene locus_tag LOCUS_25670 245061 245909 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_25670 245932 246189 gene locus_tag LOCUS_25680 245932 246189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 246260 246757 gene locus_tag LOCUS_25690 246260 246757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 247282 246851 gene locus_tag LOCUS_25700 247282 246851 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230381.1 protein_id gnl|my_center|LOCUS_25700 247743 247279 gene locus_tag LOCUS_25710 247743 247279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 247956 248444 gene locus_tag LOCUS_25720 247956 248444 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_25720 248441 249484 gene locus_tag LOCUS_25730 248441 249484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 250382 249507 gene locus_tag LOCUS_25740 250382 249507 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533789.1 protein_id gnl|my_center|LOCUS_25740 251380 250562 gene locus_tag LOCUS_25750 251380 250562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 252651 251377 gene locus_tag LOCUS_25760 252651 251377 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_25760 253239 255920 gene locus_tag LOCUS_25770 253239 255920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 255969 257228 gene locus_tag LOCUS_25780 255969 257228 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_25780 257225 258154 gene locus_tag LOCUS_25790 257225 258154 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804268.1 protein_id gnl|my_center|LOCUS_25790 258147 259007 gene locus_tag LOCUS_25800 258147 259007 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804269.1 protein_id gnl|my_center|LOCUS_25800 259133 261307 gene locus_tag LOCUS_25810 259133 261307 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639906.1 protein_id gnl|my_center|LOCUS_25810 262210 261347 gene locus_tag LOCUS_25820 262210 261347 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729459.1 protein_id gnl|my_center|LOCUS_25820 262378 263256 gene locus_tag LOCUS_25830 262378 263256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 263249 264205 gene locus_tag LOCUS_25840 263249 264205 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916599.1 protein_id gnl|my_center|LOCUS_25840 265470 264319 gene locus_tag LOCUS_25850 265470 264319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 266618 265659 gene locus_tag LOCUS_25860 266618 265659 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029804.1 protein_id gnl|my_center|LOCUS_25860 266985 267917 gene locus_tag LOCUS_25870 266985 267917 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229285.1 protein_id gnl|my_center|LOCUS_25870 267986 269101 gene locus_tag LOCUS_25880 267986 269101 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 protein_id gnl|my_center|LOCUS_25880 269252 270418 gene locus_tag LOCUS_25890 269252 270418 CDS product damage-control phosphatase ARMT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485432.1 protein_id gnl|my_center|LOCUS_25890 273231 270460 gene locus_tag LOCUS_25900 273231 270460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 273929 273228 gene locus_tag LOCUS_25910 273929 273228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941994.1 protein_id gnl|my_center|LOCUS_25910 274008 274616 gene locus_tag LOCUS_25920 274008 274616 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225030.1 protein_id gnl|my_center|LOCUS_25920 275444 274629 gene locus_tag LOCUS_25930 275444 274629 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_25930 275655 277199 gene locus_tag LOCUS_25940 275655 277199 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083171434.1 protein_id gnl|my_center|LOCUS_25940 277183 278124 gene locus_tag LOCUS_25950 277183 278124 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224428.1 protein_id gnl|my_center|LOCUS_25950 278137 279168 gene locus_tag LOCUS_25960 278137 279168 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224427.1 protein_id gnl|my_center|LOCUS_25960 279173 280321 gene locus_tag LOCUS_25970 279173 280321 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897320.1 protein_id gnl|my_center|LOCUS_25970 280442 282040 gene locus_tag LOCUS_25980 280442 282040 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225732.1 protein_id gnl|my_center|LOCUS_25980 282086 282691 gene locus_tag LOCUS_25990 282086 282691 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_25990 282986 282729 gene locus_tag LOCUS_26000 282986 282729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 283244 284656 gene locus_tag LOCUS_26010 283244 284656 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900487.1 protein_id gnl|my_center|LOCUS_26010 285120 285428 gene locus_tag LOCUS_26020 285120 285428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 285425 287086 gene locus_tag LOCUS_26030 285425 287086 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_26030 287807 287169 gene locus_tag LOCUS_26040 287807 287169 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 protein_id gnl|my_center|LOCUS_26040 288811 287927 gene locus_tag LOCUS_26050 288811 287927 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_26050 288887 289882 gene locus_tag LOCUS_26060 288887 289882 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090528.1 protein_id gnl|my_center|LOCUS_26060 290820 290305 gene locus_tag LOCUS_26070 290820 290305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 291708 290833 gene locus_tag LOCUS_26080 291708 290833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 292057 291710 gene locus_tag LOCUS_26090 292057 291710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 292312 292632 gene locus_tag LOCUS_26100 292312 292632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence017 1586 150 gene locus_tag LOCUS_26110 1586 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 1926 1624 gene locus_tag LOCUS_26120 1926 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 2909 1977 gene locus_tag LOCUS_26130 2909 1977 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031422.1 protein_id gnl|my_center|LOCUS_26130 2646 2562 gene locus_tag LOCUS_t00200 2646 2562 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 3154 6783 gene locus_tag LOCUS_26140 3154 6783 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031481.1 protein_id gnl|my_center|LOCUS_26140 8030 6945 gene locus_tag LOCUS_26150 8030 6945 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027929.1 protein_id gnl|my_center|LOCUS_26150 8248 8054 gene locus_tag LOCUS_26160 8248 8054 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224296.1 protein_id gnl|my_center|LOCUS_26160 8754 8302 gene locus_tag LOCUS_26170 8754 8302 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726631.1 protein_id gnl|my_center|LOCUS_26170 9367 8933 gene locus_tag LOCUS_26180 9367 8933 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192119.1 protein_id gnl|my_center|LOCUS_26180 9708 9944 gene locus_tag LOCUS_26190 9708 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 10087 10557 gene locus_tag LOCUS_26200 10087 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 10685 11920 gene locus_tag LOCUS_26210 10685 11920 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726720.1 protein_id gnl|my_center|LOCUS_26210 12655 12011 gene locus_tag LOCUS_26220 12655 12011 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192781106.1 protein_id gnl|my_center|LOCUS_26220 12956 13630 gene locus_tag LOCUS_26230 12956 13630 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225192.1 protein_id gnl|my_center|LOCUS_26230 16462 13763 gene locus_tag LOCUS_26240 16462 13763 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 protein_id gnl|my_center|LOCUS_26240 16654 17277 gene locus_tag LOCUS_26250 16654 17277 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028219.1 protein_id gnl|my_center|LOCUS_26250 20109 17341 gene locus_tag LOCUS_26260 20109 17341 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 protein_id gnl|my_center|LOCUS_26260 20431 21999 gene locus_tag LOCUS_26270 20431 21999 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_26270 22882 22235 gene locus_tag LOCUS_26280 22882 22235 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224723.1 protein_id gnl|my_center|LOCUS_26280 23247 22870 gene locus_tag LOCUS_26290 23247 22870 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224722.1 protein_id gnl|my_center|LOCUS_26290 23653 24171 gene locus_tag LOCUS_26300 23653 24171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 25494 24355 gene locus_tag LOCUS_26310 25494 24355 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_26310 26204 25491 gene locus_tag LOCUS_26320 26204 25491 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_26320 27538 26252 gene locus_tag LOCUS_26330 27538 26252 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_26330 27859 28884 gene locus_tag LOCUS_26340 gene gmd 27859 28884 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284917.1 protein_id gnl|my_center|LOCUS_26340 30379 28892 gene locus_tag LOCUS_26350 30379 28892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 31798 30596 gene locus_tag LOCUS_26360 31798 30596 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020115335.1 protein_id gnl|my_center|LOCUS_26360 32114 32977 gene locus_tag LOCUS_26370 32114 32977 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028618.1 protein_id gnl|my_center|LOCUS_26370 32974 34287 gene locus_tag LOCUS_26380 32974 34287 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223728.1 protein_id gnl|my_center|LOCUS_26380 34284 35030 gene locus_tag LOCUS_26390 34284 35030 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027048.1 protein_id gnl|my_center|LOCUS_26390 35296 35087 gene locus_tag LOCUS_26400 35296 35087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 35181 36215 gene locus_tag LOCUS_26410 35181 36215 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224952.1 protein_id gnl|my_center|LOCUS_26410 36215 37714 gene locus_tag LOCUS_26420 36215 37714 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224953.1 protein_id gnl|my_center|LOCUS_26420 37711 38754 gene locus_tag LOCUS_26430 37711 38754 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224954.1 protein_id gnl|my_center|LOCUS_26430 38754 39056 gene locus_tag LOCUS_26440 38754 39056 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803725.1 protein_id gnl|my_center|LOCUS_26440 39104 40069 gene locus_tag LOCUS_26450 39104 40069 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027041.1 protein_id gnl|my_center|LOCUS_26450 40188 41033 gene locus_tag LOCUS_26460 40188 41033 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223735.1 protein_id gnl|my_center|LOCUS_26460 41271 41846 gene locus_tag LOCUS_26470 41271 41846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 43362 41989 gene locus_tag LOCUS_26480 43362 41989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 44258 43587 gene locus_tag LOCUS_26490 44258 43587 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223733.1 protein_id gnl|my_center|LOCUS_26490 45597 44437 gene locus_tag LOCUS_26500 45597 44437 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224421.1 protein_id gnl|my_center|LOCUS_26500 46464 45784 gene locus_tag LOCUS_26510 46464 45784 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976494.1 protein_id gnl|my_center|LOCUS_26510 46714 47808 gene locus_tag LOCUS_26520 46714 47808 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224380.1 protein_id gnl|my_center|LOCUS_26520 47808 48959 gene locus_tag LOCUS_26530 47808 48959 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419296.1 protein_id gnl|my_center|LOCUS_26530 48956 49957 gene locus_tag LOCUS_26540 48956 49957 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224382.1 protein_id gnl|my_center|LOCUS_26540 49957 50364 gene locus_tag LOCUS_26550 49957 50364 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224383.1 protein_id gnl|my_center|LOCUS_26550 50454 51626 gene locus_tag LOCUS_26560 50454 51626 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_26560 52070 51687 gene locus_tag LOCUS_26570 52070 51687 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230341.1 protein_id gnl|my_center|LOCUS_26570 52725 52132 gene locus_tag LOCUS_26580 52725 52132 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230340.1 protein_id gnl|my_center|LOCUS_26580 52816 53268 gene locus_tag LOCUS_26590 52816 53268 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230339.1 protein_id gnl|my_center|LOCUS_26590 53888 53487 gene locus_tag LOCUS_26600 53888 53487 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971536.1 protein_id gnl|my_center|LOCUS_26600 56372 53967 gene locus_tag LOCUS_26610 56372 53967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 56745 58001 gene locus_tag LOCUS_26620 56745 58001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972859.1 protein_id gnl|my_center|LOCUS_26620 57994 58656 gene locus_tag LOCUS_26630 57994 58656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 58653 59324 gene locus_tag LOCUS_26640 58653 59324 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 protein_id gnl|my_center|LOCUS_26640 59364 60284 gene locus_tag LOCUS_26650 59364 60284 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020544063.1 protein_id gnl|my_center|LOCUS_26650 60815 60591 gene locus_tag LOCUS_26660 60815 60591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 62095 61070 gene locus_tag LOCUS_26670 62095 61070 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730353.1 protein_id gnl|my_center|LOCUS_26670 62208 62687 gene locus_tag LOCUS_26680 62208 62687 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229065.1 protein_id gnl|my_center|LOCUS_26680 64138 62669 gene locus_tag LOCUS_26690 64138 62669 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485352.1 protein_id gnl|my_center|LOCUS_26690 64727 64239 gene locus_tag LOCUS_26700 64727 64239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 64875 65459 gene locus_tag LOCUS_26710 64875 65459 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970935.1 protein_id gnl|my_center|LOCUS_26710 65566 66033 gene locus_tag LOCUS_26720 65566 66033 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090535.1 protein_id gnl|my_center|LOCUS_26720 66699 66226 gene locus_tag LOCUS_26730 66699 66226 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224025.1 protein_id gnl|my_center|LOCUS_26730 66758 67171 gene locus_tag LOCUS_26740 66758 67171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 68951 67260 gene locus_tag LOCUS_26750 68951 67260 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390371.1 protein_id gnl|my_center|LOCUS_26750 71376 69103 gene locus_tag LOCUS_26760 gene glgB 71376 69103 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_26760 72059 71568 gene locus_tag LOCUS_26770 72059 71568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 73565 72135 gene locus_tag LOCUS_26780 73565 72135 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224469.1 protein_id gnl|my_center|LOCUS_26780 75268 73562 gene locus_tag LOCUS_26790 gene treS 75268 73562 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031594.1 protein_id gnl|my_center|LOCUS_26790 77366 75345 gene locus_tag LOCUS_26800 77366 75345 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031595.1 protein_id gnl|my_center|LOCUS_26800 77948 80545 gene locus_tag LOCUS_26810 77948 80545 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_26810 80783 82501 gene locus_tag LOCUS_26820 80783 82501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 82819 83400 gene locus_tag LOCUS_26830 82819 83400 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063830.1 protein_id gnl|my_center|LOCUS_26830 83411 83764 gene locus_tag LOCUS_26840 83411 83764 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224338.1 protein_id gnl|my_center|LOCUS_26840 84163 83816 gene locus_tag LOCUS_26850 84163 83816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 85161 84238 gene locus_tag LOCUS_26860 85161 84238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029723.1 protein_id gnl|my_center|LOCUS_26860 86422 85280 gene locus_tag LOCUS_26870 86422 85280 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456408.1 protein_id gnl|my_center|LOCUS_26870 86495 86659 gene locus_tag LOCUS_26880 gene rpmG 86495 86659 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003889348.1 protein_id gnl|my_center|LOCUS_26880 86724 86960 gene locus_tag LOCUS_26890 gene rpmB 86724 86960 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028971.1 protein_id gnl|my_center|LOCUS_26890 86960 87259 gene locus_tag LOCUS_26900 gene rpsN 86960 87259 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063153.1 protein_id gnl|my_center|LOCUS_26900 87262 87423 gene locus_tag LOCUS_26910 gene rpmF 87262 87423 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978430.1 protein_id gnl|my_center|LOCUS_26910 87691 88113 gene locus_tag LOCUS_26920 87691 88113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 88116 89351 gene locus_tag LOCUS_26930 88116 89351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 89348 90190 gene locus_tag LOCUS_26940 89348 90190 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_26940 90195 92015 gene locus_tag LOCUS_26950 90195 92015 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275275.1 protein_id gnl|my_center|LOCUS_26950 92021 92545 gene locus_tag LOCUS_26960 92021 92545 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_26960 92660 92959 gene locus_tag LOCUS_26970 92660 92959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 92956 95358 gene locus_tag LOCUS_26980 92956 95358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 95355 97406 gene locus_tag LOCUS_26990 95355 97406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 97452 98669 gene locus_tag LOCUS_27000 97452 98669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 99019 99798 gene locus_tag LOCUS_27010 99019 99798 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_27010 99809 100762 gene locus_tag LOCUS_27020 99809 100762 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223551.1 protein_id gnl|my_center|LOCUS_27020 100985 101515 gene locus_tag LOCUS_27030 100985 101515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 103063 101690 gene locus_tag LOCUS_27040 103063 101690 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480120.1 protein_id gnl|my_center|LOCUS_27040 103886 103377 gene locus_tag LOCUS_27050 103886 103377 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 protein_id gnl|my_center|LOCUS_27050 103947 105110 gene locus_tag LOCUS_27060 103947 105110 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_27060 106524 105298 gene locus_tag LOCUS_27070 106524 105298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 106980 110510 gene locus_tag LOCUS_27080 106980 110510 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_27080 110507 112060 gene locus_tag LOCUS_27090 110507 112060 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159692158.1 protein_id gnl|my_center|LOCUS_27090 112057 113562 gene locus_tag LOCUS_27100 112057 113562 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_27100 114992 113670 gene locus_tag LOCUS_27110 114992 113670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 116612 115263 gene locus_tag LOCUS_27120 116612 115263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 116800 117510 gene locus_tag LOCUS_27130 116800 117510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 117610 118359 gene locus_tag LOCUS_27140 117610 118359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 118356 119006 gene locus_tag LOCUS_27150 118356 119006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 119003 119563 gene locus_tag LOCUS_27160 119003 119563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 119598 119813 gene locus_tag LOCUS_27170 119598 119813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 119985 123566 gene locus_tag LOCUS_27180 gene dnaE 119985 123566 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486830.1 protein_id gnl|my_center|LOCUS_27180 123656 123928 gene locus_tag LOCUS_27190 123656 123928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 124994 123948 gene locus_tag LOCUS_27200 124994 123948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 126514 125192 gene locus_tag LOCUS_27210 126514 125192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 126780 127616 gene locus_tag LOCUS_27220 126780 127616 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222998.1 protein_id gnl|my_center|LOCUS_27220 127613 128767 gene locus_tag LOCUS_27230 127613 128767 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972783.1 protein_id gnl|my_center|LOCUS_27230 129449 128871 gene locus_tag LOCUS_27240 129449 128871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 130708 129734 gene locus_tag LOCUS_27250 130708 129734 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786700.1 protein_id gnl|my_center|LOCUS_27250 131321 130689 gene locus_tag LOCUS_27260 131321 130689 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029378.1 protein_id gnl|my_center|LOCUS_27260 131424 132233 gene locus_tag LOCUS_27270 131424 132233 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_27270 132396 133346 gene locus_tag LOCUS_27280 132396 133346 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029434.1 protein_id gnl|my_center|LOCUS_27280 133806 133459 gene locus_tag LOCUS_27290 133806 133459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 134171 133809 gene locus_tag LOCUS_27300 134171 133809 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899954.1 protein_id gnl|my_center|LOCUS_27300 135433 134390 gene locus_tag LOCUS_27310 135433 134390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 135545 136603 gene locus_tag LOCUS_27320 gene mnmA 135545 136603 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_27320 137332 136697 gene locus_tag LOCUS_27330 137332 136697 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031843.1 protein_id gnl|my_center|LOCUS_27330 137600 137340 gene locus_tag LOCUS_27340 137600 137340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 137557 138528 gene locus_tag LOCUS_27350 137557 138528 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_27350 138964 138590 gene locus_tag LOCUS_27360 138964 138590 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868731.1 protein_id gnl|my_center|LOCUS_27360 139334 139810 gene locus_tag LOCUS_27370 139334 139810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 139991 140839 gene locus_tag LOCUS_27380 139991 140839 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775665.1 protein_id gnl|my_center|LOCUS_27380 141557 140817 gene locus_tag LOCUS_27390 141557 140817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 141875 144127 gene locus_tag LOCUS_27400 gene ligA 141875 144127 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030278.1 protein_id gnl|my_center|LOCUS_27400 145037 144789 gene locus_tag LOCUS_27410 145037 144789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 145000 145350 gene locus_tag LOCUS_27420 145000 145350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 146630 145488 gene locus_tag LOCUS_27430 146630 145488 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027112.1 protein_id gnl|my_center|LOCUS_27430 147086 151057 gene locus_tag LOCUS_27440 147086 151057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 151500 153593 gene locus_tag LOCUS_27450 gene rmdB 151500 153593 CDS product cyclic Di-GMP phosphodiesterase RmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030279.1 protein_id gnl|my_center|LOCUS_27450 153729 154028 gene locus_tag LOCUS_27460 gene gatC 153729 154028 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_27460 154025 155515 gene locus_tag LOCUS_27470 gene gatA 154025 155515 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 protein_id gnl|my_center|LOCUS_27470 155512 157020 gene locus_tag LOCUS_27480 gene gatB 155512 157020 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_27480 157229 159637 gene locus_tag LOCUS_27490 157229 159637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 160773 159649 gene locus_tag LOCUS_27500 160773 159649 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_27500 161056 161964 gene locus_tag LOCUS_27510 161056 161964 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223960.1 protein_id gnl|my_center|LOCUS_27510 162220 164877 gene locus_tag LOCUS_27520 162220 164877 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030287.1 protein_id gnl|my_center|LOCUS_27520 165242 166993 gene locus_tag LOCUS_27530 165242 166993 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_27530 167046 167570 gene locus_tag LOCUS_27540 gene ilvN 167046 167570 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_27540 167617 168612 gene locus_tag LOCUS_27550 gene ilvC 167617 168612 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223583.1 protein_id gnl|my_center|LOCUS_27550 169571 168678 gene locus_tag LOCUS_27560 169571 168678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029723.1 protein_id gnl|my_center|LOCUS_27560 171259 169877 gene locus_tag LOCUS_27570 171259 169877 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086861759.1 protein_id gnl|my_center|LOCUS_27570 171526 171930 gene locus_tag LOCUS_27580 171526 171930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 173678 172110 gene locus_tag LOCUS_27590 gene dacB 173678 172110 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_27590 175056 173758 gene locus_tag LOCUS_27600 gene thrS 175056 173758 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485230.1 protein_id gnl|my_center|LOCUS_27600 175584 176156 gene locus_tag LOCUS_27610 175584 176156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 176920 176399 gene locus_tag LOCUS_27620 176920 176399 CDS product DUF1707 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030637.1 protein_id gnl|my_center|LOCUS_27620 177031 177567 gene locus_tag LOCUS_27630 177031 177567 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 protein_id gnl|my_center|LOCUS_27630 177557 178255 gene locus_tag LOCUS_27640 177557 178255 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265944.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27640 178252 180891 gene locus_tag LOCUS_27650 178252 180891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 182321 180990 gene locus_tag LOCUS_27660 182321 180990 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226840.1 protein_id gnl|my_center|LOCUS_27660 183547 182639 gene locus_tag LOCUS_27670 183547 182639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 183759 185348 gene locus_tag LOCUS_27680 gene serA 183759 185348 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_27680 185743 186012 gene locus_tag LOCUS_27690 185743 186012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 186109 187173 gene locus_tag LOCUS_27700 186109 187173 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_27700 187379 188476 gene locus_tag LOCUS_27710 187379 188476 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284299.1 protein_id gnl|my_center|LOCUS_27710 188818 190392 gene locus_tag LOCUS_27720 gene cimA 188818 190392 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_27720 191944 190415 gene locus_tag LOCUS_27730 191944 190415 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223174.1 protein_id gnl|my_center|LOCUS_27730 192509 191928 gene locus_tag LOCUS_27740 192509 191928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 192891 193298 gene locus_tag LOCUS_27750 192891 193298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 193538 193314 gene locus_tag LOCUS_27760 193538 193314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 193618 195093 gene locus_tag LOCUS_27770 193618 195093 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878083.1 protein_id gnl|my_center|LOCUS_27770 195577 195155 gene locus_tag LOCUS_27780 195577 195155 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972161.1 protein_id gnl|my_center|LOCUS_27780 196544 195561 gene locus_tag LOCUS_27790 196544 195561 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731552.1 protein_id gnl|my_center|LOCUS_27790 197907 196546 gene locus_tag LOCUS_27800 197907 196546 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_27800 199274 197931 gene locus_tag LOCUS_27810 199274 197931 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 protein_id gnl|my_center|LOCUS_27810 199610 199356 gene locus_tag LOCUS_27820 199610 199356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 199856 200992 gene locus_tag LOCUS_27830 199856 200992 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973142.1 protein_id gnl|my_center|LOCUS_27830 200992 202452 gene locus_tag LOCUS_27840 200992 202452 CDS product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030516.1 protein_id gnl|my_center|LOCUS_27840 202449 203873 gene locus_tag LOCUS_27850 202449 203873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 203893 204075 gene locus_tag LOCUS_27860 203893 204075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 204166 204600 gene locus_tag LOCUS_27870 204166 204600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 205638 204946 gene locus_tag LOCUS_27880 205638 204946 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977081.1 protein_id gnl|my_center|LOCUS_27880 207765 206056 gene locus_tag LOCUS_27890 207765 206056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 208254 207901 gene locus_tag LOCUS_27900 208254 207901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 208934 208545 gene locus_tag LOCUS_27910 208934 208545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 209379 213215 gene locus_tag LOCUS_27920 209379 213215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 213343 214074 gene locus_tag LOCUS_27930 213343 214074 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056890.1 protein_id gnl|my_center|LOCUS_27930 214067 215464 gene locus_tag LOCUS_27940 gene gltX 214067 215464 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_27940 216316 215663 gene locus_tag LOCUS_27950 216316 215663 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222406.1 protein_id gnl|my_center|LOCUS_27950 218229 216307 gene locus_tag LOCUS_27960 218229 216307 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223435.1 protein_id gnl|my_center|LOCUS_27960 218588 218226 gene locus_tag LOCUS_27970 218588 218226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 220853 218859 gene locus_tag LOCUS_27980 220853 218859 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226475.1 protein_id gnl|my_center|LOCUS_27980 221074 221146 gene locus_tag LOCUS_t00210 221074 221146 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 221581 221748 gene locus_tag LOCUS_27990 221581 221748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27990 221864 221937 gene locus_tag LOCUS_t00220 221864 221937 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 221979 222052 gene locus_tag LOCUS_t00230 221979 222052 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 223917 222172 gene locus_tag LOCUS_28000 223917 222172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 224754 224038 gene locus_tag LOCUS_28010 gene ndgR 224754 224038 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_28010 224896 226272 gene locus_tag LOCUS_28020 gene leuC 224896 226272 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_28020 226287 226874 gene locus_tag LOCUS_28030 gene leuD 226287 226874 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_28030 226853 227113 gene locus_tag LOCUS_28040 226853 227113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 227281 227580 gene locus_tag LOCUS_28050 227281 227580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 227872 227660 gene locus_tag LOCUS_28060 227872 227660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 227991 229172 gene locus_tag LOCUS_28070 227991 229172 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_28070 229966 229169 gene locus_tag LOCUS_28080 gene actII 229966 229169 CDS product TetR family transcriptional regulator ActII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030045.1 protein_id gnl|my_center|LOCUS_28080 230256 231965 gene locus_tag LOCUS_28090 230256 231965 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030046.1 protein_id gnl|my_center|LOCUS_28090 232670 231978 gene locus_tag LOCUS_28100 gene cofC 232670 231978 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_28100 232747 233466 gene locus_tag LOCUS_28110 232747 233466 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_28110 233582 234589 gene locus_tag LOCUS_28120 233582 234589 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_28120 234604 235836 gene locus_tag LOCUS_28130 gene megL 234604 235836 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_28130 235920 237035 gene locus_tag LOCUS_28140 235920 237035 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_28140 237480 237064 gene locus_tag LOCUS_28150 237480 237064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 237751 237518 gene locus_tag LOCUS_28160 237751 237518 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_28160 237917 238786 gene locus_tag LOCUS_28170 237917 238786 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_28170 238862 240334 gene locus_tag LOCUS_28180 238862 240334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 240417 241202 gene locus_tag LOCUS_28190 gene thiD 240417 241202 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973431.1 protein_id gnl|my_center|LOCUS_28190 242298 241408 gene locus_tag LOCUS_28200 242298 241408 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028976.1 protein_id gnl|my_center|LOCUS_28200 242413 242859 gene locus_tag LOCUS_28210 242413 242859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 242904 243269 gene locus_tag LOCUS_28220 242904 243269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 243322 243717 gene locus_tag LOCUS_28230 243322 243717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 243710 245299 gene locus_tag LOCUS_28240 243710 245299 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_28240 245731 245540 gene locus_tag LOCUS_28250 gene rpmB 245731 245540 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_28250 245982 247589 gene locus_tag LOCUS_28260 245982 247589 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_28260 247856 250066 gene locus_tag LOCUS_28270 gene recG 247856 250066 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_28270 250616 251185 gene locus_tag LOCUS_28280 gene rsmD 250616 251185 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_28280 251202 251678 gene locus_tag LOCUS_28290 gene coaD 251202 251678 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_28290 251727 252299 gene locus_tag LOCUS_28300 251727 252299 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_28300 252301 252480 gene locus_tag LOCUS_28310 gene rpmF 252301 252480 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 protein_id gnl|my_center|LOCUS_28310 252713 253450 gene locus_tag LOCUS_28320 252713 253450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 253455 254447 gene locus_tag LOCUS_28330 gene mutM 253455 254447 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_28330 254444 254758 gene locus_tag LOCUS_28340 254444 254758 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223794.1 protein_id gnl|my_center|LOCUS_28340 254948 255142 gene locus_tag LOCUS_28350 254948 255142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 255759 255286 gene locus_tag LOCUS_28360 255759 255286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 255644 259324 gene locus_tag LOCUS_28370 gene smc 255644 259324 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_28370 260224 259514 gene locus_tag LOCUS_28380 260224 259514 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727914.1 protein_id gnl|my_center|LOCUS_28380 260376 261017 gene locus_tag LOCUS_28390 260376 261017 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729968.1 protein_id gnl|my_center|LOCUS_28390 261330 262511 gene locus_tag LOCUS_28400 gene ftsY 261330 262511 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_28400 262768 263088 gene locus_tag LOCUS_28410 262768 263088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 263037 263261 gene locus_tag LOCUS_28420 263037 263261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 263258 263671 gene locus_tag LOCUS_28430 263258 263671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence018 473 1039 gene locus_tag LOCUS_28440 473 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 2022 925 gene locus_tag LOCUS_28450 2022 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 2065 3339 gene locus_tag LOCUS_28460 2065 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 4543 3599 gene locus_tag LOCUS_28470 4543 3599 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257434.1 protein_id gnl|my_center|LOCUS_28470 4789 5250 gene locus_tag LOCUS_28480 4789 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 7418 5376 gene locus_tag LOCUS_28490 7418 5376 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 protein_id gnl|my_center|LOCUS_28490 8948 7605 gene locus_tag LOCUS_28500 8948 7605 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031641.1 protein_id gnl|my_center|LOCUS_28500 9940 9002 gene locus_tag LOCUS_28510 9940 9002 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031642.1 protein_id gnl|my_center|LOCUS_28510 10849 9944 gene locus_tag LOCUS_28520 10849 9944 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031643.1 protein_id gnl|my_center|LOCUS_28520 11104 12195 gene locus_tag LOCUS_28530 11104 12195 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051005886.1 protein_id gnl|my_center|LOCUS_28530 13598 12333 gene locus_tag LOCUS_28540 13598 12333 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_28540 13712 14140 gene locus_tag LOCUS_28550 13712 14140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 14235 15230 gene locus_tag LOCUS_28560 14235 15230 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_28560 15671 15324 gene locus_tag LOCUS_28570 15671 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977038.1 protein_id gnl|my_center|LOCUS_28570 15967 16161 gene locus_tag LOCUS_28580 15967 16161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 16181 17008 gene locus_tag LOCUS_28590 16181 17008 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_28590 17043 17951 gene locus_tag LOCUS_28600 17043 17951 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_28600 18186 19904 gene locus_tag LOCUS_28610 gene recN 18186 19904 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_28610 20104 21300 gene locus_tag LOCUS_28620 gene steA 20104 21300 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_28620 21297 22268 gene locus_tag LOCUS_28630 21297 22268 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_28630 22395 23285 gene locus_tag LOCUS_28640 22395 23285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804978.1 protein_id gnl|my_center|LOCUS_28640 23282 24967 gene locus_tag LOCUS_28650 23282 24967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 25111 26232 gene locus_tag LOCUS_28660 25111 26232 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666770.1 protein_id gnl|my_center|LOCUS_28660 26450 27433 gene locus_tag LOCUS_28670 26450 27433 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_28670 27555 28202 gene locus_tag LOCUS_28680 27555 28202 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972510.1 protein_id gnl|my_center|LOCUS_28680 28216 29028 gene locus_tag LOCUS_28690 gene pssA 28216 29028 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972511.1 protein_id gnl|my_center|LOCUS_28690 29764 29120 gene locus_tag LOCUS_28700 29764 29120 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_28700 30570 29761 gene locus_tag LOCUS_28710 30570 29761 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222689.1 protein_id gnl|my_center|LOCUS_28710 30748 33588 gene locus_tag LOCUS_28720 gene uvrA 30748 33588 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_28720 33876 34340 gene locus_tag LOCUS_28730 33876 34340 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977470.1 protein_id gnl|my_center|LOCUS_28730 34763 36679 gene locus_tag LOCUS_28740 gene uvrC 34763 36679 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_28740 36676 37614 gene locus_tag LOCUS_28750 gene rapZ 36676 37614 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_28750 37611 38972 gene locus_tag LOCUS_28760 37611 38972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 39111 40091 gene locus_tag LOCUS_28770 gene whiA 39111 40091 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_28770 40586 41590 gene locus_tag LOCUS_28780 gene gap 40586 41590 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_28780 41590 42777 gene locus_tag LOCUS_28790 41590 42777 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224667.1 protein_id gnl|my_center|LOCUS_28790 42785 43570 gene locus_tag LOCUS_28800 gene tpiA 42785 43570 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_28800 43701 43934 gene locus_tag LOCUS_28810 43701 43934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 44009 44353 gene locus_tag LOCUS_28820 44009 44353 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_28820 46096 44423 gene locus_tag LOCUS_28830 46096 44423 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_28830 46287 47321 gene locus_tag LOCUS_28840 46287 47321 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027701.1 protein_id gnl|my_center|LOCUS_28840 47492 49747 gene locus_tag LOCUS_28850 47492 49747 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729127.1 protein_id gnl|my_center|LOCUS_28850 50876 50049 gene locus_tag LOCUS_28860 50876 50049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 51042 51530 gene locus_tag LOCUS_28870 51042 51530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 52503 51838 gene locus_tag LOCUS_28880 52503 51838 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729087.1 protein_id gnl|my_center|LOCUS_28880 53128 52550 gene locus_tag LOCUS_28890 53128 52550 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226520.1 protein_id gnl|my_center|LOCUS_28890 53201 53995 gene locus_tag LOCUS_28900 53201 53995 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088221.1 protein_id gnl|my_center|LOCUS_28900 54063 55121 gene locus_tag LOCUS_28910 gene add 54063 55121 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228060.1 protein_id gnl|my_center|LOCUS_28910 55988 55134 gene locus_tag LOCUS_28920 55988 55134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 57195 56422 gene locus_tag LOCUS_28930 gene pgl 57195 56422 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_28930 58242 57331 gene locus_tag LOCUS_28940 gene opcA 58242 57331 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976880.1 protein_id gnl|my_center|LOCUS_28940 60037 58295 gene locus_tag LOCUS_28950 gene zwf 60037 58295 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031084.1 protein_id gnl|my_center|LOCUS_28950 61674 60037 gene locus_tag LOCUS_28960 61674 60037 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_28960 62922 61813 gene locus_tag LOCUS_28970 gene tal 62922 61813 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224676.1 protein_id gnl|my_center|LOCUS_28970 65044 62933 gene locus_tag LOCUS_28980 gene tkt 65044 62933 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_28980 65480 66415 gene locus_tag LOCUS_28990 65480 66415 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_28990 66531 67010 gene locus_tag LOCUS_29000 66531 67010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 68582 67143 gene locus_tag LOCUS_29010 68582 67143 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530465.1 protein_id gnl|my_center|LOCUS_29010 68909 69856 gene locus_tag LOCUS_29020 68909 69856 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027013.1 protein_id gnl|my_center|LOCUS_29020 70185 71486 gene locus_tag LOCUS_29030 70185 71486 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230460.1 protein_id gnl|my_center|LOCUS_29030 72063 71740 gene locus_tag LOCUS_29040 72063 71740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 71948 72232 gene locus_tag LOCUS_29050 71948 72232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 73366 72647 gene locus_tag LOCUS_29060 73366 72647 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_29060 74405 73371 gene locus_tag LOCUS_29070 74405 73371 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_29070 74600 75736 gene locus_tag LOCUS_29080 74600 75736 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030796.1 protein_id gnl|my_center|LOCUS_29080 75733 76053 gene locus_tag LOCUS_29090 75733 76053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 76050 77849 gene locus_tag LOCUS_29100 76050 77849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 77833 78729 gene locus_tag LOCUS_29110 77833 78729 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030799.1 protein_id gnl|my_center|LOCUS_29110 78761 79738 gene locus_tag LOCUS_29120 78761 79738 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030800.1 protein_id gnl|my_center|LOCUS_29120 79887 81242 gene locus_tag LOCUS_29130 79887 81242 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064368.1 protein_id gnl|my_center|LOCUS_29130 81770 83398 gene locus_tag LOCUS_29140 81770 83398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 84945 83518 gene locus_tag LOCUS_29150 84945 83518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 84878 85246 gene locus_tag LOCUS_29160 84878 85246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 85616 86779 gene locus_tag LOCUS_29170 85616 86779 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013893969.1 protein_id gnl|my_center|LOCUS_29170 86832 87725 gene locus_tag LOCUS_29180 86832 87725 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525177.1 protein_id gnl|my_center|LOCUS_29180 87722 88687 gene locus_tag LOCUS_29190 87722 88687 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525178.1 protein_id gnl|my_center|LOCUS_29190 88684 89529 gene locus_tag LOCUS_29200 88684 89529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525179.1 protein_id gnl|my_center|LOCUS_29200 89447 90235 gene locus_tag LOCUS_29210 89447 90235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_29210 90462 91139 gene locus_tag LOCUS_29220 90462 91139 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327688.1 protein_id gnl|my_center|LOCUS_29220 92084 91161 gene locus_tag LOCUS_29230 92084 91161 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034357836.1 protein_id gnl|my_center|LOCUS_29230 93176 92406 gene locus_tag LOCUS_29240 93176 92406 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_29240 94143 93229 gene locus_tag LOCUS_29250 94143 93229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_29250 94368 95147 gene locus_tag LOCUS_29260 94368 95147 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978600.1 protein_id gnl|my_center|LOCUS_29260 95264 96112 gene locus_tag LOCUS_29270 95264 96112 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 protein_id gnl|my_center|LOCUS_29270 96109 97521 gene locus_tag LOCUS_29280 gene sufB 96109 97521 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_29280 97524 98645 gene locus_tag LOCUS_29290 gene sufD 97524 98645 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_29290 98642 98980 gene locus_tag LOCUS_29300 98642 98980 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_29300 98981 99727 gene locus_tag LOCUS_29310 gene sufC 98981 99727 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_29310 99724 100986 gene locus_tag LOCUS_29320 99724 100986 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_29320 100990 101427 gene locus_tag LOCUS_29330 100990 101427 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_29330 101501 101866 gene locus_tag LOCUS_29340 101501 101866 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057839.1 protein_id gnl|my_center|LOCUS_29340 102523 104055 gene locus_tag LOCUS_29350 102523 104055 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029195.1 protein_id gnl|my_center|LOCUS_29350 105186 104170 gene locus_tag LOCUS_29360 105186 104170 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972694.1 protein_id gnl|my_center|LOCUS_29360 105580 108015 gene locus_tag LOCUS_29370 105580 108015 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225596.1 protein_id gnl|my_center|LOCUS_29370 108187 109902 gene locus_tag LOCUS_29380 108187 109902 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803788.1 protein_id gnl|my_center|LOCUS_29380 109967 110953 gene locus_tag LOCUS_29390 109967 110953 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_29390 111017 111892 gene locus_tag LOCUS_29400 111017 111892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29400 111889 113007 gene locus_tag LOCUS_29410 111889 113007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_29410 113004 113978 gene locus_tag LOCUS_29420 113004 113978 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225595.1 protein_id gnl|my_center|LOCUS_29420 114516 114205 gene locus_tag LOCUS_29430 114516 114205 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742073.1 protein_id gnl|my_center|LOCUS_29430 114606 115505 gene locus_tag LOCUS_29440 114606 115505 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731218.1 protein_id gnl|my_center|LOCUS_29440 115730 115993 gene locus_tag LOCUS_29450 115730 115993 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226745.1 protein_id gnl|my_center|LOCUS_29450 116071 116916 gene locus_tag LOCUS_29460 gene hisG 116071 116916 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_29460 117206 118096 gene locus_tag LOCUS_29470 117206 118096 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878179.1 protein_id gnl|my_center|LOCUS_29470 118099 118836 gene locus_tag LOCUS_29480 118099 118836 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973847.1 protein_id gnl|my_center|LOCUS_29480 118841 119986 gene locus_tag LOCUS_29490 118841 119986 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030073.1 protein_id gnl|my_center|LOCUS_29490 119983 120165 gene locus_tag LOCUS_29500 119983 120165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 120195 120767 gene locus_tag LOCUS_29510 120195 120767 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_29510 121672 121097 gene locus_tag LOCUS_29520 121672 121097 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228785.1 protein_id gnl|my_center|LOCUS_29520 121747 122547 gene locus_tag LOCUS_29530 121747 122547 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_29530 122851 122654 gene locus_tag LOCUS_29540 122851 122654 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_29540 123669 122842 gene locus_tag LOCUS_29550 123669 122842 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028937.1 protein_id gnl|my_center|LOCUS_29550 123895 124314 gene locus_tag LOCUS_29560 123895 124314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 125552 124443 gene locus_tag LOCUS_29570 125552 124443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 125832 125695 gene locus_tag LOCUS_29580 125832 125695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 127235 125829 gene locus_tag LOCUS_29590 127235 125829 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229610.1 protein_id gnl|my_center|LOCUS_29590 128057 128845 gene locus_tag LOCUS_29600 128057 128845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 129388 128978 gene locus_tag LOCUS_29610 129388 128978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 129486 130454 gene locus_tag LOCUS_29620 129486 130454 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226571.1 protein_id gnl|my_center|LOCUS_29620 131875 130628 gene locus_tag LOCUS_29630 131875 130628 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226144.1 protein_id gnl|my_center|LOCUS_29630 133336 132080 gene locus_tag LOCUS_29640 133336 132080 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226537.1 protein_id gnl|my_center|LOCUS_29640 133668 133333 gene locus_tag LOCUS_29650 133668 133333 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230891.1 protein_id gnl|my_center|LOCUS_29650 134323 133697 gene locus_tag LOCUS_29660 134323 133697 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495312.1 protein_id gnl|my_center|LOCUS_29660 134756 135175 gene locus_tag LOCUS_29670 134756 135175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 135503 136411 gene locus_tag LOCUS_29680 135503 136411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 138126 136747 gene locus_tag LOCUS_29690 138126 136747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 139127 138447 gene locus_tag LOCUS_29700 139127 138447 CDS product acVLRF1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 protein_id gnl|my_center|LOCUS_29700 139559 141157 gene locus_tag LOCUS_29710 139559 141157 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_29710 141272 141487 gene locus_tag LOCUS_29720 141272 141487 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976983.1 protein_id gnl|my_center|LOCUS_29720 141630 142547 gene locus_tag LOCUS_29730 141630 142547 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_29730 142715 144583 gene locus_tag LOCUS_29740 142715 144583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_29740 145514 144630 gene locus_tag LOCUS_29750 145514 144630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 145684 146610 gene locus_tag LOCUS_29760 145684 146610 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_29760 146649 147554 gene locus_tag LOCUS_29770 146649 147554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 149414 147573 gene locus_tag LOCUS_29780 149414 147573 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027969.1 protein_id gnl|my_center|LOCUS_29780 150111 149506 gene locus_tag LOCUS_29790 150111 149506 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367926.1 protein_id gnl|my_center|LOCUS_29790 150173 151630 gene locus_tag LOCUS_29800 150173 151630 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977408.1 protein_id gnl|my_center|LOCUS_29800 153133 151649 gene locus_tag LOCUS_29810 153133 151649 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_29810 153392 155254 gene locus_tag LOCUS_29820 153392 155254 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229431.1 protein_id gnl|my_center|LOCUS_29820 155473 156312 gene locus_tag LOCUS_29830 155473 156312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 156696 156400 gene locus_tag LOCUS_29840 156696 156400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 157173 156865 gene locus_tag LOCUS_29850 157173 156865 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_29850 157425 158699 gene locus_tag LOCUS_29860 157425 158699 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230482.1 protein_id gnl|my_center|LOCUS_29860 158956 159945 gene locus_tag LOCUS_29870 158956 159945 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038752.1 protein_id gnl|my_center|LOCUS_29870 160768 160202 gene locus_tag LOCUS_29880 gene mug 160768 160202 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027672.1 protein_id gnl|my_center|LOCUS_29880 161250 160780 gene locus_tag LOCUS_29890 161250 160780 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_29890 162510 161470 gene locus_tag LOCUS_29900 162510 161470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 163069 162695 gene locus_tag LOCUS_29910 163069 162695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 163468 163217 gene locus_tag LOCUS_29920 163468 163217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 164319 163465 gene locus_tag LOCUS_29930 164319 163465 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_29930 164573 164917 gene locus_tag LOCUS_29940 164573 164917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 167348 165039 gene locus_tag LOCUS_29950 167348 165039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 167986 167345 gene locus_tag LOCUS_29960 167986 167345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 168563 170248 gene locus_tag LOCUS_29970 168563 170248 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_29970 171515 170496 gene locus_tag LOCUS_29980 171515 170496 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031816.1 protein_id gnl|my_center|LOCUS_29980 172246 171512 gene locus_tag LOCUS_29990 172246 171512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 173313 172255 gene locus_tag LOCUS_30000 173313 172255 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089170.1 protein_id gnl|my_center|LOCUS_30000 174148 173618 gene locus_tag LOCUS_30010 174148 173618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 174517 174200 gene locus_tag LOCUS_30020 174517 174200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 174686 175567 gene locus_tag LOCUS_30030 174686 175567 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_30030 175587 175805 gene locus_tag LOCUS_30040 175587 175805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 175802 176056 gene locus_tag LOCUS_30050 175802 176056 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_30050 176453 177097 gene locus_tag LOCUS_30060 176453 177097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 177087 178415 gene locus_tag LOCUS_30070 177087 178415 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975833.1 protein_id gnl|my_center|LOCUS_30070 178412 180142 gene locus_tag LOCUS_30080 178412 180142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 180139 182448 gene locus_tag LOCUS_30090 180139 182448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 184386 182491 gene locus_tag LOCUS_30100 184386 182491 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484240.1 protein_id gnl|my_center|LOCUS_30100 184775 185383 gene locus_tag LOCUS_30110 184775 185383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 185526 185915 gene locus_tag LOCUS_30120 185526 185915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 187457 186252 gene locus_tag LOCUS_30130 187457 186252 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728974.1 protein_id gnl|my_center|LOCUS_30130 187524 187793 gene locus_tag LOCUS_30140 187524 187793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 187790 188446 gene locus_tag LOCUS_30150 187790 188446 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028296.1 protein_id gnl|my_center|LOCUS_30150 189436 188474 gene locus_tag LOCUS_30160 189436 188474 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192779382.1 protein_id gnl|my_center|LOCUS_30160 190278 189433 gene locus_tag LOCUS_30170 190278 189433 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227650.1 protein_id gnl|my_center|LOCUS_30170 190667 190275 gene locus_tag LOCUS_30180 190667 190275 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284752.1 protein_id gnl|my_center|LOCUS_30180 191044 191172 gene locus_tag LOCUS_30190 191044 191172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 191257 191526 gene locus_tag LOCUS_30200 191257 191526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 191884 192012 gene locus_tag LOCUS_30210 191884 192012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 192530 193717 gene locus_tag LOCUS_30220 192530 193717 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230594.1 protein_id gnl|my_center|LOCUS_30220 194840 193782 gene locus_tag LOCUS_30230 194840 193782 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226230.1 protein_id gnl|my_center|LOCUS_30230 196673 195192 gene locus_tag LOCUS_30240 gene araA 196673 195192 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226247.1 protein_id gnl|my_center|LOCUS_30240 197332 196670 gene locus_tag LOCUS_30250 197332 196670 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226246.1 protein_id gnl|my_center|LOCUS_30250 198978 197329 gene locus_tag LOCUS_30260 gene araB 198978 197329 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226245.1 protein_id gnl|my_center|LOCUS_30260 199885 201027 gene locus_tag LOCUS_30270 gene chvE 199885 201027 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226248.1 protein_id gnl|my_center|LOCUS_30270 201102 202640 gene locus_tag LOCUS_30280 gene gguA 201102 202640 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226249.1 protein_id gnl|my_center|LOCUS_30280 202637 203899 gene locus_tag LOCUS_30290 gene gguB 202637 203899 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226250.1 protein_id gnl|my_center|LOCUS_30290 204308 205297 gene locus_tag LOCUS_30300 gene moaA 204308 205297 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_30300 205300 205914 gene locus_tag LOCUS_30310 205300 205914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30310 205938 206195 gene locus_tag LOCUS_30320 205938 206195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30320 206740 206420 gene locus_tag LOCUS_30330 206740 206420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 206816 207028 gene locus_tag LOCUS_30340 206816 207028 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_30340 208463 207096 gene locus_tag LOCUS_30350 208463 207096 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_30350 209959 208460 gene locus_tag LOCUS_30360 209959 208460 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411929.1 protein_id gnl|my_center|LOCUS_30360 210036 210740 gene locus_tag LOCUS_30370 gene fabG 210036 210740 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_30370 210724 211506 gene locus_tag LOCUS_30380 gene fabI 210724 211506 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_30380 212724 211567 gene locus_tag LOCUS_30390 212724 211567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 213952 213014 gene locus_tag LOCUS_30400 213952 213014 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285031.1 protein_id gnl|my_center|LOCUS_30400 214086 214907 gene locus_tag LOCUS_30410 214086 214907 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226473.1 protein_id gnl|my_center|LOCUS_30410 214917 215630 gene locus_tag LOCUS_30420 214917 215630 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_30420 215640 216212 gene locus_tag LOCUS_30430 215640 216212 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_30430 216209 216973 gene locus_tag LOCUS_30440 216209 216973 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270002.1 protein_id gnl|my_center|LOCUS_30440 217041 217784 gene locus_tag LOCUS_30450 217041 217784 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388471.1 protein_id gnl|my_center|LOCUS_30450 219515 217794 gene locus_tag LOCUS_30460 219515 217794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 219702 220925 gene locus_tag LOCUS_30470 gene mshC 219702 220925 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_30470 221610 220984 gene locus_tag LOCUS_30480 221610 220984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 221911 221591 gene locus_tag LOCUS_30490 221911 221591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 222792 221905 gene locus_tag LOCUS_30500 222792 221905 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730760.1 protein_id gnl|my_center|LOCUS_30500 223440 222850 gene locus_tag LOCUS_30510 223440 222850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 223942 223442 gene locus_tag LOCUS_30520 223942 223442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 224316 224095 gene locus_tag LOCUS_30530 224316 224095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 225182 224331 gene locus_tag LOCUS_30540 225182 224331 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972477.1 protein_id gnl|my_center|LOCUS_30540 225591 225184 gene locus_tag LOCUS_30550 225591 225184 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030969.1 protein_id gnl|my_center|LOCUS_30550 227032 225752 gene locus_tag LOCUS_30560 227032 225752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30560 227752 227039 gene locus_tag LOCUS_30570 227752 227039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 228612 228109 gene locus_tag LOCUS_30580 gene def 228612 228109 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_30580 228844 230208 gene locus_tag LOCUS_30590 228844 230208 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085590.1 protein_id gnl|my_center|LOCUS_30590 230447 230151 gene locus_tag LOCUS_30600 230447 230151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 230479 232605 gene locus_tag LOCUS_30610 230479 232605 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_30610 232602 233999 gene locus_tag LOCUS_30620 232602 233999 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223027.1 protein_id gnl|my_center|LOCUS_30620 233996 236425 gene locus_tag LOCUS_30630 gene nirB 233996 236425 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223029.1 protein_id gnl|my_center|LOCUS_30630 236422 236790 gene locus_tag LOCUS_30640 gene nirD 236422 236790 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726940.1 protein_id gnl|my_center|LOCUS_30640 236787 237956 gene locus_tag LOCUS_30650 236787 237956 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028682.1 protein_id gnl|my_center|LOCUS_30650 237953 238771 gene locus_tag LOCUS_30660 237953 238771 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891750.1 protein_id gnl|my_center|LOCUS_30660 239313 238657 gene locus_tag LOCUS_30670 239313 238657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 240492 239638 gene locus_tag LOCUS_30680 gene parJ 240492 239638 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_30680 >Feature sequence019 1591 842 gene locus_tag LOCUS_30690 1591 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 2487 1591 gene locus_tag LOCUS_30700 2487 1591 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776867.1 protein_id gnl|my_center|LOCUS_30700 3404 2484 gene locus_tag LOCUS_30710 3404 2484 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_30710 4782 3481 gene locus_tag LOCUS_30720 4782 3481 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359868.1 protein_id gnl|my_center|LOCUS_30720 5827 4811 gene locus_tag LOCUS_30730 5827 4811 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225054.1 protein_id gnl|my_center|LOCUS_30730 6236 8149 gene locus_tag LOCUS_30740 6236 8149 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225053.1 protein_id gnl|my_center|LOCUS_30740 9235 8141 gene locus_tag LOCUS_30750 9235 8141 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316201.1 protein_id gnl|my_center|LOCUS_30750 9482 9249 gene locus_tag LOCUS_30760 9482 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 10284 9643 gene locus_tag LOCUS_30770 10284 9643 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029436.1 protein_id gnl|my_center|LOCUS_30770 11059 10358 gene locus_tag LOCUS_30780 11059 10358 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968061.1 protein_id gnl|my_center|LOCUS_30780 11429 11190 gene locus_tag LOCUS_30790 11429 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 12489 11860 gene locus_tag LOCUS_30800 12489 11860 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742191.1 protein_id gnl|my_center|LOCUS_30800 12992 13198 gene locus_tag LOCUS_30810 12992 13198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 14119 13295 gene locus_tag LOCUS_30820 14119 13295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 14436 14278 gene locus_tag LOCUS_30830 14436 14278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 14401 15024 gene locus_tag LOCUS_30840 14401 15024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 15467 15392 gene locus_tag LOCUS_t00240 15467 15392 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15663 16112 gene locus_tag LOCUS_30850 15663 16112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 16252 17082 gene locus_tag LOCUS_30860 16252 17082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224872.1 protein_id gnl|my_center|LOCUS_30860 17086 18264 gene locus_tag LOCUS_30870 17086 18264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 18274 18468 gene locus_tag LOCUS_30880 18274 18468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 18515 18937 gene locus_tag LOCUS_30890 18515 18937 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027424.1 protein_id gnl|my_center|LOCUS_30890 20504 19104 gene locus_tag LOCUS_30900 20504 19104 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 protein_id gnl|my_center|LOCUS_30900 20957 20505 gene locus_tag LOCUS_30910 20957 20505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 21904 21113 gene locus_tag LOCUS_30920 21904 21113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 22129 22497 gene locus_tag LOCUS_30930 22129 22497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 23315 22602 gene locus_tag LOCUS_30940 23315 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 23579 25477 gene locus_tag LOCUS_30950 23579 25477 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485194.1 protein_id gnl|my_center|LOCUS_30950 25672 26850 gene locus_tag LOCUS_30960 25672 26850 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_30960 27421 26987 gene locus_tag LOCUS_30970 27421 26987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 27312 27719 gene locus_tag LOCUS_30980 27312 27719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 28712 27789 gene locus_tag LOCUS_30990 28712 27789 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027480.1 protein_id gnl|my_center|LOCUS_30990 28954 30141 gene locus_tag LOCUS_31000 28954 30141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 30138 30602 gene locus_tag LOCUS_31010 30138 30602 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530702.1 protein_id gnl|my_center|LOCUS_31010 30606 31607 gene locus_tag LOCUS_31020 30606 31607 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640561.1 protein_id gnl|my_center|LOCUS_31020 31604 33784 gene locus_tag LOCUS_31030 31604 33784 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531564.1 protein_id gnl|my_center|LOCUS_31030 35279 33876 gene locus_tag LOCUS_31040 gene sthA 35279 33876 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_31040 35978 35379 gene locus_tag LOCUS_31050 35978 35379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 35890 36504 gene locus_tag LOCUS_31060 35890 36504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 37626 36571 gene locus_tag LOCUS_31070 37626 36571 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973478.1 protein_id gnl|my_center|LOCUS_31070 37709 38638 gene locus_tag LOCUS_31080 37709 38638 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_31080 38647 40272 gene locus_tag LOCUS_31090 gene pruA 38647 40272 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_31090 41422 40340 gene locus_tag LOCUS_31100 41422 40340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 41740 42675 gene locus_tag LOCUS_31110 41740 42675 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027435.1 protein_id gnl|my_center|LOCUS_31110 42632 43456 gene locus_tag LOCUS_31120 42632 43456 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227429.1 protein_id gnl|my_center|LOCUS_31120 44023 45612 gene locus_tag LOCUS_31130 44023 45612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 45612 45995 gene locus_tag LOCUS_31140 45612 45995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 46188 47180 gene locus_tag LOCUS_31150 gene dhaK 46188 47180 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972071.1 protein_id gnl|my_center|LOCUS_31150 47388 48185 gene locus_tag LOCUS_31160 gene dhaL 47388 48185 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031416.1 protein_id gnl|my_center|LOCUS_31160 48228 48626 gene locus_tag LOCUS_31170 48228 48626 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164277346.1 protein_id gnl|my_center|LOCUS_31170 50028 48805 gene locus_tag LOCUS_31180 50028 48805 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228781.1 protein_id gnl|my_center|LOCUS_31180 50387 50512 gene locus_tag LOCUS_31190 50387 50512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 50625 50885 gene locus_tag LOCUS_31200 50625 50885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 51175 50882 gene locus_tag LOCUS_31210 51175 50882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 51099 51905 gene locus_tag LOCUS_31220 51099 51905 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104409.1 protein_id gnl|my_center|LOCUS_31220 53487 51913 gene locus_tag LOCUS_31230 53487 51913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 53545 54075 gene locus_tag LOCUS_31240 53545 54075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 54089 54292 gene locus_tag LOCUS_31250 54089 54292 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_31250 56100 54349 gene locus_tag LOCUS_31260 56100 54349 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029406.1 protein_id gnl|my_center|LOCUS_31260 56861 56121 gene locus_tag LOCUS_31270 56861 56121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 58258 56960 gene locus_tag LOCUS_31280 58258 56960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 58146 58580 gene locus_tag LOCUS_31290 58146 58580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 60646 58487 gene locus_tag LOCUS_31300 60646 58487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 61302 61159 gene locus_tag LOCUS_31310 61302 61159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 64359 61507 gene locus_tag LOCUS_31320 64359 61507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 64617 77873 gene locus_tag LOCUS_31330 64617 77873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 78539 77970 gene locus_tag LOCUS_31340 78539 77970 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228221.1 protein_id gnl|my_center|LOCUS_31340 78629 79594 gene locus_tag LOCUS_31350 78629 79594 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228220.1 protein_id gnl|my_center|LOCUS_31350 81346 79775 gene locus_tag LOCUS_31360 81346 79775 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225131.1 protein_id gnl|my_center|LOCUS_31360 82798 81455 gene locus_tag LOCUS_31370 82798 81455 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467055.1 protein_id gnl|my_center|LOCUS_31370 83790 83332 gene locus_tag LOCUS_31380 83790 83332 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863309.1 protein_id gnl|my_center|LOCUS_31380 84671 83787 gene locus_tag LOCUS_31390 gene couO 84671 83787 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 protein_id gnl|my_center|LOCUS_31390 84861 85664 gene locus_tag LOCUS_31400 84861 85664 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225909.1 protein_id gnl|my_center|LOCUS_31400 87059 85722 gene locus_tag LOCUS_31410 87059 85722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 87345 87803 gene locus_tag LOCUS_31420 87345 87803 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200865.1 protein_id gnl|my_center|LOCUS_31420 88267 87839 gene locus_tag LOCUS_31430 88267 87839 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230457.1 protein_id gnl|my_center|LOCUS_31430 88804 90102 gene locus_tag LOCUS_31440 88804 90102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 91850 90048 gene locus_tag LOCUS_31450 91850 90048 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224751.1 protein_id gnl|my_center|LOCUS_31450 92137 92865 gene locus_tag LOCUS_31460 92137 92865 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015034.1 protein_id gnl|my_center|LOCUS_31460 93852 92884 gene locus_tag LOCUS_31470 93852 92884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 93995 94834 gene locus_tag LOCUS_31480 93995 94834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 94831 95301 gene locus_tag LOCUS_31490 94831 95301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 96192 95419 gene locus_tag LOCUS_31500 96192 95419 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727382.1 protein_id gnl|my_center|LOCUS_31500 96540 96286 gene locus_tag LOCUS_31510 96540 96286 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_31510 96846 100235 gene locus_tag LOCUS_31520 96846 100235 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258737.1 protein_id gnl|my_center|LOCUS_31520 101097 100426 gene locus_tag LOCUS_31530 101097 100426 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224977.1 protein_id gnl|my_center|LOCUS_31530 102648 101344 gene locus_tag LOCUS_31540 102648 101344 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222229.1 protein_id gnl|my_center|LOCUS_31540 103343 102852 gene locus_tag LOCUS_31550 103343 102852 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975641.1 protein_id gnl|my_center|LOCUS_31550 104177 103494 gene locus_tag LOCUS_31560 104177 103494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 106031 104250 gene locus_tag LOCUS_31570 106031 104250 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226759.1 protein_id gnl|my_center|LOCUS_31570 106424 107335 gene locus_tag LOCUS_31580 106424 107335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 107462 108118 gene locus_tag LOCUS_31590 gene lexA 107462 108118 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225332.1 protein_id gnl|my_center|LOCUS_31590 110987 108195 gene locus_tag LOCUS_31600 110987 108195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 112024 110984 gene locus_tag LOCUS_31610 112024 110984 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208437.1 protein_id gnl|my_center|LOCUS_31610 113592 112111 gene locus_tag LOCUS_31620 113592 112111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 114977 113589 gene locus_tag LOCUS_31630 114977 113589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 115480 114977 gene locus_tag LOCUS_31640 115480 114977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 116439 115984 gene locus_tag LOCUS_31650 116439 115984 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326908.1 protein_id gnl|my_center|LOCUS_31650 116567 116436 gene locus_tag LOCUS_31660 116567 116436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 116793 117620 gene locus_tag LOCUS_31670 116793 117620 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749477.1 protein_id gnl|my_center|LOCUS_31670 117611 117817 gene locus_tag LOCUS_31680 117611 117817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 117842 118048 gene locus_tag LOCUS_31690 117842 118048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 118119 118502 gene locus_tag LOCUS_31700 118119 118502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 119553 118426 gene locus_tag LOCUS_31710 119553 118426 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138052126.1 protein_id gnl|my_center|LOCUS_31710 119873 119691 gene locus_tag LOCUS_31720 119873 119691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 120460 120047 gene locus_tag LOCUS_31730 120460 120047 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893670.1 protein_id gnl|my_center|LOCUS_31730 120597 121469 gene locus_tag LOCUS_31740 120597 121469 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223829.1 protein_id gnl|my_center|LOCUS_31740 122175 121537 gene locus_tag LOCUS_31750 122175 121537 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224186.1 protein_id gnl|my_center|LOCUS_31750 122884 122456 gene locus_tag LOCUS_31760 122884 122456 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729927.1 protein_id gnl|my_center|LOCUS_31760 123118 124521 gene locus_tag LOCUS_31770 123118 124521 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974973.1 protein_id gnl|my_center|LOCUS_31770 124993 124586 gene locus_tag LOCUS_31780 124993 124586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 128691 125227 gene locus_tag LOCUS_31790 128691 125227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 128854 129480 gene locus_tag LOCUS_31800 128854 129480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 130605 129400 gene locus_tag LOCUS_31810 130605 129400 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028575.1 protein_id gnl|my_center|LOCUS_31810 130759 131253 gene locus_tag LOCUS_31820 130759 131253 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 protein_id gnl|my_center|LOCUS_31820 131339 132049 gene locus_tag LOCUS_31830 131339 132049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 132104 133699 gene locus_tag LOCUS_31840 132104 133699 CDS product aminoglycoside/tetracycline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407310.1 protein_id gnl|my_center|LOCUS_31840 134145 135311 gene locus_tag LOCUS_31850 134145 135311 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330441.1 protein_id gnl|my_center|LOCUS_31850 135308 136627 gene locus_tag LOCUS_31860 135308 136627 CDS product aromatic-ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114852.1 protein_id gnl|my_center|LOCUS_31860 136624 137136 gene locus_tag LOCUS_31870 136624 137136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 137144 138352 gene locus_tag LOCUS_31880 137144 138352 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081138.1 protein_id gnl|my_center|LOCUS_31880 138356 138748 gene locus_tag LOCUS_31890 138356 138748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 138738 139274 gene locus_tag LOCUS_31900 138738 139274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 139873 139217 gene locus_tag LOCUS_31910 139873 139217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 140456 140118 gene locus_tag LOCUS_31920 140456 140118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 140761 140453 gene locus_tag LOCUS_31930 140761 140453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 142265 140808 gene locus_tag LOCUS_31940 142265 140808 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030556.1 protein_id gnl|my_center|LOCUS_31940 142387 143313 gene locus_tag LOCUS_31950 142387 143313 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727063.1 protein_id gnl|my_center|LOCUS_31950 143629 143306 gene locus_tag LOCUS_31960 143629 143306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 143514 144053 gene locus_tag LOCUS_31970 143514 144053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 144331 144501 gene locus_tag LOCUS_31980 144331 144501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 144721 144539 gene locus_tag LOCUS_31990 144721 144539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 144852 146081 gene locus_tag LOCUS_32000 144852 146081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 146109 147341 gene locus_tag LOCUS_32010 146109 147341 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014331.1 protein_id gnl|my_center|LOCUS_32010 148844 147387 gene locus_tag LOCUS_32020 gene der 148844 147387 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_32020 149557 148901 gene locus_tag LOCUS_32030 gene cmk 149557 148901 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_32030 150747 149647 gene locus_tag LOCUS_32040 150747 149647 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_32040 151103 150744 gene locus_tag LOCUS_32050 gene aroH 151103 150744 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_32050 <152351 151155 gene locus_tag LOCUS_32060 <152351 151155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027963.1:pseudouridine synthase >Feature sequence020 1202 501 gene locus_tag LOCUS_32070 gene scpB 1202 501 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_32070 2097 1183 gene locus_tag LOCUS_32080 2097 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 3141 2215 gene locus_tag LOCUS_32090 3141 2215 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_32090 4005 3232 gene locus_tag LOCUS_32100 gene xerD 4005 3232 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408401.1 protein_id gnl|my_center|LOCUS_32100 4833 4177 gene locus_tag LOCUS_32110 4833 4177 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_32110 6500 4830 gene locus_tag LOCUS_32120 6500 4830 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027968.1 protein_id gnl|my_center|LOCUS_32120 6693 7373 gene locus_tag LOCUS_32130 6693 7373 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977515.1 protein_id gnl|my_center|LOCUS_32130 7674 8981 gene locus_tag LOCUS_32140 7674 8981 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 protein_id gnl|my_center|LOCUS_32140 9443 10138 gene locus_tag LOCUS_32150 9443 10138 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896486.1 protein_id gnl|my_center|LOCUS_32150 12388 10298 gene locus_tag LOCUS_32160 gene uvrB 12388 10298 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_32160 13666 12476 gene locus_tag LOCUS_32170 13666 12476 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104175.1 protein_id gnl|my_center|LOCUS_32170 14343 13726 gene locus_tag LOCUS_32180 gene coaE 14343 13726 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_32180 14824 14366 gene locus_tag LOCUS_32190 14824 14366 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230160.1 protein_id gnl|my_center|LOCUS_32190 16715 15234 gene locus_tag LOCUS_32200 gene rpsA 16715 15234 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_32200 18014 16938 gene locus_tag LOCUS_32210 18014 16938 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225108.1 protein_id gnl|my_center|LOCUS_32210 20894 18192 gene locus_tag LOCUS_32220 gene polA 20894 18192 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_32220 20963 21403 gene locus_tag LOCUS_32230 20963 21403 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976812.1 protein_id gnl|my_center|LOCUS_32230 22515 21682 gene locus_tag LOCUS_32240 22515 21682 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_32240 23363 22512 gene locus_tag LOCUS_32250 23363 22512 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230771.1 protein_id gnl|my_center|LOCUS_32250 24232 23369 gene locus_tag LOCUS_32260 24232 23369 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583414.1 protein_id gnl|my_center|LOCUS_32260 24394 24951 gene locus_tag LOCUS_32270 24394 24951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 25884 25189 gene locus_tag LOCUS_32280 25884 25189 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227935.1 protein_id gnl|my_center|LOCUS_32280 26677 25895 gene locus_tag LOCUS_32290 26677 25895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227934.1 protein_id gnl|my_center|LOCUS_32290 27822 26674 gene locus_tag LOCUS_32300 27822 26674 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093952556.1 protein_id gnl|my_center|LOCUS_32300 28787 27819 gene locus_tag LOCUS_32310 28787 27819 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227932.1 protein_id gnl|my_center|LOCUS_32310 30089 28893 gene locus_tag LOCUS_32320 30089 28893 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227931.1 protein_id gnl|my_center|LOCUS_32320 31072 30491 gene locus_tag LOCUS_32330 31072 30491 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_32330 31141 31214 gene locus_tag LOCUS_t00250 31141 31214 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 32899 31469 gene locus_tag LOCUS_32340 gene pyk 32899 31469 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_32340 34973 33237 gene locus_tag LOCUS_32350 34973 33237 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229919.1 protein_id gnl|my_center|LOCUS_32350 36663 35179 gene locus_tag LOCUS_32360 36663 35179 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228800.1 protein_id gnl|my_center|LOCUS_32360 41192 36678 gene locus_tag LOCUS_32370 gene gltB 41192 36678 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742213.1 protein_id gnl|my_center|LOCUS_32370 42125 41499 gene locus_tag LOCUS_32380 42125 41499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 43051 42167 gene locus_tag LOCUS_32390 43051 42167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 44238 43048 gene locus_tag LOCUS_32400 gene lgt 44238 43048 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976782.1 protein_id gnl|my_center|LOCUS_32400 45014 44250 gene locus_tag LOCUS_32410 45014 44250 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715374.1 protein_id gnl|my_center|LOCUS_32410 45606 45055 gene locus_tag LOCUS_32420 45606 45055 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_32420 46745 45942 gene locus_tag LOCUS_32430 gene trpA 46745 45942 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976780.1 protein_id gnl|my_center|LOCUS_32430 48021 46777 gene locus_tag LOCUS_32440 gene trpB 48021 46777 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 protein_id gnl|my_center|LOCUS_32440 48842 48018 gene locus_tag LOCUS_32450 gene trpC 48842 48018 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_32450 49465 49028 gene locus_tag LOCUS_32460 49465 49028 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028111.1 protein_id gnl|my_center|LOCUS_32460 49971 49465 gene locus_tag LOCUS_32470 49971 49465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 50760 50110 gene locus_tag LOCUS_32480 50760 50110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 51107 50757 gene locus_tag LOCUS_32490 gene hisI 51107 50757 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 protein_id gnl|my_center|LOCUS_32490 51382 52251 gene locus_tag LOCUS_32500 51382 52251 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_32500 52366 52668 gene locus_tag LOCUS_32510 52366 52668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 52874 53971 gene locus_tag LOCUS_32520 52874 53971 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029660.1 protein_id gnl|my_center|LOCUS_32520 54388 54047 gene locus_tag LOCUS_32530 54388 54047 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357080.1 protein_id gnl|my_center|LOCUS_32530 54501 55562 gene locus_tag LOCUS_32540 54501 55562 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966730.1 protein_id gnl|my_center|LOCUS_32540 57473 55638 gene locus_tag LOCUS_32550 57473 55638 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_32550 59349 57565 gene locus_tag LOCUS_32560 59349 57565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32560 59291 59728 gene locus_tag LOCUS_32570 59291 59728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 59734 60369 gene locus_tag LOCUS_32580 59734 60369 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230583.1 protein_id gnl|my_center|LOCUS_32580 60637 60807 gene locus_tag LOCUS_32590 60637 60807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 62358 60982 gene locus_tag LOCUS_32600 62358 60982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 63416 62646 gene locus_tag LOCUS_32610 gene hisF 63416 62646 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466799.1 protein_id gnl|my_center|LOCUS_32610 64135 63413 gene locus_tag LOCUS_32620 gene priA 64135 63413 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_32620 64478 64140 gene locus_tag LOCUS_32630 64478 64140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 65156 64524 gene locus_tag LOCUS_32640 gene hisH 65156 64524 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224143.1 protein_id gnl|my_center|LOCUS_32640 65302 65147 gene locus_tag LOCUS_32650 65302 65147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 65919 65299 gene locus_tag LOCUS_32660 gene hisB 65919 65299 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_32660 67073 65916 gene locus_tag LOCUS_32670 67073 65916 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_32670 68356 67070 gene locus_tag LOCUS_32680 gene hisD 68356 67070 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028117.1 protein_id gnl|my_center|LOCUS_32680 68475 68975 gene locus_tag LOCUS_32690 gene ybaK 68475 68975 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229713.1 protein_id gnl|my_center|LOCUS_32690 69184 70584 gene locus_tag LOCUS_32700 69184 70584 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_32700 70714 71286 gene locus_tag LOCUS_32710 70714 71286 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225197.1 protein_id gnl|my_center|LOCUS_32710 71289 71912 gene locus_tag LOCUS_32720 71289 71912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 72676 72020 gene locus_tag LOCUS_32730 72676 72020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 72751 74097 gene locus_tag LOCUS_32740 gene murA 72751 74097 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775882.1 protein_id gnl|my_center|LOCUS_32740 74217 76526 gene locus_tag LOCUS_32750 74217 76526 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_32750 76830 77579 gene locus_tag LOCUS_32760 76830 77579 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668774.1 protein_id gnl|my_center|LOCUS_32760 78781 78053 gene locus_tag LOCUS_32770 78781 78053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 79624 79106 gene locus_tag LOCUS_32780 79624 79106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 80255 79755 gene locus_tag LOCUS_32790 80255 79755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 80607 80780 gene locus_tag LOCUS_32800 80607 80780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 81978 80830 gene locus_tag LOCUS_32810 gene murG 81978 80830 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724779.1 protein_id gnl|my_center|LOCUS_32810 82453 82259 gene locus_tag LOCUS_32820 82453 82259 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_32820 >Feature sequence021 1088 24 gene locus_tag LOCUS_32830 gene hisC 1088 24 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_32830 1953 1294 gene locus_tag LOCUS_32840 1953 1294 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226433.1 protein_id gnl|my_center|LOCUS_32840 3804 1993 gene locus_tag LOCUS_32850 3804 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 5017 3929 gene locus_tag LOCUS_32860 5017 3929 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_32860 6301 5036 gene locus_tag LOCUS_32870 6301 5036 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582949.1 protein_id gnl|my_center|LOCUS_32870 8092 6431 gene locus_tag LOCUS_32880 8092 6431 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776768.1 protein_id gnl|my_center|LOCUS_32880 8170 9309 gene locus_tag LOCUS_32890 gene wecB 8170 9309 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776111.1 protein_id gnl|my_center|LOCUS_32890 9445 11520 gene locus_tag LOCUS_32900 9445 11520 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776746.1 protein_id gnl|my_center|LOCUS_32900 11657 12343 gene locus_tag LOCUS_32910 11657 12343 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_32910 12566 13987 gene locus_tag LOCUS_32920 12566 13987 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250416.1 protein_id gnl|my_center|LOCUS_32920 14342 15793 gene locus_tag LOCUS_32930 14342 15793 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_32930 16042 16437 gene locus_tag LOCUS_32940 16042 16437 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946033.1 protein_id gnl|my_center|LOCUS_32940 16557 17009 gene locus_tag LOCUS_32950 16557 17009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 17473 17105 gene locus_tag LOCUS_32960 gene glbN 17473 17105 CDS product group 1 truncated hemoglobin GlbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407730.1 protein_id gnl|my_center|LOCUS_32960 18515 17700 gene locus_tag LOCUS_32970 18515 17700 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_32970 18651 19598 gene locus_tag LOCUS_32980 18651 19598 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065279.1 protein_id gnl|my_center|LOCUS_32980 20015 21613 gene locus_tag LOCUS_32990 20015 21613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 22217 21714 gene locus_tag LOCUS_33000 22217 21714 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977781.1 protein_id gnl|my_center|LOCUS_33000 22489 23619 gene locus_tag LOCUS_33010 22489 23619 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_33010 24549 23623 gene locus_tag LOCUS_33020 24549 23623 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831472.1 protein_id gnl|my_center|LOCUS_33020 25755 24805 gene locus_tag LOCUS_33030 gene nrfD 25755 24805 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227549.1 protein_id gnl|my_center|LOCUS_33030 26641 25775 gene locus_tag LOCUS_33040 26641 25775 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145933610.1 protein_id gnl|my_center|LOCUS_33040 29900 26670 gene locus_tag LOCUS_33050 gene fdh 29900 26670 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227547.1 protein_id gnl|my_center|LOCUS_33050 31035 30190 gene locus_tag LOCUS_33060 31035 30190 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223482.1 protein_id gnl|my_center|LOCUS_33060 31522 31040 gene locus_tag LOCUS_33070 31522 31040 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029897.1 protein_id gnl|my_center|LOCUS_33070 31570 33225 gene locus_tag LOCUS_33080 31570 33225 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029898.1 protein_id gnl|my_center|LOCUS_33080 33810 33382 gene locus_tag LOCUS_33090 33810 33382 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972358.1 protein_id gnl|my_center|LOCUS_33090 33892 34749 gene locus_tag LOCUS_33100 33892 34749 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031047.1 protein_id gnl|my_center|LOCUS_33100 34909 35172 gene locus_tag LOCUS_33110 34909 35172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 35270 35488 gene locus_tag LOCUS_33120 35270 35488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 35704 35973 gene locus_tag LOCUS_33130 35704 35973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 36002 36958 gene locus_tag LOCUS_33140 gene tgmB 36002 36958 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028637.1 protein_id gnl|my_center|LOCUS_33140 36946 38082 gene locus_tag LOCUS_33150 gene tgmC 36946 38082 CDS product ATP-grasp peptide maturase system methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028638.1 protein_id gnl|my_center|LOCUS_33150 38494 38174 gene locus_tag LOCUS_33160 38494 38174 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804861.1 protein_id gnl|my_center|LOCUS_33160 40409 38895 gene locus_tag LOCUS_33170 40409 38895 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224190.1 protein_id gnl|my_center|LOCUS_33170 40639 40442 gene locus_tag LOCUS_33180 40639 40442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224191.1 protein_id gnl|my_center|LOCUS_33180 41107 42978 gene locus_tag LOCUS_33190 41107 42978 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_33190 44086 43046 gene locus_tag LOCUS_33200 44086 43046 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028459.1 protein_id gnl|my_center|LOCUS_33200 45056 44319 gene locus_tag LOCUS_33210 45056 44319 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_33210 45254 47947 gene locus_tag LOCUS_33220 45254 47947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 47944 48351 gene locus_tag LOCUS_33230 47944 48351 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977425.1 protein_id gnl|my_center|LOCUS_33230 48348 48725 gene locus_tag LOCUS_33240 48348 48725 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_33240 48706 49281 gene locus_tag LOCUS_33250 48706 49281 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977427.1 protein_id gnl|my_center|LOCUS_33250 49829 49467 gene locus_tag LOCUS_33260 49829 49467 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_33260 50224 49829 gene locus_tag LOCUS_33270 50224 49829 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977672.1 protein_id gnl|my_center|LOCUS_33270 52998 50227 gene locus_tag LOCUS_33280 52998 50227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 53977 53132 gene locus_tag LOCUS_33290 53977 53132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 55631 54258 gene locus_tag LOCUS_33300 gene xylB 55631 54258 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877620.1 protein_id gnl|my_center|LOCUS_33300 56779 55628 gene locus_tag LOCUS_33310 gene xylA 56779 55628 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228546.1 protein_id gnl|my_center|LOCUS_33310 56924 58090 gene locus_tag LOCUS_33320 56924 58090 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228545.1 protein_id gnl|my_center|LOCUS_33320 58215 58730 gene locus_tag LOCUS_33330 58215 58730 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226958.1 protein_id gnl|my_center|LOCUS_33330 59070 60035 gene locus_tag LOCUS_33340 59070 60035 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031408.1 protein_id gnl|my_center|LOCUS_33340 60774 60088 gene locus_tag LOCUS_33350 60774 60088 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031090.1 protein_id gnl|my_center|LOCUS_33350 62159 60771 gene locus_tag LOCUS_33360 62159 60771 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031091.1 protein_id gnl|my_center|LOCUS_33360 62473 63468 gene locus_tag LOCUS_33370 62473 63468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 63619 64626 gene locus_tag LOCUS_33380 63619 64626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 65253 64642 gene locus_tag LOCUS_33390 65253 64642 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_33390 65535 65990 gene locus_tag LOCUS_33400 65535 65990 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074042.1 protein_id gnl|my_center|LOCUS_33400 67716 66112 gene locus_tag LOCUS_33410 67716 66112 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_33410 68646 69947 gene locus_tag LOCUS_33420 68646 69947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 71583 70006 gene locus_tag LOCUS_33430 71583 70006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 73488 71926 gene locus_tag LOCUS_33440 gene paaP 73488 71926 CDS product aminopeptidase PaaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101464.1 protein_id gnl|my_center|LOCUS_33440 74029 75966 gene locus_tag LOCUS_33450 74029 75966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 77578 76043 gene locus_tag LOCUS_33460 77578 76043 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029563.1 protein_id gnl|my_center|LOCUS_33460 78085 78555 gene locus_tag LOCUS_33470 78085 78555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 78593 79087 gene locus_tag LOCUS_33480 78593 79087 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030185.1 protein_id gnl|my_center|LOCUS_33480 79224 79520 gene locus_tag LOCUS_33490 79224 79520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 80427 79723 gene locus_tag LOCUS_33500 80427 79723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 80844 80536 gene locus_tag LOCUS_33510 80844 80536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 80952 82094 gene locus_tag LOCUS_33520 80952 82094 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027750.1 protein_id gnl|my_center|LOCUS_33520 82091 82819 gene locus_tag LOCUS_33530 82091 82819 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803688.1 protein_id gnl|my_center|LOCUS_33530 82844 83434 gene locus_tag LOCUS_33540 82844 83434 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030525.1 protein_id gnl|my_center|LOCUS_33540 83760 83569 gene locus_tag LOCUS_33550 83760 83569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 84867 84394 gene locus_tag LOCUS_33560 84867 84394 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031198.1 protein_id gnl|my_center|LOCUS_33560 84955 85326 gene locus_tag LOCUS_33570 84955 85326 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_33570 85344 86108 gene locus_tag LOCUS_33580 85344 86108 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_33580 86105 87025 gene locus_tag LOCUS_33590 86105 87025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 88238 87258 gene locus_tag LOCUS_33600 88238 87258 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968231.1 protein_id gnl|my_center|LOCUS_33600 88754 88371 gene locus_tag LOCUS_33610 88754 88371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 89433 89357 gene locus_tag LOCUS_t00260 89433 89357 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 90227 92611 gene locus_tag LOCUS_33620 90227 92611 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_33620 92614 93633 gene locus_tag LOCUS_33630 92614 93633 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 protein_id gnl|my_center|LOCUS_33630 95217 93679 gene locus_tag LOCUS_33640 95217 93679 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_33640 95105 95500 gene locus_tag LOCUS_33650 95105 95500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 96379 95525 gene locus_tag LOCUS_33660 96379 95525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 97733 96552 gene locus_tag LOCUS_33670 97733 96552 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_33670 99780 97765 gene locus_tag LOCUS_33680 99780 97765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 100227 101078 gene locus_tag LOCUS_33690 100227 101078 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_33690 101141 102280 gene locus_tag LOCUS_33700 101141 102280 CDS product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 protein_id gnl|my_center|LOCUS_33700 102360 103619 gene locus_tag LOCUS_33710 gene efeB 102360 103619 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730522.1 protein_id gnl|my_center|LOCUS_33710 106382 103719 gene locus_tag LOCUS_33720 gene topA 106382 103719 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_33720 106625 106810 gene locus_tag LOCUS_33730 106625 106810 CDS product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977152.1 protein_id gnl|my_center|LOCUS_33730 >Feature sequence022 1503 856 gene locus_tag LOCUS_33740 1503 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 2922 1624 gene locus_tag LOCUS_33750 2922 1624 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_33750 3171 3257 gene locus_tag LOCUS_t00270 3171 3257 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3423 3262 gene locus_tag LOCUS_33760 3423 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 3747 3968 gene locus_tag LOCUS_33770 3747 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 4395 4565 gene locus_tag LOCUS_33780 4395 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 5004 5672 gene locus_tag LOCUS_33790 5004 5672 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781894.1 protein_id gnl|my_center|LOCUS_33790 5778 6704 gene locus_tag LOCUS_33800 5778 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 6688 8724 gene locus_tag LOCUS_33810 6688 8724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222595.1 protein_id gnl|my_center|LOCUS_33810 8721 9845 gene locus_tag LOCUS_33820 8721 9845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 9838 11166 gene locus_tag LOCUS_33830 9838 11166 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190872.1 protein_id gnl|my_center|LOCUS_33830 11600 11082 gene locus_tag LOCUS_33840 11600 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 11705 12364 gene locus_tag LOCUS_33850 11705 12364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 12361 13698 gene locus_tag LOCUS_33860 gene mrx(A) 12361 13698 CDS product macrolide resistance MFS transporter Mrx(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004159.1 protein_id gnl|my_center|LOCUS_33860 14963 13863 gene locus_tag LOCUS_33870 14963 13863 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_33870 15675 15286 gene locus_tag LOCUS_33880 15675 15286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 15828 18242 gene locus_tag LOCUS_33890 gene pepN 15828 18242 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110162.1 protein_id gnl|my_center|LOCUS_33890 18351 19370 gene locus_tag LOCUS_33900 18351 19370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 20839 19616 gene locus_tag LOCUS_33910 20839 19616 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227131.1 protein_id gnl|my_center|LOCUS_33910 22195 20855 gene locus_tag LOCUS_33920 22195 20855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 23558 22179 gene locus_tag LOCUS_33930 23558 22179 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929201.1 protein_id gnl|my_center|LOCUS_33930 24454 23549 gene locus_tag LOCUS_33940 24454 23549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 25929 24409 gene locus_tag LOCUS_33950 25929 24409 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201884.1 protein_id gnl|my_center|LOCUS_33950 26179 26045 gene locus_tag LOCUS_33960 26179 26045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 27961 26285 gene locus_tag LOCUS_33970 27961 26285 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930203.1 protein_id gnl|my_center|LOCUS_33970 28880 28152 gene locus_tag LOCUS_33980 28880 28152 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_33980 30238 29285 gene locus_tag LOCUS_33990 30238 29285 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_33990 30441 31016 gene locus_tag LOCUS_34000 30441 31016 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 protein_id gnl|my_center|LOCUS_34000 31290 31676 gene locus_tag LOCUS_34010 31290 31676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 31743 32360 gene locus_tag LOCUS_34020 31743 32360 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486466.1 protein_id gnl|my_center|LOCUS_34020 34870 32435 gene locus_tag LOCUS_34030 34870 32435 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 protein_id gnl|my_center|LOCUS_34030 35975 34986 gene locus_tag LOCUS_34040 35975 34986 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_34040 36248 36592 gene locus_tag LOCUS_34050 36248 36592 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975456.1 protein_id gnl|my_center|LOCUS_34050 36589 37536 gene locus_tag LOCUS_34060 36589 37536 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112734.1 protein_id gnl|my_center|LOCUS_34060 39164 37671 gene locus_tag LOCUS_34070 39164 37671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919016.1 protein_id gnl|my_center|LOCUS_34070 40220 39339 gene locus_tag LOCUS_34080 40220 39339 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031642.1 protein_id gnl|my_center|LOCUS_34080 41161 40220 gene locus_tag LOCUS_34090 41161 40220 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031643.1 protein_id gnl|my_center|LOCUS_34090 42603 41236 gene locus_tag LOCUS_34100 42603 41236 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878184.1 protein_id gnl|my_center|LOCUS_34100 44970 42805 gene locus_tag LOCUS_34110 44970 42805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 46137 45115 gene locus_tag LOCUS_34120 46137 45115 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852489.1 protein_id gnl|my_center|LOCUS_34120 46815 46471 gene locus_tag LOCUS_34130 46815 46471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 46727 47527 gene locus_tag LOCUS_34140 46727 47527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 47584 47961 gene locus_tag LOCUS_34150 47584 47961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 47970 49289 gene locus_tag LOCUS_34160 47970 49289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084962.1 protein_id gnl|my_center|LOCUS_34160 50578 49358 gene locus_tag LOCUS_34170 50578 49358 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777064.1 protein_id gnl|my_center|LOCUS_34170 51128 50583 gene locus_tag LOCUS_34180 51128 50583 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731368.1 protein_id gnl|my_center|LOCUS_34180 51881 51318 gene locus_tag LOCUS_34190 51881 51318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027403.1 protein_id gnl|my_center|LOCUS_34190 52120 52689 gene locus_tag LOCUS_34200 52120 52689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 52851 54236 gene locus_tag LOCUS_34210 52851 54236 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027399.1 protein_id gnl|my_center|LOCUS_34210 54410 55636 gene locus_tag LOCUS_34220 54410 55636 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027502.1 protein_id gnl|my_center|LOCUS_34220 55633 56844 gene locus_tag LOCUS_34230 55633 56844 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027503.1 protein_id gnl|my_center|LOCUS_34230 56401 56478 gene locus_tag LOCUS_t00280 56401 56478 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 56841 57992 gene locus_tag LOCUS_34240 56841 57992 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188478.1 protein_id gnl|my_center|LOCUS_34240 58751 58005 gene locus_tag LOCUS_34250 58751 58005 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030136.1 protein_id gnl|my_center|LOCUS_34250 58912 59652 gene locus_tag LOCUS_34260 58912 59652 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027504.1 protein_id gnl|my_center|LOCUS_34260 59720 60844 gene locus_tag LOCUS_34270 59720 60844 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031517.1 protein_id gnl|my_center|LOCUS_34270 60845 61687 gene locus_tag LOCUS_34280 60845 61687 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_34280 61684 62694 gene locus_tag LOCUS_34290 61684 62694 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031519.1 protein_id gnl|my_center|LOCUS_34290 62698 63615 gene locus_tag LOCUS_34300 62698 63615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027500.1 protein_id gnl|my_center|LOCUS_34300 63650 64633 gene locus_tag LOCUS_34310 63650 64633 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027501.1 protein_id gnl|my_center|LOCUS_34310 64688 65254 gene locus_tag LOCUS_34320 64688 65254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027495.1 protein_id gnl|my_center|LOCUS_34320 65458 66036 gene locus_tag LOCUS_34330 65458 66036 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027402.1 protein_id gnl|my_center|LOCUS_34330 67944 66124 gene locus_tag LOCUS_34340 67944 66124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 68458 70743 gene locus_tag LOCUS_34350 68458 70743 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224956.1 protein_id gnl|my_center|LOCUS_34350 71931 70837 gene locus_tag LOCUS_34360 71931 70837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 72657 72388 gene locus_tag LOCUS_34370 72657 72388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 72677 73168 gene locus_tag LOCUS_34380 72677 73168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 73384 73869 gene locus_tag LOCUS_34390 73384 73869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 74049 75443 gene locus_tag LOCUS_34400 74049 75443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 76599 75388 gene locus_tag LOCUS_34410 76599 75388 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726727.1 protein_id gnl|my_center|LOCUS_34410 77663 76878 gene locus_tag LOCUS_34420 77663 76878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 78887 78045 gene locus_tag LOCUS_34430 78887 78045 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227679.1 protein_id gnl|my_center|LOCUS_34430 79278 78946 gene locus_tag LOCUS_34440 79278 78946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877697.1 protein_id gnl|my_center|LOCUS_34440 79371 80324 gene locus_tag LOCUS_34450 79371 80324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 81478 80273 gene locus_tag LOCUS_34460 81478 80273 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228864.1 protein_id gnl|my_center|LOCUS_34460 82301 81651 gene locus_tag LOCUS_34470 82301 81651 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466502.1 protein_id gnl|my_center|LOCUS_34470 83636 82479 gene locus_tag LOCUS_34480 83636 82479 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893096.1 protein_id gnl|my_center|LOCUS_34480 84150 83860 gene locus_tag LOCUS_34490 84150 83860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 84581 84147 gene locus_tag LOCUS_34500 84581 84147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 84853 84578 gene locus_tag LOCUS_34510 84853 84578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 85386 84850 gene locus_tag LOCUS_34520 85386 84850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 86731 85514 gene locus_tag LOCUS_34530 86731 85514 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_34530 86930 86745 gene locus_tag LOCUS_34540 86930 86745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 88311 87088 gene locus_tag LOCUS_34550 88311 87088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 88481 88645 gene locus_tag LOCUS_34560 88481 88645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 89123 88758 gene locus_tag LOCUS_34570 89123 88758 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974289.1 protein_id gnl|my_center|LOCUS_34570 89343 90371 gene locus_tag LOCUS_34580 89343 90371 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029199.1 protein_id gnl|my_center|LOCUS_34580 90916 91311 gene locus_tag LOCUS_34590 90916 91311 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029511.1 protein_id gnl|my_center|LOCUS_34590 93311 91512 gene locus_tag LOCUS_34600 93311 91512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 93643 94299 gene locus_tag LOCUS_34610 93643 94299 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029202.1 protein_id gnl|my_center|LOCUS_34610 94647 95474 gene locus_tag LOCUS_34620 94647 95474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 95776 96993 gene locus_tag LOCUS_34630 95776 96993 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027081.1 protein_id gnl|my_center|LOCUS_34630 96990 97724 gene locus_tag LOCUS_34640 96990 97724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 99109 98000 gene locus_tag LOCUS_34650 99109 98000 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257104.1 protein_id gnl|my_center|LOCUS_34650 100568 99144 gene locus_tag LOCUS_34660 100568 99144 CDS product NDP-hexose 2,3-dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781848.1 protein_id gnl|my_center|LOCUS_34660 100739 102088 gene locus_tag LOCUS_34670 100739 102088 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876469.1 protein_id gnl|my_center|LOCUS_34670 102093 103106 gene locus_tag LOCUS_34680 102093 103106 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_34680 103885 103172 gene locus_tag LOCUS_34690 103885 103172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 104252 105541 gene locus_tag LOCUS_34700 104252 105541 CDS product DUF1205 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227238.1 protein_id gnl|my_center|LOCUS_34700 105589 106461 gene locus_tag LOCUS_34710 gene rfbA 105589 106461 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222507.1 protein_id gnl|my_center|LOCUS_34710 106972 108177 gene locus_tag LOCUS_34720 106972 108177 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089192.1 protein_id gnl|my_center|LOCUS_34720 108797 108186 gene locus_tag LOCUS_34730 108797 108186 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230054.1 protein_id gnl|my_center|LOCUS_34730 109176 109601 gene locus_tag LOCUS_34740 109176 109601 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_34740 109612 110403 gene locus_tag LOCUS_34750 gene modA 109612 110403 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_34750 110406 111251 gene locus_tag LOCUS_34760 110406 111251 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_34760 111443 112477 gene locus_tag LOCUS_34770 111443 112477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_34770 >Feature sequence023 <1 975 gene locus_tag LOCUS_34780 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894933.1:GlxA family transcriptional regulator 1239 1724 gene locus_tag LOCUS_34790 1239 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 4001 1857 gene locus_tag LOCUS_34800 4001 1857 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_34800 4177 4509 gene locus_tag LOCUS_34810 4177 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 6388 4742 gene locus_tag LOCUS_34820 6388 4742 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_34820 7360 6533 gene locus_tag LOCUS_34830 7360 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 9907 7490 gene locus_tag LOCUS_34840 9907 7490 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029578.1 protein_id gnl|my_center|LOCUS_34840 10239 11678 gene locus_tag LOCUS_34850 10239 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 12270 11626 gene locus_tag LOCUS_34860 12270 11626 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727017.1 protein_id gnl|my_center|LOCUS_34860 12628 13251 gene locus_tag LOCUS_34870 12628 13251 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029580.1 protein_id gnl|my_center|LOCUS_34870 13251 13715 gene locus_tag LOCUS_34880 13251 13715 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_34880 15778 13838 gene locus_tag LOCUS_34890 15778 13838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 16077 15778 gene locus_tag LOCUS_34900 16077 15778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 16094 16915 gene locus_tag LOCUS_34910 16094 16915 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776598.1 protein_id gnl|my_center|LOCUS_34910 17004 20054 gene locus_tag LOCUS_34920 17004 20054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029583.1 protein_id gnl|my_center|LOCUS_34920 20441 20154 gene locus_tag LOCUS_34930 20441 20154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 20592 22067 gene locus_tag LOCUS_34940 20592 22067 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230209.1 protein_id gnl|my_center|LOCUS_34940 23451 22129 gene locus_tag LOCUS_34950 23451 22129 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968097.1 protein_id gnl|my_center|LOCUS_34950 24044 23499 gene locus_tag LOCUS_34960 24044 23499 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170153456.1 protein_id gnl|my_center|LOCUS_34960 24320 24619 gene locus_tag LOCUS_34970 24320 24619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 26743 24683 gene locus_tag LOCUS_34980 26743 24683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 26803 27003 gene locus_tag LOCUS_34990 26803 27003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 27033 27584 gene locus_tag LOCUS_35000 27033 27584 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030981.1 protein_id gnl|my_center|LOCUS_35000 27595 28023 gene locus_tag LOCUS_35010 27595 28023 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863690.1 protein_id gnl|my_center|LOCUS_35010 28982 28128 gene locus_tag LOCUS_35020 28982 28128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 29832 29242 gene locus_tag LOCUS_35030 29832 29242 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893937.1 protein_id gnl|my_center|LOCUS_35030 29962 30591 gene locus_tag LOCUS_35040 29962 30591 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728450.1 protein_id gnl|my_center|LOCUS_35040 30690 32045 gene locus_tag LOCUS_35050 30690 32045 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229610.1 protein_id gnl|my_center|LOCUS_35050 32294 32752 gene locus_tag LOCUS_35060 32294 32752 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974639.1 protein_id gnl|my_center|LOCUS_35060 32749 34236 gene locus_tag LOCUS_35070 32749 34236 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_35070 34187 34753 gene locus_tag LOCUS_35080 gene thpR 34187 34753 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029587.1 protein_id gnl|my_center|LOCUS_35080 35953 34982 gene locus_tag LOCUS_35090 35953 34982 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974629.1 protein_id gnl|my_center|LOCUS_35090 36144 37253 gene locus_tag LOCUS_35100 36144 37253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 37389 37850 gene locus_tag LOCUS_35110 37389 37850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 37958 39142 gene locus_tag LOCUS_35120 gene lhgO 37958 39142 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727635.1 protein_id gnl|my_center|LOCUS_35120 39166 39867 gene locus_tag LOCUS_35130 gene phoP 39166 39867 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403867.1 protein_id gnl|my_center|LOCUS_35130 39864 41555 gene locus_tag LOCUS_35140 39864 41555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 41952 43052 gene locus_tag LOCUS_35150 41952 43052 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227080.1 protein_id gnl|my_center|LOCUS_35150 43866 43186 gene locus_tag LOCUS_35160 43866 43186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 44171 44836 gene locus_tag LOCUS_35170 44171 44836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 45125 45406 gene locus_tag LOCUS_35180 45125 45406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 45547 46908 gene locus_tag LOCUS_35190 45547 46908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 46905 47816 gene locus_tag LOCUS_35200 46905 47816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 47813 49105 gene locus_tag LOCUS_35210 47813 49105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222426.1 protein_id gnl|my_center|LOCUS_35210 49131 49787 gene locus_tag LOCUS_35220 49131 49787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 49833 50522 gene locus_tag LOCUS_35230 gene phoP 49833 50522 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403867.1 protein_id gnl|my_center|LOCUS_35230 50596 52083 gene locus_tag LOCUS_35240 gene phoR 50596 52083 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403870.1 protein_id gnl|my_center|LOCUS_35240 52348 52890 gene locus_tag LOCUS_35250 52348 52890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 52984 54879 gene locus_tag LOCUS_35260 52984 54879 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 protein_id gnl|my_center|LOCUS_35260 54876 56615 gene locus_tag LOCUS_35270 54876 56615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 57563 57087 gene locus_tag LOCUS_35280 57563 57087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 57972 57658 gene locus_tag LOCUS_35290 gene sugE 57972 57658 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705814.1 protein_id gnl|my_center|LOCUS_35290 58595 57969 gene locus_tag LOCUS_35300 58595 57969 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831492.1 protein_id gnl|my_center|LOCUS_35300 58694 59245 gene locus_tag LOCUS_35310 58694 59245 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226699.1 protein_id gnl|my_center|LOCUS_35310 60458 59364 gene locus_tag LOCUS_35320 60458 59364 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866892.1 protein_id gnl|my_center|LOCUS_35320 60893 60462 gene locus_tag LOCUS_35330 60893 60462 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971919.1 protein_id gnl|my_center|LOCUS_35330 63210 61036 gene locus_tag LOCUS_35340 63210 61036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 64382 63207 gene locus_tag LOCUS_35350 64382 63207 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222108.1 protein_id gnl|my_center|LOCUS_35350 64671 66011 gene locus_tag LOCUS_35360 64671 66011 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940840.1 protein_id gnl|my_center|LOCUS_35360 66008 66598 gene locus_tag LOCUS_35370 66008 66598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940841.1 protein_id gnl|my_center|LOCUS_35370 66844 66626 gene locus_tag LOCUS_35380 66844 66626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 66819 67067 gene locus_tag LOCUS_35390 66819 67067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 68389 67031 gene locus_tag LOCUS_35400 68389 67031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 68557 68952 gene locus_tag LOCUS_35410 68557 68952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 68964 69293 gene locus_tag LOCUS_35420 68964 69293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 69310 69954 gene locus_tag LOCUS_35430 69310 69954 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 protein_id gnl|my_center|LOCUS_35430 70473 71750 gene locus_tag LOCUS_35440 70473 71750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 71977 71735 gene locus_tag LOCUS_35450 71977 71735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 72903 71974 gene locus_tag LOCUS_35460 72903 71974 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107014379.1 protein_id gnl|my_center|LOCUS_35460 73024 73776 gene locus_tag LOCUS_35470 73024 73776 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974670.1 protein_id gnl|my_center|LOCUS_35470 74171 74746 gene locus_tag LOCUS_35480 74171 74746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 74986 74777 gene locus_tag LOCUS_35490 74986 74777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 75354 75593 gene locus_tag LOCUS_35500 75354 75593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 75909 75625 gene locus_tag LOCUS_35510 75909 75625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 76984 76085 gene locus_tag LOCUS_35520 76984 76085 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223098.1 protein_id gnl|my_center|LOCUS_35520 78151 77174 gene locus_tag LOCUS_35530 78151 77174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 78613 79473 gene locus_tag LOCUS_35540 78613 79473 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976414.1 protein_id gnl|my_center|LOCUS_35540 80301 79489 gene locus_tag LOCUS_35550 80301 79489 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015201.1 protein_id gnl|my_center|LOCUS_35550 81227 80331 gene locus_tag LOCUS_35560 81227 80331 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230113.1 protein_id gnl|my_center|LOCUS_35560 82017 81220 gene locus_tag LOCUS_35570 82017 81220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 82901 82014 gene locus_tag LOCUS_35580 82901 82014 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230111.1 protein_id gnl|my_center|LOCUS_35580 84236 82932 gene locus_tag LOCUS_35590 84236 82932 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027774.1 protein_id gnl|my_center|LOCUS_35590 84415 85125 gene locus_tag LOCUS_35600 84415 85125 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027773.1 protein_id gnl|my_center|LOCUS_35600 85328 85798 gene locus_tag LOCUS_35610 85328 85798 CDS product YfcE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228757.1 protein_id gnl|my_center|LOCUS_35610 86030 86488 gene locus_tag LOCUS_35620 86030 86488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 87821 86670 gene locus_tag LOCUS_35630 87821 86670 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_35630 87912 88568 gene locus_tag LOCUS_35640 87912 88568 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029568.1 protein_id gnl|my_center|LOCUS_35640 88884 89708 gene locus_tag LOCUS_35650 88884 89708 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028316.1 protein_id gnl|my_center|LOCUS_35650 89698 89901 gene locus_tag LOCUS_35660 89698 89901 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_35660 89933 90136 gene locus_tag LOCUS_35670 89933 90136 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_35670 90892 90326 gene locus_tag LOCUS_35680 90892 90326 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226947.1 protein_id gnl|my_center|LOCUS_35680 91253 91594 gene locus_tag LOCUS_35690 91253 91594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 91674 92078 gene locus_tag LOCUS_35700 91674 92078 CDS product DUF3147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090367.1 protein_id gnl|my_center|LOCUS_35700 92564 92385 gene locus_tag LOCUS_35710 92564 92385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 94419 93310 gene locus_tag LOCUS_35720 94419 93310 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726945.1 protein_id gnl|my_center|LOCUS_35720 94638 94420 gene locus_tag LOCUS_35730 94638 94420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 95238 95498 gene locus_tag LOCUS_35740 95238 95498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 95530 97185 gene locus_tag LOCUS_35750 95530 97185 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188100697.1 protein_id gnl|my_center|LOCUS_35750 98798 97206 gene locus_tag LOCUS_35760 98798 97206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 99400 98795 gene locus_tag LOCUS_35770 99400 98795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 99650 99393 gene locus_tag LOCUS_35780 99650 99393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 100432 99653 gene locus_tag LOCUS_35790 100432 99653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 101616 100432 gene locus_tag LOCUS_35800 101616 100432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 103727 101613 gene locus_tag LOCUS_35810 103727 101613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 104572 103727 gene locus_tag LOCUS_35820 104572 103727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 105591 104572 gene locus_tag LOCUS_35830 105591 104572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 107237 105588 gene locus_tag LOCUS_35840 107237 105588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 108496 107213 gene locus_tag LOCUS_35850 108496 107213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 109061 108489 gene locus_tag LOCUS_35860 109061 108489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 109276 109052 gene locus_tag LOCUS_35870 109276 109052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 113238 109273 gene locus_tag LOCUS_35880 113238 109273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 114278 113235 gene locus_tag LOCUS_35890 gene amrS 114278 113235 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228858.1 protein_id gnl|my_center|LOCUS_35890 115095 114280 gene locus_tag LOCUS_35900 115095 114280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 115604 116236 gene locus_tag LOCUS_35910 115604 116236 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976456.1 protein_id gnl|my_center|LOCUS_35910 119070 116374 gene locus_tag LOCUS_35920 gene adhE 119070 116374 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137036.1 protein_id gnl|my_center|LOCUS_35920 120691 119315 gene locus_tag LOCUS_35930 120691 119315 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483346.1 protein_id gnl|my_center|LOCUS_35930 120412 120508 gene locus_tag LOCUS_t00290 120412 120508 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 121120 122340 gene locus_tag LOCUS_35940 121120 122340 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727175.1 protein_id gnl|my_center|LOCUS_35940 123312 122389 gene locus_tag LOCUS_35950 123312 122389 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_35950 124299 123544 gene locus_tag LOCUS_35960 gene kduD 124299 123544 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230720.1 protein_id gnl|my_center|LOCUS_35960 125306 124296 gene locus_tag LOCUS_35970 125306 124296 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383135.1 protein_id gnl|my_center|LOCUS_35970 125485 126813 gene locus_tag LOCUS_35980 125485 126813 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226624.1 protein_id gnl|my_center|LOCUS_35980 126902 127747 gene locus_tag LOCUS_35990 126902 127747 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947166.1 protein_id gnl|my_center|LOCUS_35990 127751 128662 gene locus_tag LOCUS_36000 127751 128662 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226621.1 protein_id gnl|my_center|LOCUS_36000 128691 129881 gene locus_tag LOCUS_36010 128691 129881 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027050.1 protein_id gnl|my_center|LOCUS_36010 129878 130222 gene locus_tag LOCUS_36020 129878 130222 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225806.1 protein_id gnl|my_center|LOCUS_36020 130219 131268 gene locus_tag LOCUS_36030 130219 131268 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223734.1 protein_id gnl|my_center|LOCUS_36030 132147 131353 gene locus_tag LOCUS_36040 132147 131353 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226620.1 protein_id gnl|my_center|LOCUS_36040 133821 132358 gene locus_tag LOCUS_36050 133821 132358 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284325.1 protein_id gnl|my_center|LOCUS_36050 134574 134260 gene locus_tag LOCUS_36060 134574 134260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 134586 136043 gene locus_tag LOCUS_36070 134586 136043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 136258 138876 gene locus_tag LOCUS_36080 136258 138876 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455818.1 protein_id gnl|my_center|LOCUS_36080 138960 139214 gene locus_tag LOCUS_36090 138960 139214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 139513 139800 gene locus_tag LOCUS_36100 139513 139800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 139804 141273 gene locus_tag LOCUS_36110 139804 141273 CDS product non-reducing end alpha-L-arabinofuranosidase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226649.1 protein_id gnl|my_center|LOCUS_36110 142413 141454 gene locus_tag LOCUS_36120 142413 141454 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727621.1 protein_id gnl|my_center|LOCUS_36120 142475 143047 gene locus_tag LOCUS_36130 142475 143047 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222694.1 protein_id gnl|my_center|LOCUS_36130 143049 143486 gene locus_tag LOCUS_36140 143049 143486 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_36140 144122 144382 gene locus_tag LOCUS_36150 144122 144382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 147227 144534 gene locus_tag LOCUS_36160 147227 144534 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225154.1 protein_id gnl|my_center|LOCUS_36160 148420 147959 gene locus_tag LOCUS_36170 148420 147959 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975474.1 protein_id gnl|my_center|LOCUS_36170 148519 149259 gene locus_tag LOCUS_36180 148519 149259 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804665.1 protein_id gnl|my_center|LOCUS_36180 149259 149564 gene locus_tag LOCUS_36190 149259 149564 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973260.1 protein_id gnl|my_center|LOCUS_36190 150553 150098 gene locus_tag LOCUS_36200 150553 150098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 150765 150926 gene locus_tag LOCUS_36210 150765 150926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 152187 151534 gene locus_tag LOCUS_36220 152187 151534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 152400 153533 gene locus_tag LOCUS_36230 152400 153533 CDS product DUF4263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389913.1 protein_id gnl|my_center|LOCUS_36230 155808 154657 gene locus_tag LOCUS_36240 155808 154657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 156780 155815 gene locus_tag LOCUS_36250 156780 155815 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228850.1 protein_id gnl|my_center|LOCUS_36250 157481 157161 gene locus_tag LOCUS_36260 157481 157161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 157639 158460 gene locus_tag LOCUS_36270 157639 158460 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_36270 158457 158789 gene locus_tag LOCUS_36280 158457 158789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 159572 158952 gene locus_tag LOCUS_36290 159572 158952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 160606 159569 gene locus_tag LOCUS_36300 160606 159569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 161254 160862 gene locus_tag LOCUS_36310 161254 160862 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390011.1 protein_id gnl|my_center|LOCUS_36310 161394 161744 gene locus_tag LOCUS_36320 161394 161744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 161744 163126 gene locus_tag LOCUS_36330 161744 163126 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030188.1 protein_id gnl|my_center|LOCUS_36330 163146 164003 gene locus_tag LOCUS_36340 163146 164003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 164023 164364 gene locus_tag LOCUS_36350 164023 164364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 164366 164497 gene locus_tag LOCUS_36360 164366 164497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 164604 165983 gene locus_tag LOCUS_36370 gene repSA 164604 165983 CDS product replication initiator protein RepSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030196.1 protein_id gnl|my_center|LOCUS_36370 165980 166171 gene locus_tag LOCUS_36380 165980 166171 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031039432.1 protein_id gnl|my_center|LOCUS_36380 166168 167538 gene locus_tag LOCUS_36390 166168 167538 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030198.1 protein_id gnl|my_center|LOCUS_36390 167829 167755 gene locus_tag LOCUS_t00300 167829 167755 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 168007 168987 gene locus_tag LOCUS_36400 168007 168987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 169606 170691 gene locus_tag LOCUS_36410 169606 170691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 171519 170848 gene locus_tag LOCUS_36420 171519 170848 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896877.1 protein_id gnl|my_center|LOCUS_36420 172753 171947 gene locus_tag LOCUS_36430 172753 171947 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_36430 172725 173072 gene locus_tag LOCUS_36440 172725 173072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 173170 173322 gene locus_tag LOCUS_36450 173170 173322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 175768 174266 gene locus_tag LOCUS_36460 175768 174266 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029115.1 protein_id gnl|my_center|LOCUS_36460 175898 177073 gene locus_tag LOCUS_36470 175898 177073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 177733 177122 gene locus_tag LOCUS_36480 177733 177122 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_36480 177746 178651 gene locus_tag LOCUS_36490 gene galU 177746 178651 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_36490 178746 179978 gene locus_tag LOCUS_36500 178746 179978 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_36500 180058 180528 gene locus_tag LOCUS_36510 gene moaC 180058 180528 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_36510 180525 181004 gene locus_tag LOCUS_36520 180525 181004 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_36520 181176 181808 gene locus_tag LOCUS_36530 181176 181808 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_36530 182027 182926 gene locus_tag LOCUS_36540 182027 182926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 184107 182986 gene locus_tag LOCUS_36550 184107 182986 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742129.1 protein_id gnl|my_center|LOCUS_36550 184217 185353 gene locus_tag LOCUS_36560 184217 185353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 185350 185997 gene locus_tag LOCUS_36570 185350 185997 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930016.1 protein_id gnl|my_center|LOCUS_36570 186476 186090 gene locus_tag LOCUS_36580 186476 186090 CDS product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285721.1 protein_id gnl|my_center|LOCUS_36580 186564 187298 gene locus_tag LOCUS_36590 186564 187298 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027589.1 protein_id gnl|my_center|LOCUS_36590 188647 187484 gene locus_tag LOCUS_36600 188647 187484 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114201.1 protein_id gnl|my_center|LOCUS_36600 189105 188644 gene locus_tag LOCUS_36610 189105 188644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 189132 189680 gene locus_tag LOCUS_36620 189132 189680 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226520.1 protein_id gnl|my_center|LOCUS_36620 190239 189691 gene locus_tag LOCUS_36630 190239 189691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 191110 190250 gene locus_tag LOCUS_36640 191110 190250 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030055.1 protein_id gnl|my_center|LOCUS_36640 192389 191445 gene locus_tag LOCUS_36650 192389 191445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 192753 192675 gene locus_tag LOCUS_t00310 192753 192675 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 193020 193949 gene locus_tag LOCUS_36660 193020 193949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 194152 194568 gene locus_tag LOCUS_36670 194152 194568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 202610 194631 gene locus_tag LOCUS_36680 202610 194631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 203566 202616 gene locus_tag LOCUS_36690 203566 202616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 204524 203604 gene locus_tag LOCUS_36700 204524 203604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 206218 205034 gene locus_tag LOCUS_36710 206218 205034 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920312.1 protein_id gnl|my_center|LOCUS_36710 206586 207476 gene locus_tag LOCUS_36720 206586 207476 CDS product glycolipid sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898849.1 protein_id gnl|my_center|LOCUS_36720 207828 209357 gene locus_tag LOCUS_36730 207828 209357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 209848 209435 gene locus_tag LOCUS_36740 209848 209435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 212923 209966 gene locus_tag LOCUS_36750 212923 209966 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487423.1 protein_id gnl|my_center|LOCUS_36750 213799 213149 gene locus_tag LOCUS_36760 213799 213149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 214276 214908 gene locus_tag LOCUS_36770 214276 214908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 215088 215369 gene locus_tag LOCUS_36780 215088 215369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 216846 215521 gene locus_tag LOCUS_36790 216846 215521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 218599 216980 gene locus_tag LOCUS_36800 218599 216980 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_36800 218885 219730 gene locus_tag LOCUS_36810 gene rsmI 218885 219730 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_36810 >Feature sequence024 426 1748 gene locus_tag LOCUS_36820 426 1748 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_36820 1879 2220 gene locus_tag LOCUS_36830 1879 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 2301 4292 gene locus_tag LOCUS_36840 2301 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 4514 4924 gene locus_tag LOCUS_36850 gene ndk 4514 4924 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859294.1 protein_id gnl|my_center|LOCUS_36850 5222 6253 gene locus_tag LOCUS_36860 5222 6253 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_36860 6272 7414 gene locus_tag LOCUS_36870 gene mreC 6272 7414 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_36870 7601 8128 gene locus_tag LOCUS_36880 7601 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 8125 10173 gene locus_tag LOCUS_36890 gene mrdA 8125 10173 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_36890 10170 11333 gene locus_tag LOCUS_36900 gene rodA 10170 11333 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_36900 11402 13324 gene locus_tag LOCUS_36910 11402 13324 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_36910 13568 14323 gene locus_tag LOCUS_36920 13568 14323 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_36920 14427 17396 gene locus_tag LOCUS_36930 14427 17396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36930 17585 17899 gene locus_tag LOCUS_36940 gene rplU 17585 17899 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067132.1 protein_id gnl|my_center|LOCUS_36940 17912 18169 gene locus_tag LOCUS_36950 gene rpmA 17912 18169 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_36950 18352 19746 gene locus_tag LOCUS_36960 gene obgE 18352 19746 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_36960 19863 21017 gene locus_tag LOCUS_36970 gene proB 19863 21017 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_36970 21010 22293 gene locus_tag LOCUS_36980 21010 22293 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_36980 22425 22649 gene locus_tag LOCUS_36990 22425 22649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 22742 24631 gene locus_tag LOCUS_37000 22742 24631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 25737 24721 gene locus_tag LOCUS_37010 25737 24721 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028434.1 protein_id gnl|my_center|LOCUS_37010 25924 26493 gene locus_tag LOCUS_37020 gene nadD 25924 26493 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_37020 26502 26951 gene locus_tag LOCUS_37030 gene rsfS 26502 26951 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_37030 26944 27600 gene locus_tag LOCUS_37040 26944 27600 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_37040 27980 28054 gene locus_tag LOCUS_t00320 27980 28054 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 29754 28420 gene locus_tag LOCUS_37050 gene aspS 29754 28420 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193209104.1 protein_id gnl|my_center|LOCUS_37050 31240 30269 gene locus_tag LOCUS_37060 31240 30269 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_37060 31470 31237 gene locus_tag LOCUS_37070 31470 31237 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_37070 31892 31464 gene locus_tag LOCUS_37080 31892 31464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223906.1 protein_id gnl|my_center|LOCUS_37080 32086 33348 gene locus_tag LOCUS_37090 gene aldO 32086 33348 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_37090 33531 34397 gene locus_tag LOCUS_37100 33531 34397 CDS product DUF11 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223252.1 protein_id gnl|my_center|LOCUS_37100 34612 34283 gene locus_tag LOCUS_37110 34612 34283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 34602 35357 gene locus_tag LOCUS_37120 34602 35357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 35526 36758 gene locus_tag LOCUS_37130 35526 36758 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 protein_id gnl|my_center|LOCUS_37130 36834 36908 gene locus_tag LOCUS_t00330 36834 36908 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 37022 37615 gene locus_tag LOCUS_37140 37022 37615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 37665 38570 gene locus_tag LOCUS_37150 37665 38570 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114349.1 protein_id gnl|my_center|LOCUS_37150 39248 39901 gene locus_tag LOCUS_37160 39248 39901 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970812.1 protein_id gnl|my_center|LOCUS_37160 40030 41559 gene locus_tag LOCUS_37170 40030 41559 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028539.1 protein_id gnl|my_center|LOCUS_37170 42155 41607 gene locus_tag LOCUS_37180 gene calD 42155 41607 CDS product calcium binding protein CalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974571.1 protein_id gnl|my_center|LOCUS_37180 42383 42456 gene locus_tag LOCUS_t00340 42383 42456 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 43726 42743 gene locus_tag LOCUS_37190 43726 42743 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089171.1 protein_id gnl|my_center|LOCUS_37190 43861 45129 gene locus_tag LOCUS_37200 43861 45129 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_37200 45196 45906 gene locus_tag LOCUS_37210 45196 45906 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030616.1 protein_id gnl|my_center|LOCUS_37210 46095 47129 gene locus_tag LOCUS_37220 46095 47129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 47244 47840 gene locus_tag LOCUS_37230 47244 47840 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_37230 47881 48678 gene locus_tag LOCUS_37240 47881 48678 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_37240 49051 50133 gene locus_tag LOCUS_37250 49051 50133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 50943 50551 gene locus_tag LOCUS_37260 50943 50551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 protein_id gnl|my_center|LOCUS_37260 51140 51652 gene locus_tag LOCUS_37270 51140 51652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 52668 51811 gene locus_tag LOCUS_37280 52668 51811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 54737 53214 gene locus_tag LOCUS_37290 54737 53214 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877353.1 protein_id gnl|my_center|LOCUS_37290 55449 55075 gene locus_tag LOCUS_37300 55449 55075 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_37300 57453 56143 gene locus_tag LOCUS_37310 57453 56143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 59099 57627 gene locus_tag LOCUS_37320 59099 57627 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_37320 59258 59758 gene locus_tag LOCUS_37330 59258 59758 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606669.1 protein_id gnl|my_center|LOCUS_37330 61152 59947 gene locus_tag LOCUS_37340 61152 59947 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031180.1 protein_id gnl|my_center|LOCUS_37340 61432 62781 gene locus_tag LOCUS_37350 61432 62781 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_37350 62795 64054 gene locus_tag LOCUS_37360 62795 64054 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226359.1 protein_id gnl|my_center|LOCUS_37360 65668 64115 gene locus_tag LOCUS_37370 65668 64115 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_37370 65854 67398 gene locus_tag LOCUS_37380 65854 67398 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406598.1 protein_id gnl|my_center|LOCUS_37380 67436 68743 gene locus_tag LOCUS_37390 67436 68743 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_37390 70702 68795 gene locus_tag LOCUS_37400 70702 68795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37400 70941 73406 gene locus_tag LOCUS_37410 gene leuS 70941 73406 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_37410 74228 73515 gene locus_tag LOCUS_37420 gene lexA 74228 73515 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_37420 75067 74903 gene locus_tag LOCUS_37430 75067 74903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 75021 75344 gene locus_tag LOCUS_37440 75021 75344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 75502 78327 gene locus_tag LOCUS_37450 75502 78327 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_37450 78437 79402 gene locus_tag LOCUS_37460 78437 79402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 80946 79582 gene locus_tag LOCUS_37470 80946 79582 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028622.1 protein_id gnl|my_center|LOCUS_37470 81025 81543 gene locus_tag LOCUS_37480 81025 81543 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326320.1 protein_id gnl|my_center|LOCUS_37480 81856 82659 gene locus_tag LOCUS_37490 81856 82659 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228583.1 protein_id gnl|my_center|LOCUS_37490 82890 82705 gene locus_tag LOCUS_37500 82890 82705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 83302 83069 gene locus_tag LOCUS_37510 83302 83069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 83514 83203 gene locus_tag LOCUS_37520 83514 83203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 83639 85927 gene locus_tag LOCUS_37530 gene yicI 83639 85927 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027547.1 protein_id gnl|my_center|LOCUS_37530 85946 87259 gene locus_tag LOCUS_37540 85946 87259 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803805.1 protein_id gnl|my_center|LOCUS_37540 87263 88204 gene locus_tag LOCUS_37550 87263 88204 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803806.1 protein_id gnl|my_center|LOCUS_37550 88278 89168 gene locus_tag LOCUS_37560 88278 89168 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803807.1 protein_id gnl|my_center|LOCUS_37560 89333 92293 gene locus_tag LOCUS_37570 89333 92293 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226193.1 protein_id gnl|my_center|LOCUS_37570 92793 92416 gene locus_tag LOCUS_37580 92793 92416 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225795.1 protein_id gnl|my_center|LOCUS_37580 92908 93981 gene locus_tag LOCUS_37590 92908 93981 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971557.1 protein_id gnl|my_center|LOCUS_37590 94372 94073 gene locus_tag LOCUS_37600 94372 94073 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920916.1 protein_id gnl|my_center|LOCUS_37600 95647 94751 gene locus_tag LOCUS_37610 95647 94751 CDS product DUF4429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976013.1 protein_id gnl|my_center|LOCUS_37610 97889 95808 gene locus_tag LOCUS_37620 97889 95808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 98143 98391 gene locus_tag LOCUS_37630 98143 98391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976994.1 protein_id gnl|my_center|LOCUS_37630 100233 98542 gene locus_tag LOCUS_37640 100233 98542 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193177.1 protein_id gnl|my_center|LOCUS_37640 101197 100244 gene locus_tag LOCUS_37650 101197 100244 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804969.1 protein_id gnl|my_center|LOCUS_37650 102249 101194 gene locus_tag LOCUS_37660 102249 101194 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804968.1 protein_id gnl|my_center|LOCUS_37660 103980 102286 gene locus_tag LOCUS_37670 103980 102286 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804967.1 protein_id gnl|my_center|LOCUS_37670 104360 105574 gene locus_tag LOCUS_37680 104360 105574 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027551.1 protein_id gnl|my_center|LOCUS_37680 106023 108860 gene locus_tag LOCUS_37690 106023 108860 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030390.1 protein_id gnl|my_center|LOCUS_37690 108857 109867 gene locus_tag LOCUS_37700 108857 109867 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 protein_id gnl|my_center|LOCUS_37700 110831 109968 gene locus_tag LOCUS_37710 110831 109968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 112514 110988 gene locus_tag LOCUS_37720 112514 110988 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027955.1 protein_id gnl|my_center|LOCUS_37720 112897 114792 gene locus_tag LOCUS_37730 112897 114792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 113936 114030 gene locus_tag LOCUS_t00350 113936 114030 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 114920 115354 gene locus_tag LOCUS_37740 gene hrp1 114920 115354 CDS product hypoxic response protein Hrp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413598.1 protein_id gnl|my_center|LOCUS_37740 115529 117883 gene locus_tag LOCUS_37750 115529 117883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 118307 119290 gene locus_tag LOCUS_37760 118307 119290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730242.1 protein_id gnl|my_center|LOCUS_37760 119291 120190 gene locus_tag LOCUS_37770 119291 120190 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730243.1 protein_id gnl|my_center|LOCUS_37770 120187 122607 gene locus_tag LOCUS_37780 120187 122607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 122643 124352 gene locus_tag LOCUS_37790 122643 124352 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051713212.1 protein_id gnl|my_center|LOCUS_37790 126273 124420 gene locus_tag LOCUS_37800 126273 124420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 126813 126433 gene locus_tag LOCUS_37810 126813 126433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 >Feature sequence025 354 2054 gene locus_tag LOCUS_37820 354 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 2284 3192 gene locus_tag LOCUS_37830 2284 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 3943 3179 gene locus_tag LOCUS_37840 gene yaaA 3943 3179 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_37840 4400 5128 gene locus_tag LOCUS_37850 4400 5128 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529443.1 protein_id gnl|my_center|LOCUS_37850 5529 5308 gene locus_tag LOCUS_37860 5529 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_37860 5772 7844 gene locus_tag LOCUS_37870 5772 7844 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_37870 8699 8199 gene locus_tag LOCUS_37880 8699 8199 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214742.1 protein_id gnl|my_center|LOCUS_37880 8842 9171 gene locus_tag LOCUS_37890 8842 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 9752 9192 gene locus_tag LOCUS_37900 9752 9192 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_37900 10552 9794 gene locus_tag LOCUS_37910 10552 9794 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203813331.1 protein_id gnl|my_center|LOCUS_37910 10620 11075 gene locus_tag LOCUS_37920 10620 11075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 11264 11638 gene locus_tag LOCUS_37930 11264 11638 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222358.1 protein_id gnl|my_center|LOCUS_37930 14439 11926 gene locus_tag LOCUS_37940 14439 11926 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_37940 14752 16845 gene locus_tag LOCUS_37950 14752 16845 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228470.1 protein_id gnl|my_center|LOCUS_37950 18250 17357 gene locus_tag LOCUS_37960 18250 17357 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466843.1 protein_id gnl|my_center|LOCUS_37960 18362 21031 gene locus_tag LOCUS_37970 18362 21031 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_37970 21324 21986 gene locus_tag LOCUS_37980 21324 21986 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_37980 22169 22972 gene locus_tag LOCUS_37990 22169 22972 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224290.1 protein_id gnl|my_center|LOCUS_37990 25615 23147 gene locus_tag LOCUS_38000 25615 23147 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030298.1 protein_id gnl|my_center|LOCUS_38000 28619 25860 gene locus_tag LOCUS_38010 28619 25860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 29416 29021 gene locus_tag LOCUS_38020 29416 29021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 29720 30022 gene locus_tag LOCUS_38030 29720 30022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 30435 29917 gene locus_tag LOCUS_38040 30435 29917 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223264.1 protein_id gnl|my_center|LOCUS_38040 31509 30478 gene locus_tag LOCUS_38050 31509 30478 CDS product S8/S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223262.1 protein_id gnl|my_center|LOCUS_38050 31713 32207 gene locus_tag LOCUS_38060 31713 32207 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_38060 34202 32775 gene locus_tag LOCUS_38070 34202 32775 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060587.1 protein_id gnl|my_center|LOCUS_38070 35448 34216 gene locus_tag LOCUS_38080 35448 34216 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_38080 35763 35524 gene locus_tag LOCUS_38090 35763 35524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 36793 35837 gene locus_tag LOCUS_38100 36793 35837 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031009.1 protein_id gnl|my_center|LOCUS_38100 37731 36790 gene locus_tag LOCUS_38110 37731 36790 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_38110 39006 37849 gene locus_tag LOCUS_38120 gene fasR 39006 37849 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_38120 39533 39084 gene locus_tag LOCUS_38130 39533 39084 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222140.1 protein_id gnl|my_center|LOCUS_38130 40772 39621 gene locus_tag LOCUS_38140 40772 39621 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112824.1 protein_id gnl|my_center|LOCUS_38140 41139 40774 gene locus_tag LOCUS_38150 41139 40774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 41069 41332 gene locus_tag LOCUS_38160 41069 41332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 41401 42438 gene locus_tag LOCUS_38170 41401 42438 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_38170 42530 43309 gene locus_tag LOCUS_38180 42530 43309 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640423.1 protein_id gnl|my_center|LOCUS_38180 46213 43394 gene locus_tag LOCUS_38190 gene aceE 46213 43394 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976432.1 protein_id gnl|my_center|LOCUS_38190 46892 46656 gene locus_tag LOCUS_38200 46892 46656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 46797 47021 gene locus_tag LOCUS_38210 46797 47021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 47244 47912 gene locus_tag LOCUS_38220 47244 47912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38220 49574 48222 gene locus_tag LOCUS_38230 49574 48222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 50050 49634 gene locus_tag LOCUS_38240 50050 49634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 50173 50367 gene locus_tag LOCUS_38250 50173 50367 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285998.1 protein_id gnl|my_center|LOCUS_38250 50378 50785 gene locus_tag LOCUS_38260 50378 50785 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_38260 50921 51349 gene locus_tag LOCUS_38270 50921 51349 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224000.1 protein_id gnl|my_center|LOCUS_38270 51634 52095 gene locus_tag LOCUS_38280 51634 52095 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_38280 52141 52476 gene locus_tag LOCUS_38290 52141 52476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 52669 53688 gene locus_tag LOCUS_38300 52669 53688 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029555.1 protein_id gnl|my_center|LOCUS_38300 53723 53797 gene locus_tag LOCUS_t00360 53723 53797 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 54987 53854 gene locus_tag LOCUS_38310 54987 53854 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230505.1 protein_id gnl|my_center|LOCUS_38310 55373 55017 gene locus_tag LOCUS_38320 55373 55017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 56118 55345 gene locus_tag LOCUS_38330 56118 55345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 58096 56324 gene locus_tag LOCUS_38340 58096 56324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 58753 58355 gene locus_tag LOCUS_38350 58753 58355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 59087 58746 gene locus_tag LOCUS_38360 59087 58746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 59912 60370 gene locus_tag LOCUS_38370 59912 60370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 62099 60336 gene locus_tag LOCUS_38380 62099 60336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211127999.1 protein_id gnl|my_center|LOCUS_38380 62312 63304 gene locus_tag LOCUS_38390 62312 63304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 63634 63284 gene locus_tag LOCUS_38400 63634 63284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 63907 65952 gene locus_tag LOCUS_38410 63907 65952 CDS product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003681.1 protein_id gnl|my_center|LOCUS_38410 65949 67301 gene locus_tag LOCUS_38420 65949 67301 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003683.1 protein_id gnl|my_center|LOCUS_38420 67387 70266 gene locus_tag LOCUS_38430 67387 70266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 71141 70707 gene locus_tag LOCUS_38440 71141 70707 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223693.1 protein_id gnl|my_center|LOCUS_38440 71754 71239 gene locus_tag LOCUS_38450 71754 71239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 72775 72251 gene locus_tag LOCUS_38460 72775 72251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 73277 72807 gene locus_tag LOCUS_38470 73277 72807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 73920 73489 gene locus_tag LOCUS_38480 73920 73489 CDS product secretion protein EspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897840.1 protein_id gnl|my_center|LOCUS_38480 74183 74506 gene locus_tag LOCUS_38490 74183 74506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 74525 75274 gene locus_tag LOCUS_38500 74525 75274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 75327 76832 gene locus_tag LOCUS_38510 75327 76832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 76829 78373 gene locus_tag LOCUS_38520 76829 78373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137309464.1 protein_id gnl|my_center|LOCUS_38520 78592 79872 gene locus_tag LOCUS_38530 78592 79872 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031263.1 protein_id gnl|my_center|LOCUS_38530 79874 81724 gene locus_tag LOCUS_38540 79874 81724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 81721 82536 gene locus_tag LOCUS_38550 81721 82536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 82639 83652 gene locus_tag LOCUS_38560 82639 83652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 83668 83988 gene locus_tag LOCUS_38570 83668 83988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 83985 85712 gene locus_tag LOCUS_38580 83985 85712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 >Feature sequence026 227 2332 gene locus_tag LOCUS_38590 gene glgX 227 2332 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_38590 2391 4616 gene locus_tag LOCUS_38600 gene treY 2391 4616 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224464.1 protein_id gnl|my_center|LOCUS_38600 4672 6396 gene locus_tag LOCUS_38610 gene treZ 4672 6396 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224465.1 protein_id gnl|my_center|LOCUS_38610 6944 6420 gene locus_tag LOCUS_38620 6944 6420 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026917.1 protein_id gnl|my_center|LOCUS_38620 8214 7171 gene locus_tag LOCUS_38630 8214 7171 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222679.1 protein_id gnl|my_center|LOCUS_38630 8319 9608 gene locus_tag LOCUS_38640 8319 9608 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027384.1 protein_id gnl|my_center|LOCUS_38640 9609 9911 gene locus_tag LOCUS_38650 9609 9911 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 protein_id gnl|my_center|LOCUS_38650 9908 10183 gene locus_tag LOCUS_38660 9908 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 10287 11936 gene locus_tag LOCUS_38670 gene pgm 10287 11936 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_38670 12857 12192 gene locus_tag LOCUS_38680 12857 12192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 13085 13804 gene locus_tag LOCUS_38690 13085 13804 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229333.1 protein_id gnl|my_center|LOCUS_38690 13797 15608 gene locus_tag LOCUS_38700 13797 15608 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229334.1 protein_id gnl|my_center|LOCUS_38700 16333 15656 gene locus_tag LOCUS_38710 16333 15656 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223644.1 protein_id gnl|my_center|LOCUS_38710 17420 16518 gene locus_tag LOCUS_38720 17420 16518 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975831.1 protein_id gnl|my_center|LOCUS_38720 19030 17417 gene locus_tag LOCUS_38730 19030 17417 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865510.1 protein_id gnl|my_center|LOCUS_38730 20370 19042 gene locus_tag LOCUS_38740 20370 19042 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975833.1 protein_id gnl|my_center|LOCUS_38740 21714 20452 gene locus_tag LOCUS_38750 21714 20452 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 protein_id gnl|my_center|LOCUS_38750 21847 22353 gene locus_tag LOCUS_38760 21847 22353 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225030.1 protein_id gnl|my_center|LOCUS_38760 22390 23145 gene locus_tag LOCUS_38770 22390 23145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583200.1 protein_id gnl|my_center|LOCUS_38770 23305 25581 gene locus_tag LOCUS_38780 23305 25581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 27318 25630 gene locus_tag LOCUS_38790 gene treS 27318 25630 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031594.1 protein_id gnl|my_center|LOCUS_38790 29458 27626 gene locus_tag LOCUS_38800 29458 27626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 29553 31703 gene locus_tag LOCUS_38810 29553 31703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 32188 31883 gene locus_tag LOCUS_38820 32188 31883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 32892 32260 gene locus_tag LOCUS_38830 32892 32260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 33651 33148 gene locus_tag LOCUS_38840 33651 33148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 33851 34711 gene locus_tag LOCUS_38850 33851 34711 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_38850 34736 35008 gene locus_tag LOCUS_38860 34736 35008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 34983 35294 gene locus_tag LOCUS_38870 34983 35294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 38878 35180 gene locus_tag LOCUS_38880 38878 35180 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031493.1 protein_id gnl|my_center|LOCUS_38880 39832 39065 gene locus_tag LOCUS_38890 39832 39065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 40031 40351 gene locus_tag LOCUS_38900 40031 40351 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223065.1 protein_id gnl|my_center|LOCUS_38900 40348 40872 gene locus_tag LOCUS_38910 40348 40872 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223064.1 protein_id gnl|my_center|LOCUS_38910 40918 41145 gene locus_tag LOCUS_38920 40918 41145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 44501 41049 gene locus_tag LOCUS_38930 44501 41049 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_38930 44994 45875 gene locus_tag LOCUS_38940 44994 45875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 46004 47386 gene locus_tag LOCUS_38950 gene lysA 46004 47386 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_38950 47383 48795 gene locus_tag LOCUS_38960 47383 48795 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_38960 48997 50352 gene locus_tag LOCUS_38970 48997 50352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 50349 52352 gene locus_tag LOCUS_38980 50349 52352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 52883 54493 gene locus_tag LOCUS_38990 52883 54493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 55730 54564 gene locus_tag LOCUS_39000 55730 54564 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226538.1 protein_id gnl|my_center|LOCUS_39000 57087 55870 gene locus_tag LOCUS_39010 57087 55870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 57383 58441 gene locus_tag LOCUS_39020 gene thrC 57383 58441 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_39020 58830 59747 gene locus_tag LOCUS_39030 gene thrB 58830 59747 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_39030 60199 62205 gene locus_tag LOCUS_39040 60199 62205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 62701 63993 gene locus_tag LOCUS_39050 62701 63993 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223162.1 protein_id gnl|my_center|LOCUS_39050 64086 64733 gene locus_tag LOCUS_39060 64086 64733 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466646.1 protein_id gnl|my_center|LOCUS_39060 64942 65160 gene locus_tag LOCUS_39070 gene rpmE 64942 65160 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973638.1 protein_id gnl|my_center|LOCUS_39070 65275 66327 gene locus_tag LOCUS_39080 gene prfA 65275 66327 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229537.1 protein_id gnl|my_center|LOCUS_39080 66406 67260 gene locus_tag LOCUS_39090 gene prmC 66406 67260 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_39090 67317 68429 gene locus_tag LOCUS_39100 67317 68429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 68734 71040 gene locus_tag LOCUS_39110 68734 71040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 71055 71435 gene locus_tag LOCUS_39120 71055 71435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 71861 71556 gene locus_tag LOCUS_39130 71861 71556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 72090 73469 gene locus_tag LOCUS_39140 72090 73469 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973633.1 protein_id gnl|my_center|LOCUS_39140 73530 74813 gene locus_tag LOCUS_39150 73530 74813 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_39150 75007 75435 gene locus_tag LOCUS_39160 75007 75435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 75725 76516 gene locus_tag LOCUS_39170 gene atpB 75725 76516 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030208.1 protein_id gnl|my_center|LOCUS_39170 76608 76838 gene locus_tag LOCUS_39180 gene atpE 76608 76838 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973629.1 protein_id gnl|my_center|LOCUS_39180 76871 77410 gene locus_tag LOCUS_39190 76871 77410 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_39190 77410 78219 gene locus_tag LOCUS_39200 77410 78219 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_39200 78260 79909 gene locus_tag LOCUS_39210 gene atpA 78260 79909 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973626.1 protein_id gnl|my_center|LOCUS_39210 79913 80815 gene locus_tag LOCUS_39220 79913 80815 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_39220 80825 82252 gene locus_tag LOCUS_39230 gene atpD 80825 82252 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406701.1 protein_id gnl|my_center|LOCUS_39230 82305 82706 gene locus_tag LOCUS_39240 82305 82706 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229521.1 protein_id gnl|my_center|LOCUS_39240 82738 83124 gene locus_tag LOCUS_39250 82738 83124 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_39250 83775 83185 gene locus_tag LOCUS_39260 83775 83185 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_39260 84030 84347 gene locus_tag LOCUS_39270 84030 84347 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973611.1 protein_id gnl|my_center|LOCUS_39270 85087 84479 gene locus_tag LOCUS_39280 85087 84479 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084972.1 protein_id gnl|my_center|LOCUS_39280 86663 85167 gene locus_tag LOCUS_39290 86663 85167 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_39290 88259 86976 gene locus_tag LOCUS_39300 88259 86976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 89389 88730 gene locus_tag LOCUS_39310 gene nucS 89389 88730 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_39310 89456 91066 gene locus_tag LOCUS_39320 89456 91066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 91103 91438 gene locus_tag LOCUS_39330 91103 91438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_39330 91485 92189 gene locus_tag LOCUS_39340 91485 92189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 92244 93005 gene locus_tag LOCUS_39350 92244 93005 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_39350 94365 93046 gene locus_tag LOCUS_39360 94365 93046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 96021 94726 gene locus_tag LOCUS_39370 96021 94726 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068425.1 protein_id gnl|my_center|LOCUS_39370 96724 96296 gene locus_tag LOCUS_39380 gene mce 96724 96296 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 protein_id gnl|my_center|LOCUS_39380 96870 98108 gene locus_tag LOCUS_39390 96870 98108 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_39390 98401 98174 gene locus_tag LOCUS_39400 98401 98174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 98627 99808 gene locus_tag LOCUS_39410 98627 99808 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_39410 99805 100488 gene locus_tag LOCUS_39420 99805 100488 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_39420 101192 100503 gene locus_tag LOCUS_39430 101192 100503 CDS product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027353.1 protein_id gnl|my_center|LOCUS_39430 102720 101224 gene locus_tag LOCUS_39440 102720 101224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 103064 103699 gene locus_tag LOCUS_39450 103064 103699 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_39450 105521 103791 gene locus_tag LOCUS_39460 105521 103791 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229919.1 protein_id gnl|my_center|LOCUS_39460 105692 106651 gene locus_tag LOCUS_39470 105692 106651 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 protein_id gnl|my_center|LOCUS_39470 >Feature sequence027 166 1575 gene locus_tag LOCUS_39480 166 1575 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_39480 2391 1642 gene locus_tag LOCUS_39490 2391 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 2569 3147 gene locus_tag LOCUS_39500 2569 3147 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_39500 3752 3090 gene locus_tag LOCUS_39510 3752 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 3891 5462 gene locus_tag LOCUS_39520 3891 5462 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_39520 5560 5832 gene locus_tag LOCUS_39530 5560 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 6183 7139 gene locus_tag LOCUS_39540 6183 7139 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229676.1 protein_id gnl|my_center|LOCUS_39540 7393 7178 gene locus_tag LOCUS_39550 7393 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 7332 8549 gene locus_tag LOCUS_39560 7332 8549 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191309483.1 protein_id gnl|my_center|LOCUS_39560 8686 9366 gene locus_tag LOCUS_39570 8686 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 9571 11325 gene locus_tag LOCUS_39580 9571 11325 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975874.1 protein_id gnl|my_center|LOCUS_39580 11627 11971 gene locus_tag LOCUS_39590 11627 11971 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199254442.1 protein_id gnl|my_center|LOCUS_39590 12745 12170 gene locus_tag LOCUS_39600 12745 12170 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_39600 14157 12877 gene locus_tag LOCUS_39610 14157 12877 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_39610 14209 14499 gene locus_tag LOCUS_39620 gene clpS 14209 14499 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_39620 14502 15023 gene locus_tag LOCUS_39630 14502 15023 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_39630 15033 15443 gene locus_tag LOCUS_39640 15033 15443 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896304.1 protein_id gnl|my_center|LOCUS_39640 15727 16005 gene locus_tag LOCUS_39650 15727 16005 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 protein_id gnl|my_center|LOCUS_39650 16008 16955 gene locus_tag LOCUS_39660 16008 16955 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975900.1 protein_id gnl|my_center|LOCUS_39660 18770 17061 gene locus_tag LOCUS_39670 18770 17061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 19143 19934 gene locus_tag LOCUS_39680 19143 19934 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 protein_id gnl|my_center|LOCUS_39680 20067 20972 gene locus_tag LOCUS_39690 gene murI 20067 20972 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776024.1 protein_id gnl|my_center|LOCUS_39690 21156 21908 gene locus_tag LOCUS_39700 21156 21908 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_39700 21914 22630 gene locus_tag LOCUS_39710 gene rph 21914 22630 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_39710 22627 23232 gene locus_tag LOCUS_39720 gene rdgB 22627 23232 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_39720 23303 24991 gene locus_tag LOCUS_39730 23303 24991 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112402.1 protein_id gnl|my_center|LOCUS_39730 25582 26472 gene locus_tag LOCUS_39740 25582 26472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 26469 26795 gene locus_tag LOCUS_39750 26469 26795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 29414 26841 gene locus_tag LOCUS_39760 29414 26841 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_39760 30182 29418 gene locus_tag LOCUS_39770 30182 29418 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_39770 31225 30524 gene locus_tag LOCUS_39780 31225 30524 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 protein_id gnl|my_center|LOCUS_39780 32403 31222 gene locus_tag LOCUS_39790 32403 31222 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_39790 32884 32810 gene locus_tag LOCUS_t00370 32884 32810 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33412 32939 gene locus_tag LOCUS_39800 gene bcp 33412 32939 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_39800 33537 33872 gene locus_tag LOCUS_39810 33537 33872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 35064 33877 gene locus_tag LOCUS_39820 35064 33877 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027880.1 protein_id gnl|my_center|LOCUS_39820 37402 35108 gene locus_tag LOCUS_39830 37402 35108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 38938 37457 gene locus_tag LOCUS_39840 38938 37457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 39208 39414 gene locus_tag LOCUS_39850 39208 39414 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975194.1 protein_id gnl|my_center|LOCUS_39850 41041 39605 gene locus_tag LOCUS_39860 41041 39605 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404013.1 protein_id gnl|my_center|LOCUS_39860 41808 41413 gene locus_tag LOCUS_39870 41808 41413 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457988.1 protein_id gnl|my_center|LOCUS_39870 41992 42846 gene locus_tag LOCUS_39880 41992 42846 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028937.1 protein_id gnl|my_center|LOCUS_39880 42806 43003 gene locus_tag LOCUS_39890 42806 43003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 43000 43230 gene locus_tag LOCUS_39900 43000 43230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39900 46165 43511 gene locus_tag LOCUS_39910 46165 43511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 46620 46162 gene locus_tag LOCUS_39920 46620 46162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 46781 46617 gene locus_tag LOCUS_39930 46781 46617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 47191 46967 gene locus_tag LOCUS_39940 47191 46967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 48315 47440 gene locus_tag LOCUS_39950 48315 47440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 48366 49031 gene locus_tag LOCUS_39960 gene tetR(A) 48366 49031 CDS product tetracycline resistance transcriptional repressor TetR(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470728.1 protein_id gnl|my_center|LOCUS_39960 49063 49377 gene locus_tag LOCUS_39970 49063 49377 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262050.1 protein_id gnl|my_center|LOCUS_39970 49472 50668 gene locus_tag LOCUS_39980 49472 50668 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 protein_id gnl|my_center|LOCUS_39980 50665 51585 gene locus_tag LOCUS_39990 50665 51585 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_39990 51740 52123 gene locus_tag LOCUS_40000 51740 52123 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143935.1 protein_id gnl|my_center|LOCUS_40000 52155 53399 gene locus_tag LOCUS_40010 52155 53399 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525075.1 protein_id gnl|my_center|LOCUS_40010 54383 53511 gene locus_tag LOCUS_40020 54383 53511 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026999.1 protein_id gnl|my_center|LOCUS_40020 54454 55323 gene locus_tag LOCUS_40030 54454 55323 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227429.1 protein_id gnl|my_center|LOCUS_40030 55554 57143 gene locus_tag LOCUS_40040 55554 57143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 57411 58061 gene locus_tag LOCUS_40050 57411 58061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 59424 58048 gene locus_tag LOCUS_40060 59424 58048 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_40060 59366 59578 gene locus_tag LOCUS_40070 59366 59578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 60020 59631 gene locus_tag LOCUS_40080 gene gcvH 60020 59631 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 protein_id gnl|my_center|LOCUS_40080 61108 60017 gene locus_tag LOCUS_40090 gene gcvT 61108 60017 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 protein_id gnl|my_center|LOCUS_40090 62089 61358 gene locus_tag LOCUS_40100 62089 61358 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900586.1 protein_id gnl|my_center|LOCUS_40100 62864 62100 gene locus_tag LOCUS_40110 62864 62100 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_40110 64259 62916 gene locus_tag LOCUS_40120 64259 62916 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 protein_id gnl|my_center|LOCUS_40120 65669 64323 gene locus_tag LOCUS_40130 65669 64323 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876257.1 protein_id gnl|my_center|LOCUS_40130 65814 66536 gene locus_tag LOCUS_40140 65814 66536 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466719.1 protein_id gnl|my_center|LOCUS_40140 66606 67559 gene locus_tag LOCUS_40150 66606 67559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40150 67810 68004 gene locus_tag LOCUS_40160 67810 68004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 68392 69267 gene locus_tag LOCUS_40170 68392 69267 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978137.1 protein_id gnl|my_center|LOCUS_40170 69531 70226 gene locus_tag LOCUS_40180 69531 70226 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230982.1 protein_id gnl|my_center|LOCUS_40180 70288 71646 gene locus_tag LOCUS_40190 70288 71646 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_40190 72015 72863 gene locus_tag LOCUS_40200 72015 72863 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_40200 73133 74446 gene locus_tag LOCUS_40210 73133 74446 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_40210 74443 74781 gene locus_tag LOCUS_40220 74443 74781 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_40220 74786 77143 gene locus_tag LOCUS_40230 74786 77143 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_40230 77370 80714 gene locus_tag LOCUS_40240 77370 80714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 80761 81183 gene locus_tag LOCUS_40250 80761 81183 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_40250 81183 81542 gene locus_tag LOCUS_40260 81183 81542 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973454.1 protein_id gnl|my_center|LOCUS_40260 81523 82113 gene locus_tag LOCUS_40270 81523 82113 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_40270 83081 82095 gene locus_tag LOCUS_40280 83081 82095 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896728.1 protein_id gnl|my_center|LOCUS_40280 84169 83078 gene locus_tag LOCUS_40290 84169 83078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 84392 85525 gene locus_tag LOCUS_40300 84392 85525 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528946.1 protein_id gnl|my_center|LOCUS_40300 85536 86474 gene locus_tag LOCUS_40310 85536 86474 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528945.1 protein_id gnl|my_center|LOCUS_40310 86467 87240 gene locus_tag LOCUS_40320 86467 87240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528944.1 protein_id gnl|my_center|LOCUS_40320 87237 88295 gene locus_tag LOCUS_40330 87237 88295 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528943.1 protein_id gnl|my_center|LOCUS_40330 88984 88373 gene locus_tag LOCUS_40340 88984 88373 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730474.1 protein_id gnl|my_center|LOCUS_40340 89120 90412 gene locus_tag LOCUS_40350 89120 90412 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528942.1 protein_id gnl|my_center|LOCUS_40350 90475 91902 gene locus_tag LOCUS_40360 90475 91902 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877153.1 protein_id gnl|my_center|LOCUS_40360 92143 95304 gene locus_tag LOCUS_40370 92143 95304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 95301 95723 gene locus_tag LOCUS_40380 95301 95723 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_40380 95747 96214 gene locus_tag LOCUS_40390 95747 96214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 96195 96791 gene locus_tag LOCUS_40400 96195 96791 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_40400 97770 96925 gene locus_tag LOCUS_40410 97770 96925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230261.1 protein_id gnl|my_center|LOCUS_40410 98640 97780 gene locus_tag LOCUS_40420 98640 97780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230260.1 protein_id gnl|my_center|LOCUS_40420 99410 98637 gene locus_tag LOCUS_40430 99410 98637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 protein_id gnl|my_center|LOCUS_40430 100396 99407 gene locus_tag LOCUS_40440 100396 99407 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223278.1 protein_id gnl|my_center|LOCUS_40440 100944 104087 gene locus_tag LOCUS_40450 100944 104087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40450 >Feature sequence028 743 369 gene locus_tag LOCUS_40460 743 369 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 protein_id gnl|my_center|LOCUS_40460 943 740 gene locus_tag LOCUS_40470 943 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 1267 1037 gene locus_tag LOCUS_40480 1267 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 1690 1358 gene locus_tag LOCUS_40490 1690 1358 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227025.1 protein_id gnl|my_center|LOCUS_40490 3213 1996 gene locus_tag LOCUS_40500 3213 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 3374 3883 gene locus_tag LOCUS_40510 3374 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 4320 5945 gene locus_tag LOCUS_40520 4320 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 7862 6093 gene locus_tag LOCUS_40530 7862 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 9410 7998 gene locus_tag LOCUS_40540 9410 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 9850 10437 gene locus_tag LOCUS_40550 9850 10437 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893780.1 protein_id gnl|my_center|LOCUS_40550 11776 10568 gene locus_tag LOCUS_40560 11776 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 12398 12060 gene locus_tag LOCUS_40570 12398 12060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 12565 12807 gene locus_tag LOCUS_40580 12565 12807 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028299.1 protein_id gnl|my_center|LOCUS_40580 13451 14509 gene locus_tag LOCUS_40590 13451 14509 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030823.1 protein_id gnl|my_center|LOCUS_40590 14729 15409 gene locus_tag LOCUS_40600 14729 15409 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870668.1 protein_id gnl|my_center|LOCUS_40600 16607 15444 gene locus_tag LOCUS_40610 16607 15444 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 protein_id gnl|my_center|LOCUS_40610 17491 16604 gene locus_tag LOCUS_40620 17491 16604 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866806.1 protein_id gnl|my_center|LOCUS_40620 18046 17504 gene locus_tag LOCUS_40630 18046 17504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 18108 18380 gene locus_tag LOCUS_40640 18108 18380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 18509 19468 gene locus_tag LOCUS_40650 18509 19468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 20729 19473 gene locus_tag LOCUS_40660 20729 19473 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410039.1 protein_id gnl|my_center|LOCUS_40660 22714 20810 gene locus_tag LOCUS_40670 22714 20810 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093101.1 protein_id gnl|my_center|LOCUS_40670 22933 23127 gene locus_tag LOCUS_40680 22933 23127 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_40680 23870 23241 gene locus_tag LOCUS_40690 23870 23241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 24673 24221 gene locus_tag LOCUS_40700 24673 24221 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929291.1 protein_id gnl|my_center|LOCUS_40700 24998 25396 gene locus_tag LOCUS_40710 24998 25396 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230403.1 protein_id gnl|my_center|LOCUS_40710 25543 26874 gene locus_tag LOCUS_40720 25543 26874 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027670.1 protein_id gnl|my_center|LOCUS_40720 26871 27893 gene locus_tag LOCUS_40730 26871 27893 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977390.1 protein_id gnl|my_center|LOCUS_40730 27949 29274 gene locus_tag LOCUS_40740 27949 29274 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039282280.1 protein_id gnl|my_center|LOCUS_40740 29486 30886 gene locus_tag LOCUS_40750 29486 30886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 31115 31783 gene locus_tag LOCUS_40760 31115 31783 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_40760 31919 33352 gene locus_tag LOCUS_40770 gene gndA 31919 33352 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222331.1 protein_id gnl|my_center|LOCUS_40770 33461 34288 gene locus_tag LOCUS_40780 33461 34288 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226473.1 protein_id gnl|my_center|LOCUS_40780 34396 35358 gene locus_tag LOCUS_40790 34396 35358 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225858.1 protein_id gnl|my_center|LOCUS_40790 35376 36134 gene locus_tag LOCUS_40800 35376 36134 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225859.1 protein_id gnl|my_center|LOCUS_40800 36173 37324 gene locus_tag LOCUS_40810 36173 37324 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225860.1 protein_id gnl|my_center|LOCUS_40810 37392 39113 gene locus_tag LOCUS_40820 37392 39113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 39110 40126 gene locus_tag LOCUS_40830 39110 40126 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225862.1 protein_id gnl|my_center|LOCUS_40830 41705 40527 gene locus_tag LOCUS_40840 41705 40527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 41941 42435 gene locus_tag LOCUS_40850 41941 42435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 42432 42761 gene locus_tag LOCUS_40860 42432 42761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 42922 44097 gene locus_tag LOCUS_40870 42922 44097 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043778558.1 protein_id gnl|my_center|LOCUS_40870 44269 45675 gene locus_tag LOCUS_40880 44269 45675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 45729 48068 gene locus_tag LOCUS_40890 45729 48068 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108688.1 protein_id gnl|my_center|LOCUS_40890 48203 49258 gene locus_tag LOCUS_40900 48203 49258 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_40900 49255 50112 gene locus_tag LOCUS_40910 49255 50112 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_40910 50109 50966 gene locus_tag LOCUS_40920 50109 50966 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223442.1 protein_id gnl|my_center|LOCUS_40920 50966 51373 gene locus_tag LOCUS_40930 50966 51373 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259066.1 protein_id gnl|my_center|LOCUS_40930 51527 53023 gene locus_tag LOCUS_40940 51527 53023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 53217 53411 gene locus_tag LOCUS_40950 53217 53411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 53557 54513 gene locus_tag LOCUS_40960 53557 54513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326561.1 protein_id gnl|my_center|LOCUS_40960 54668 55054 gene locus_tag LOCUS_40970 54668 55054 CDS product SCO5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973607.1 protein_id gnl|my_center|LOCUS_40970 55443 56093 gene locus_tag LOCUS_40980 55443 56093 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028564.1 protein_id gnl|my_center|LOCUS_40980 57133 56651 gene locus_tag LOCUS_40990 57133 56651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 57507 60596 gene locus_tag LOCUS_41000 gene afsR 57507 60596 CDS product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 protein_id gnl|my_center|LOCUS_41000 61000 61305 gene locus_tag LOCUS_41010 61000 61305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 62255 61302 gene locus_tag LOCUS_41020 62255 61302 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107014379.1 protein_id gnl|my_center|LOCUS_41020 62359 63393 gene locus_tag LOCUS_41030 62359 63393 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723784.1 protein_id gnl|my_center|LOCUS_41030 65085 63481 gene locus_tag LOCUS_41040 65085 63481 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231020.1 protein_id gnl|my_center|LOCUS_41040 66291 65701 gene locus_tag LOCUS_41050 66291 65701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 66962 66390 gene locus_tag LOCUS_41060 66962 66390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 67016 67522 gene locus_tag LOCUS_41070 67016 67522 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965898.1 protein_id gnl|my_center|LOCUS_41070 68218 67565 gene locus_tag LOCUS_41080 68218 67565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 68331 69209 gene locus_tag LOCUS_41090 68331 69209 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_41090 69459 70658 gene locus_tag LOCUS_41100 69459 70658 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_41100 71143 70751 gene locus_tag LOCUS_41110 71143 70751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 72242 71538 gene locus_tag LOCUS_41120 72242 71538 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224587.1 protein_id gnl|my_center|LOCUS_41120 72417 73793 gene locus_tag LOCUS_41130 72417 73793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 75257 74193 gene locus_tag LOCUS_41140 75257 74193 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_41140 76567 75293 gene locus_tag LOCUS_41150 76567 75293 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_41150 77330 76800 gene locus_tag LOCUS_41160 77330 76800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 77922 77323 gene locus_tag LOCUS_41170 gene recR 77922 77323 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_41170 78275 77928 gene locus_tag LOCUS_41180 78275 77928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 80815 78626 gene locus_tag LOCUS_41190 80815 78626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 81134 81220 gene locus_tag LOCUS_t00380 81134 81220 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 81812 81465 gene locus_tag LOCUS_41200 81812 81465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 82113 82985 gene locus_tag LOCUS_41210 82113 82985 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222195.1 protein_id gnl|my_center|LOCUS_41210 83055 83393 gene locus_tag LOCUS_41220 83055 83393 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412258.1 protein_id gnl|my_center|LOCUS_41220 83579 84100 gene locus_tag LOCUS_41230 83579 84100 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229692.1 protein_id gnl|my_center|LOCUS_41230 84351 84262 gene locus_tag LOCUS_t00390 84351 84262 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 84857 84423 gene locus_tag LOCUS_41240 gene tadA 84857 84423 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_41240 85442 84951 gene locus_tag LOCUS_41250 85442 84951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 85948 85460 gene locus_tag LOCUS_41260 85948 85460 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112944.1 protein_id gnl|my_center|LOCUS_41260 86126 86764 gene locus_tag LOCUS_41270 gene upp 86126 86764 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_41270 86898 87116 gene locus_tag LOCUS_41280 86898 87116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 87186 87389 gene locus_tag LOCUS_41290 87186 87389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 87386 87913 gene locus_tag LOCUS_41300 87386 87913 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095467.1 protein_id gnl|my_center|LOCUS_41300 88047 89387 gene locus_tag LOCUS_41310 88047 89387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 89494 90183 gene locus_tag LOCUS_41320 89494 90183 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728586.1 protein_id gnl|my_center|LOCUS_41320 91373 90279 gene locus_tag LOCUS_41330 gene dnaN 91373 90279 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_41330 92131 91478 gene locus_tag LOCUS_41340 92131 91478 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028204.1 protein_id gnl|my_center|LOCUS_41340 93630 92128 gene locus_tag LOCUS_41350 93630 92128 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028203.1 protein_id gnl|my_center|LOCUS_41350 93758 94675 gene locus_tag LOCUS_41360 93758 94675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_41360 94685 95467 gene locus_tag LOCUS_41370 94685 95467 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221994.1 protein_id gnl|my_center|LOCUS_41370 95546 96127 gene locus_tag LOCUS_41380 95546 96127 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_41380 96272 97024 gene locus_tag LOCUS_41390 96272 97024 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223839.1 protein_id gnl|my_center|LOCUS_41390 97132 98013 gene locus_tag LOCUS_41400 97132 98013 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226808.1 protein_id gnl|my_center|LOCUS_41400 100809 98176 gene locus_tag LOCUS_41410 100809 98176 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400547.1 protein_id gnl|my_center|LOCUS_41410 101114 102424 gene locus_tag LOCUS_41420 101114 102424 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_41420 103209 102448 gene locus_tag LOCUS_41430 103209 102448 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 protein_id gnl|my_center|LOCUS_41430 104087 103206 gene locus_tag LOCUS_41440 104087 103206 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053659.1 protein_id gnl|my_center|LOCUS_41440 104971 104084 gene locus_tag LOCUS_41450 104971 104084 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_41450 105606 105160 gene locus_tag LOCUS_41460 gene rplI 105606 105160 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_41460 105861 105625 gene locus_tag LOCUS_41470 gene rpsR 105861 105625 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_41470 106499 105936 gene locus_tag LOCUS_41480 106499 105936 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231003.1 protein_id gnl|my_center|LOCUS_41480 106892 106602 gene locus_tag LOCUS_41490 gene rpsF 106892 106602 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_41490 107137 107445 gene locus_tag LOCUS_41500 107137 107445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975026.1 protein_id gnl|my_center|LOCUS_41500 107725 107540 gene locus_tag LOCUS_41510 107725 107540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 107825 108580 gene locus_tag LOCUS_41520 107825 108580 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467888.1 protein_id gnl|my_center|LOCUS_41520 109804 108671 gene locus_tag LOCUS_41530 109804 108671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 111213 109864 gene locus_tag LOCUS_41540 111213 109864 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_41540 114103 111227 gene locus_tag LOCUS_41550 114103 111227 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943963.1 protein_id gnl|my_center|LOCUS_41550 114611 114201 gene locus_tag LOCUS_41560 114611 114201 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323592.1 protein_id gnl|my_center|LOCUS_41560 114780 115436 gene locus_tag LOCUS_41570 114780 115436 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_41570 115450 116529 gene locus_tag LOCUS_41580 115450 116529 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_41580 117308 116736 gene locus_tag LOCUS_41590 gene idi 117308 116736 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898999.1 protein_id gnl|my_center|LOCUS_41590 117595 118893 gene locus_tag LOCUS_41600 117595 118893 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 protein_id gnl|my_center|LOCUS_41600 120412 119141 gene locus_tag LOCUS_41610 120412 119141 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224093.1 protein_id gnl|my_center|LOCUS_41610 122026 120623 gene locus_tag LOCUS_41620 122026 120623 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_41620 122209 122718 gene locus_tag LOCUS_41630 122209 122718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 122833 125046 gene locus_tag LOCUS_41640 122833 125046 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231053.1 protein_id gnl|my_center|LOCUS_41640 125043 126656 gene locus_tag LOCUS_41650 125043 126656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 126944 128449 gene locus_tag LOCUS_41660 126944 128449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 128463 129107 gene locus_tag LOCUS_41670 gene sigM 128463 129107 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_41670 129097 130185 gene locus_tag LOCUS_41680 129097 130185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 130421 131374 gene locus_tag LOCUS_41690 gene trxB 130421 131374 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_41690 131387 131710 gene locus_tag LOCUS_41700 gene trxA 131387 131710 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_41700 132687 132016 gene locus_tag LOCUS_41710 132687 132016 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975043.1 protein_id gnl|my_center|LOCUS_41710 132723 132953 gene locus_tag LOCUS_41720 132723 132953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 133041 134366 gene locus_tag LOCUS_41730 133041 134366 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_41730 134450 135403 gene locus_tag LOCUS_41740 134450 135403 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_41740 135434 136489 gene locus_tag LOCUS_41750 135434 136489 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_41750 136994 136587 gene locus_tag LOCUS_41760 136994 136587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 138300 137335 gene locus_tag LOCUS_41770 138300 137335 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_41770 139410 138460 gene locus_tag LOCUS_41780 139410 138460 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225439919.1 protein_id gnl|my_center|LOCUS_41780 140231 139542 gene locus_tag LOCUS_41790 gene rsmG 140231 139542 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_41790 141165 140665 gene locus_tag LOCUS_41800 141165 140665 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_41800 142156 141194 gene locus_tag LOCUS_41810 142156 141194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 142514 142161 gene locus_tag LOCUS_41820 142514 142161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 142903 142511 gene locus_tag LOCUS_41830 gene rnpA 142903 142511 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 protein_id gnl|my_center|LOCUS_41830 143145 143008 gene locus_tag LOCUS_41840 gene rpmH 143145 143008 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_41840 143762 145798 gene locus_tag LOCUS_41850 gene dnaA 143762 145798 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029287.1 protein_id gnl|my_center|LOCUS_41850 146389 147522 gene locus_tag LOCUS_41860 gene dnaN 146389 147522 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_41860 147616 148560 gene locus_tag LOCUS_41870 gene gnd 147616 148560 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029286.1 protein_id gnl|my_center|LOCUS_41870 148786 150027 gene locus_tag LOCUS_41880 gene recF 148786 150027 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_41880 150017 150544 gene locus_tag LOCUS_41890 150017 150544 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975057.1 protein_id gnl|my_center|LOCUS_41890 150902 152845 gene locus_tag LOCUS_41900 gene gyrB 150902 152845 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_41900 152898 155396 gene locus_tag LOCUS_41910 gene gyrA 152898 155396 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_41910 155673 155401 gene locus_tag LOCUS_41920 155673 155401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 155606 156391 gene locus_tag LOCUS_41930 155606 156391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 156551 156627 gene locus_tag LOCUS_t00400 156551 156627 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 156818 156690 gene locus_tag LOCUS_41940 156818 156690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 157060 156878 gene locus_tag LOCUS_41950 157060 156878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 157920 157447 gene locus_tag LOCUS_41960 157920 157447 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029549.1 protein_id gnl|my_center|LOCUS_41960 159625 160269 gene locus_tag LOCUS_41970 159625 160269 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226773.1 protein_id gnl|my_center|LOCUS_41970 161597 160368 gene locus_tag LOCUS_41980 161597 160368 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_41980 162805 161612 gene locus_tag LOCUS_41990 162805 161612 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 protein_id gnl|my_center|LOCUS_41990 163227 164381 gene locus_tag LOCUS_42000 gene lysS 163227 164381 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320019.1 protein_id gnl|my_center|LOCUS_42000 164412 164597 gene locus_tag LOCUS_42010 164412 164597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 164606 165457 gene locus_tag LOCUS_42020 gene lysX 164606 165457 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229004.1 protein_id gnl|my_center|LOCUS_42020 165454 166509 gene locus_tag LOCUS_42030 gene argC 165454 166509 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978134.1 protein_id gnl|my_center|LOCUS_42030 166506 167315 gene locus_tag LOCUS_42040 166506 167315 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256974.1 protein_id gnl|my_center|LOCUS_42040 167367 167948 gene locus_tag LOCUS_42050 167367 167948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 168013 169128 gene locus_tag LOCUS_42060 168013 169128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 169125 170762 gene locus_tag LOCUS_42070 169125 170762 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729559.1 protein_id gnl|my_center|LOCUS_42070 170830 172131 gene locus_tag LOCUS_42080 170830 172131 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485736.1 protein_id gnl|my_center|LOCUS_42080 172196 173092 gene locus_tag LOCUS_42090 172196 173092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 173563 173123 gene locus_tag LOCUS_42100 173563 173123 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043782036.1 protein_id gnl|my_center|LOCUS_42100 173628 174836 gene locus_tag LOCUS_42110 173628 174836 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182893188.1 protein_id gnl|my_center|LOCUS_42110 175345 177564 gene locus_tag LOCUS_42120 175345 177564 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_42120 178390 177596 gene locus_tag LOCUS_42130 178390 177596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 179249 178377 gene locus_tag LOCUS_42140 179249 178377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 182554 179246 gene locus_tag LOCUS_42150 182554 179246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 182763 182551 gene locus_tag LOCUS_42160 182763 182551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 184729 182915 gene locus_tag LOCUS_42170 184729 182915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 185947 184805 gene locus_tag LOCUS_42180 185947 184805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 187238 186609 gene locus_tag LOCUS_42190 187238 186609 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027667.1 protein_id gnl|my_center|LOCUS_42190 187594 188673 gene locus_tag LOCUS_42200 187594 188673 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845572.1 protein_id gnl|my_center|LOCUS_42200 189859 188684 gene locus_tag LOCUS_42210 189859 188684 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084375.1 protein_id gnl|my_center|LOCUS_42210 190023 190943 gene locus_tag LOCUS_42220 190023 190943 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225528.1 protein_id gnl|my_center|LOCUS_42220 191873 190950 gene locus_tag LOCUS_42230 191873 190950 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030936.1 protein_id gnl|my_center|LOCUS_42230 192683 191877 gene locus_tag LOCUS_42240 192683 191877 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731143.1 protein_id gnl|my_center|LOCUS_42240 193962 192787 gene locus_tag LOCUS_42250 193962 192787 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201056.1 protein_id gnl|my_center|LOCUS_42250 194078 195040 gene locus_tag LOCUS_42260 194078 195040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 196105 195128 gene locus_tag LOCUS_42270 gene axeA 196105 195128 CDS product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 protein_id gnl|my_center|LOCUS_42270 196604 196996 gene locus_tag LOCUS_42280 196604 196996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 197245 197364 gene locus_tag LOCUS_42290 197245 197364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 197424 198149 gene locus_tag LOCUS_42300 197424 198149 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084718.1 protein_id gnl|my_center|LOCUS_42300 198165 198240 gene locus_tag LOCUS_t00410 198165 198240 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 199356 198676 gene locus_tag LOCUS_42310 199356 198676 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086031.1 protein_id gnl|my_center|LOCUS_42310 199399 200652 gene locus_tag LOCUS_42320 199399 200652 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037380.1 protein_id gnl|my_center|LOCUS_42320 200770 200958 gene locus_tag LOCUS_42330 200770 200958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 202010 201108 gene locus_tag LOCUS_42340 202010 201108 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030266.1 protein_id gnl|my_center|LOCUS_42340 202857 202249 gene locus_tag LOCUS_42350 202857 202249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 203035 203982 gene locus_tag LOCUS_42360 gene sigJ 203035 203982 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226028235.1 protein_id gnl|my_center|LOCUS_42360 204065 205261 gene locus_tag LOCUS_42370 204065 205261 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 protein_id gnl|my_center|LOCUS_42370 207237 205528 gene locus_tag LOCUS_42380 207237 205528 CDS product glycoside hydrolase family 30 beta sandwich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224121.1 protein_id gnl|my_center|LOCUS_42380 207771 209000 gene locus_tag LOCUS_42390 207771 209000 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975925.1 protein_id gnl|my_center|LOCUS_42390 209567 209049 gene locus_tag LOCUS_42400 209567 209049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 210108 209776 gene locus_tag LOCUS_42410 210108 209776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 >Feature sequence029 1768 689 gene locus_tag LOCUS_42420 1768 689 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_42420 2159 1806 gene locus_tag LOCUS_42430 2159 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 3144 2437 gene locus_tag LOCUS_42440 3144 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 4694 3306 gene locus_tag LOCUS_42450 4694 3306 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229300.1 protein_id gnl|my_center|LOCUS_42450 4838 5239 gene locus_tag LOCUS_42460 4838 5239 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972102.1 protein_id gnl|my_center|LOCUS_42460 6686 5409 gene locus_tag LOCUS_42470 6686 5409 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_42470 7111 6692 gene locus_tag LOCUS_42480 7111 6692 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056128.1 protein_id gnl|my_center|LOCUS_42480 8435 7167 gene locus_tag LOCUS_42490 8435 7167 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 protein_id gnl|my_center|LOCUS_42490 9612 8476 gene locus_tag LOCUS_42500 9612 8476 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222770.1 protein_id gnl|my_center|LOCUS_42500 11210 9609 gene locus_tag LOCUS_42510 11210 9609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974086.1 protein_id gnl|my_center|LOCUS_42510 12519 11440 gene locus_tag LOCUS_42520 12519 11440 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222768.1 protein_id gnl|my_center|LOCUS_42520 13996 12755 gene locus_tag LOCUS_42530 13996 12755 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029925.1 protein_id gnl|my_center|LOCUS_42530 15164 13983 gene locus_tag LOCUS_42540 15164 13983 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 protein_id gnl|my_center|LOCUS_42540 15607 15392 gene locus_tag LOCUS_42550 15607 15392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 15696 16841 gene locus_tag LOCUS_42560 15696 16841 CDS product DUF5136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486558.1 protein_id gnl|my_center|LOCUS_42560 17790 16849 gene locus_tag LOCUS_42570 17790 16849 CDS product YhjD/YihY/BrkB family envelope integrity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224425.1 protein_id gnl|my_center|LOCUS_42570 18930 17926 gene locus_tag LOCUS_42580 gene trpS 18930 17926 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_42580 20334 19006 gene locus_tag LOCUS_42590 20334 19006 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113973.1 protein_id gnl|my_center|LOCUS_42590 20480 21442 gene locus_tag LOCUS_42600 gene galE 20480 21442 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975676.1 protein_id gnl|my_center|LOCUS_42600 22245 21361 gene locus_tag LOCUS_42610 22245 21361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 24596 22392 gene locus_tag LOCUS_42620 24596 22392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 25302 24892 gene locus_tag LOCUS_42630 25302 24892 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727828.1 protein_id gnl|my_center|LOCUS_42630 26669 25452 gene locus_tag LOCUS_42640 26669 25452 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532148.1 protein_id gnl|my_center|LOCUS_42640 27050 26775 gene locus_tag LOCUS_42650 27050 26775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 28158 27037 gene locus_tag LOCUS_42660 gene citZ 28158 27037 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903548.1 protein_id gnl|my_center|LOCUS_42660 28341 28991 gene locus_tag LOCUS_42670 28341 28991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 29207 29713 gene locus_tag LOCUS_42680 29207 29713 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 protein_id gnl|my_center|LOCUS_42680 30134 29796 gene locus_tag LOCUS_42690 30134 29796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 31660 30260 gene locus_tag LOCUS_42700 31660 30260 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228608.1 protein_id gnl|my_center|LOCUS_42700 31803 31651 gene locus_tag LOCUS_42710 31803 31651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 35018 31959 gene locus_tag LOCUS_42720 35018 31959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 35276 35109 gene locus_tag LOCUS_42730 35276 35109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 35958 35503 gene locus_tag LOCUS_42740 35958 35503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 37506 36841 gene locus_tag LOCUS_42750 37506 36841 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971593.1 protein_id gnl|my_center|LOCUS_42750 37505 38455 gene locus_tag LOCUS_42760 37505 38455 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898125.1 protein_id gnl|my_center|LOCUS_42760 39114 38566 gene locus_tag LOCUS_42770 39114 38566 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030960.1 protein_id gnl|my_center|LOCUS_42770 39230 39757 gene locus_tag LOCUS_42780 39230 39757 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027861.1 protein_id gnl|my_center|LOCUS_42780 40102 40338 gene locus_tag LOCUS_42790 40102 40338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 41031 42086 gene locus_tag LOCUS_42800 41031 42086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 42761 42225 gene locus_tag LOCUS_42810 42761 42225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 43343 42876 gene locus_tag LOCUS_42820 43343 42876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 43771 45165 gene locus_tag LOCUS_42830 43771 45165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 46516 45233 gene locus_tag LOCUS_42840 46516 45233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 47372 51436 gene locus_tag LOCUS_42850 47372 51436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 51766 53121 gene locus_tag LOCUS_42860 51766 53121 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_42860 54024 53173 gene locus_tag LOCUS_42870 54024 53173 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893053.1 protein_id gnl|my_center|LOCUS_42870 54837 54103 gene locus_tag LOCUS_42880 54837 54103 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112385.1 protein_id gnl|my_center|LOCUS_42880 56603 55056 gene locus_tag LOCUS_42890 gene purH 56603 55056 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222720.1 protein_id gnl|my_center|LOCUS_42890 57265 56600 gene locus_tag LOCUS_42900 gene purN 57265 56600 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_42900 57409 57768 gene locus_tag LOCUS_42910 57409 57768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 57882 58193 gene locus_tag LOCUS_42920 57882 58193 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036285.1 protein_id gnl|my_center|LOCUS_42920 60045 58210 gene locus_tag LOCUS_42930 60045 58210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 61403 60510 gene locus_tag LOCUS_42940 gene sucD 61403 60510 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222716.1 protein_id gnl|my_center|LOCUS_42940 62581 61403 gene locus_tag LOCUS_42950 gene sucC 62581 61403 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222715.1 protein_id gnl|my_center|LOCUS_42950 62913 63806 gene locus_tag LOCUS_42960 62913 63806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 66167 63903 gene locus_tag LOCUS_42970 gene pcrA 66167 63903 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_42970 66442 67170 gene locus_tag LOCUS_42980 66442 67170 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_42980 68039 67134 gene locus_tag LOCUS_42990 68039 67134 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899053.1 protein_id gnl|my_center|LOCUS_42990 68752 68039 gene locus_tag LOCUS_43000 68752 68039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 69605 68958 gene locus_tag LOCUS_43010 69605 68958 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_43010 70824 69637 gene locus_tag LOCUS_43020 70824 69637 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 protein_id gnl|my_center|LOCUS_43020 70958 72817 gene locus_tag LOCUS_43030 70958 72817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 72804 72983 gene locus_tag LOCUS_43040 72804 72983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 73054 73506 gene locus_tag LOCUS_43050 73054 73506 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223540.1 protein_id gnl|my_center|LOCUS_43050 73899 74390 gene locus_tag LOCUS_43060 73899 74390 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_43060 74387 76792 gene locus_tag LOCUS_43070 74387 76792 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_43070 76929 77900 gene locus_tag LOCUS_43080 76929 77900 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_43080 79053 78163 gene locus_tag LOCUS_43090 79053 78163 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976846.1 protein_id gnl|my_center|LOCUS_43090 79374 80243 gene locus_tag LOCUS_43100 79374 80243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 81513 80413 gene locus_tag LOCUS_43110 81513 80413 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120625.1 protein_id gnl|my_center|LOCUS_43110 81607 82083 gene locus_tag LOCUS_43120 81607 82083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 82416 82114 gene locus_tag LOCUS_43130 82416 82114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 82590 83504 gene locus_tag LOCUS_43140 82590 83504 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731219.1 protein_id gnl|my_center|LOCUS_43140 83914 84609 gene locus_tag LOCUS_43150 83914 84609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43150 84600 85046 gene locus_tag LOCUS_43160 84600 85046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 85791 85438 gene locus_tag LOCUS_43170 85791 85438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 87219 85792 gene locus_tag LOCUS_43180 87219 85792 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039073.1 protein_id gnl|my_center|LOCUS_43180 89075 87453 gene locus_tag LOCUS_43190 89075 87453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 89398 89970 gene locus_tag LOCUS_43200 89398 89970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 91634 90402 gene locus_tag LOCUS_43210 91634 90402 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223766.1 protein_id gnl|my_center|LOCUS_43210 92703 91879 gene locus_tag LOCUS_43220 92703 91879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 93194 92700 gene locus_tag LOCUS_43230 93194 92700 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495205.1 protein_id gnl|my_center|LOCUS_43230 95503 93821 gene locus_tag LOCUS_43240 95503 93821 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028251.1 protein_id gnl|my_center|LOCUS_43240 95775 98606 gene locus_tag LOCUS_43250 95775 98606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 98615 99676 gene locus_tag LOCUS_43260 98615 99676 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039954.1 protein_id gnl|my_center|LOCUS_43260 100764 99697 gene locus_tag LOCUS_43270 100764 99697 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_43270 100676 100879 gene locus_tag LOCUS_43280 100676 100879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 102411 100768 gene locus_tag LOCUS_43290 102411 100768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 102837 102646 gene locus_tag LOCUS_43300 102837 102646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 102827 103432 gene locus_tag LOCUS_43310 102827 103432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 103688 103918 gene locus_tag LOCUS_43320 103688 103918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 104501 103983 gene locus_tag LOCUS_43330 104501 103983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 105868 104498 gene locus_tag LOCUS_43340 105868 104498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 107821 106271 gene locus_tag LOCUS_43350 gene guaA 107821 106271 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_43350 108020 110170 gene locus_tag LOCUS_43360 108020 110170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 112174 110366 gene locus_tag LOCUS_43370 112174 110366 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_43370 113282 112512 gene locus_tag LOCUS_43380 113282 112512 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027539.1 protein_id gnl|my_center|LOCUS_43380 113402 114418 gene locus_tag LOCUS_43390 113402 114418 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007446839.1 protein_id gnl|my_center|LOCUS_43390 114415 115551 gene locus_tag LOCUS_43400 gene nagA 114415 115551 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 protein_id gnl|my_center|LOCUS_43400 116736 115618 gene locus_tag LOCUS_43410 116736 115618 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_43410 116778 116954 gene locus_tag LOCUS_43420 116778 116954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 118463 116985 gene locus_tag LOCUS_43430 gene guaB 118463 116985 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222684.1 protein_id gnl|my_center|LOCUS_43430 118927 119304 gene locus_tag LOCUS_43440 118927 119304 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003073549.1 protein_id gnl|my_center|LOCUS_43440 119474 119265 gene locus_tag LOCUS_43450 119474 119265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 120109 119471 gene locus_tag LOCUS_43460 120109 119471 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974204.1 protein_id gnl|my_center|LOCUS_43460 122041 120419 gene locus_tag LOCUS_43470 gene groL 122041 120419 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_43470 122459 122148 gene locus_tag LOCUS_43480 gene groES 122459 122148 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418028.1 protein_id gnl|my_center|LOCUS_43480 122738 123934 gene locus_tag LOCUS_43490 122738 123934 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_43490 124147 125802 gene locus_tag LOCUS_43500 124147 125802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 126873 125842 gene locus_tag LOCUS_43510 gene tsaD 126873 125842 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_43510 127337 126873 gene locus_tag LOCUS_43520 gene rimI 127337 126873 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_43520 128008 127334 gene locus_tag LOCUS_43530 gene tsaB 128008 127334 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_43530 128708 128157 gene locus_tag LOCUS_43540 128708 128157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 129448 128732 gene locus_tag LOCUS_43550 129448 128732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 130016 129561 gene locus_tag LOCUS_43560 gene tsaE 130016 129561 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_43560 131547 130150 gene locus_tag LOCUS_43570 131547 130150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 132703 131561 gene locus_tag LOCUS_43580 gene alr 132703 131561 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_43580 134235 132733 gene locus_tag LOCUS_43590 134235 132733 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_43590 134675 134325 gene locus_tag LOCUS_43600 134675 134325 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_43600 134792 135715 gene locus_tag LOCUS_43610 gene coaA 134792 135715 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974235.1 protein_id gnl|my_center|LOCUS_43610 135751 136728 gene locus_tag LOCUS_43620 135751 136728 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466857.1 protein_id gnl|my_center|LOCUS_43620 136865 137779 gene locus_tag LOCUS_43630 136865 137779 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_43630 137772 138674 gene locus_tag LOCUS_43640 137772 138674 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182524933.1 protein_id gnl|my_center|LOCUS_43640 138671 139588 gene locus_tag LOCUS_43650 138671 139588 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_43650 139653 140369 gene locus_tag LOCUS_43660 139653 140369 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974984.1 protein_id gnl|my_center|LOCUS_43660 140504 141898 gene locus_tag LOCUS_43670 140504 141898 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225941.1 protein_id gnl|my_center|LOCUS_43670 145451 141906 gene locus_tag LOCUS_43680 145451 141906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 146026 145676 gene locus_tag LOCUS_43690 146026 145676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 146182 146730 gene locus_tag LOCUS_43700 146182 146730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 148331 146970 gene locus_tag LOCUS_43710 gene glmM 148331 146970 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_43710 148849 148328 gene locus_tag LOCUS_43720 gene rpsI 148849 148328 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_43720 149346 148903 gene locus_tag LOCUS_43730 gene rplM 149346 148903 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_43730 149674 150489 gene locus_tag LOCUS_43740 149674 150489 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027196.1 protein_id gnl|my_center|LOCUS_43740 150525 152738 gene locus_tag LOCUS_43750 150525 152738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 152849 157936 gene locus_tag LOCUS_43760 152849 157936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 159025 157940 gene locus_tag LOCUS_43770 gene truA 159025 157940 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_43770 160200 159673 gene locus_tag LOCUS_43780 gene rplQ 160200 159673 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776350.1 protein_id gnl|my_center|LOCUS_43780 161444 160428 gene locus_tag LOCUS_43790 161444 160428 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_43790 162193 161567 gene locus_tag LOCUS_43800 gene rpsD 162193 161567 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 protein_id gnl|my_center|LOCUS_43800 162618 162214 gene locus_tag LOCUS_43810 gene rpsK 162618 162214 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_43810 163092 162712 gene locus_tag LOCUS_43820 gene rpsM 163092 162712 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908646.1 protein_id gnl|my_center|LOCUS_43820 163753 163532 gene locus_tag LOCUS_43830 gene infA 163753 163532 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_43830 164771 164307 gene locus_tag LOCUS_43840 164771 164307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 165399 164956 gene locus_tag LOCUS_43850 165399 164956 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190249366.1 protein_id gnl|my_center|LOCUS_43850 166302 165472 gene locus_tag LOCUS_43860 gene map 166302 165472 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_43860 167093 166440 gene locus_tag LOCUS_43870 167093 166440 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_43870 168400 167093 gene locus_tag LOCUS_43880 gene secY 168400 167093 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_43880 169042 168569 gene locus_tag LOCUS_43890 gene rplO 169042 168569 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_43890 169227 169045 gene locus_tag LOCUS_43900 gene rpmD 169227 169045 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776359.1 protein_id gnl|my_center|LOCUS_43900 169863 169231 gene locus_tag LOCUS_43910 gene rpsE 169863 169231 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_43910 170293 169913 gene locus_tag LOCUS_43920 gene rplR 170293 169913 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130474831.1 protein_id gnl|my_center|LOCUS_43920 170838 170296 gene locus_tag LOCUS_43930 gene rplF 170838 170296 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_43930 171255 170857 gene locus_tag LOCUS_43940 gene rpsH 171255 170857 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_43940 171614 171429 gene locus_tag LOCUS_43950 171614 171429 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_43950 172189 171614 gene locus_tag LOCUS_43960 gene rplE 172189 171614 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_43960 172497 172189 gene locus_tag LOCUS_43970 172497 172189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 172866 172498 gene locus_tag LOCUS_43980 gene rplN 172866 172498 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_43980 173301 173017 gene locus_tag LOCUS_43990 gene rpsQ 173301 173017 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_43990 173530 173294 gene locus_tag LOCUS_44000 gene rpmC 173530 173294 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_44000 173949 173530 gene locus_tag LOCUS_44010 gene rplP 173949 173530 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558864.1 protein_id gnl|my_center|LOCUS_44010 174794 173952 gene locus_tag LOCUS_44020 174794 173952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 175162 174794 gene locus_tag LOCUS_44030 gene rplV 175162 174794 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974262.1 protein_id gnl|my_center|LOCUS_44030 175467 175189 gene locus_tag LOCUS_44040 gene rpsS 175467 175189 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974263.1 protein_id gnl|my_center|LOCUS_44040 176315 175479 gene locus_tag LOCUS_44050 gene rplB 176315 175479 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_44050 176663 176361 gene locus_tag LOCUS_44060 gene rplW 176663 176361 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403581.1 protein_id gnl|my_center|LOCUS_44060 177313 176663 gene locus_tag LOCUS_44070 gene rplD 177313 176663 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_44070 177963 177310 gene locus_tag LOCUS_44080 gene rplC 177963 177310 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_44080 178286 177978 gene locus_tag LOCUS_44090 gene rpsJ 178286 177978 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_44090 179749 178556 gene locus_tag LOCUS_44100 gene tuf 179749 178556 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_44100 182026 179927 gene locus_tag LOCUS_44110 gene fusA 182026 179927 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974302.1 protein_id gnl|my_center|LOCUS_44110 182536 182066 gene locus_tag LOCUS_44120 gene rpsG 182536 182066 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776385.1 protein_id gnl|my_center|LOCUS_44120 182912 182538 gene locus_tag LOCUS_44130 gene rpsL 182912 182538 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_44130 185826 183427 gene locus_tag LOCUS_44140 185826 183427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 186941 185811 gene locus_tag LOCUS_44150 gene pdhA 186941 185811 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467649.1 protein_id gnl|my_center|LOCUS_44150 188032 186938 gene locus_tag LOCUS_44160 gene ala 188032 186938 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_44160 189450 188086 gene locus_tag LOCUS_44170 189450 188086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 190680 189478 gene locus_tag LOCUS_44180 190680 189478 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224970.1 protein_id gnl|my_center|LOCUS_44180 191995 190727 gene locus_tag LOCUS_44190 191995 190727 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228024.1 protein_id gnl|my_center|LOCUS_44190 193276 192035 gene locus_tag LOCUS_44200 193276 192035 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228024.1 protein_id gnl|my_center|LOCUS_44200 195155 193302 gene locus_tag LOCUS_44210 195155 193302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44210 195985 195233 gene locus_tag LOCUS_44220 195985 195233 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552045.1 protein_id gnl|my_center|LOCUS_44220 197243 196047 gene locus_tag LOCUS_44230 197243 196047 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224970.1 protein_id gnl|my_center|LOCUS_44230 197546 197325 gene locus_tag LOCUS_44240 197546 197325 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975599.1 protein_id gnl|my_center|LOCUS_44240 207236 197589 gene locus_tag LOCUS_44250 207236 197589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44250 <210186 207240 gene locus_tag LOCUS_44260 <210186 207240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028843.1:non-ribosomal peptide synthetase note possible pseudo, internal stop codon, frameshifted >Feature sequence030 237 2315 gene locus_tag LOCUS_44270 237 2315 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730837.1 protein_id gnl|my_center|LOCUS_44270 2312 3319 gene locus_tag LOCUS_44280 gene mgrA 2312 3319 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_44280 5951 3396 gene locus_tag LOCUS_44290 5951 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 6340 8364 gene locus_tag LOCUS_44300 6340 8364 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256905.1 protein_id gnl|my_center|LOCUS_44300 8849 8400 gene locus_tag LOCUS_44310 8849 8400 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530753.1 protein_id gnl|my_center|LOCUS_44310 9172 9624 gene locus_tag LOCUS_44320 9172 9624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 10042 9677 gene locus_tag LOCUS_44330 10042 9677 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 protein_id gnl|my_center|LOCUS_44330 10304 10855 gene locus_tag LOCUS_44340 10304 10855 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230397.1 protein_id gnl|my_center|LOCUS_44340 10852 11556 gene locus_tag LOCUS_44350 10852 11556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 11828 13273 gene locus_tag LOCUS_44360 11828 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 13392 15215 gene locus_tag LOCUS_44370 13392 15215 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112395.1 protein_id gnl|my_center|LOCUS_44370 15392 15616 gene locus_tag LOCUS_44380 15392 15616 CDS product DUF6458 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975139.1 protein_id gnl|my_center|LOCUS_44380 16109 15816 gene locus_tag LOCUS_44390 16109 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 16690 16481 gene locus_tag LOCUS_44400 16690 16481 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_44400 16857 17384 gene locus_tag LOCUS_44410 16857 17384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 19594 17402 gene locus_tag LOCUS_44420 19594 17402 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_44420 20138 19629 gene locus_tag LOCUS_44430 20138 19629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 21118 20135 gene locus_tag LOCUS_44440 21118 20135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 22191 21214 gene locus_tag LOCUS_44450 22191 21214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_44450 22496 22359 gene locus_tag LOCUS_44460 22496 22359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 24241 22751 gene locus_tag LOCUS_44470 24241 22751 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_44470 25231 24254 gene locus_tag LOCUS_44480 25231 24254 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_44480 26328 25228 gene locus_tag LOCUS_44490 gene pdhA 26328 25228 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_44490 26902 27150 gene locus_tag LOCUS_44500 gene purS 26902 27150 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 protein_id gnl|my_center|LOCUS_44500 27321 27761 gene locus_tag LOCUS_44510 27321 27761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 27973 28521 gene locus_tag LOCUS_44520 27973 28521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 29145 28678 gene locus_tag LOCUS_44530 29145 28678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 31083 29146 gene locus_tag LOCUS_44540 31083 29146 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911742.1 protein_id gnl|my_center|LOCUS_44540 32637 31306 gene locus_tag LOCUS_44550 32637 31306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 32849 33199 gene locus_tag LOCUS_44560 32849 33199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 33423 33869 gene locus_tag LOCUS_44570 33423 33869 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865215.1 protein_id gnl|my_center|LOCUS_44570 33954 34607 gene locus_tag LOCUS_44580 33954 34607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 34588 35037 gene locus_tag LOCUS_44590 34588 35037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 35583 36266 gene locus_tag LOCUS_44600 gene purQ 35583 36266 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_44600 36329 38584 gene locus_tag LOCUS_44610 gene purL 36329 38584 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_44610 38903 41203 gene locus_tag LOCUS_44620 38903 41203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 41326 42009 gene locus_tag LOCUS_44630 41326 42009 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227881.1 protein_id gnl|my_center|LOCUS_44630 42124 43626 gene locus_tag LOCUS_44640 42124 43626 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392514.1 protein_id gnl|my_center|LOCUS_44640 43874 43653 gene locus_tag LOCUS_44650 43874 43653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 43762 44835 gene locus_tag LOCUS_44660 43762 44835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 44957 44724 gene locus_tag LOCUS_44670 44957 44724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 44987 46252 gene locus_tag LOCUS_44680 44987 46252 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_44680 46285 46725 gene locus_tag LOCUS_44690 46285 46725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 47378 46767 gene locus_tag LOCUS_44700 47378 46767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 47572 49086 gene locus_tag LOCUS_44710 gene purF 47572 49086 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_44710 49083 50132 gene locus_tag LOCUS_44720 gene purM 49083 50132 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974885.1 protein_id gnl|my_center|LOCUS_44720 50842 50618 gene locus_tag LOCUS_44730 50842 50618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 52096 50993 gene locus_tag LOCUS_44740 52096 50993 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029424.1 protein_id gnl|my_center|LOCUS_44740 52289 53170 gene locus_tag LOCUS_44750 52289 53170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974882.1 protein_id gnl|my_center|LOCUS_44750 53492 53695 gene locus_tag LOCUS_44760 gene bldC 53492 53695 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_44760 54584 53958 gene locus_tag LOCUS_44770 54584 53958 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976592.1 protein_id gnl|my_center|LOCUS_44770 54830 55933 gene locus_tag LOCUS_44780 54830 55933 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_44780 55979 56326 gene locus_tag LOCUS_44790 55979 56326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 56413 57267 gene locus_tag LOCUS_44800 56413 57267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 57312 59024 gene locus_tag LOCUS_44810 57312 59024 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_44810 60134 59049 gene locus_tag LOCUS_44820 60134 59049 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 protein_id gnl|my_center|LOCUS_44820 61002 60298 gene locus_tag LOCUS_44830 61002 60298 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228330.1 protein_id gnl|my_center|LOCUS_44830 63698 61611 gene locus_tag LOCUS_44840 63698 61611 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876865.1 protein_id gnl|my_center|LOCUS_44840 63865 64377 gene locus_tag LOCUS_44850 63865 64377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 64495 64986 gene locus_tag LOCUS_44860 64495 64986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 65041 65982 gene locus_tag LOCUS_44870 65041 65982 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027325.1 protein_id gnl|my_center|LOCUS_44870 66162 66848 gene locus_tag LOCUS_44880 66162 66848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 68330 66903 gene locus_tag LOCUS_44890 68330 66903 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_44890 69368 68619 gene locus_tag LOCUS_44900 69368 68619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 70820 69603 gene locus_tag LOCUS_44910 70820 69603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 71993 71172 gene locus_tag LOCUS_44920 71993 71172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 72184 73308 gene locus_tag LOCUS_44930 72184 73308 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259168.1 protein_id gnl|my_center|LOCUS_44930 74342 73698 gene locus_tag LOCUS_44940 74342 73698 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_44940 75498 74335 gene locus_tag LOCUS_44950 75498 74335 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870027.1 protein_id gnl|my_center|LOCUS_44950 76197 75502 gene locus_tag LOCUS_44960 76197 75502 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221994.1 protein_id gnl|my_center|LOCUS_44960 77102 76209 gene locus_tag LOCUS_44970 77102 76209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_44970 78404 77508 gene locus_tag LOCUS_44980 78404 77508 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225296.1 protein_id gnl|my_center|LOCUS_44980 79326 78397 gene locus_tag LOCUS_44990 79326 78397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229405.1 protein_id gnl|my_center|LOCUS_44990 80206 79397 gene locus_tag LOCUS_45000 80206 79397 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225297.1 protein_id gnl|my_center|LOCUS_45000 80792 80716 gene locus_tag LOCUS_t00420 80792 80716 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 81522 80815 gene locus_tag LOCUS_45010 81522 80815 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254069.1 protein_id gnl|my_center|LOCUS_45010 81430 81669 gene locus_tag LOCUS_45020 81430 81669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 82037 83290 gene locus_tag LOCUS_45030 82037 83290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 83672 84754 gene locus_tag LOCUS_45040 83672 84754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 84954 85889 gene locus_tag LOCUS_45050 84954 85889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 85847 86371 gene locus_tag LOCUS_45060 85847 86371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 86443 88401 gene locus_tag LOCUS_45070 86443 88401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 89272 89502 gene locus_tag LOCUS_45080 89272 89502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 91202 89847 gene locus_tag LOCUS_45090 91202 89847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 91464 92201 gene locus_tag LOCUS_45100 91464 92201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45100 92302 92102 gene locus_tag LOCUS_45110 92302 92102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 92335 92994 gene locus_tag LOCUS_45120 92335 92994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45120 93336 93112 gene locus_tag LOCUS_45130 93336 93112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 93355 94047 gene locus_tag LOCUS_45140 93355 94047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45140 94986 94090 gene locus_tag LOCUS_45150 94986 94090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 95181 95105 gene locus_tag LOCUS_t00430 95181 95105 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 95282 95207 gene locus_tag LOCUS_t00440 95282 95207 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 95463 95390 gene locus_tag LOCUS_t00450 95463 95390 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 97200 95548 gene locus_tag LOCUS_45160 97200 95548 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974879.1 protein_id gnl|my_center|LOCUS_45160 97363 97704 gene locus_tag LOCUS_45170 97363 97704 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_45170 97955 99247 gene locus_tag LOCUS_45180 97955 99247 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847962.1 protein_id gnl|my_center|LOCUS_45180 99759 99244 gene locus_tag LOCUS_45190 99759 99244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 99950 100023 gene locus_tag LOCUS_t00460 99950 100023 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 101313 100342 gene locus_tag LOCUS_45200 101313 100342 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229677.1 protein_id gnl|my_center|LOCUS_45200 102008 101433 gene locus_tag LOCUS_45210 102008 101433 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870827.1 protein_id gnl|my_center|LOCUS_45210 104198 102255 gene locus_tag LOCUS_45220 104198 102255 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040688119.1 protein_id gnl|my_center|LOCUS_45220 105692 107260 gene locus_tag LOCUS_45230 105692 107260 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792662.1 protein_id gnl|my_center|LOCUS_45230 107257 108798 gene locus_tag LOCUS_45240 107257 108798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 108844 109344 gene locus_tag LOCUS_45250 108844 109344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 109370 110152 gene locus_tag LOCUS_45260 109370 110152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 110192 110650 gene locus_tag LOCUS_45270 110192 110650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 110647 111195 gene locus_tag LOCUS_45280 110647 111195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 111317 112069 gene locus_tag LOCUS_45290 111317 112069 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104409.1 protein_id gnl|my_center|LOCUS_45290 112789 112133 gene locus_tag LOCUS_45300 112789 112133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 113053 113586 gene locus_tag LOCUS_45310 113053 113586 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027345.1 protein_id gnl|my_center|LOCUS_45310 113657 114052 gene locus_tag LOCUS_45320 113657 114052 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028904.1 protein_id gnl|my_center|LOCUS_45320 114797 114126 gene locus_tag LOCUS_45330 114797 114126 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027267.1 protein_id gnl|my_center|LOCUS_45330 116050 115157 gene locus_tag LOCUS_45340 116050 115157 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064366.1 protein_id gnl|my_center|LOCUS_45340 116316 117698 gene locus_tag LOCUS_45350 116316 117698 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_45350 119115 118162 gene locus_tag LOCUS_45360 119115 118162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 119478 121355 gene locus_tag LOCUS_45370 119478 121355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929086.1 protein_id gnl|my_center|LOCUS_45370 121352 123250 gene locus_tag LOCUS_45380 121352 123250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142714.1 protein_id gnl|my_center|LOCUS_45380 123678 123322 gene locus_tag LOCUS_45390 123678 123322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 123913 124539 gene locus_tag LOCUS_45400 123913 124539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226912.1 protein_id gnl|my_center|LOCUS_45400 124886 125425 gene locus_tag LOCUS_45410 124886 125425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 125580 126329 gene locus_tag LOCUS_45420 125580 126329 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029507.1 protein_id gnl|my_center|LOCUS_45420 126455 126823 gene locus_tag LOCUS_45430 126455 126823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 128568 127126 gene locus_tag LOCUS_45440 128568 127126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 128812 129402 gene locus_tag LOCUS_45450 128812 129402 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_45450 129458 130810 gene locus_tag LOCUS_45460 129458 130810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 130807 131202 gene locus_tag LOCUS_45470 130807 131202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 131805 131515 gene locus_tag LOCUS_45480 131805 131515 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726761.1 protein_id gnl|my_center|LOCUS_45480 132920 131838 gene locus_tag LOCUS_45490 132920 131838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 133723 132917 gene locus_tag LOCUS_45500 133723 132917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 136198 134051 gene locus_tag LOCUS_45510 136198 134051 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226200.1 protein_id gnl|my_center|LOCUS_45510 137124 136375 gene locus_tag LOCUS_45520 137124 136375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 137953 137138 gene locus_tag LOCUS_45530 137953 137138 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_45530 138081 138779 gene locus_tag LOCUS_45540 138081 138779 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223868.1 protein_id gnl|my_center|LOCUS_45540 138865 139245 gene locus_tag LOCUS_45550 138865 139245 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973561.1 protein_id gnl|my_center|LOCUS_45550 139242 139556 gene locus_tag LOCUS_45560 gene trxA 139242 139556 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_45560 139617 141050 gene locus_tag LOCUS_45570 gene radA 139617 141050 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_45570 141086 142192 gene locus_tag LOCUS_45580 gene disA 141086 142192 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_45580 142324 142476 gene locus_tag LOCUS_45590 142324 142476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 143181 142501 gene locus_tag LOCUS_45600 143181 142501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 144163 143297 gene locus_tag LOCUS_45610 144163 143297 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_45610 145307 144363 gene locus_tag LOCUS_45620 145307 144363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 148252 145769 gene locus_tag LOCUS_45630 148252 145769 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_45630 148963 148628 gene locus_tag LOCUS_45640 148963 148628 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_45640 149231 149082 gene locus_tag LOCUS_45650 149231 149082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 150247 149519 gene locus_tag LOCUS_45660 150247 149519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 151712 150414 gene locus_tag LOCUS_45670 151712 150414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 152374 151829 gene locus_tag LOCUS_45680 152374 151829 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057157.1 protein_id gnl|my_center|LOCUS_45680 152955 154028 gene locus_tag LOCUS_45690 152955 154028 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_45690 154362 154114 gene locus_tag LOCUS_45700 154362 154114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 155733 154948 gene locus_tag LOCUS_45710 155733 154948 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_45710 158282 155730 gene locus_tag LOCUS_45720 158282 155730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 159430 158408 gene locus_tag LOCUS_45730 gene panC 159430 158408 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731036.1 protein_id gnl|my_center|LOCUS_45730 160484 159594 gene locus_tag LOCUS_45740 160484 159594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 160876 160625 gene locus_tag LOCUS_45750 160876 160625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 160906 161895 gene locus_tag LOCUS_45760 160906 161895 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_45760 163105 161903 gene locus_tag LOCUS_45770 163105 161903 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_45770 164111 163287 gene locus_tag LOCUS_45780 164111 163287 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_45780 164613 164305 gene locus_tag LOCUS_45790 164613 164305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 164692 166233 gene locus_tag LOCUS_45800 164692 166233 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028165.1 protein_id gnl|my_center|LOCUS_45800 166650 167822 gene locus_tag LOCUS_45810 166650 167822 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_45810 168928 168473 gene locus_tag LOCUS_45820 168928 168473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 169749 169243 gene locus_tag LOCUS_45830 gene folK 169749 169243 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_45830 170105 169746 gene locus_tag LOCUS_45840 gene folB 170105 169746 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 protein_id gnl|my_center|LOCUS_45840 170630 170190 gene locus_tag LOCUS_45850 170630 170190 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 protein_id gnl|my_center|LOCUS_45850 171460 170627 gene locus_tag LOCUS_45860 gene folP 171460 170627 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_45860 172327 171740 gene locus_tag LOCUS_45870 gene folE 172327 171740 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_45870 174352 172331 gene locus_tag LOCUS_45880 gene ftsH 174352 172331 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_45880 175192 174635 gene locus_tag LOCUS_45890 gene hpt 175192 174635 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_45890 176216 175206 gene locus_tag LOCUS_45900 gene tilS 176216 175206 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_45900 177377 176277 gene locus_tag LOCUS_45910 177377 176277 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_45910 178794 177397 gene locus_tag LOCUS_45920 178794 177397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 178895 179437 gene locus_tag LOCUS_45930 178895 179437 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_45930 180294 179626 gene locus_tag LOCUS_45940 180294 179626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 181085 180432 gene locus_tag LOCUS_45950 181085 180432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 182556 181069 gene locus_tag LOCUS_45960 182556 181069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 184183 182912 gene locus_tag LOCUS_45970 184183 182912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 185061 184180 gene locus_tag LOCUS_45980 185061 184180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 186705 185095 gene locus_tag LOCUS_45990 186705 185095 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_45990 188262 186856 gene locus_tag LOCUS_46000 188262 186856 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_46000 188767 189252 gene locus_tag LOCUS_46010 188767 189252 CDS product MSMEG_6728 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467217.1 protein_id gnl|my_center|LOCUS_46010 189698 191035 gene locus_tag LOCUS_46020 189698 191035 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020638993.1 protein_id gnl|my_center|LOCUS_46020 192229 191255 gene locus_tag LOCUS_46030 192229 191255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 193518 192358 gene locus_tag LOCUS_46040 193518 192358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 194042 193515 gene locus_tag LOCUS_46050 194042 193515 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973087.1 protein_id gnl|my_center|LOCUS_46050 194462 194277 gene locus_tag LOCUS_46060 194462 194277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 194811 195686 gene locus_tag LOCUS_46070 194811 195686 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_46070 195939 195742 gene locus_tag LOCUS_46080 195939 195742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 196044 197081 gene locus_tag LOCUS_46090 196044 197081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 197078 199315 gene locus_tag LOCUS_46100 197078 199315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 199353 200237 gene locus_tag LOCUS_46110 199353 200237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 200234 201496 gene locus_tag LOCUS_46120 200234 201496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 201507 202889 gene locus_tag LOCUS_46130 201507 202889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 203040 203675 gene locus_tag LOCUS_46140 203040 203675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 >Feature sequence031 1264 869 gene locus_tag LOCUS_46150 1264 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 1318 1920 gene locus_tag LOCUS_46160 1318 1920 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229714.1 protein_id gnl|my_center|LOCUS_46160 2124 1924 gene locus_tag LOCUS_46170 2124 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 3079 2450 gene locus_tag LOCUS_46180 3079 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 3324 3722 gene locus_tag LOCUS_46190 3324 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 4961 3801 gene locus_tag LOCUS_46200 4961 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 4852 5148 gene locus_tag LOCUS_46210 4852 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 6464 6120 gene locus_tag LOCUS_46220 6464 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 7719 6544 gene locus_tag LOCUS_46230 gene menE 7719 6544 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216843435.1 protein_id gnl|my_center|LOCUS_46230 7843 9498 gene locus_tag LOCUS_46240 gene menD 7843 9498 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466562.1 protein_id gnl|my_center|LOCUS_46240 9578 10267 gene locus_tag LOCUS_46250 9578 10267 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977513.1 protein_id gnl|my_center|LOCUS_46250 10482 10234 gene locus_tag LOCUS_46260 10482 10234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_46260 10634 10900 gene locus_tag LOCUS_46270 10634 10900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 11989 11039 gene locus_tag LOCUS_46280 11989 11039 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225603.1 protein_id gnl|my_center|LOCUS_46280 12126 13544 gene locus_tag LOCUS_46290 12126 13544 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485352.1 protein_id gnl|my_center|LOCUS_46290 15037 13808 gene locus_tag LOCUS_46300 15037 13808 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 protein_id gnl|my_center|LOCUS_46300 15295 16161 gene locus_tag LOCUS_46310 15295 16161 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976414.1 protein_id gnl|my_center|LOCUS_46310 17536 16190 gene locus_tag LOCUS_46320 17536 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 18082 18294 gene locus_tag LOCUS_46330 18082 18294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 18307 18606 gene locus_tag LOCUS_46340 18307 18606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 19127 18522 gene locus_tag LOCUS_46350 19127 18522 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_46350 20461 19331 gene locus_tag LOCUS_46360 20461 19331 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028268.1 protein_id gnl|my_center|LOCUS_46360 21389 20664 gene locus_tag LOCUS_46370 21389 20664 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028267.1 protein_id gnl|my_center|LOCUS_46370 22375 21389 gene locus_tag LOCUS_46380 22375 21389 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028266.1 protein_id gnl|my_center|LOCUS_46380 23524 22502 gene locus_tag LOCUS_46390 23524 22502 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258491.1 protein_id gnl|my_center|LOCUS_46390 23787 23581 gene locus_tag LOCUS_46400 23787 23581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 23675 24256 gene locus_tag LOCUS_46410 23675 24256 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038433.1 protein_id gnl|my_center|LOCUS_46410 24952 24293 gene locus_tag LOCUS_46420 24952 24293 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223180.1 protein_id gnl|my_center|LOCUS_46420 26055 24949 gene locus_tag LOCUS_46430 26055 24949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 27530 26052 gene locus_tag LOCUS_46440 27530 26052 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026469007.1 protein_id gnl|my_center|LOCUS_46440 31319 27672 gene locus_tag LOCUS_46450 31319 27672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 31777 31637 gene locus_tag LOCUS_46460 31777 31637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 32968 31934 gene locus_tag LOCUS_46470 32968 31934 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_46470 33032 32963 gene locus_tag LOCUS_t00470 33032 32963 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33118 33396 gene locus_tag LOCUS_46480 33118 33396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 35307 33670 gene locus_tag LOCUS_46490 35307 33670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 36184 35522 gene locus_tag LOCUS_46500 36184 35522 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_46500 36592 37902 gene locus_tag LOCUS_46510 36592 37902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 38037 38216 gene locus_tag LOCUS_46520 38037 38216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 38715 38344 gene locus_tag LOCUS_46530 38715 38344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 39577 38879 gene locus_tag LOCUS_46540 39577 38879 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972430.1 protein_id gnl|my_center|LOCUS_46540 39826 40725 gene locus_tag LOCUS_46550 39826 40725 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227572.1 protein_id gnl|my_center|LOCUS_46550 41242 41640 gene locus_tag LOCUS_46560 41242 41640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 41757 42332 gene locus_tag LOCUS_46570 41757 42332 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031671.1 protein_id gnl|my_center|LOCUS_46570 42402 42611 gene locus_tag LOCUS_46580 42402 42611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 43639 42653 gene locus_tag LOCUS_46590 43639 42653 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073632.1 protein_id gnl|my_center|LOCUS_46590 44231 43668 gene locus_tag LOCUS_46600 44231 43668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 44739 44359 gene locus_tag LOCUS_46610 44739 44359 CDS product SchA/CurD-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227245.1 protein_id gnl|my_center|LOCUS_46610 45488 44847 gene locus_tag LOCUS_46620 45488 44847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 46023 45553 gene locus_tag LOCUS_46630 46023 45553 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973657.1 protein_id gnl|my_center|LOCUS_46630 46293 46042 gene locus_tag LOCUS_46640 46293 46042 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973889.1 protein_id gnl|my_center|LOCUS_46640 47577 46333 gene locus_tag LOCUS_46650 47577 46333 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182663097.1 protein_id gnl|my_center|LOCUS_46650 48934 47570 gene locus_tag LOCUS_46660 48934 47570 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227255.1 protein_id gnl|my_center|LOCUS_46660 49350 48931 gene locus_tag LOCUS_46670 49350 48931 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227256.1 protein_id gnl|my_center|LOCUS_46670 49672 49343 gene locus_tag LOCUS_46680 49672 49343 CDS product TcmI family type II polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227257.1 protein_id gnl|my_center|LOCUS_46680 52016 50070 gene locus_tag LOCUS_46690 52016 50070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 52500 54191 gene locus_tag LOCUS_46700 52500 54191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 54376 54852 gene locus_tag LOCUS_46710 54376 54852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 54885 56240 gene locus_tag LOCUS_46720 gene accC 54885 56240 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259259.1 protein_id gnl|my_center|LOCUS_46720 57227 56586 gene locus_tag LOCUS_46730 57227 56586 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_46730 58468 57224 gene locus_tag LOCUS_46740 58468 57224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 59952 58552 gene locus_tag LOCUS_46750 59952 58552 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_46750 60495 61832 gene locus_tag LOCUS_46760 60495 61832 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230367.1 protein_id gnl|my_center|LOCUS_46760 63102 62119 gene locus_tag LOCUS_46770 63102 62119 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_46770 64142 63345 gene locus_tag LOCUS_46780 64142 63345 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087125.1 protein_id gnl|my_center|LOCUS_46780 64814 64365 gene locus_tag LOCUS_46790 64814 64365 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137312206.1 protein_id gnl|my_center|LOCUS_46790 64944 68141 gene locus_tag LOCUS_46800 64944 68141 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224450.1 protein_id gnl|my_center|LOCUS_46800 68167 69594 gene locus_tag LOCUS_46810 gene purB 68167 69594 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_46810 70149 69697 gene locus_tag LOCUS_46820 70149 69697 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_46820 71224 70631 gene locus_tag LOCUS_46830 71224 70631 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226186.1 protein_id gnl|my_center|LOCUS_46830 71922 71311 gene locus_tag LOCUS_46840 71922 71311 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_46840 72154 71978 gene locus_tag LOCUS_46850 72154 71978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 72996 72403 gene locus_tag LOCUS_46860 72996 72403 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284050.1 protein_id gnl|my_center|LOCUS_46860 73070 73567 gene locus_tag LOCUS_46870 73070 73567 CDS product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978065.1 protein_id gnl|my_center|LOCUS_46870 73964 73497 gene locus_tag LOCUS_46880 73964 73497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 75859 74171 gene locus_tag LOCUS_46890 75859 74171 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030693.1 protein_id gnl|my_center|LOCUS_46890 75764 76021 gene locus_tag LOCUS_46900 75764 76021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 76147 77187 gene locus_tag LOCUS_46910 76147 77187 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775736.1 protein_id gnl|my_center|LOCUS_46910 78343 77339 gene locus_tag LOCUS_46920 78343 77339 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222236.1 protein_id gnl|my_center|LOCUS_46920 79406 78390 gene locus_tag LOCUS_46930 79406 78390 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414689.1 protein_id gnl|my_center|LOCUS_46930 80605 79565 gene locus_tag LOCUS_46940 80605 79565 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226556.1 protein_id gnl|my_center|LOCUS_46940 82972 81908 gene locus_tag LOCUS_46950 82972 81908 CDS product ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031466.1 protein_id gnl|my_center|LOCUS_46950 84189 83290 gene locus_tag LOCUS_46960 84189 83290 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226696.1 protein_id gnl|my_center|LOCUS_46960 84431 84916 gene locus_tag LOCUS_46970 84431 84916 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467392.1 protein_id gnl|my_center|LOCUS_46970 84926 86113 gene locus_tag LOCUS_46980 84926 86113 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973241.1 protein_id gnl|my_center|LOCUS_46980 86274 88544 gene locus_tag LOCUS_46990 gene metE 86274 88544 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405914.1 protein_id gnl|my_center|LOCUS_46990 89137 88760 gene locus_tag LOCUS_47000 89137 88760 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226694.1 protein_id gnl|my_center|LOCUS_47000 89595 89143 gene locus_tag LOCUS_47010 89595 89143 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891554.1 protein_id gnl|my_center|LOCUS_47010 90469 89753 gene locus_tag LOCUS_47020 90469 89753 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891775.1 protein_id gnl|my_center|LOCUS_47020 90605 91204 gene locus_tag LOCUS_47030 90605 91204 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891774.1 protein_id gnl|my_center|LOCUS_47030 91206 92582 gene locus_tag LOCUS_47040 91206 92582 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223067.1 protein_id gnl|my_center|LOCUS_47040 93367 92636 gene locus_tag LOCUS_47050 93367 92636 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021273.1 protein_id gnl|my_center|LOCUS_47050 93639 94412 gene locus_tag LOCUS_47060 93639 94412 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410019.1 protein_id gnl|my_center|LOCUS_47060 96768 94453 gene locus_tag LOCUS_47070 96768 94453 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729203.1 protein_id gnl|my_center|LOCUS_47070 97372 96818 gene locus_tag LOCUS_47080 97372 96818 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028699.1 protein_id gnl|my_center|LOCUS_47080 97406 97714 gene locus_tag LOCUS_47090 97406 97714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47090 97959 97771 gene locus_tag LOCUS_47100 97959 97771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 97951 98880 gene locus_tag LOCUS_47110 97951 98880 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_47110 98880 99662 gene locus_tag LOCUS_47120 98880 99662 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_47120 99668 100483 gene locus_tag LOCUS_47130 99668 100483 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_47130 100601 101308 gene locus_tag LOCUS_47140 100601 101308 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226990.1 protein_id gnl|my_center|LOCUS_47140 101549 102535 gene locus_tag LOCUS_47150 101549 102535 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_47150 104344 102686 gene locus_tag LOCUS_47160 104344 102686 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225252.1 protein_id gnl|my_center|LOCUS_47160 105339 104347 gene locus_tag LOCUS_47170 105339 104347 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224988.1 protein_id gnl|my_center|LOCUS_47170 105460 106137 gene locus_tag LOCUS_47180 105460 106137 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873188.1 protein_id gnl|my_center|LOCUS_47180 106788 106321 gene locus_tag LOCUS_47190 106788 106321 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47190 109423 107279 gene locus_tag LOCUS_47200 gene helR 109423 107279 CDS product RNA polymerase recycling motor ATPase HelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728199.1 protein_id gnl|my_center|LOCUS_47200 110448 110002 gene locus_tag LOCUS_47210 110448 110002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 111856 110636 gene locus_tag LOCUS_47220 111856 110636 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496011.1 protein_id gnl|my_center|LOCUS_47220 114614 112395 gene locus_tag LOCUS_47230 114614 112395 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_47230 114783 116138 gene locus_tag LOCUS_47240 114783 116138 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 protein_id gnl|my_center|LOCUS_47240 116311 117645 gene locus_tag LOCUS_47250 116311 117645 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228643.1 protein_id gnl|my_center|LOCUS_47250 117939 117646 gene locus_tag LOCUS_47260 117939 117646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 118676 118149 gene locus_tag LOCUS_47270 118676 118149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 118771 121020 gene locus_tag LOCUS_47280 118771 121020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 121024 121278 gene locus_tag LOCUS_47290 121024 121278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 121287 121943 gene locus_tag LOCUS_47300 121287 121943 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742128.1 protein_id gnl|my_center|LOCUS_47300 122045 122386 gene locus_tag LOCUS_47310 122045 122386 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921019.1 protein_id gnl|my_center|LOCUS_47310 123308 122481 gene locus_tag LOCUS_47320 123308 122481 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114809.1 protein_id gnl|my_center|LOCUS_47320 124298 123339 gene locus_tag LOCUS_47330 124298 123339 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805167.1 protein_id gnl|my_center|LOCUS_47330 125390 124608 gene locus_tag LOCUS_47340 125390 124608 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229360.1 protein_id gnl|my_center|LOCUS_47340 127826 125463 gene locus_tag LOCUS_47350 127826 125463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 126436 126362 gene locus_tag LOCUS_t00480 126436 126362 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 128319 127987 gene locus_tag LOCUS_47360 128319 127987 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_47360 128528 128316 gene locus_tag LOCUS_47370 128528 128316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 128776 128525 gene locus_tag LOCUS_47380 128776 128525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 129938 128952 gene locus_tag LOCUS_47390 129938 128952 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967883.1 protein_id gnl|my_center|LOCUS_47390 130677 130090 gene locus_tag LOCUS_47400 130677 130090 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225839.1 protein_id gnl|my_center|LOCUS_47400 131673 130804 gene locus_tag LOCUS_47410 131673 130804 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978631.1 protein_id gnl|my_center|LOCUS_47410 131863 132624 gene locus_tag LOCUS_47420 131863 132624 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978630.1 protein_id gnl|my_center|LOCUS_47420 133130 132726 gene locus_tag LOCUS_47430 133130 132726 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225181.1 protein_id gnl|my_center|LOCUS_47430 133447 133127 gene locus_tag LOCUS_47440 133447 133127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 133994 133641 gene locus_tag LOCUS_47450 133994 133641 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031460.1 protein_id gnl|my_center|LOCUS_47450 134050 134811 gene locus_tag LOCUS_47460 134050 134811 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971996.1 protein_id gnl|my_center|LOCUS_47460 135123 136358 gene locus_tag LOCUS_47470 135123 136358 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726720.1 protein_id gnl|my_center|LOCUS_47470 136939 136565 gene locus_tag LOCUS_47480 136939 136565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265779.1 protein_id gnl|my_center|LOCUS_47480 137295 137765 gene locus_tag LOCUS_47490 137295 137765 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286038.1 protein_id gnl|my_center|LOCUS_47490 138491 137922 gene locus_tag LOCUS_47500 138491 137922 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_47500 138708 138574 gene locus_tag LOCUS_47510 138708 138574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 141072 139063 gene locus_tag LOCUS_47520 141072 139063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 145048 141137 gene locus_tag LOCUS_47530 145048 141137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 146106 145537 gene locus_tag LOCUS_47540 146106 145537 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_47540 146942 146208 gene locus_tag LOCUS_47550 146942 146208 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533133.1 protein_id gnl|my_center|LOCUS_47550 147332 148750 gene locus_tag LOCUS_47560 147332 148750 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529494.1 protein_id gnl|my_center|LOCUS_47560 148747 149697 gene locus_tag LOCUS_47570 148747 149697 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528078.1 protein_id gnl|my_center|LOCUS_47570 149697 150608 gene locus_tag LOCUS_47580 149697 150608 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034858202.1 protein_id gnl|my_center|LOCUS_47580 150608 151675 gene locus_tag LOCUS_47590 150608 151675 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211523.1 protein_id gnl|my_center|LOCUS_47590 151675 152751 gene locus_tag LOCUS_47600 gene ugpC 151675 152751 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972908.1 protein_id gnl|my_center|LOCUS_47600 152775 152942 gene locus_tag LOCUS_47610 152775 152942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 153019 154479 gene locus_tag LOCUS_47620 153019 154479 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031393.1 protein_id gnl|my_center|LOCUS_47620 154476 154739 gene locus_tag LOCUS_47630 154476 154739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 154741 155976 gene locus_tag LOCUS_47640 154741 155976 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970145.1 protein_id gnl|my_center|LOCUS_47640 157979 156270 gene locus_tag LOCUS_47650 157979 156270 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803883.1 protein_id gnl|my_center|LOCUS_47650 158320 157991 gene locus_tag LOCUS_47660 158320 157991 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_47660 158487 158320 gene locus_tag LOCUS_47670 158487 158320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 158669 158484 gene locus_tag LOCUS_47680 158669 158484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 158836 159237 gene locus_tag LOCUS_47690 158836 159237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 159277 159456 gene locus_tag LOCUS_47700 159277 159456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 159472 159747 gene locus_tag LOCUS_47710 159472 159747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 160883 159948 gene locus_tag LOCUS_47720 160883 159948 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185965189.1 protein_id gnl|my_center|LOCUS_47720 161406 161978 gene locus_tag LOCUS_47730 161406 161978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 163458 162175 gene locus_tag LOCUS_47740 163458 162175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 163798 165498 gene locus_tag LOCUS_47750 163798 165498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 165598 166155 gene locus_tag LOCUS_47760 165598 166155 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495205.1 protein_id gnl|my_center|LOCUS_47760 166152 167234 gene locus_tag LOCUS_47770 166152 167234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 167935 167327 gene locus_tag LOCUS_47780 167935 167327 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974527.1 protein_id gnl|my_center|LOCUS_47780 168111 168671 gene locus_tag LOCUS_47790 168111 168671 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225840.1 protein_id gnl|my_center|LOCUS_47790 169075 170508 gene locus_tag LOCUS_47800 169075 170508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 171459 170554 gene locus_tag LOCUS_47810 gene dapA 171459 170554 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225337.1 protein_id gnl|my_center|LOCUS_47810 171533 172150 gene locus_tag LOCUS_47820 171533 172150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47820 172129 172416 gene locus_tag LOCUS_47830 172129 172416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 172772 172515 gene locus_tag LOCUS_47840 172772 172515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 173156 172788 gene locus_tag LOCUS_47850 173156 172788 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228109.1 protein_id gnl|my_center|LOCUS_47850 173963 173190 gene locus_tag LOCUS_47860 173963 173190 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227420.1 protein_id gnl|my_center|LOCUS_47860 174044 174622 gene locus_tag LOCUS_47870 174044 174622 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530706.1 protein_id gnl|my_center|LOCUS_47870 175287 174643 gene locus_tag LOCUS_47880 175287 174643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 176486 175284 gene locus_tag LOCUS_47890 176486 175284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 178979 176703 gene locus_tag LOCUS_47900 178979 176703 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327169.1 protein_id gnl|my_center|LOCUS_47900 179656 178973 gene locus_tag LOCUS_47910 179656 178973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_47910 180177 179653 gene locus_tag LOCUS_47920 180177 179653 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_47920 181172 180480 gene locus_tag LOCUS_47930 181172 180480 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971520.1 protein_id gnl|my_center|LOCUS_47930 181239 182372 gene locus_tag LOCUS_47940 181239 182372 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031785.1 protein_id gnl|my_center|LOCUS_47940 183373 182408 gene locus_tag LOCUS_47950 183373 182408 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226156.1 protein_id gnl|my_center|LOCUS_47950 183473 184093 gene locus_tag LOCUS_47960 183473 184093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 184405 185280 gene locus_tag LOCUS_47970 184405 185280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 185323 185775 gene locus_tag LOCUS_47980 185323 185775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 186082 186576 gene locus_tag LOCUS_47990 186082 186576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 187920 187015 gene locus_tag LOCUS_48000 187920 187015 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145736531.1 protein_id gnl|my_center|LOCUS_48000 189458 188346 gene locus_tag LOCUS_48010 189458 188346 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031727.1 protein_id gnl|my_center|LOCUS_48010 190217 189639 gene locus_tag LOCUS_48020 190217 189639 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029611.1 protein_id gnl|my_center|LOCUS_48020 190317 191360 gene locus_tag LOCUS_48030 190317 191360 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868968.1 protein_id gnl|my_center|LOCUS_48030 >Feature sequence032 1776 508 gene locus_tag LOCUS_48040 gene tyrS 1776 508 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_48040 2631 1900 gene locus_tag LOCUS_48050 2631 1900 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_48050 4058 2613 gene locus_tag LOCUS_48060 gene argH 4058 2613 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_48060 4751 4233 gene locus_tag LOCUS_48070 4751 4233 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_48070 5731 4748 gene locus_tag LOCUS_48080 gene argF 5731 4748 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776178.1 protein_id gnl|my_center|LOCUS_48080 6975 5728 gene locus_tag LOCUS_48090 6975 5728 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977247.1 protein_id gnl|my_center|LOCUS_48090 7913 6972 gene locus_tag LOCUS_48100 gene argB 7913 6972 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977246.1 protein_id gnl|my_center|LOCUS_48100 9061 7910 gene locus_tag LOCUS_48110 gene argJ 9061 7910 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_48110 10145 9114 gene locus_tag LOCUS_48120 gene argC 10145 9114 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_48120 10596 10375 gene locus_tag LOCUS_48130 10596 10375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 10519 12117 gene locus_tag LOCUS_48140 10519 12117 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_48140 12283 13578 gene locus_tag LOCUS_48150 12283 13578 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030908.1 protein_id gnl|my_center|LOCUS_48150 13774 14397 gene locus_tag LOCUS_48160 13774 14397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 14427 15899 gene locus_tag LOCUS_48170 14427 15899 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027916.1 protein_id gnl|my_center|LOCUS_48170 15896 16495 gene locus_tag LOCUS_48180 15896 16495 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729926.1 protein_id gnl|my_center|LOCUS_48180 17435 16692 gene locus_tag LOCUS_48190 17435 16692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 17519 18436 gene locus_tag LOCUS_48200 17519 18436 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030042.1 protein_id gnl|my_center|LOCUS_48200 18590 21802 gene locus_tag LOCUS_48210 18590 21802 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742126.1 protein_id gnl|my_center|LOCUS_48210 24616 22085 gene locus_tag LOCUS_48220 gene pheT 24616 22085 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_48220 25716 24616 gene locus_tag LOCUS_48230 gene pheS 25716 24616 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_48230 27009 25927 gene locus_tag LOCUS_48240 27009 25927 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 protein_id gnl|my_center|LOCUS_48240 27952 27149 gene locus_tag LOCUS_48250 27952 27149 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_48250 28454 28071 gene locus_tag LOCUS_48260 gene rplT 28454 28071 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_48260 28673 28479 gene locus_tag LOCUS_48270 gene rpmI 28673 28479 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_48270 29391 28810 gene locus_tag LOCUS_48280 gene infC 29391 28810 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_48280 30583 29759 gene locus_tag LOCUS_48290 30583 29759 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_48290 31746 30583 gene locus_tag LOCUS_48300 gene mltG 31746 30583 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775669.1 protein_id gnl|my_center|LOCUS_48300 33244 31904 gene locus_tag LOCUS_48310 33244 31904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 33732 33241 gene locus_tag LOCUS_48320 gene ruvX 33732 33241 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894407.1 protein_id gnl|my_center|LOCUS_48320 36616 33944 gene locus_tag LOCUS_48330 gene alaS 36616 33944 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_48330 36872 36618 gene locus_tag LOCUS_48340 36872 36618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 37258 36869 gene locus_tag LOCUS_48350 37258 36869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 38695 37388 gene locus_tag LOCUS_48360 38695 37388 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_48360 39219 38758 gene locus_tag LOCUS_48370 39219 38758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 39514 40443 gene locus_tag LOCUS_48380 39514 40443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 42333 40555 gene locus_tag LOCUS_48390 gene aspS 42333 40555 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224570.1 protein_id gnl|my_center|LOCUS_48390 43589 42330 gene locus_tag LOCUS_48400 gene hisS 43589 42330 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325801.1 protein_id gnl|my_center|LOCUS_48400 44195 43590 gene locus_tag LOCUS_48410 44195 43590 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_48410 44233 44421 gene locus_tag LOCUS_48420 44233 44421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 44418 45350 gene locus_tag LOCUS_48430 44418 45350 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227106.1 protein_id gnl|my_center|LOCUS_48430 45395 46639 gene locus_tag LOCUS_48440 45395 46639 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_48440 49153 46805 gene locus_tag LOCUS_48450 gene relA 49153 46805 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_48450 49745 49227 gene locus_tag LOCUS_48460 49745 49227 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_48460 50943 49867 gene locus_tag LOCUS_48470 gene secF 50943 49867 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_48470 52721 50943 gene locus_tag LOCUS_48480 gene secD 52721 50943 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 protein_id gnl|my_center|LOCUS_48480 53141 52764 gene locus_tag LOCUS_48490 gene yajC 53141 52764 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413391.1 protein_id gnl|my_center|LOCUS_48490 54847 53789 gene locus_tag LOCUS_48500 gene ruvB 54847 53789 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_48500 55712 55092 gene locus_tag LOCUS_48510 gene ruvA 55712 55092 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_48510 56446 55709 gene locus_tag LOCUS_48520 56446 55709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 57812 56646 gene locus_tag LOCUS_48530 57812 56646 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106275831.1 protein_id gnl|my_center|LOCUS_48530 58873 58121 gene locus_tag LOCUS_48540 58873 58121 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_48540 59467 58877 gene locus_tag LOCUS_48550 gene pdxT 59467 58877 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_48550 61226 59742 gene locus_tag LOCUS_48560 gene phoD 61226 59742 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_48560 62391 61474 gene locus_tag LOCUS_48570 gene pdxS 62391 61474 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_48570 63642 62626 gene locus_tag LOCUS_48580 63642 62626 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_48580 64046 64933 gene locus_tag LOCUS_48590 64046 64933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 65645 65100 gene locus_tag LOCUS_48600 65645 65100 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_48600 66810 65677 gene locus_tag LOCUS_48610 66810 65677 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_48610 67786 66872 gene locus_tag LOCUS_48620 67786 66872 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_48620 68513 67878 gene locus_tag LOCUS_48630 68513 67878 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_48630 68924 71011 gene locus_tag LOCUS_48640 68924 71011 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400860.1 protein_id gnl|my_center|LOCUS_48640 71517 73169 gene locus_tag LOCUS_48650 71517 73169 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 protein_id gnl|my_center|LOCUS_48650 73556 75691 gene locus_tag LOCUS_48660 73556 75691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804311.1 protein_id gnl|my_center|LOCUS_48660 76357 75803 gene locus_tag LOCUS_48670 76357 75803 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_48670 78382 76415 gene locus_tag LOCUS_48680 gene thrS 78382 76415 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_48680 79149 78532 gene locus_tag LOCUS_48690 79149 78532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 79489 81090 gene locus_tag LOCUS_48700 79489 81090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 81130 81396 gene locus_tag LOCUS_48710 81130 81396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 81557 81985 gene locus_tag LOCUS_48720 81557 81985 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895387.1 protein_id gnl|my_center|LOCUS_48720 82345 82986 gene locus_tag LOCUS_48730 82345 82986 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_48730 84449 83202 gene locus_tag LOCUS_48740 84449 83202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 85402 84539 gene locus_tag LOCUS_48750 85402 84539 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058333.1 protein_id gnl|my_center|LOCUS_48750 86141 85479 gene locus_tag LOCUS_48760 86141 85479 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031734.1 protein_id gnl|my_center|LOCUS_48760 87548 86373 gene locus_tag LOCUS_48770 87548 86373 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037159.1 protein_id gnl|my_center|LOCUS_48770 88018 87545 gene locus_tag LOCUS_48780 88018 87545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 89462 89127 gene locus_tag LOCUS_48790 89462 89127 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 protein_id gnl|my_center|LOCUS_48790 89771 90724 gene locus_tag LOCUS_48800 89771 90724 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226333.1 protein_id gnl|my_center|LOCUS_48800 90785 91204 gene locus_tag LOCUS_48810 gene crcB 90785 91204 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031398.1 protein_id gnl|my_center|LOCUS_48810 91234 91587 gene locus_tag LOCUS_48820 91234 91587 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972099.1 protein_id gnl|my_center|LOCUS_48820 91584 91949 gene locus_tag LOCUS_48830 91584 91949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 92946 91981 gene locus_tag LOCUS_48840 92946 91981 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_48840 93976 93212 gene locus_tag LOCUS_48850 93976 93212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 94398 93973 gene locus_tag LOCUS_48860 94398 93973 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225267572.1 protein_id gnl|my_center|LOCUS_48860 95468 94467 gene locus_tag LOCUS_48870 95468 94467 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226137.1 protein_id gnl|my_center|LOCUS_48870 96012 95581 gene locus_tag LOCUS_48880 96012 95581 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401141.1 protein_id gnl|my_center|LOCUS_48880 96357 97667 gene locus_tag LOCUS_48890 96357 97667 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226866.1 protein_id gnl|my_center|LOCUS_48890 >Feature sequence033 <1 744 gene locus_tag LOCUS_48900 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226856.1:ABC transporter ATP-binding protein 809 2599 gene locus_tag LOCUS_48910 809 2599 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226857.1 protein_id gnl|my_center|LOCUS_48910 2654 3727 gene locus_tag LOCUS_48920 2654 3727 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259666.1 protein_id gnl|my_center|LOCUS_48920 4021 3815 gene locus_tag LOCUS_48930 gene mbtH 4021 3815 CDS product mycobactin NRPS accessory protein MbtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412265.1 protein_id gnl|my_center|LOCUS_48930 24487 4076 gene locus_tag LOCUS_48940 24487 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 13458 13367 gene locus_tag LOCUS_t00490 13458 13367 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25415 25981 gene locus_tag LOCUS_48950 25415 25981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 26112 27140 gene locus_tag LOCUS_48960 26112 27140 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226862.1 protein_id gnl|my_center|LOCUS_48960 27143 28228 gene locus_tag LOCUS_48970 27143 28228 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226863.1 protein_id gnl|my_center|LOCUS_48970 28233 29057 gene locus_tag LOCUS_48980 28233 29057 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_48980 30014 29067 gene locus_tag LOCUS_48990 30014 29067 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027162.1 protein_id gnl|my_center|LOCUS_48990 31055 30069 gene locus_tag LOCUS_49000 31055 30069 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 protein_id gnl|my_center|LOCUS_49000 31246 31926 gene locus_tag LOCUS_49010 31246 31926 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226512.1 protein_id gnl|my_center|LOCUS_49010 32151 33827 gene locus_tag LOCUS_49020 32151 33827 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226513.1 protein_id gnl|my_center|LOCUS_49020 34191 34490 gene locus_tag LOCUS_49030 34191 34490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 35038 34559 gene locus_tag LOCUS_49040 35038 34559 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031523.1 protein_id gnl|my_center|LOCUS_49040 35860 35486 gene locus_tag LOCUS_49050 35860 35486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49050 36273 37100 gene locus_tag LOCUS_49060 36273 37100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 38105 37281 gene locus_tag LOCUS_49070 38105 37281 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466913.1 protein_id gnl|my_center|LOCUS_49070 38477 39214 gene locus_tag LOCUS_49080 38477 39214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 39932 39249 gene locus_tag LOCUS_49090 39932 39249 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972782.1 protein_id gnl|my_center|LOCUS_49090 40087 39905 gene locus_tag LOCUS_49100 40087 39905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 40463 41713 gene locus_tag LOCUS_49110 40463 41713 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896959.1 protein_id gnl|my_center|LOCUS_49110 42046 43008 gene locus_tag LOCUS_49120 gene cmrA 42046 43008 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_49120 43182 45521 gene locus_tag LOCUS_49130 43182 45521 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209645732.1 protein_id gnl|my_center|LOCUS_49130 47208 45529 gene locus_tag LOCUS_49140 47208 45529 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228626.1 protein_id gnl|my_center|LOCUS_49140 48053 47241 gene locus_tag LOCUS_49150 48053 47241 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_49150 49101 48046 gene locus_tag LOCUS_49160 gene scbA 49101 48046 CDS product gamma-butyrolactone biosynthesis protein ScbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972659.1 protein_id gnl|my_center|LOCUS_49160 49852 49193 gene locus_tag LOCUS_49170 49852 49193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 50928 49951 gene locus_tag LOCUS_49180 50928 49951 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014613.1 protein_id gnl|my_center|LOCUS_49180 52803 50995 gene locus_tag LOCUS_49190 52803 50995 CDS product 3-oxoacid CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414123.1 protein_id gnl|my_center|LOCUS_49190 54110 52800 gene locus_tag LOCUS_49200 54110 52800 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360486.1 protein_id gnl|my_center|LOCUS_49200 55869 54328 gene locus_tag LOCUS_49210 55869 54328 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030784.1 protein_id gnl|my_center|LOCUS_49210 57124 55871 gene locus_tag LOCUS_49220 57124 55871 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522068.1 protein_id gnl|my_center|LOCUS_49220 57864 57145 gene locus_tag LOCUS_49230 57864 57145 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_49230 58124 59191 gene locus_tag LOCUS_49240 58124 59191 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224997.1 protein_id gnl|my_center|LOCUS_49240 59175 59540 gene locus_tag LOCUS_49250 59175 59540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 59555 60406 gene locus_tag LOCUS_49260 59555 60406 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530904.1 protein_id gnl|my_center|LOCUS_49260 61352 60447 gene locus_tag LOCUS_49270 61352 60447 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222063.1 protein_id gnl|my_center|LOCUS_49270 63503 62238 gene locus_tag LOCUS_49280 63503 62238 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_49280 64596 63523 gene locus_tag LOCUS_49290 64596 63523 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_49290 65359 64604 gene locus_tag LOCUS_49300 65359 64604 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224989.1 protein_id gnl|my_center|LOCUS_49300 66896 65367 gene locus_tag LOCUS_49310 66896 65367 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544143.1 protein_id gnl|my_center|LOCUS_49310 67594 66917 gene locus_tag LOCUS_49320 gene casR 67594 66917 CDS product two-component system response regulator CasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694623.1 protein_id gnl|my_center|LOCUS_49320 67958 68959 gene locus_tag LOCUS_49330 67958 68959 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_49330 69114 69040 gene locus_tag LOCUS_t00500 69114 69040 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 69563 69976 gene locus_tag LOCUS_49340 69563 69976 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004002642.1 protein_id gnl|my_center|LOCUS_49340 70675 70019 gene locus_tag LOCUS_49350 70675 70019 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 protein_id gnl|my_center|LOCUS_49350 70781 70587 gene locus_tag LOCUS_49360 70781 70587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 70768 72171 gene locus_tag LOCUS_49370 70768 72171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_49370 73012 72182 gene locus_tag LOCUS_49380 73012 72182 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_49380 74043 73054 gene locus_tag LOCUS_49390 74043 73054 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 protein_id gnl|my_center|LOCUS_49390 75691 74105 gene locus_tag LOCUS_49400 gene hutH 75691 74105 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 protein_id gnl|my_center|LOCUS_49400 75808 75881 gene locus_tag LOCUS_t00510 75808 75881 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 75909 75981 gene locus_tag LOCUS_t00520 75909 75981 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 75996 76070 gene locus_tag LOCUS_t00530 75996 76070 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 76451 76245 gene locus_tag LOCUS_49410 76451 76245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 >Feature sequence034 810 70 gene locus_tag LOCUS_49420 810 70 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190909.1 protein_id gnl|my_center|LOCUS_49420 1724 1245 gene locus_tag LOCUS_49430 1724 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 2245 1904 gene locus_tag LOCUS_49440 2245 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 3657 2419 gene locus_tag LOCUS_49450 3657 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 3587 3844 gene locus_tag LOCUS_49460 3587 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 5509 4001 gene locus_tag LOCUS_49470 5509 4001 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228262.1 protein_id gnl|my_center|LOCUS_49470 6056 8887 gene locus_tag LOCUS_49480 6056 8887 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_49480 8960 10501 gene locus_tag LOCUS_49490 8960 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 11504 10572 gene locus_tag LOCUS_49500 11504 10572 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230440.1 protein_id gnl|my_center|LOCUS_49500 12198 11590 gene locus_tag LOCUS_49510 12198 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 12436 13833 gene locus_tag LOCUS_49520 12436 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029632.1 protein_id gnl|my_center|LOCUS_49520 14082 13858 gene locus_tag LOCUS_49530 14082 13858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 14208 15005 gene locus_tag LOCUS_49540 14208 15005 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972022.1 protein_id gnl|my_center|LOCUS_49540 15135 16778 gene locus_tag LOCUS_49550 15135 16778 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921422.1 protein_id gnl|my_center|LOCUS_49550 16897 17259 gene locus_tag LOCUS_49560 16897 17259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 18289 17648 gene locus_tag LOCUS_49570 18289 17648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 18613 19989 gene locus_tag LOCUS_49580 18613 19989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468787.1 protein_id gnl|my_center|LOCUS_49580 20313 22400 gene locus_tag LOCUS_49590 20313 22400 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_49590 22397 23689 gene locus_tag LOCUS_49600 22397 23689 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071651.1 protein_id gnl|my_center|LOCUS_49600 23686 24309 gene locus_tag LOCUS_49610 23686 24309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071652.1 protein_id gnl|my_center|LOCUS_49610 24306 25712 gene locus_tag LOCUS_49620 24306 25712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 25716 29771 gene locus_tag LOCUS_49630 25716 29771 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071654.1 protein_id gnl|my_center|LOCUS_49630 29768 31360 gene locus_tag LOCUS_49640 29768 31360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071655.1 protein_id gnl|my_center|LOCUS_49640 31428 36746 gene locus_tag LOCUS_49650 31428 36746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 38307 36835 gene locus_tag LOCUS_49660 38307 36835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 40167 38608 gene locus_tag LOCUS_49670 40167 38608 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_49670 42424 40556 gene locus_tag LOCUS_49680 42424 40556 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528002.1 protein_id gnl|my_center|LOCUS_49680 43029 43787 gene locus_tag LOCUS_49690 43029 43787 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391052.1 protein_id gnl|my_center|LOCUS_49690 43774 44490 gene locus_tag LOCUS_49700 43774 44490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067079.1 protein_id gnl|my_center|LOCUS_49700 44593 45837 gene locus_tag LOCUS_49710 44593 45837 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435262.1 protein_id gnl|my_center|LOCUS_49710 45901 46764 gene locus_tag LOCUS_49720 45901 46764 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813860.1 protein_id gnl|my_center|LOCUS_49720 46761 47774 gene locus_tag LOCUS_49730 46761 47774 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397979.1 protein_id gnl|my_center|LOCUS_49730 47847 48632 gene locus_tag LOCUS_49740 47847 48632 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227748.1 protein_id gnl|my_center|LOCUS_49740 48794 50698 gene locus_tag LOCUS_49750 48794 50698 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027517.1 protein_id gnl|my_center|LOCUS_49750 53813 50736 gene locus_tag LOCUS_49760 53813 50736 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226639.1 protein_id gnl|my_center|LOCUS_49760 54777 55145 gene locus_tag LOCUS_49770 gene uraH 54777 55145 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057392.1 protein_id gnl|my_center|LOCUS_49770 55226 57127 gene locus_tag LOCUS_49780 gene leuA 55226 57127 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976275.1 protein_id gnl|my_center|LOCUS_49780 57253 60054 gene locus_tag LOCUS_49790 57253 60054 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223082.1 protein_id gnl|my_center|LOCUS_49790 61282 59996 gene locus_tag LOCUS_49800 61282 59996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 61464 62147 gene locus_tag LOCUS_49810 61464 62147 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224231.1 protein_id gnl|my_center|LOCUS_49810 62465 63661 gene locus_tag LOCUS_49820 62465 63661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028496.1 protein_id gnl|my_center|LOCUS_49820 63658 66195 gene locus_tag LOCUS_49830 63658 66195 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 protein_id gnl|my_center|LOCUS_49830 66192 67157 gene locus_tag LOCUS_49840 66192 67157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49840 67150 68439 gene locus_tag LOCUS_49850 67150 68439 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_49850 68442 69323 gene locus_tag LOCUS_49860 68442 69323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 69325 70827 gene locus_tag LOCUS_49870 gene glnX 69325 70827 CDS product protein kinase G-activating protein GlnX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876871.1 protein_id gnl|my_center|LOCUS_49870 70841 71749 gene locus_tag LOCUS_49880 70841 71749 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012471745.1 protein_id gnl|my_center|LOCUS_49880 71880 73109 gene locus_tag LOCUS_49890 71880 73109 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_49890 73258 73740 gene locus_tag LOCUS_49900 73258 73740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 73826 74848 gene locus_tag LOCUS_49910 73826 74848 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_49910 76115 75198 gene locus_tag LOCUS_49920 76115 75198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 76739 78061 gene locus_tag LOCUS_49930 76739 78061 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203873878.1 protein_id gnl|my_center|LOCUS_49930 78301 78576 gene locus_tag LOCUS_49940 78301 78576 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062094.1 protein_id gnl|my_center|LOCUS_49940 81234 78580 gene locus_tag LOCUS_49950 81234 78580 CDS product terpene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030632.1 protein_id gnl|my_center|LOCUS_49950 81808 81362 gene locus_tag LOCUS_49960 81808 81362 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222590.1 protein_id gnl|my_center|LOCUS_49960 81941 82825 gene locus_tag LOCUS_49970 81941 82825 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029139.1 protein_id gnl|my_center|LOCUS_49970 83490 82867 gene locus_tag LOCUS_49980 83490 82867 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529365.1 protein_id gnl|my_center|LOCUS_49980 83739 84344 gene locus_tag LOCUS_49990 83739 84344 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978174.1 protein_id gnl|my_center|LOCUS_49990 84341 85324 gene locus_tag LOCUS_50000 84341 85324 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027298.1 protein_id gnl|my_center|LOCUS_50000 85321 87417 gene locus_tag LOCUS_50010 85321 87417 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727118.1 protein_id gnl|my_center|LOCUS_50010 87433 89346 gene locus_tag LOCUS_50020 87433 89346 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031470.1 protein_id gnl|my_center|LOCUS_50020 91533 89383 gene locus_tag LOCUS_50030 91533 89383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 92840 91815 gene locus_tag LOCUS_50040 gene egtD 92840 91815 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731156.1 protein_id gnl|my_center|LOCUS_50040 93657 92947 gene locus_tag LOCUS_50050 gene egtC 93657 92947 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731157.1 protein_id gnl|my_center|LOCUS_50050 94989 93658 gene locus_tag LOCUS_50060 gene egtB 94989 93658 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 protein_id gnl|my_center|LOCUS_50060 96224 94986 gene locus_tag LOCUS_50070 gene egtA 96224 94986 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027438.1 protein_id gnl|my_center|LOCUS_50070 97958 96849 gene locus_tag LOCUS_50080 97958 96849 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921105.1 protein_id gnl|my_center|LOCUS_50080 99119 98073 gene locus_tag LOCUS_50090 99119 98073 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307767.1 protein_id gnl|my_center|LOCUS_50090 99487 100755 gene locus_tag LOCUS_50100 99487 100755 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 protein_id gnl|my_center|LOCUS_50100 100859 101782 gene locus_tag LOCUS_50110 100859 101782 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224315.1 protein_id gnl|my_center|LOCUS_50110 101782 102669 gene locus_tag LOCUS_50120 101782 102669 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224316.1 protein_id gnl|my_center|LOCUS_50120 102672 104036 gene locus_tag LOCUS_50130 102672 104036 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224317.1 protein_id gnl|my_center|LOCUS_50130 104181 104420 gene locus_tag LOCUS_50140 104181 104420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 105058 104486 gene locus_tag LOCUS_50150 105058 104486 CDS product HAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028507.1 protein_id gnl|my_center|LOCUS_50150 106318 105167 gene locus_tag LOCUS_50160 106318 105167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869966.1 protein_id gnl|my_center|LOCUS_50160 106658 106888 gene locus_tag LOCUS_50170 106658 106888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 107953 106985 gene locus_tag LOCUS_50180 gene iunH 107953 106985 CDS product nucleoside hydrolase IunH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417946.1 protein_id gnl|my_center|LOCUS_50180 109032 107950 gene locus_tag LOCUS_50190 109032 107950 CDS product s-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679362.1 protein_id gnl|my_center|LOCUS_50190 109374 110717 gene locus_tag LOCUS_50200 109374 110717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_50200 110965 110810 gene locus_tag LOCUS_50210 110965 110810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 111857 111120 gene locus_tag LOCUS_50220 111857 111120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 112642 111854 gene locus_tag LOCUS_50230 112642 111854 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_50230 112763 113587 gene locus_tag LOCUS_50240 112763 113587 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031583.1 protein_id gnl|my_center|LOCUS_50240 116901 113677 gene locus_tag LOCUS_50250 116901 113677 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_50250 117249 117785 gene locus_tag LOCUS_50260 117249 117785 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 protein_id gnl|my_center|LOCUS_50260 117939 118187 gene locus_tag LOCUS_50270 117939 118187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 118174 118407 gene locus_tag LOCUS_50280 118174 118407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 119336 118545 gene locus_tag LOCUS_50290 119336 118545 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104598.1 protein_id gnl|my_center|LOCUS_50290 120470 119466 gene locus_tag LOCUS_50300 120470 119466 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728687.1 protein_id gnl|my_center|LOCUS_50300 121525 120515 gene locus_tag LOCUS_50310 121525 120515 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 protein_id gnl|my_center|LOCUS_50310 122409 121525 gene locus_tag LOCUS_50320 122409 121525 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775734.1 protein_id gnl|my_center|LOCUS_50320 123332 122406 gene locus_tag LOCUS_50330 123332 122406 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804050.1 protein_id gnl|my_center|LOCUS_50330 124645 123329 gene locus_tag LOCUS_50340 124645 123329 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804049.1 protein_id gnl|my_center|LOCUS_50340 124766 126805 gene locus_tag LOCUS_50350 124766 126805 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804048.1 protein_id gnl|my_center|LOCUS_50350 128447 126813 gene locus_tag LOCUS_50360 128447 126813 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027406.1 protein_id gnl|my_center|LOCUS_50360 129185 128616 gene locus_tag LOCUS_50370 129185 128616 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975467.1 protein_id gnl|my_center|LOCUS_50370 129313 130929 gene locus_tag LOCUS_50380 129313 130929 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028938.1 protein_id gnl|my_center|LOCUS_50380 131145 131558 gene locus_tag LOCUS_50390 131145 131558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 131709 132641 gene locus_tag LOCUS_50400 131709 132641 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_50400 132814 133434 gene locus_tag LOCUS_50410 132814 133434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 133476 134591 gene locus_tag LOCUS_50420 133476 134591 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191120.1 protein_id gnl|my_center|LOCUS_50420 136186 134873 gene locus_tag LOCUS_50430 136186 134873 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975990.1 protein_id gnl|my_center|LOCUS_50430 136717 138288 gene locus_tag LOCUS_50440 136717 138288 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031804.1 protein_id gnl|my_center|LOCUS_50440 139866 138397 gene locus_tag LOCUS_50450 139866 138397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484926.1 protein_id gnl|my_center|LOCUS_50450 140231 139863 gene locus_tag LOCUS_50460 140231 139863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 141376 140228 gene locus_tag LOCUS_50470 141376 140228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485125.1 protein_id gnl|my_center|LOCUS_50470 142662 141373 gene locus_tag LOCUS_50480 142662 141373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 144946 142859 gene locus_tag LOCUS_50490 144946 142859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 145277 146008 gene locus_tag LOCUS_50500 145277 146008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 147694 146087 gene locus_tag LOCUS_50510 147694 146087 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230949.1 protein_id gnl|my_center|LOCUS_50510 147921 147691 gene locus_tag LOCUS_50520 147921 147691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 149942 148347 gene locus_tag LOCUS_50530 149942 148347 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224032.1 protein_id gnl|my_center|LOCUS_50530 150265 152397 gene locus_tag LOCUS_50540 150265 152397 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529939.1 protein_id gnl|my_center|LOCUS_50540 152654 153589 gene locus_tag LOCUS_50550 152654 153589 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225025.1 protein_id gnl|my_center|LOCUS_50550 153586 154338 gene locus_tag LOCUS_50560 153586 154338 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804277.1 protein_id gnl|my_center|LOCUS_50560 154407 155870 gene locus_tag LOCUS_50570 154407 155870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 156198 155893 gene locus_tag LOCUS_50580 156198 155893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 157584 156367 gene locus_tag LOCUS_50590 157584 156367 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978774.1 protein_id gnl|my_center|LOCUS_50590 158140 158826 gene locus_tag LOCUS_50600 158140 158826 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727426.1 protein_id gnl|my_center|LOCUS_50600 160077 158896 gene locus_tag LOCUS_50610 160077 158896 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878160.1 protein_id gnl|my_center|LOCUS_50610 160785 160174 gene locus_tag LOCUS_50620 160785 160174 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 protein_id gnl|my_center|LOCUS_50620 161053 160775 gene locus_tag LOCUS_50630 161053 160775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 160998 161582 gene locus_tag LOCUS_50640 160998 161582 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_50640 161673 164174 gene locus_tag LOCUS_50650 161673 164174 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_50650 164536 165039 gene locus_tag LOCUS_50660 164536 165039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 165052 165732 gene locus_tag LOCUS_50670 165052 165732 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_50670 165864 166334 gene locus_tag LOCUS_50680 165864 166334 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_50680 166481 167104 gene locus_tag LOCUS_50690 166481 167104 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_50690 167601 170459 gene locus_tag LOCUS_50700 gene gcvP 167601 170459 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_50700 170563 171381 gene locus_tag LOCUS_50710 170563 171381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 171736 172710 gene locus_tag LOCUS_50720 171736 172710 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729488.1 protein_id gnl|my_center|LOCUS_50720 173835 172837 gene locus_tag LOCUS_50730 173835 172837 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230322.1 protein_id gnl|my_center|LOCUS_50730 173926 174300 gene locus_tag LOCUS_50740 173926 174300 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039540.1 protein_id gnl|my_center|LOCUS_50740 >Feature sequence035 370 1416 gene locus_tag LOCUS_50750 370 1416 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030073.1 protein_id gnl|my_center|LOCUS_50750 1421 2119 gene locus_tag LOCUS_50760 1421 2119 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_50760 2895 2155 gene locus_tag LOCUS_50770 2895 2155 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973847.1 protein_id gnl|my_center|LOCUS_50770 3806 2895 gene locus_tag LOCUS_50780 3806 2895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223406.1 protein_id gnl|my_center|LOCUS_50780 4115 4276 gene locus_tag LOCUS_50790 4115 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 4386 4973 gene locus_tag LOCUS_50800 4386 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 4983 5903 gene locus_tag LOCUS_50810 4983 5903 CDS product SagB family peptide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948240.1 protein_id gnl|my_center|LOCUS_50810 5891 7123 gene locus_tag LOCUS_50820 gene hemW 5891 7123 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_50820 7159 8184 gene locus_tag LOCUS_50830 7159 8184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 8177 9523 gene locus_tag LOCUS_50840 8177 9523 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990434.1 protein_id gnl|my_center|LOCUS_50840 9501 10343 gene locus_tag LOCUS_50850 9501 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 10340 11320 gene locus_tag LOCUS_50860 10340 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 11355 12425 gene locus_tag LOCUS_50870 11355 12425 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703489.1 protein_id gnl|my_center|LOCUS_50870 12438 13478 gene locus_tag LOCUS_50880 12438 13478 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467095.1 protein_id gnl|my_center|LOCUS_50880 14368 13643 gene locus_tag LOCUS_50890 14368 13643 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258317.1 protein_id gnl|my_center|LOCUS_50890 14866 15957 gene locus_tag LOCUS_50900 14866 15957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 16253 18541 gene locus_tag LOCUS_50910 16253 18541 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026895.1 protein_id gnl|my_center|LOCUS_50910 19233 18571 gene locus_tag LOCUS_50920 19233 18571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 19784 19365 gene locus_tag LOCUS_50930 19784 19365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 20064 21158 gene locus_tag LOCUS_50940 20064 21158 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224399.1 protein_id gnl|my_center|LOCUS_50940 21160 22107 gene locus_tag LOCUS_50950 21160 22107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 23464 22178 gene locus_tag LOCUS_50960 23464 22178 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031624.1 protein_id gnl|my_center|LOCUS_50960 23689 24216 gene locus_tag LOCUS_50970 23689 24216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230193.1 protein_id gnl|my_center|LOCUS_50970 25562 24339 gene locus_tag LOCUS_50980 25562 24339 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 protein_id gnl|my_center|LOCUS_50980 26236 25562 gene locus_tag LOCUS_50990 26236 25562 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_50990 26559 27626 gene locus_tag LOCUS_51000 26559 27626 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225401.1 protein_id gnl|my_center|LOCUS_51000 27851 28603 gene locus_tag LOCUS_51010 27851 28603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 protein_id gnl|my_center|LOCUS_51010 28600 29880 gene locus_tag LOCUS_51020 28600 29880 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_51020 30065 30400 gene locus_tag LOCUS_51030 30065 30400 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029816.1 protein_id gnl|my_center|LOCUS_51030 30714 31223 gene locus_tag LOCUS_51040 30714 31223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 31907 31704 gene locus_tag LOCUS_51050 31907 31704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 32728 31895 gene locus_tag LOCUS_51060 32728 31895 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028316.1 protein_id gnl|my_center|LOCUS_51060 33080 33781 gene locus_tag LOCUS_51070 33080 33781 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804215.1 protein_id gnl|my_center|LOCUS_51070 33852 34400 gene locus_tag LOCUS_51080 33852 34400 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258315.1 protein_id gnl|my_center|LOCUS_51080 34605 35888 gene locus_tag LOCUS_51090 34605 35888 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227556.1 protein_id gnl|my_center|LOCUS_51090 35922 36365 gene locus_tag LOCUS_51100 35922 36365 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227557.1 protein_id gnl|my_center|LOCUS_51100 36612 37886 gene locus_tag LOCUS_51110 36612 37886 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742244.1 protein_id gnl|my_center|LOCUS_51110 39066 38056 gene locus_tag LOCUS_51120 39066 38056 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804036.1 protein_id gnl|my_center|LOCUS_51120 39899 39156 gene locus_tag LOCUS_51130 39899 39156 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227640.1 protein_id gnl|my_center|LOCUS_51130 43363 40112 gene locus_tag LOCUS_51140 43363 40112 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224450.1 protein_id gnl|my_center|LOCUS_51140 44394 43723 gene locus_tag LOCUS_51150 44394 43723 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976651.1 protein_id gnl|my_center|LOCUS_51150 45635 44391 gene locus_tag LOCUS_51160 45635 44391 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976650.1 protein_id gnl|my_center|LOCUS_51160 46011 46868 gene locus_tag LOCUS_51170 46011 46868 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109004014.1 protein_id gnl|my_center|LOCUS_51170 46921 48438 gene locus_tag LOCUS_51180 gene glpK 46921 48438 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226257.1 protein_id gnl|my_center|LOCUS_51180 49446 48466 gene locus_tag LOCUS_51190 49446 48466 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029227.1 protein_id gnl|my_center|LOCUS_51190 50384 49443 gene locus_tag LOCUS_51200 50384 49443 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029226.1 protein_id gnl|my_center|LOCUS_51200 50490 52046 gene locus_tag LOCUS_51210 50490 52046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 52654 52085 gene locus_tag LOCUS_51220 52654 52085 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731123.1 protein_id gnl|my_center|LOCUS_51220 52806 54233 gene locus_tag LOCUS_51230 52806 54233 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978299.1 protein_id gnl|my_center|LOCUS_51230 55519 54281 gene locus_tag LOCUS_51240 55519 54281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51240 56057 55554 gene locus_tag LOCUS_51250 56057 55554 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971719.1 protein_id gnl|my_center|LOCUS_51250 56268 57125 gene locus_tag LOCUS_51260 56268 57125 CDS product DUF4253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111709.1 protein_id gnl|my_center|LOCUS_51260 57444 57740 gene locus_tag LOCUS_51270 57444 57740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 57976 58425 gene locus_tag LOCUS_51280 57976 58425 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457988.1 protein_id gnl|my_center|LOCUS_51280 59775 58612 gene locus_tag LOCUS_51290 59775 58612 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224141.1 protein_id gnl|my_center|LOCUS_51290 62217 59977 gene locus_tag LOCUS_51300 gene secA2 62217 59977 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223120.1 protein_id gnl|my_center|LOCUS_51300 63406 62288 gene locus_tag LOCUS_51310 63406 62288 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_51310 64065 63403 gene locus_tag LOCUS_51320 64065 63403 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225902.1 protein_id gnl|my_center|LOCUS_51320 64205 65803 gene locus_tag LOCUS_51330 64205 65803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103962448.1 protein_id gnl|my_center|LOCUS_51330 67259 65730 gene locus_tag LOCUS_51340 67259 65730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 68552 67545 gene locus_tag LOCUS_51350 68552 67545 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027747.1 protein_id gnl|my_center|LOCUS_51350 68792 69172 gene locus_tag LOCUS_51360 68792 69172 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226395.1 protein_id gnl|my_center|LOCUS_51360 69447 70343 gene locus_tag LOCUS_51370 69447 70343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 71565 70351 gene locus_tag LOCUS_51380 71565 70351 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_51380 71620 72222 gene locus_tag LOCUS_51390 71620 72222 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977488.1 protein_id gnl|my_center|LOCUS_51390 72505 73539 gene locus_tag LOCUS_51400 72505 73539 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_51400 73539 74750 gene locus_tag LOCUS_51410 73539 74750 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_51410 74901 76079 gene locus_tag LOCUS_51420 74901 76079 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_51420 76076 77203 gene locus_tag LOCUS_51430 76076 77203 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027646.1 protein_id gnl|my_center|LOCUS_51430 77894 77220 gene locus_tag LOCUS_51440 77894 77220 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868049.1 protein_id gnl|my_center|LOCUS_51440 78120 78884 gene locus_tag LOCUS_51450 78120 78884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 78990 79064 gene locus_tag LOCUS_t00540 78990 79064 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 79390 79707 gene locus_tag LOCUS_51460 79390 79707 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899955.1 protein_id gnl|my_center|LOCUS_51460 80656 79859 gene locus_tag LOCUS_51470 80656 79859 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768145.1 protein_id gnl|my_center|LOCUS_51470 81750 80827 gene locus_tag LOCUS_51480 81750 80827 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222442.1 protein_id gnl|my_center|LOCUS_51480 82636 81836 gene locus_tag LOCUS_51490 82636 81836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 83181 84002 gene locus_tag LOCUS_51500 83181 84002 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027090.1 protein_id gnl|my_center|LOCUS_51500 86085 84154 gene locus_tag LOCUS_51510 86085 84154 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189868312.1 protein_id gnl|my_center|LOCUS_51510 87457 86279 gene locus_tag LOCUS_51520 87457 86279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_51520 88362 87466 gene locus_tag LOCUS_51530 88362 87466 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973040.1 protein_id gnl|my_center|LOCUS_51530 88698 90896 gene locus_tag LOCUS_51540 88698 90896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 91067 91609 gene locus_tag LOCUS_51550 91067 91609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 92058 91678 gene locus_tag LOCUS_51560 92058 91678 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229383.1 protein_id gnl|my_center|LOCUS_51560 92477 94549 gene locus_tag LOCUS_51570 92477 94549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 96021 94798 gene locus_tag LOCUS_51580 gene fdhA 96021 94798 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118811.1 protein_id gnl|my_center|LOCUS_51580 96379 97821 gene locus_tag LOCUS_51590 96379 97821 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976304.1 protein_id gnl|my_center|LOCUS_51590 97818 98234 gene locus_tag LOCUS_51600 97818 98234 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005102829.1 protein_id gnl|my_center|LOCUS_51600 99459 98647 gene locus_tag LOCUS_51610 99459 98647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 99710 99868 gene locus_tag LOCUS_51620 99710 99868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 101388 100075 gene locus_tag LOCUS_51630 101388 100075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 101592 102071 gene locus_tag LOCUS_51640 101592 102071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 103245 102211 gene locus_tag LOCUS_51650 103245 102211 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223417.1 protein_id gnl|my_center|LOCUS_51650 104927 103518 gene locus_tag LOCUS_51660 104927 103518 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_51660 105212 105556 gene locus_tag LOCUS_51670 105212 105556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 105649 107649 gene locus_tag LOCUS_51680 105649 107649 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410178.1 protein_id gnl|my_center|LOCUS_51680 107785 108414 gene locus_tag LOCUS_51690 107785 108414 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225650.1 protein_id gnl|my_center|LOCUS_51690 108401 109153 gene locus_tag LOCUS_51700 108401 109153 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225648.1 protein_id gnl|my_center|LOCUS_51700 109165 110250 gene locus_tag LOCUS_51710 109165 110250 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225647.1 protein_id gnl|my_center|LOCUS_51710 110254 112032 gene locus_tag LOCUS_51720 110254 112032 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225646.1 protein_id gnl|my_center|LOCUS_51720 112136 112732 gene locus_tag LOCUS_51730 112136 112732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 113134 113853 gene locus_tag LOCUS_51740 113134 113853 CDS product DUF5947 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467021.1 protein_id gnl|my_center|LOCUS_51740 113850 114482 gene locus_tag LOCUS_51750 113850 114482 CDS product DUF6084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225643.1 protein_id gnl|my_center|LOCUS_51750 114563 116098 gene locus_tag LOCUS_51760 114563 116098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 116095 116913 gene locus_tag LOCUS_51770 116095 116913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 116917 117309 gene locus_tag LOCUS_51780 116917 117309 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894106.1 protein_id gnl|my_center|LOCUS_51780 117257 117535 gene locus_tag LOCUS_51790 117257 117535 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225640.1 protein_id gnl|my_center|LOCUS_51790 117541 118668 gene locus_tag LOCUS_51800 gene hypD 117541 118668 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225639.1 protein_id gnl|my_center|LOCUS_51800 118665 119894 gene locus_tag LOCUS_51810 gene hypE 118665 119894 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_51810 120086 120487 gene locus_tag LOCUS_51820 120086 120487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 121982 120558 gene locus_tag LOCUS_51830 121982 120558 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031772.1 protein_id gnl|my_center|LOCUS_51830 122576 122391 gene locus_tag LOCUS_51840 122576 122391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 122627 123655 gene locus_tag LOCUS_51850 122627 123655 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030217.1 protein_id gnl|my_center|LOCUS_51850 123997 124932 gene locus_tag LOCUS_51860 123997 124932 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_51860 125378 125007 gene locus_tag LOCUS_51870 125378 125007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_51870 125813 125424 gene locus_tag LOCUS_51880 125813 125424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 126885 125905 gene locus_tag LOCUS_51890 126885 125905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 127269 126889 gene locus_tag LOCUS_51900 127269 126889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 127470 128027 gene locus_tag LOCUS_51910 127470 128027 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815447.1 protein_id gnl|my_center|LOCUS_51910 128034 128306 gene locus_tag LOCUS_51920 128034 128306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 129705 128467 gene locus_tag LOCUS_51930 129705 128467 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_51930 130235 131683 gene locus_tag LOCUS_51940 gene ngcE 130235 131683 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_51940 131690 132643 gene locus_tag LOCUS_51950 131690 132643 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030592.1 protein_id gnl|my_center|LOCUS_51950 132645 133550 gene locus_tag LOCUS_51960 132645 133550 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776379.1 protein_id gnl|my_center|LOCUS_51960 133686 135797 gene locus_tag LOCUS_51970 133686 135797 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229532.1 protein_id gnl|my_center|LOCUS_51970 135926 136477 gene locus_tag LOCUS_51980 135926 136477 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_51980 136572 136925 gene locus_tag LOCUS_51990 136572 136925 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259014.1 protein_id gnl|my_center|LOCUS_51990 137824 136973 gene locus_tag LOCUS_52000 137824 136973 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878192.1 protein_id gnl|my_center|LOCUS_52000 137887 139518 gene locus_tag LOCUS_52010 137887 139518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 139699 140559 gene locus_tag LOCUS_52020 139699 140559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 141899 140697 gene locus_tag LOCUS_52030 141899 140697 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224417.1 protein_id gnl|my_center|LOCUS_52030 142057 142656 gene locus_tag LOCUS_52040 142057 142656 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096765.1 protein_id gnl|my_center|LOCUS_52040 142776 144074 gene locus_tag LOCUS_52050 gene lat 142776 144074 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893146.1 protein_id gnl|my_center|LOCUS_52050 144340 144098 gene locus_tag LOCUS_52060 144340 144098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 144652 144579 gene locus_tag LOCUS_t00550 144652 144579 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 145322 144726 gene locus_tag LOCUS_52070 gene orn 145322 144726 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_52070 146864 145344 gene locus_tag LOCUS_52080 146864 145344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 148341 146923 gene locus_tag LOCUS_52090 148341 146923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 149991 148342 gene locus_tag LOCUS_52100 149991 148342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 150878 150105 gene locus_tag LOCUS_52110 150878 150105 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223636.1 protein_id gnl|my_center|LOCUS_52110 150813 152315 gene locus_tag LOCUS_52120 150813 152315 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931021.1 protein_id gnl|my_center|LOCUS_52120 153509 152355 gene locus_tag LOCUS_52130 153509 152355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 154689 153607 gene locus_tag LOCUS_52140 154689 153607 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640455.1 protein_id gnl|my_center|LOCUS_52140 155418 154807 gene locus_tag LOCUS_52150 155418 154807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 155669 157054 gene locus_tag LOCUS_52160 155669 157054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 160719 157231 gene locus_tag LOCUS_52170 160719 157231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 162188 160740 gene locus_tag LOCUS_52180 162188 160740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 162981 162181 gene locus_tag LOCUS_52190 162981 162181 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813221.1 protein_id gnl|my_center|LOCUS_52190 163975 162986 gene locus_tag LOCUS_52200 163975 162986 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 protein_id gnl|my_center|LOCUS_52200 164818 163982 gene locus_tag LOCUS_52210 164818 163982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 166071 164953 gene locus_tag LOCUS_52220 166071 164953 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640455.1 protein_id gnl|my_center|LOCUS_52220 166439 166068 gene locus_tag LOCUS_52230 166439 166068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 168388 166652 gene locus_tag LOCUS_52240 168388 166652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 170766 168964 gene locus_tag LOCUS_52250 170766 168964 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229295.1 protein_id gnl|my_center|LOCUS_52250 171057 171629 gene locus_tag LOCUS_52260 171057 171629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 171945 172856 gene locus_tag LOCUS_52270 171945 172856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 172849 173760 gene locus_tag LOCUS_52280 172849 173760 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067135926.1 protein_id gnl|my_center|LOCUS_52280 >Feature sequence036 1053 175 gene locus_tag LOCUS_52290 1053 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 1280 2422 gene locus_tag LOCUS_52300 1280 2422 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730643.1 protein_id gnl|my_center|LOCUS_52300 4026 2476 gene locus_tag LOCUS_52310 4026 2476 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312152.1 protein_id gnl|my_center|LOCUS_52310 4594 4031 gene locus_tag LOCUS_52320 4594 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228656.1 protein_id gnl|my_center|LOCUS_52320 5269 4709 gene locus_tag LOCUS_52330 5269 4709 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_52330 5549 5944 gene locus_tag LOCUS_52340 5549 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 6923 6102 gene locus_tag LOCUS_52350 6923 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 8755 7604 gene locus_tag LOCUS_52360 8755 7604 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014331.1 protein_id gnl|my_center|LOCUS_52360 9675 11282 gene locus_tag LOCUS_52370 9675 11282 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231020.1 protein_id gnl|my_center|LOCUS_52370 11501 11764 gene locus_tag LOCUS_52380 11501 11764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 12275 13258 gene locus_tag LOCUS_52390 12275 13258 CDS product DUF1702 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228639.1 protein_id gnl|my_center|LOCUS_52390 13638 14531 gene locus_tag LOCUS_52400 13638 14531 CDS product DUF1702 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086861803.1 protein_id gnl|my_center|LOCUS_52400 14528 16495 gene locus_tag LOCUS_52410 14528 16495 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228637.1 protein_id gnl|my_center|LOCUS_52410 16492 17511 gene locus_tag LOCUS_52420 16492 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228636.1 protein_id gnl|my_center|LOCUS_52420 17508 23300 gene locus_tag LOCUS_52430 17508 23300 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831510.1 protein_id gnl|my_center|LOCUS_52430 23378 23806 gene locus_tag LOCUS_52440 23378 23806 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228629.1 protein_id gnl|my_center|LOCUS_52440 23840 24379 gene locus_tag LOCUS_52450 23840 24379 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228628.1 protein_id gnl|my_center|LOCUS_52450 24376 25812 gene locus_tag LOCUS_52460 24376 25812 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 protein_id gnl|my_center|LOCUS_52460 27201 26470 gene locus_tag LOCUS_52470 27201 26470 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228650.1 protein_id gnl|my_center|LOCUS_52470 27618 28187 gene locus_tag LOCUS_52480 27618 28187 CDS product DUF5987 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228634.1 protein_id gnl|my_center|LOCUS_52480 28184 29839 gene locus_tag LOCUS_52490 28184 29839 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228633.1 protein_id gnl|my_center|LOCUS_52490 29969 31090 gene locus_tag LOCUS_52500 29969 31090 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742109.1 protein_id gnl|my_center|LOCUS_52500 31124 31927 gene locus_tag LOCUS_52510 31124 31927 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228631.1 protein_id gnl|my_center|LOCUS_52510 32788 31988 gene locus_tag LOCUS_52520 32788 31988 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_52520 33099 34187 gene locus_tag LOCUS_52530 33099 34187 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_52530 34793 36424 gene locus_tag LOCUS_52540 34793 36424 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231020.1 protein_id gnl|my_center|LOCUS_52540 36616 36945 gene locus_tag LOCUS_52550 36616 36945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 37527 37054 gene locus_tag LOCUS_52560 37527 37054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 39125 37881 gene locus_tag LOCUS_52570 39125 37881 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014331.1 protein_id gnl|my_center|LOCUS_52570 39365 40540 gene locus_tag LOCUS_52580 39365 40540 CDS product DUF2855 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640655.1 protein_id gnl|my_center|LOCUS_52580 40745 41479 gene locus_tag LOCUS_52590 40745 41479 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227359.1 protein_id gnl|my_center|LOCUS_52590 43000 41654 gene locus_tag LOCUS_52600 43000 41654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 43507 45084 gene locus_tag LOCUS_52610 43507 45084 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030784.1 protein_id gnl|my_center|LOCUS_52610 45255 46514 gene locus_tag LOCUS_52620 45255 46514 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229096.1 protein_id gnl|my_center|LOCUS_52620 46576 47118 gene locus_tag LOCUS_52630 46576 47118 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240088.1 protein_id gnl|my_center|LOCUS_52630 47203 48072 gene locus_tag LOCUS_52640 47203 48072 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222502.1 protein_id gnl|my_center|LOCUS_52640 48108 48689 gene locus_tag LOCUS_52650 48108 48689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 48686 49483 gene locus_tag LOCUS_52660 48686 49483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 49480 50286 gene locus_tag LOCUS_52670 gene pchC 49480 50286 CDS product pyochelin biosynthesis editing thioesterase PchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114687.1 protein_id gnl|my_center|LOCUS_52670 50817 50323 gene locus_tag LOCUS_52680 50817 50323 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467140.1 protein_id gnl|my_center|LOCUS_52680 52077 51037 gene locus_tag LOCUS_52690 52077 51037 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803824.1 protein_id gnl|my_center|LOCUS_52690 52262 53575 gene locus_tag LOCUS_52700 52262 53575 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114086.1 protein_id gnl|my_center|LOCUS_52700 53675 54628 gene locus_tag LOCUS_52710 53675 54628 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051281.1 protein_id gnl|my_center|LOCUS_52710 54705 55556 gene locus_tag LOCUS_52720 54705 55556 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032738944.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52720 55714 57351 gene locus_tag LOCUS_52730 55714 57351 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_52730 59753 57402 gene locus_tag LOCUS_52740 59753 57402 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223220.1 protein_id gnl|my_center|LOCUS_52740 60855 59974 gene locus_tag LOCUS_52750 60855 59974 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228829.1 protein_id gnl|my_center|LOCUS_52750 61802 60852 gene locus_tag LOCUS_52760 61802 60852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228828.1 protein_id gnl|my_center|LOCUS_52760 61926 62831 gene locus_tag LOCUS_52770 61926 62831 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029682.1 protein_id gnl|my_center|LOCUS_52770 64129 62906 gene locus_tag LOCUS_52780 64129 62906 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014331.1 protein_id gnl|my_center|LOCUS_52780 64480 65730 gene locus_tag LOCUS_52790 64480 65730 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083663.1 protein_id gnl|my_center|LOCUS_52790 66896 66066 gene locus_tag LOCUS_52800 66896 66066 CDS product 27-O-demethylrifamycin SV methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_52800 67227 68777 gene locus_tag LOCUS_52810 67227 68777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 68823 70208 gene locus_tag LOCUS_52820 68823 70208 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728048.1 protein_id gnl|my_center|LOCUS_52820 70517 70726 gene locus_tag LOCUS_52830 70517 70726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 70774 73032 gene locus_tag LOCUS_52840 70774 73032 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_52840 73953 73201 gene locus_tag LOCUS_52850 73953 73201 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974670.1 protein_id gnl|my_center|LOCUS_52850 74701 76143 gene locus_tag LOCUS_52860 74701 76143 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227361.1 protein_id gnl|my_center|LOCUS_52860 76228 79545 gene locus_tag LOCUS_52870 76228 79545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 79551 81158 gene locus_tag LOCUS_52880 gene hutH 79551 81158 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243255.1 protein_id gnl|my_center|LOCUS_52880 81404 83104 gene locus_tag LOCUS_52890 81404 83104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 83187 84059 gene locus_tag LOCUS_52900 83187 84059 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_52900 84968 84147 gene locus_tag LOCUS_52910 84968 84147 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031499.1 protein_id gnl|my_center|LOCUS_52910 86729 85119 gene locus_tag LOCUS_52920 86729 85119 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229060.1 protein_id gnl|my_center|LOCUS_52920 87233 86979 gene locus_tag LOCUS_52930 87233 86979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 87120 88304 gene locus_tag LOCUS_52940 87120 88304 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_52940 88330 88752 gene locus_tag LOCUS_52950 88330 88752 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228611.1 protein_id gnl|my_center|LOCUS_52950 88707 88955 gene locus_tag LOCUS_52960 88707 88955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 89153 90169 gene locus_tag LOCUS_52970 89153 90169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 90690 90121 gene locus_tag LOCUS_52980 90690 90121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 90929 91054 gene locus_tag LOCUS_52990 90929 91054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 91084 91548 gene locus_tag LOCUS_53000 91084 91548 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841425.1 protein_id gnl|my_center|LOCUS_53000 91750 92736 gene locus_tag LOCUS_53010 91750 92736 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282906.1 protein_id gnl|my_center|LOCUS_53010 92814 93866 gene locus_tag LOCUS_53020 92814 93866 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228627.1 protein_id gnl|my_center|LOCUS_53020 93881 95596 gene locus_tag LOCUS_53030 93881 95596 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228626.1 protein_id gnl|my_center|LOCUS_53030 95954 96514 gene locus_tag LOCUS_53040 95954 96514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228656.1 protein_id gnl|my_center|LOCUS_53040 96511 96999 gene locus_tag LOCUS_53050 96511 96999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 96996 97754 gene locus_tag LOCUS_53060 96996 97754 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974625.1 protein_id gnl|my_center|LOCUS_53060 98507 97782 gene locus_tag LOCUS_53070 98507 97782 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729362.1 protein_id gnl|my_center|LOCUS_53070 99420 98674 gene locus_tag LOCUS_53080 gene sfp 99420 98674 CDS product 4'-phosphopantetheinyl transferase Sfp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573024.1 protein_id gnl|my_center|LOCUS_53080 99704 99417 gene locus_tag LOCUS_53090 99704 99417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 100165 101601 gene locus_tag LOCUS_53100 100165 101601 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 protein_id gnl|my_center|LOCUS_53100 102762 101653 gene locus_tag LOCUS_53110 102762 101653 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229235.1 protein_id gnl|my_center|LOCUS_53110 103932 103024 gene locus_tag LOCUS_53120 103932 103024 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_53120 104226 105815 gene locus_tag LOCUS_53130 104226 105815 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226611.1 protein_id gnl|my_center|LOCUS_53130 106667 106014 gene locus_tag LOCUS_53140 106667 106014 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525272.1 protein_id gnl|my_center|LOCUS_53140 108393 107377 gene locus_tag LOCUS_53150 108393 107377 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397659.1 protein_id gnl|my_center|LOCUS_53150 108511 109260 gene locus_tag LOCUS_53160 108511 109260 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226429.1 protein_id gnl|my_center|LOCUS_53160 109658 109389 gene locus_tag LOCUS_53170 109658 109389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 109781 109999 gene locus_tag LOCUS_53180 109781 109999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 110060 110296 gene locus_tag LOCUS_53190 110060 110296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 110894 110436 gene locus_tag LOCUS_53200 110894 110436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 111442 110987 gene locus_tag LOCUS_53210 111442 110987 CDS product DUF4383 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466936.1 protein_id gnl|my_center|LOCUS_53210 112206 111607 gene locus_tag LOCUS_53220 112206 111607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 113103 112210 gene locus_tag LOCUS_53230 113103 112210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 113543 113100 gene locus_tag LOCUS_53240 113543 113100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 113731 113540 gene locus_tag LOCUS_53250 113731 113540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 114227 113799 gene locus_tag LOCUS_53260 114227 113799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 114703 114224 gene locus_tag LOCUS_53270 114703 114224 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976986.1 protein_id gnl|my_center|LOCUS_53270 116627 114825 gene locus_tag LOCUS_53280 116627 114825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031102.1 protein_id gnl|my_center|LOCUS_53280 118555 116624 gene locus_tag LOCUS_53290 118555 116624 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031101.1 protein_id gnl|my_center|LOCUS_53290 118769 118635 gene locus_tag LOCUS_53300 118769 118635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 118958 118824 gene locus_tag LOCUS_53310 118958 118824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 119116 118991 gene locus_tag LOCUS_53320 119116 118991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 121822 119123 gene locus_tag LOCUS_53330 gene lanKC 121822 119123 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495285.1 protein_id gnl|my_center|LOCUS_53330 122344 122535 gene locus_tag LOCUS_53340 122344 122535 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226108.1 protein_id gnl|my_center|LOCUS_53340 123389 122718 gene locus_tag LOCUS_53350 123389 122718 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227864.1 protein_id gnl|my_center|LOCUS_53350 124801 123386 gene locus_tag LOCUS_53360 124801 123386 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227865.1 protein_id gnl|my_center|LOCUS_53360 124890 126095 gene locus_tag LOCUS_53370 124890 126095 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029184.1 protein_id gnl|my_center|LOCUS_53370 126092 126778 gene locus_tag LOCUS_53380 126092 126778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 127198 129264 gene locus_tag LOCUS_53390 127198 129264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 130403 129372 gene locus_tag LOCUS_53400 130403 129372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838152.1 protein_id gnl|my_center|LOCUS_53400 130486 131256 gene locus_tag LOCUS_53410 130486 131256 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973919.1 protein_id gnl|my_center|LOCUS_53410 131377 131808 gene locus_tag LOCUS_53420 131377 131808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 132057 135959 gene locus_tag LOCUS_53430 gene hrpA 132057 135959 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029425.1 protein_id gnl|my_center|LOCUS_53430 136238 137281 gene locus_tag LOCUS_53440 136238 137281 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028254.1 protein_id gnl|my_center|LOCUS_53440 137470 138147 gene locus_tag LOCUS_53450 137470 138147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 140256 138199 gene locus_tag LOCUS_53460 140256 138199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 141550 140246 gene locus_tag LOCUS_53470 141550 140246 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051223.1 protein_id gnl|my_center|LOCUS_53470 142371 141547 gene locus_tag LOCUS_53480 142371 141547 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641746.1 protein_id gnl|my_center|LOCUS_53480 142939 142376 gene locus_tag LOCUS_53490 142939 142376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 144591 142939 gene locus_tag LOCUS_53500 144591 142939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776847.1 protein_id gnl|my_center|LOCUS_53500 144898 145764 gene locus_tag LOCUS_53510 gene ptbB 144898 145764 CDS product tyrosine-protein phosphatase PtbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401010.1 protein_id gnl|my_center|LOCUS_53510 146806 145757 gene locus_tag LOCUS_53520 146806 145757 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_53520 147705 146803 gene locus_tag LOCUS_53530 147705 146803 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_53530 147879 148271 gene locus_tag LOCUS_53540 147879 148271 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_53540 148393 149328 gene locus_tag LOCUS_53550 148393 149328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 151474 149360 gene locus_tag LOCUS_53560 151474 149360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325800.1 protein_id gnl|my_center|LOCUS_53560 151669 151830 gene locus_tag LOCUS_53570 151669 151830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 153360 151972 gene locus_tag LOCUS_53580 153360 151972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 153539 154471 gene locus_tag LOCUS_53590 153539 154471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 155420 154542 gene locus_tag LOCUS_53600 155420 154542 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 protein_id gnl|my_center|LOCUS_53600 158113 155417 gene locus_tag LOCUS_53610 158113 155417 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227899.1 protein_id gnl|my_center|LOCUS_53610 158250 159467 gene locus_tag LOCUS_53620 158250 159467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467860.1 protein_id gnl|my_center|LOCUS_53620 160748 159612 gene locus_tag LOCUS_53630 160748 159612 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222043.1 protein_id gnl|my_center|LOCUS_53630 161398 160745 gene locus_tag LOCUS_53640 161398 160745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 161651 162460 gene locus_tag LOCUS_53650 161651 162460 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226033.1 protein_id gnl|my_center|LOCUS_53650 163907 162894 gene locus_tag LOCUS_53660 163907 162894 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226355.1 protein_id gnl|my_center|LOCUS_53660 164169 165443 gene locus_tag LOCUS_53670 164169 165443 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226351.1 protein_id gnl|my_center|LOCUS_53670 165579 166577 gene locus_tag LOCUS_53680 165579 166577 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 protein_id gnl|my_center|LOCUS_53680 166574 167434 gene locus_tag LOCUS_53690 166574 167434 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226353.1 protein_id gnl|my_center|LOCUS_53690 167559 170579 gene locus_tag LOCUS_53700 167559 170579 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584062.1 protein_id gnl|my_center|LOCUS_53700 170622 172157 gene locus_tag LOCUS_53710 170622 172157 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 protein_id gnl|my_center|LOCUS_53710 >Feature sequence037 60 866 gene locus_tag LOCUS_53720 60 866 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227632.1 protein_id gnl|my_center|LOCUS_53720 1422 2966 gene locus_tag LOCUS_53730 1422 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 4251 2968 gene locus_tag LOCUS_53740 4251 2968 CDS product DUF1205 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227238.1 protein_id gnl|my_center|LOCUS_53740 5358 4315 gene locus_tag LOCUS_53750 5358 4315 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223417.1 protein_id gnl|my_center|LOCUS_53750 6374 5355 gene locus_tag LOCUS_53760 6374 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53760 7789 6371 gene locus_tag LOCUS_53770 7789 6371 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_53770 8093 8533 gene locus_tag LOCUS_53780 8093 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 8637 9890 gene locus_tag LOCUS_53790 8637 9890 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_53790 9887 10357 gene locus_tag LOCUS_53800 9887 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 10413 11384 gene locus_tag LOCUS_53810 10413 11384 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_53810 11381 12301 gene locus_tag LOCUS_53820 11381 12301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 12309 15935 gene locus_tag LOCUS_53830 12309 15935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 16067 18787 gene locus_tag LOCUS_53840 16067 18787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 19998 19234 gene locus_tag LOCUS_53850 19998 19234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 20835 20098 gene locus_tag LOCUS_53860 20835 20098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 20837 20998 gene locus_tag LOCUS_53870 20837 20998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 22037 21282 gene locus_tag LOCUS_53880 22037 21282 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897003.1 protein_id gnl|my_center|LOCUS_53880 22168 22602 gene locus_tag LOCUS_53890 22168 22602 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028484.1 protein_id gnl|my_center|LOCUS_53890 24100 22709 gene locus_tag LOCUS_53900 24100 22709 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486261.1 protein_id gnl|my_center|LOCUS_53900 25001 24546 gene locus_tag LOCUS_53910 25001 24546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 25721 25050 gene locus_tag LOCUS_53920 25721 25050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 25806 26831 gene locus_tag LOCUS_53930 25806 26831 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 protein_id gnl|my_center|LOCUS_53930 27615 27241 gene locus_tag LOCUS_53940 27615 27241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 30817 27524 gene locus_tag LOCUS_53950 30817 27524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 31111 31473 gene locus_tag LOCUS_53960 31111 31473 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227508.1 protein_id gnl|my_center|LOCUS_53960 32307 31537 gene locus_tag LOCUS_53970 32307 31537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 33124 32390 gene locus_tag LOCUS_53980 33124 32390 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_53980 33312 34343 gene locus_tag LOCUS_53990 33312 34343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 35353 34406 gene locus_tag LOCUS_54000 35353 34406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 36281 35388 gene locus_tag LOCUS_54010 36281 35388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 37193 36348 gene locus_tag LOCUS_54020 37193 36348 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227669.1 protein_id gnl|my_center|LOCUS_54020 38784 37675 gene locus_tag LOCUS_54030 38784 37675 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_54030 39849 38893 gene locus_tag LOCUS_54040 39849 38893 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_54040 41256 40006 gene locus_tag LOCUS_54050 41256 40006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 42005 43414 gene locus_tag LOCUS_54060 42005 43414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54060 43916 43539 gene locus_tag LOCUS_54070 43916 43539 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 protein_id gnl|my_center|LOCUS_54070 44728 43913 gene locus_tag LOCUS_54080 44728 43913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 45180 45575 gene locus_tag LOCUS_54090 45180 45575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 45951 46460 gene locus_tag LOCUS_54100 45951 46460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 47185 46604 gene locus_tag LOCUS_54110 47185 46604 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 protein_id gnl|my_center|LOCUS_54110 48999 47311 gene locus_tag LOCUS_54120 48999 47311 CDS product cellulose 1,4-beta-cellobiosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031002.1 protein_id gnl|my_center|LOCUS_54120 48881 49204 gene locus_tag LOCUS_54130 48881 49204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 49517 49915 gene locus_tag LOCUS_54140 49517 49915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 49918 50109 gene locus_tag LOCUS_54150 49918 50109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 50153 50338 gene locus_tag LOCUS_54160 50153 50338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 50358 53234 gene locus_tag LOCUS_54170 50358 53234 CDS product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226577.1 protein_id gnl|my_center|LOCUS_54170 53606 53472 gene locus_tag LOCUS_54180 53606 53472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 54474 53965 gene locus_tag LOCUS_54190 54474 53965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 54788 54471 gene locus_tag LOCUS_54200 54788 54471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 55858 55073 gene locus_tag LOCUS_54210 55858 55073 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029507.1 protein_id gnl|my_center|LOCUS_54210 55932 56360 gene locus_tag LOCUS_54220 55932 56360 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950169.1 protein_id gnl|my_center|LOCUS_54220 56374 56646 gene locus_tag LOCUS_54230 56374 56646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 58736 56745 gene locus_tag LOCUS_54240 58736 56745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229912.1 protein_id gnl|my_center|LOCUS_54240 59872 58733 gene locus_tag LOCUS_54250 59872 58733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 60638 59880 gene locus_tag LOCUS_54260 60638 59880 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742194.1 protein_id gnl|my_center|LOCUS_54260 61147 60635 gene locus_tag LOCUS_54270 61147 60635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 61186 61494 gene locus_tag LOCUS_54280 61186 61494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 61491 61841 gene locus_tag LOCUS_54290 61491 61841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 61889 62359 gene locus_tag LOCUS_54300 61889 62359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 62580 63008 gene locus_tag LOCUS_54310 62580 63008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 63046 62971 gene locus_tag LOCUS_t00560 63046 62971 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 63420 63187 gene locus_tag LOCUS_54320 63420 63187 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225660.1 protein_id gnl|my_center|LOCUS_54320 63748 64320 gene locus_tag LOCUS_54330 63748 64320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 64933 64394 gene locus_tag LOCUS_54340 64933 64394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030213.1 protein_id gnl|my_center|LOCUS_54340 65059 66231 gene locus_tag LOCUS_54350 65059 66231 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030212.1 protein_id gnl|my_center|LOCUS_54350 66228 66860 gene locus_tag LOCUS_54360 66228 66860 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973620.1 protein_id gnl|my_center|LOCUS_54360 67433 66885 gene locus_tag LOCUS_54370 67433 66885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 68345 67869 gene locus_tag LOCUS_54380 68345 67869 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230087.1 protein_id gnl|my_center|LOCUS_54380 69218 68577 gene locus_tag LOCUS_54390 69218 68577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 70349 69270 gene locus_tag LOCUS_54400 70349 69270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 71124 70603 gene locus_tag LOCUS_54410 71124 70603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 71412 72023 gene locus_tag LOCUS_54420 71412 72023 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530118.1 protein_id gnl|my_center|LOCUS_54420 75160 72149 gene locus_tag LOCUS_54430 75160 72149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 75406 76410 gene locus_tag LOCUS_54440 75406 76410 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282906.1 protein_id gnl|my_center|LOCUS_54440 76574 77116 gene locus_tag LOCUS_54450 76574 77116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 78305 77127 gene locus_tag LOCUS_54460 78305 77127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 78677 79138 gene locus_tag LOCUS_54470 78677 79138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 79261 80172 gene locus_tag LOCUS_54480 79261 80172 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228232.1 protein_id gnl|my_center|LOCUS_54480 80691 81533 gene locus_tag LOCUS_54490 80691 81533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 81608 82222 gene locus_tag LOCUS_54500 81608 82222 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222876.1 protein_id gnl|my_center|LOCUS_54500 83059 82232 gene locus_tag LOCUS_54510 83059 82232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 83164 83544 gene locus_tag LOCUS_54520 83164 83544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 83797 84642 gene locus_tag LOCUS_54530 83797 84642 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_54530 84629 84817 gene locus_tag LOCUS_54540 84629 84817 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_54540 85782 85054 gene locus_tag LOCUS_54550 85782 85054 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252035.1 protein_id gnl|my_center|LOCUS_54550 86144 87319 gene locus_tag LOCUS_54560 86144 87319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54560 87423 87923 gene locus_tag LOCUS_54570 87423 87923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 89112 88225 gene locus_tag LOCUS_54580 89112 88225 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108987323.1 protein_id gnl|my_center|LOCUS_54580 89476 90033 gene locus_tag LOCUS_54590 89476 90033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970379.1 protein_id gnl|my_center|LOCUS_54590 90030 90365 gene locus_tag LOCUS_54600 90030 90365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 90423 90824 gene locus_tag LOCUS_54610 90423 90824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 91904 91479 gene locus_tag LOCUS_54620 91904 91479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 91870 92067 gene locus_tag LOCUS_54630 91870 92067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54630 92230 92140 gene locus_tag LOCUS_t00570 92230 92140 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 93182 92619 gene locus_tag LOCUS_54640 93182 92619 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854913.1 protein_id gnl|my_center|LOCUS_54640 93294 93788 gene locus_tag LOCUS_54650 93294 93788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 94576 94028 gene locus_tag LOCUS_54660 94576 94028 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495205.1 protein_id gnl|my_center|LOCUS_54660 94833 95774 gene locus_tag LOCUS_54670 94833 95774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 95785 96777 gene locus_tag LOCUS_54680 95785 96777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 98143 96962 gene locus_tag LOCUS_54690 98143 96962 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_54690 98814 98485 gene locus_tag LOCUS_54700 98814 98485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 98783 99277 gene locus_tag LOCUS_54710 98783 99277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 99584 100462 gene locus_tag LOCUS_54720 99584 100462 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224326.1 protein_id gnl|my_center|LOCUS_54720 100718 101746 gene locus_tag LOCUS_54730 100718 101746 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225345.1 protein_id gnl|my_center|LOCUS_54730 101752 102504 gene locus_tag LOCUS_54740 101752 102504 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228386.1 protein_id gnl|my_center|LOCUS_54740 102576 102665 gene locus_tag LOCUS_t00580 102576 102665 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 105173 102696 gene locus_tag LOCUS_54750 105173 102696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 105288 106244 gene locus_tag LOCUS_54760 105288 106244 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_54760 106260 106784 gene locus_tag LOCUS_54770 106260 106784 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_54770 107681 106884 gene locus_tag LOCUS_54780 107681 106884 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_54780 107919 108122 gene locus_tag LOCUS_54790 107919 108122 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891980.1 protein_id gnl|my_center|LOCUS_54790 109554 108295 gene locus_tag LOCUS_54800 gene serS 109554 108295 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831496.1 protein_id gnl|my_center|LOCUS_54800 110529 109609 gene locus_tag LOCUS_54810 gene pheA 110529 109609 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_54810 111028 110585 gene locus_tag LOCUS_54820 111028 110585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 112379 111051 gene locus_tag LOCUS_54830 112379 111051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 112593 115217 gene locus_tag LOCUS_54840 112593 115217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 117341 116598 gene locus_tag LOCUS_54850 117341 116598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 117961 117575 gene locus_tag LOCUS_54860 117961 117575 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975744.1 protein_id gnl|my_center|LOCUS_54860 118195 118968 gene locus_tag LOCUS_54870 118195 118968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 120064 118943 gene locus_tag LOCUS_54880 120064 118943 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029200.1 protein_id gnl|my_center|LOCUS_54880 120818 120090 gene locus_tag LOCUS_54890 120818 120090 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_54890 121114 121281 gene locus_tag LOCUS_54900 121114 121281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 121547 122746 gene locus_tag LOCUS_54910 121547 122746 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466510.1 protein_id gnl|my_center|LOCUS_54910 123163 122729 gene locus_tag LOCUS_54920 123163 122729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 125202 123316 gene locus_tag LOCUS_54930 125202 123316 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257930.1 protein_id gnl|my_center|LOCUS_54930 125362 125943 gene locus_tag LOCUS_54940 125362 125943 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_54940 127292 125940 gene locus_tag LOCUS_54950 gene cytX 127292 125940 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256688.1 protein_id gnl|my_center|LOCUS_54950 127947 127615 gene locus_tag LOCUS_54960 127947 127615 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 protein_id gnl|my_center|LOCUS_54960 128892 127996 gene locus_tag LOCUS_54970 128892 127996 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_54970 130353 128944 gene locus_tag LOCUS_54980 130353 128944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 130626 131999 gene locus_tag LOCUS_54990 130626 131999 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026955.1 protein_id gnl|my_center|LOCUS_54990 131996 133066 gene locus_tag LOCUS_55000 131996 133066 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026954.1 protein_id gnl|my_center|LOCUS_55000 133768 133685 gene locus_tag LOCUS_t00590 133768 133685 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 133840 134601 gene locus_tag LOCUS_55010 133840 134601 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_55010 134619 135086 gene locus_tag LOCUS_55020 gene fhaB 134619 135086 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_55020 135083 136384 gene locus_tag LOCUS_55030 135083 136384 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776670.1 protein_id gnl|my_center|LOCUS_55030 136385 137764 gene locus_tag LOCUS_55040 136385 137764 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_55040 137761 139215 gene locus_tag LOCUS_55050 gene pbpA 137761 139215 CDS product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082861.1 protein_id gnl|my_center|LOCUS_55050 139212 140744 gene locus_tag LOCUS_55060 139212 140744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 140827 142692 gene locus_tag LOCUS_55070 gene pknB 140827 142692 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_55070 143295 142927 gene locus_tag LOCUS_55080 143295 142927 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947400.1 protein_id gnl|my_center|LOCUS_55080 143811 143365 gene locus_tag LOCUS_55090 143811 143365 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414734.1 protein_id gnl|my_center|LOCUS_55090 144135 143932 gene locus_tag LOCUS_55100 144135 143932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 144058 144816 gene locus_tag LOCUS_55110 144058 144816 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028612.1 protein_id gnl|my_center|LOCUS_55110 145834 145313 gene locus_tag LOCUS_55120 145834 145313 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 protein_id gnl|my_center|LOCUS_55120 146040 145882 gene locus_tag LOCUS_55130 146040 145882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 146760 146146 gene locus_tag LOCUS_55140 146760 146146 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776677.1 protein_id gnl|my_center|LOCUS_55140 147013 147258 gene locus_tag LOCUS_55150 gene crgA 147013 147258 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975080.1 protein_id gnl|my_center|LOCUS_55150 148264 147383 gene locus_tag LOCUS_55160 148264 147383 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495744.1 protein_id gnl|my_center|LOCUS_55160 148966 148433 gene locus_tag LOCUS_55170 148966 148433 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975078.1 protein_id gnl|my_center|LOCUS_55170 149130 149627 gene locus_tag LOCUS_55180 149130 149627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 149808 151085 gene locus_tag LOCUS_55190 149808 151085 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190904.1 protein_id gnl|my_center|LOCUS_55190 151475 151272 gene locus_tag LOCUS_55200 151475 151272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 152073 151573 gene locus_tag LOCUS_55210 152073 151573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 152570 152073 gene locus_tag LOCUS_55220 152570 152073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55220 154064 152685 gene locus_tag LOCUS_55230 gene lpdA 154064 152685 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283919.1 protein_id gnl|my_center|LOCUS_55230 154579 154977 gene locus_tag LOCUS_55240 154579 154977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 155078 154872 gene locus_tag LOCUS_55250 155078 154872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 155118 155723 gene locus_tag LOCUS_55260 155118 155723 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742088.1 protein_id gnl|my_center|LOCUS_55260 155764 156306 gene locus_tag LOCUS_55270 155764 156306 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222272.1 protein_id gnl|my_center|LOCUS_55270 156522 157304 gene locus_tag LOCUS_55280 156522 157304 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223645.1 protein_id gnl|my_center|LOCUS_55280 158327 157491 gene locus_tag LOCUS_55290 158327 157491 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466665.1 protein_id gnl|my_center|LOCUS_55290 158422 158964 gene locus_tag LOCUS_55300 158422 158964 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730328.1 protein_id gnl|my_center|LOCUS_55300 159024 159215 gene locus_tag LOCUS_55310 159024 159215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 163103 159396 gene locus_tag LOCUS_55320 163103 159396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 163325 166270 gene locus_tag LOCUS_55330 163325 166270 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 protein_id gnl|my_center|LOCUS_55330 167676 166363 gene locus_tag LOCUS_55340 167676 166363 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223198.1 protein_id gnl|my_center|LOCUS_55340 168165 167875 gene locus_tag LOCUS_55350 168165 167875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 168053 170521 gene locus_tag LOCUS_55360 168053 170521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 >Feature sequence038 861 3320 gene locus_tag LOCUS_55370 861 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 3383 4951 gene locus_tag LOCUS_55380 3383 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 5354 5890 gene locus_tag LOCUS_55390 5354 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55390 5830 6180 gene locus_tag LOCUS_55400 5830 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 6171 6377 gene locus_tag LOCUS_55410 6171 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 7670 6606 gene locus_tag LOCUS_55420 7670 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 9558 7681 gene locus_tag LOCUS_55430 9558 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 10352 9600 gene locus_tag LOCUS_55440 10352 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 11653 10367 gene locus_tag LOCUS_55450 11653 10367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55450 11822 12481 gene locus_tag LOCUS_55460 11822 12481 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_55460 12854 13276 gene locus_tag LOCUS_55470 12854 13276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55470 13367 14260 gene locus_tag LOCUS_55480 13367 14260 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224207.1 protein_id gnl|my_center|LOCUS_55480 15372 14470 gene locus_tag LOCUS_55490 15372 14470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 15350 16810 gene locus_tag LOCUS_55500 15350 16810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 18769 16919 gene locus_tag LOCUS_55510 18769 16919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55510 >Feature sequence039 6838 5900 gene locus_tag LOCUS_55520 6838 5900 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112261.1 protein_id gnl|my_center|LOCUS_55520 7463 6882 gene locus_tag LOCUS_55530 7463 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 7978 7553 gene locus_tag LOCUS_55540 7978 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 9625 8114 gene locus_tag LOCUS_55550 9625 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 9902 10315 gene locus_tag LOCUS_55560 9902 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 11611 10337 gene locus_tag LOCUS_55570 11611 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 11589 11723 gene locus_tag LOCUS_55580 11589 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 13817 11829 gene locus_tag LOCUS_55590 13817 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 14724 13822 gene locus_tag LOCUS_55600 14724 13822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 14963 14817 gene locus_tag LOCUS_55610 14963 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55610 15129 17663 gene locus_tag LOCUS_55620 15129 17663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 19058 17703 gene locus_tag LOCUS_55630 19058 17703 CDS product HEXXH motif domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229895.1 protein_id gnl|my_center|LOCUS_55630 20321 19107 gene locus_tag LOCUS_55640 20321 19107 CDS product FxsB family radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229894.1 protein_id gnl|my_center|LOCUS_55640 21548 20520 gene locus_tag LOCUS_55650 21548 20520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 22040 21675 gene locus_tag LOCUS_55660 22040 21675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55660 22564 22037 gene locus_tag LOCUS_55670 22564 22037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 22949 22722 gene locus_tag LOCUS_55680 22949 22722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 22966 23985 gene locus_tag LOCUS_55690 22966 23985 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226154.1 protein_id gnl|my_center|LOCUS_55690 23982 24863 gene locus_tag LOCUS_55700 23982 24863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727461.1 protein_id gnl|my_center|LOCUS_55700 24856 25797 gene locus_tag LOCUS_55710 24856 25797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748363.1 protein_id gnl|my_center|LOCUS_55710 25794 27158 gene locus_tag LOCUS_55720 25794 27158 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727463.1 protein_id gnl|my_center|LOCUS_55720 27155 27679 gene locus_tag LOCUS_55730 27155 27679 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728592.1 protein_id gnl|my_center|LOCUS_55730 27676 28500 gene locus_tag LOCUS_55740 27676 28500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 28923 29750 gene locus_tag LOCUS_55750 28923 29750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 29747 30817 gene locus_tag LOCUS_55760 29747 30817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 31460 30969 gene locus_tag LOCUS_55770 31460 30969 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976464.1 protein_id gnl|my_center|LOCUS_55770 32341 31565 gene locus_tag LOCUS_55780 32341 31565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 32947 32351 gene locus_tag LOCUS_55790 32947 32351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 33407 32958 gene locus_tag LOCUS_55800 33407 32958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 34568 33612 gene locus_tag LOCUS_55810 34568 33612 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227751.1 protein_id gnl|my_center|LOCUS_55810 34660 35064 gene locus_tag LOCUS_55820 34660 35064 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227750.1 protein_id gnl|my_center|LOCUS_55820 35468 35881 gene locus_tag LOCUS_55830 35468 35881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 36549 36217 gene locus_tag LOCUS_55840 36549 36217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 37806 36688 gene locus_tag LOCUS_55850 37806 36688 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165521786.1 protein_id gnl|my_center|LOCUS_55850 39173 37953 gene locus_tag LOCUS_55860 39173 37953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 <40780 39278 gene locus_tag LOCUS_55870 <40780 39278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228648.1:histidine kinase >Feature sequence040 1249 1007 gene locus_tag LOCUS_55880 1249 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 3434 1896 gene locus_tag LOCUS_55890 3434 1896 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228653.1 protein_id gnl|my_center|LOCUS_55890 5967 3472 gene locus_tag LOCUS_55900 5967 3472 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227744.1 protein_id gnl|my_center|LOCUS_55900 5926 6333 gene locus_tag LOCUS_55910 5926 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 6494 8164 gene locus_tag LOCUS_55920 6494 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 8172 9323 gene locus_tag LOCUS_55930 8172 9323 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_55930 9408 11048 gene locus_tag LOCUS_55940 9408 11048 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110774.1 protein_id gnl|my_center|LOCUS_55940 11050 11772 gene locus_tag LOCUS_55950 11050 11772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 12601 11834 gene locus_tag LOCUS_55960 gene map 12601 11834 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972570.1 protein_id gnl|my_center|LOCUS_55960 12684 12947 gene locus_tag LOCUS_55970 12684 12947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 13385 13029 gene locus_tag LOCUS_55980 13385 13029 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229185.1 protein_id gnl|my_center|LOCUS_55980 14625 13411 gene locus_tag LOCUS_55990 14625 13411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 14935 19107 gene locus_tag LOCUS_56000 14935 19107 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227688.1 protein_id gnl|my_center|LOCUS_56000 19104 19412 gene locus_tag LOCUS_56010 19104 19412 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227689.1 protein_id gnl|my_center|LOCUS_56010 19474 20562 gene locus_tag LOCUS_56020 19474 20562 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223896.1 protein_id gnl|my_center|LOCUS_56020 20735 21682 gene locus_tag LOCUS_56030 20735 21682 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229677.1 protein_id gnl|my_center|LOCUS_56030 24900 21715 gene locus_tag LOCUS_56040 24900 21715 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441479.1 protein_id gnl|my_center|LOCUS_56040 25442 26290 gene locus_tag LOCUS_56050 25442 26290 CDS product NPP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031599.1 protein_id gnl|my_center|LOCUS_56050 26550 30458 gene locus_tag LOCUS_56060 26550 30458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 30529 31713 gene locus_tag LOCUS_56070 30529 31713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 32351 31734 gene locus_tag LOCUS_56080 32351 31734 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228649.1 protein_id gnl|my_center|LOCUS_56080 35143 32531 gene locus_tag LOCUS_56090 35143 32531 CDS product exo 1,3/1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229330.1 protein_id gnl|my_center|LOCUS_56090 35880 35140 gene locus_tag LOCUS_56100 35880 35140 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143042.1 protein_id gnl|my_center|LOCUS_56100 36904 35870 gene locus_tag LOCUS_56110 36904 35870 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227355.1 protein_id gnl|my_center|LOCUS_56110 38315 37038 gene locus_tag LOCUS_56120 38315 37038 CDS product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095558.1 protein_id gnl|my_center|LOCUS_56120 39924 38338 gene locus_tag LOCUS_56130 39924 38338 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928898.1 protein_id gnl|my_center|LOCUS_56130 41133 39946 gene locus_tag LOCUS_56140 41133 39946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 42368 41130 gene locus_tag LOCUS_56150 42368 41130 CDS product galactosyltransferase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229690.1 protein_id gnl|my_center|LOCUS_56150 43826 42564 gene locus_tag LOCUS_56160 43826 42564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 44838 43918 gene locus_tag LOCUS_56170 gene cysD 44838 43918 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086386.1 protein_id gnl|my_center|LOCUS_56170 45617 44835 gene locus_tag LOCUS_56180 45617 44835 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_56180 46573 45602 gene locus_tag LOCUS_56190 46573 45602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 47493 46597 gene locus_tag LOCUS_56200 47493 46597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 48505 47507 gene locus_tag LOCUS_56210 48505 47507 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061496786.1 protein_id gnl|my_center|LOCUS_56210 49275 48502 gene locus_tag LOCUS_56220 49275 48502 CDS product 1-deoxy-D-xylulose-5-phosphate synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101028.1 protein_id gnl|my_center|LOCUS_56220 51221 49272 gene locus_tag LOCUS_56230 51221 49272 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101027.1 protein_id gnl|my_center|LOCUS_56230 52240 51212 gene locus_tag LOCUS_56240 gene argC 52240 51212 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101026.1 protein_id gnl|my_center|LOCUS_56240 53145 52237 gene locus_tag LOCUS_56250 53145 52237 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101023.1 protein_id gnl|my_center|LOCUS_56250 53323 53138 gene locus_tag LOCUS_56260 53323 53138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869195.1 protein_id gnl|my_center|LOCUS_56260 54156 53470 gene locus_tag LOCUS_56270 54156 53470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 54526 57273 gene locus_tag LOCUS_56280 54526 57273 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225440415.1 protein_id gnl|my_center|LOCUS_56280 57670 58518 gene locus_tag LOCUS_56290 57670 58518 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226056.1 protein_id gnl|my_center|LOCUS_56290 58755 59168 gene locus_tag LOCUS_56300 58755 59168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 60152 59379 gene locus_tag LOCUS_56310 60152 59379 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_56310 60882 60262 gene locus_tag LOCUS_56320 60882 60262 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 protein_id gnl|my_center|LOCUS_56320 62138 61011 gene locus_tag LOCUS_56330 62138 61011 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 protein_id gnl|my_center|LOCUS_56330 62321 63940 gene locus_tag LOCUS_56340 62321 63940 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027406.1 protein_id gnl|my_center|LOCUS_56340 64420 63959 gene locus_tag LOCUS_56350 64420 63959 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048393.1 protein_id gnl|my_center|LOCUS_56350 64612 65226 gene locus_tag LOCUS_56360 64612 65226 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742088.1 protein_id gnl|my_center|LOCUS_56360 65223 65966 gene locus_tag LOCUS_56370 65223 65966 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226469.1 protein_id gnl|my_center|LOCUS_56370 66099 66323 gene locus_tag LOCUS_56380 66099 66323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 66488 66916 gene locus_tag LOCUS_56390 66488 66916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56390 68116 67838 gene locus_tag LOCUS_56400 68116 67838 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223899.1 protein_id gnl|my_center|LOCUS_56400 69199 68120 gene locus_tag LOCUS_56410 69199 68120 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_56410 69626 69327 gene locus_tag LOCUS_56420 69626 69327 CDS product DUF6510 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729807.1 protein_id gnl|my_center|LOCUS_56420 70368 69628 gene locus_tag LOCUS_56430 70368 69628 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223384.1 protein_id gnl|my_center|LOCUS_56430 70964 70365 gene locus_tag LOCUS_56440 70964 70365 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223383.1 protein_id gnl|my_center|LOCUS_56440 71926 72804 gene locus_tag LOCUS_56450 71926 72804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 73036 74595 gene locus_tag LOCUS_56460 73036 74595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 74592 76007 gene locus_tag LOCUS_56470 74592 76007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 76004 80344 gene locus_tag LOCUS_56480 76004 80344 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052667156.1 protein_id gnl|my_center|LOCUS_56480 80500 80781 gene locus_tag LOCUS_56490 80500 80781 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_56490 81739 80819 gene locus_tag LOCUS_56500 81739 80819 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_56500 82785 81757 gene locus_tag LOCUS_56510 82785 81757 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030592.1 protein_id gnl|my_center|LOCUS_56510 84208 82787 gene locus_tag LOCUS_56520 gene ngcE 84208 82787 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_56520 85088 84330 gene locus_tag LOCUS_56530 85088 84330 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732177.1 protein_id gnl|my_center|LOCUS_56530 85770 85414 gene locus_tag LOCUS_56540 85770 85414 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977724.1 protein_id gnl|my_center|LOCUS_56540 85925 87022 gene locus_tag LOCUS_56550 85925 87022 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977723.1 protein_id gnl|my_center|LOCUS_56550 87117 87644 gene locus_tag LOCUS_56560 87117 87644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 88555 87647 gene locus_tag LOCUS_56570 88555 87647 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030936.1 protein_id gnl|my_center|LOCUS_56570 89924 88614 gene locus_tag LOCUS_56580 89924 88614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 90151 91446 gene locus_tag LOCUS_56590 90151 91446 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929215.1 protein_id gnl|my_center|LOCUS_56590 91446 92432 gene locus_tag LOCUS_56600 91446 92432 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_56600 92422 93246 gene locus_tag LOCUS_56610 92422 93246 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257156.1 protein_id gnl|my_center|LOCUS_56610 94036 93278 gene locus_tag LOCUS_56620 94036 93278 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031462.1 protein_id gnl|my_center|LOCUS_56620 95034 94177 gene locus_tag LOCUS_56630 95034 94177 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224928.1 protein_id gnl|my_center|LOCUS_56630 95148 95555 gene locus_tag LOCUS_56640 95148 95555 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973421.1 protein_id gnl|my_center|LOCUS_56640 95591 96553 gene locus_tag LOCUS_56650 95591 96553 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_56650 96747 97418 gene locus_tag LOCUS_56660 96747 97418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 97477 98082 gene locus_tag LOCUS_56670 97477 98082 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098365.1 protein_id gnl|my_center|LOCUS_56670 98112 98855 gene locus_tag LOCUS_56680 98112 98855 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071069.1 protein_id gnl|my_center|LOCUS_56680 99397 98936 gene locus_tag LOCUS_56690 99397 98936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 99499 100188 gene locus_tag LOCUS_56700 99499 100188 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_56700 100203 101462 gene locus_tag LOCUS_56710 100203 101462 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027197.1 protein_id gnl|my_center|LOCUS_56710 101654 102091 gene locus_tag LOCUS_56720 101654 102091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 102910 102278 gene locus_tag LOCUS_56730 102910 102278 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971839.1 protein_id gnl|my_center|LOCUS_56730 103783 103037 gene locus_tag LOCUS_56740 103783 103037 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 protein_id gnl|my_center|LOCUS_56740 107362 104357 gene locus_tag LOCUS_56750 107362 104357 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226639.1 protein_id gnl|my_center|LOCUS_56750 107583 107837 gene locus_tag LOCUS_56760 107583 107837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 >Feature sequence041 <1 505 gene locus_tag LOCUS_56770 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030540.1:endo-1,4-beta-xylanase 3513 610 gene locus_tag LOCUS_56780 3513 610 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 protein_id gnl|my_center|LOCUS_56780 3745 4206 gene locus_tag LOCUS_56790 3745 4206 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_56790 4492 5400 gene locus_tag LOCUS_56800 4492 5400 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030725.1 protein_id gnl|my_center|LOCUS_56800 5543 5953 gene locus_tag LOCUS_56810 5543 5953 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090019.1 protein_id gnl|my_center|LOCUS_56810 6151 7005 gene locus_tag LOCUS_56820 6151 7005 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027090.1 protein_id gnl|my_center|LOCUS_56820 8148 7126 gene locus_tag LOCUS_56830 8148 7126 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476103.1 protein_id gnl|my_center|LOCUS_56830 8264 8776 gene locus_tag LOCUS_56840 8264 8776 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226147.1 protein_id gnl|my_center|LOCUS_56840 9790 8855 gene locus_tag LOCUS_56850 9790 8855 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804906.1 protein_id gnl|my_center|LOCUS_56850 10060 10359 gene locus_tag LOCUS_56860 10060 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 12377 10401 gene locus_tag LOCUS_56870 12377 10401 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189868312.1 protein_id gnl|my_center|LOCUS_56870 12636 14519 gene locus_tag LOCUS_56880 gene recQ 12636 14519 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224869.1 protein_id gnl|my_center|LOCUS_56880 15591 14605 gene locus_tag LOCUS_56890 15591 14605 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_56890 16675 15704 gene locus_tag LOCUS_56900 16675 15704 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731488.1 protein_id gnl|my_center|LOCUS_56900 18124 17129 gene locus_tag LOCUS_56910 18124 17129 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728156.1 protein_id gnl|my_center|LOCUS_56910 18688 18239 gene locus_tag LOCUS_56920 18688 18239 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222796.1 protein_id gnl|my_center|LOCUS_56920 22823 18954 gene locus_tag LOCUS_56930 22823 18954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223680.1 protein_id gnl|my_center|LOCUS_56930 23367 22846 gene locus_tag LOCUS_56940 23367 22846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56940 23608 24330 gene locus_tag LOCUS_56950 23608 24330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 24332 25237 gene locus_tag LOCUS_56960 24332 25237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 25247 27382 gene locus_tag LOCUS_56970 25247 27382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121008027.1 protein_id gnl|my_center|LOCUS_56970 28355 27267 gene locus_tag LOCUS_56980 28355 27267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211351449.1 protein_id gnl|my_center|LOCUS_56980 29346 28423 gene locus_tag LOCUS_56990 29346 28423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 32922 29362 gene locus_tag LOCUS_57000 gene fxsT 32922 29362 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184695823.1 protein_id gnl|my_center|LOCUS_57000 33174 32974 gene locus_tag LOCUS_57010 33174 32974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57010 33250 34374 gene locus_tag LOCUS_57020 33250 34374 CDS product FxsB family radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229894.1 protein_id gnl|my_center|LOCUS_57020 34371 35747 gene locus_tag LOCUS_57030 34371 35747 CDS product HEXXH motif domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229895.1 protein_id gnl|my_center|LOCUS_57030 35804 36316 gene locus_tag LOCUS_57040 35804 36316 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224813.1 protein_id gnl|my_center|LOCUS_57040 40991 36411 gene locus_tag LOCUS_57050 40991 36411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 41354 41956 gene locus_tag LOCUS_57060 41354 41956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 42205 41966 gene locus_tag LOCUS_57070 42205 41966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57070 42511 42257 gene locus_tag LOCUS_57080 42511 42257 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 protein_id gnl|my_center|LOCUS_57080 42672 42508 gene locus_tag LOCUS_57090 gene rpmG 42672 42508 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858439.1 protein_id gnl|my_center|LOCUS_57090 42944 43357 gene locus_tag LOCUS_57100 42944 43357 CDS product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225419.1 protein_id gnl|my_center|LOCUS_57100 43365 43748 gene locus_tag LOCUS_57110 43365 43748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57110 44282 43767 gene locus_tag LOCUS_57120 44282 43767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 44515 45297 gene locus_tag LOCUS_57130 44515 45297 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385588.1 protein_id gnl|my_center|LOCUS_57130 46065 45406 gene locus_tag LOCUS_57140 46065 45406 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_57140 47405 46062 gene locus_tag LOCUS_57150 47405 46062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57150 47566 48102 gene locus_tag LOCUS_57160 47566 48102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 48219 49439 gene locus_tag LOCUS_57170 48219 49439 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306837.1 protein_id gnl|my_center|LOCUS_57170 48311 48405 gene locus_tag LOCUS_t00600 48311 48405 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 49436 50233 gene locus_tag LOCUS_57180 49436 50233 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225402.1 protein_id gnl|my_center|LOCUS_57180 50230 51423 gene locus_tag LOCUS_57190 50230 51423 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_57190 52704 51478 gene locus_tag LOCUS_57200 52704 51478 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230104.1 protein_id gnl|my_center|LOCUS_57200 53023 53706 gene locus_tag LOCUS_57210 53023 53706 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020206.1 protein_id gnl|my_center|LOCUS_57210 53971 54465 gene locus_tag LOCUS_57220 53971 54465 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973265.1 protein_id gnl|my_center|LOCUS_57220 54744 55385 gene locus_tag LOCUS_57230 54744 55385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405892.1 protein_id gnl|my_center|LOCUS_57230 55382 56998 gene locus_tag LOCUS_57240 55382 56998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 57009 58328 gene locus_tag LOCUS_57250 57009 58328 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226634.1 protein_id gnl|my_center|LOCUS_57250 61784 58494 gene locus_tag LOCUS_57260 61784 58494 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_57260 61869 62939 gene locus_tag LOCUS_57270 61869 62939 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107451924.1 protein_id gnl|my_center|LOCUS_57270 63130 64383 gene locus_tag LOCUS_57280 63130 64383 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742147.1 protein_id gnl|my_center|LOCUS_57280 64428 64640 gene locus_tag LOCUS_57290 64428 64640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57290 64684 65016 gene locus_tag LOCUS_57300 64684 65016 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413663.1 protein_id gnl|my_center|LOCUS_57300 66337 65033 gene locus_tag LOCUS_57310 66337 65033 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_57310 66614 66973 gene locus_tag LOCUS_57320 66614 66973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57320 67065 68162 gene locus_tag LOCUS_57330 67065 68162 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088561.1 protein_id gnl|my_center|LOCUS_57330 68159 69415 gene locus_tag LOCUS_57340 68159 69415 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132388.1 protein_id gnl|my_center|LOCUS_57340 69566 70321 gene locus_tag LOCUS_57350 69566 70321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 70463 70921 gene locus_tag LOCUS_57360 70463 70921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 70964 71233 gene locus_tag LOCUS_57370 70964 71233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57370 71485 72288 gene locus_tag LOCUS_57380 71485 72288 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_57380 72462 73022 gene locus_tag LOCUS_57390 72462 73022 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 protein_id gnl|my_center|LOCUS_57390 73570 73112 gene locus_tag LOCUS_57400 73570 73112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 73944 74357 gene locus_tag LOCUS_57410 73944 74357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 74455 74685 gene locus_tag LOCUS_57420 74455 74685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 74728 75552 gene locus_tag LOCUS_57430 74728 75552 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889073.1 protein_id gnl|my_center|LOCUS_57430 75556 76473 gene locus_tag LOCUS_57440 75556 76473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304036.1 protein_id gnl|my_center|LOCUS_57440 77239 76658 gene locus_tag LOCUS_57450 77239 76658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57450 77836 77486 gene locus_tag LOCUS_57460 77836 77486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57460 78685 77990 gene locus_tag LOCUS_57470 78685 77990 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028084.1 protein_id gnl|my_center|LOCUS_57470 79186 79860 gene locus_tag LOCUS_57480 79186 79860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57480 79910 80323 gene locus_tag LOCUS_57490 79910 80323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57490 80442 80221 gene locus_tag LOCUS_57500 80442 80221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57500 81022 80477 gene locus_tag LOCUS_57510 81022 80477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 81629 81557 gene locus_tag LOCUS_t00610 81629 81557 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 81760 82335 gene locus_tag LOCUS_57520 gene dcd 81760 82335 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_57520 82965 83582 gene locus_tag LOCUS_57530 82965 83582 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_57530 83583 84581 gene locus_tag LOCUS_57540 gene pitH 83583 84581 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_57540 85634 84636 gene locus_tag LOCUS_57550 gene mshD 85634 84636 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404307.1 protein_id gnl|my_center|LOCUS_57550 85735 87456 gene locus_tag LOCUS_57560 85735 87456 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230897.1 protein_id gnl|my_center|LOCUS_57560 88615 87896 gene locus_tag LOCUS_57570 gene glnR 88615 87896 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_57570 88910 89167 gene locus_tag LOCUS_57580 88910 89167 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 protein_id gnl|my_center|LOCUS_57580 89354 90031 gene locus_tag LOCUS_57590 89354 90031 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230718.1 protein_id gnl|my_center|LOCUS_57590 90024 90716 gene locus_tag LOCUS_57600 90024 90716 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_57600 90713 91573 gene locus_tag LOCUS_57610 90713 91573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57610 91803 92288 gene locus_tag LOCUS_57620 91803 92288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 92493 92903 gene locus_tag LOCUS_57630 92493 92903 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230720.1 protein_id gnl|my_center|LOCUS_57630 92919 93758 gene locus_tag LOCUS_57640 92919 93758 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974806.1 protein_id gnl|my_center|LOCUS_57640 93755 94057 gene locus_tag LOCUS_57650 93755 94057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57650 94182 95609 gene locus_tag LOCUS_57660 94182 95609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57660 96330 95494 gene locus_tag LOCUS_57670 96330 95494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57670 96992 96327 gene locus_tag LOCUS_57680 96992 96327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57680 97696 96992 gene locus_tag LOCUS_57690 97696 96992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57690 97985 99253 gene locus_tag LOCUS_57700 97985 99253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 100032 99217 gene locus_tag LOCUS_57710 100032 99217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 100751 100029 gene locus_tag LOCUS_57720 100751 100029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 100958 102904 gene locus_tag LOCUS_57730 100958 102904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 102986 106084 gene locus_tag LOCUS_57740 102986 106084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 106213 107442 gene locus_tag LOCUS_57750 106213 107442 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_57750 107432 108145 gene locus_tag LOCUS_57760 107432 108145 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 protein_id gnl|my_center|LOCUS_57760 108571 108221 gene locus_tag LOCUS_57770 108571 108221 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 protein_id gnl|my_center|LOCUS_57770 108684 109172 gene locus_tag LOCUS_57780 108684 109172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 109840 110253 gene locus_tag LOCUS_57790 109840 110253 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_57790 110488 111546 gene locus_tag LOCUS_57800 110488 111546 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_57800 112178 111753 gene locus_tag LOCUS_57810 gene dtd 112178 111753 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029487.1 protein_id gnl|my_center|LOCUS_57810 112296 113252 gene locus_tag LOCUS_57820 112296 113252 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_57820 114908 113280 gene locus_tag LOCUS_57830 114908 113280 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223053.1 protein_id gnl|my_center|LOCUS_57830 115358 115023 gene locus_tag LOCUS_57840 115358 115023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57840 115979 115533 gene locus_tag LOCUS_57850 115979 115533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 116462 115983 gene locus_tag LOCUS_57860 116462 115983 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222362.1 protein_id gnl|my_center|LOCUS_57860 117660 116734 gene locus_tag LOCUS_57870 117660 116734 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729216.1 protein_id gnl|my_center|LOCUS_57870 118013 117657 gene locus_tag LOCUS_57880 118013 117657 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908695.1 protein_id gnl|my_center|LOCUS_57880 120403 118193 gene locus_tag LOCUS_57890 120403 118193 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811993.1 protein_id gnl|my_center|LOCUS_57890 121313 120471 gene locus_tag LOCUS_57900 121313 120471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_57900 122088 121366 gene locus_tag LOCUS_57910 122088 121366 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031214.1 protein_id gnl|my_center|LOCUS_57910 122310 123599 gene locus_tag LOCUS_57920 gene mshA 122310 123599 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326818.1 protein_id gnl|my_center|LOCUS_57920 123745 124239 gene locus_tag LOCUS_57930 123745 124239 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222390.1 protein_id gnl|my_center|LOCUS_57930 124309 125058 gene locus_tag LOCUS_57940 124309 125058 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_57940 125828 125160 gene locus_tag LOCUS_57950 gene phoU 125828 125160 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_57950 125935 127107 gene locus_tag LOCUS_57960 125935 127107 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_57960 127104 127793 gene locus_tag LOCUS_57970 127104 127793 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_57970 128576 127947 gene locus_tag LOCUS_57980 128576 127947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 128839 129321 gene locus_tag LOCUS_57990 128839 129321 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_57990 129339 129797 gene locus_tag LOCUS_58000 gene ispF 129339 129797 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804549.1 protein_id gnl|my_center|LOCUS_58000 130353 130084 gene locus_tag LOCUS_58010 130353 130084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 132101 130485 gene locus_tag LOCUS_58020 132101 130485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 132445 133842 gene locus_tag LOCUS_58030 gene cysS 132445 133842 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_58030 133864 134844 gene locus_tag LOCUS_58040 gene rlmB 133864 134844 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_58040 135010 135087 gene locus_tag LOCUS_t00620 135010 135087 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 135568 135338 gene locus_tag LOCUS_58050 135568 135338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58050 135593 136726 gene locus_tag LOCUS_58060 135593 136726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 136916 139606 gene locus_tag LOCUS_58070 gene ppsA 136916 139606 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201372230.1 protein_id gnl|my_center|LOCUS_58070 140518 139640 gene locus_tag LOCUS_58080 140518 139640 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108987323.1 protein_id gnl|my_center|LOCUS_58080 140599 141834 gene locus_tag LOCUS_58090 140599 141834 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208741.1 protein_id gnl|my_center|LOCUS_58090 142379 144094 gene locus_tag LOCUS_58100 142379 144094 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730691.1 protein_id gnl|my_center|LOCUS_58100 144091 145947 gene locus_tag LOCUS_58110 144091 145947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 protein_id gnl|my_center|LOCUS_58110 148511 146217 gene locus_tag LOCUS_58120 148511 146217 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_58120 149110 148736 gene locus_tag LOCUS_58130 149110 148736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58130 149262 151073 gene locus_tag LOCUS_58140 149262 151073 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776624.1 protein_id gnl|my_center|LOCUS_58140 151348 152409 gene locus_tag LOCUS_58150 151348 152409 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028801.1 protein_id gnl|my_center|LOCUS_58150 152409 153173 gene locus_tag LOCUS_58160 gene cbiQ 152409 153173 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_58160 153170 153922 gene locus_tag LOCUS_58170 153170 153922 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_58170 154052 154393 gene locus_tag LOCUS_58180 154052 154393 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229185.1 protein_id gnl|my_center|LOCUS_58180 154441 155214 gene locus_tag LOCUS_58190 154441 155214 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063198.1 protein_id gnl|my_center|LOCUS_58190 155245 156009 gene locus_tag LOCUS_58200 155245 156009 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808209.1 protein_id gnl|my_center|LOCUS_58200 156154 156795 gene locus_tag LOCUS_58210 156154 156795 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229455.1 protein_id gnl|my_center|LOCUS_58210 156834 157262 gene locus_tag LOCUS_58220 156834 157262 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112732.1 protein_id gnl|my_center|LOCUS_58220 158403 157291 gene locus_tag LOCUS_58230 gene serC 158403 157291 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_58230 159739 158633 gene locus_tag LOCUS_58240 159739 158633 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_58240 159910 160563 gene locus_tag LOCUS_58250 gene pdxH 159910 160563 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 protein_id gnl|my_center|LOCUS_58250 160656 161909 gene locus_tag LOCUS_58260 160656 161909 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_58260 162173 162877 gene locus_tag LOCUS_58270 162173 162877 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_58270 163046 165283 gene locus_tag LOCUS_58280 163046 165283 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161102907.1 protein_id gnl|my_center|LOCUS_58280 165574 165410 gene locus_tag LOCUS_58290 165574 165410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 >Feature sequence042 779 1612 gene locus_tag LOCUS_58300 779 1612 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_58300 1902 2612 gene locus_tag LOCUS_58310 1902 2612 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_58310 2955 4391 gene locus_tag LOCUS_58320 2955 4391 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968432.1 protein_id gnl|my_center|LOCUS_58320 4486 4803 gene locus_tag LOCUS_58330 4486 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58330 4953 5222 gene locus_tag LOCUS_58340 4953 5222 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878317.1 protein_id gnl|my_center|LOCUS_58340 5306 6640 gene locus_tag LOCUS_58350 5306 6640 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_58350 6684 7262 gene locus_tag LOCUS_58360 6684 7262 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730499.1 protein_id gnl|my_center|LOCUS_58360 7306 8229 gene locus_tag LOCUS_58370 7306 8229 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730500.1 protein_id gnl|my_center|LOCUS_58370 8449 9447 gene locus_tag LOCUS_58380 gene gap 8449 9447 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_58380 9471 10130 gene locus_tag LOCUS_58390 9471 10130 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031734.1 protein_id gnl|my_center|LOCUS_58390 10327 10812 gene locus_tag LOCUS_58400 10327 10812 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 protein_id gnl|my_center|LOCUS_58400 11854 10892 gene locus_tag LOCUS_58410 11854 10892 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026893.1 protein_id gnl|my_center|LOCUS_58410 12041 12607 gene locus_tag LOCUS_58420 12041 12607 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 protein_id gnl|my_center|LOCUS_58420 16859 14094 gene locus_tag LOCUS_58430 16859 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 17234 18577 gene locus_tag LOCUS_58440 17234 18577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58440 20579 19353 gene locus_tag LOCUS_58450 20579 19353 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727016.1 protein_id gnl|my_center|LOCUS_58450 22326 20908 gene locus_tag LOCUS_58460 22326 20908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_58460 22507 23142 gene locus_tag LOCUS_58470 22507 23142 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 protein_id gnl|my_center|LOCUS_58470 23209 24249 gene locus_tag LOCUS_58480 23209 24249 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976251.1 protein_id gnl|my_center|LOCUS_58480 24392 25792 gene locus_tag LOCUS_58490 24392 25792 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223336.1 protein_id gnl|my_center|LOCUS_58490 26063 26392 gene locus_tag LOCUS_58500 26063 26392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 27476 28978 gene locus_tag LOCUS_58510 27476 28978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 29656 29078 gene locus_tag LOCUS_58520 29656 29078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 30863 29865 gene locus_tag LOCUS_58530 30863 29865 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_58530 32460 31024 gene locus_tag LOCUS_58540 32460 31024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58540 33003 33260 gene locus_tag LOCUS_58550 33003 33260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 33368 34021 gene locus_tag LOCUS_58560 33368 34021 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971974.1 protein_id gnl|my_center|LOCUS_58560 34342 35616 gene locus_tag LOCUS_58570 34342 35616 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971975.1 protein_id gnl|my_center|LOCUS_58570 35606 36613 gene locus_tag LOCUS_58580 35606 36613 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031475.1 protein_id gnl|my_center|LOCUS_58580 36610 37485 gene locus_tag LOCUS_58590 36610 37485 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971977.1 protein_id gnl|my_center|LOCUS_58590 37482 39371 gene locus_tag LOCUS_58600 37482 39371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_58600 39378 40169 gene locus_tag LOCUS_58610 39378 40169 CDS product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871852.1 protein_id gnl|my_center|LOCUS_58610 40370 41662 gene locus_tag LOCUS_58620 gene aceA 40370 41662 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223536.1 protein_id gnl|my_center|LOCUS_58620 43384 41783 gene locus_tag LOCUS_58630 43384 41783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 44615 43626 gene locus_tag LOCUS_58640 44615 43626 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_58640 45280 44939 gene locus_tag LOCUS_58650 45280 44939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 45191 45763 gene locus_tag LOCUS_58660 45191 45763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 45768 46565 gene locus_tag LOCUS_58670 45768 46565 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028652.1 protein_id gnl|my_center|LOCUS_58670 46572 47348 gene locus_tag LOCUS_58680 46572 47348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58680 47858 47355 gene locus_tag LOCUS_58690 47858 47355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58690 48039 48680 gene locus_tag LOCUS_58700 48039 48680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 49049 49807 gene locus_tag LOCUS_58710 49049 49807 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974977.1 protein_id gnl|my_center|LOCUS_58710 49968 50597 gene locus_tag LOCUS_58720 49968 50597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 50653 52077 gene locus_tag LOCUS_58730 50653 52077 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_58730 52946 52107 gene locus_tag LOCUS_58740 gene folP 52946 52107 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327205.1 protein_id gnl|my_center|LOCUS_58740 53902 53033 gene locus_tag LOCUS_58750 53902 53033 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525156.1 protein_id gnl|my_center|LOCUS_58750 54781 55752 gene locus_tag LOCUS_58760 54781 55752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_58760 55931 58063 gene locus_tag LOCUS_58770 55931 58063 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804545.1 protein_id gnl|my_center|LOCUS_58770 60139 58151 gene locus_tag LOCUS_58780 60139 58151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 60509 61873 gene locus_tag LOCUS_58790 60509 61873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58790 61911 62153 gene locus_tag LOCUS_58800 61911 62153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 63777 62218 gene locus_tag LOCUS_58810 63777 62218 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225021.1 protein_id gnl|my_center|LOCUS_58810 64487 63774 gene locus_tag LOCUS_58820 64487 63774 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225022.1 protein_id gnl|my_center|LOCUS_58820 65400 64546 gene locus_tag LOCUS_58830 65400 64546 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144635466.1 protein_id gnl|my_center|LOCUS_58830 66293 65397 gene locus_tag LOCUS_58840 66293 65397 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225025.1 protein_id gnl|my_center|LOCUS_58840 66575 67429 gene locus_tag LOCUS_58850 66575 67429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58850 <68424 67426 gene locus_tag LOCUS_58860 <68424 67426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014876734.1:ROK family transcriptional regulator >Feature sequence043 355 2235 gene locus_tag LOCUS_58870 gene edd 355 2235 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086678338.1 protein_id gnl|my_center|LOCUS_58870 2232 3299 gene locus_tag LOCUS_58880 2232 3299 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951113.1 protein_id gnl|my_center|LOCUS_58880 3296 3910 gene locus_tag LOCUS_58890 gene eda 3296 3910 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_58890 5380 3947 gene locus_tag LOCUS_58900 5380 3947 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225068.1 protein_id gnl|my_center|LOCUS_58900 6939 5536 gene locus_tag LOCUS_58910 6939 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 8735 7275 gene locus_tag LOCUS_58920 8735 7275 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225068.1 protein_id gnl|my_center|LOCUS_58920 9734 9030 gene locus_tag LOCUS_58930 9734 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976844.1 protein_id gnl|my_center|LOCUS_58930 10695 9982 gene locus_tag LOCUS_58940 10695 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 10859 11728 gene locus_tag LOCUS_58950 10859 11728 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_58950 11725 11952 gene locus_tag LOCUS_58960 11725 11952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 13150 12143 gene locus_tag LOCUS_58970 13150 12143 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029013.1 protein_id gnl|my_center|LOCUS_58970 13624 14595 gene locus_tag LOCUS_58980 13624 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 14597 16216 gene locus_tag LOCUS_58990 14597 16216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58990 16368 17294 gene locus_tag LOCUS_59000 16368 17294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 18416 17391 gene locus_tag LOCUS_59010 18416 17391 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_59010 20043 18427 gene locus_tag LOCUS_59020 20043 18427 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_59020 20968 20087 gene locus_tag LOCUS_59030 20968 20087 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_59030 21957 20962 gene locus_tag LOCUS_59040 21957 20962 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976584.1 protein_id gnl|my_center|LOCUS_59040 23259 21961 gene locus_tag LOCUS_59050 23259 21961 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_59050 23598 24992 gene locus_tag LOCUS_59060 23598 24992 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977118.1 protein_id gnl|my_center|LOCUS_59060 25667 25050 gene locus_tag LOCUS_59070 25667 25050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59070 27159 25828 gene locus_tag LOCUS_59080 27159 25828 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227778.1 protein_id gnl|my_center|LOCUS_59080 27434 28789 gene locus_tag LOCUS_59090 27434 28789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 28960 31020 gene locus_tag LOCUS_59100 28960 31020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59100 31153 32109 gene locus_tag LOCUS_59110 31153 32109 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974094.1 protein_id gnl|my_center|LOCUS_59110 32106 33377 gene locus_tag LOCUS_59120 32106 33377 CDS product alpha-2,8-polysialyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029922.1 protein_id gnl|my_center|LOCUS_59120 34561 33374 gene locus_tag LOCUS_59130 34561 33374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 35941 34730 gene locus_tag LOCUS_59140 35941 34730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59140 36957 35938 gene locus_tag LOCUS_59150 36957 35938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974090.1 protein_id gnl|my_center|LOCUS_59150 37567 38271 gene locus_tag LOCUS_59160 37567 38271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 38760 40091 gene locus_tag LOCUS_59170 38760 40091 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 protein_id gnl|my_center|LOCUS_59170 40278 41312 gene locus_tag LOCUS_59180 40278 41312 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028590.1 protein_id gnl|my_center|LOCUS_59180 41309 42193 gene locus_tag LOCUS_59190 41309 42193 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224316.1 protein_id gnl|my_center|LOCUS_59190 42190 43623 gene locus_tag LOCUS_59200 42190 43623 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_59200 43653 44675 gene locus_tag LOCUS_59210 43653 44675 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 protein_id gnl|my_center|LOCUS_59210 44770 46089 gene locus_tag LOCUS_59220 44770 46089 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_59220 46941 46198 gene locus_tag LOCUS_59230 46941 46198 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033260715.1 protein_id gnl|my_center|LOCUS_59230 47776 47264 gene locus_tag LOCUS_59240 47776 47264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59240 48189 49082 gene locus_tag LOCUS_59250 48189 49082 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804906.1 protein_id gnl|my_center|LOCUS_59250 49140 50138 gene locus_tag LOCUS_59260 49140 50138 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223218.1 protein_id gnl|my_center|LOCUS_59260 50921 50352 gene locus_tag LOCUS_59270 50921 50352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 51043 52272 gene locus_tag LOCUS_59280 51043 52272 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408560.1 protein_id gnl|my_center|LOCUS_59280 52339 53679 gene locus_tag LOCUS_59290 52339 53679 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_59290 54190 53792 gene locus_tag LOCUS_59300 gene trxA 54190 53792 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 protein_id gnl|my_center|LOCUS_59300 54809 54426 gene locus_tag LOCUS_59310 54809 54426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59310 57521 55125 gene locus_tag LOCUS_59320 57521 55125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59320 57737 59194 gene locus_tag LOCUS_59330 57737 59194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59330 59403 60122 gene locus_tag LOCUS_59340 59403 60122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 60521 60192 gene locus_tag LOCUS_59350 60521 60192 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_59350 60608 61792 gene locus_tag LOCUS_59360 60608 61792 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222962.1 protein_id gnl|my_center|LOCUS_59360 61859 62659 gene locus_tag LOCUS_59370 61859 62659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59370 62666 64411 gene locus_tag LOCUS_59380 62666 64411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59380 64581 66317 gene locus_tag LOCUS_59390 64581 66317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59390 67776 66427 gene locus_tag LOCUS_59400 67776 66427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59400 68196 69278 gene locus_tag LOCUS_59410 68196 69278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 70611 69466 gene locus_tag LOCUS_59420 70611 69466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 73139 70776 gene locus_tag LOCUS_59430 gene lon 73139 70776 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030152.1 protein_id gnl|my_center|LOCUS_59430 74115 73462 gene locus_tag LOCUS_59440 74115 73462 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_59440 75449 74112 gene locus_tag LOCUS_59450 75449 74112 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029135.1 protein_id gnl|my_center|LOCUS_59450 75661 76416 gene locus_tag LOCUS_59460 75661 76416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 76413 77855 gene locus_tag LOCUS_59470 76413 77855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59470 78033 79538 gene locus_tag LOCUS_59480 78033 79538 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_59480 82680 79606 gene locus_tag LOCUS_59490 82680 79606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 83088 82684 gene locus_tag LOCUS_59500 83088 82684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223403.1 protein_id gnl|my_center|LOCUS_59500 83495 84334 gene locus_tag LOCUS_59510 83495 84334 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728964.1 protein_id gnl|my_center|LOCUS_59510 84895 84488 gene locus_tag LOCUS_59520 84895 84488 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975554.1 protein_id gnl|my_center|LOCUS_59520 85077 86276 gene locus_tag LOCUS_59530 85077 86276 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_59530 86550 87638 gene locus_tag LOCUS_59540 86550 87638 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390074.1 protein_id gnl|my_center|LOCUS_59540 87740 87970 gene locus_tag LOCUS_59550 87740 87970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 88944 88003 gene locus_tag LOCUS_59560 88944 88003 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487139.1 protein_id gnl|my_center|LOCUS_59560 89863 89654 gene locus_tag LOCUS_59570 89863 89654 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_59570 90978 89884 gene locus_tag LOCUS_59580 90978 89884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 92123 91551 gene locus_tag LOCUS_59590 92123 91551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223299.1 protein_id gnl|my_center|LOCUS_59590 93093 92470 gene locus_tag LOCUS_59600 93093 92470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 93398 93571 gene locus_tag LOCUS_59610 93398 93571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59610 93841 94209 gene locus_tag LOCUS_59620 93841 94209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59620 94381 96387 gene locus_tag LOCUS_59630 94381 96387 CDS product glycoside hydrolase family 44 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158842832.1 protein_id gnl|my_center|LOCUS_59630 >Feature sequence044 506 1999 gene locus_tag LOCUS_59640 506 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 3114 2194 gene locus_tag LOCUS_59650 3114 2194 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729840.1 protein_id gnl|my_center|LOCUS_59650 3837 3199 gene locus_tag LOCUS_59660 3837 3199 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862601.1 protein_id gnl|my_center|LOCUS_59660 3746 5158 gene locus_tag LOCUS_59670 3746 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59670 5958 5182 gene locus_tag LOCUS_59680 5958 5182 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970102.1 protein_id gnl|my_center|LOCUS_59680 6632 6126 gene locus_tag LOCUS_59690 6632 6126 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223356.1 protein_id gnl|my_center|LOCUS_59690 6751 7731 gene locus_tag LOCUS_59700 6751 7731 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225563.1 protein_id gnl|my_center|LOCUS_59700 7851 8012 gene locus_tag LOCUS_59710 7851 8012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 8076 8516 gene locus_tag LOCUS_59720 8076 8516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 8747 8672 gene locus_tag LOCUS_t00630 8747 8672 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9740 8838 gene locus_tag LOCUS_59730 9740 8838 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467832.1 protein_id gnl|my_center|LOCUS_59730 9886 10341 gene locus_tag LOCUS_59740 9886 10341 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_59740 12662 10431 gene locus_tag LOCUS_59750 12662 10431 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_59750 12977 13273 gene locus_tag LOCUS_59760 gene wblA 12977 13273 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_59760 14655 13498 gene locus_tag LOCUS_59770 14655 13498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59770 15659 14655 gene locus_tag LOCUS_59780 15659 14655 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_59780 15814 15969 gene locus_tag LOCUS_59790 15814 15969 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_59790 15966 16427 gene locus_tag LOCUS_59800 15966 16427 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092109.1 protein_id gnl|my_center|LOCUS_59800 16729 17697 gene locus_tag LOCUS_59810 16729 17697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_59810 17694 18497 gene locus_tag LOCUS_59820 17694 18497 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_59820 19354 18674 gene locus_tag LOCUS_59830 19354 18674 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_59830 20821 19811 gene locus_tag LOCUS_59840 20821 19811 CDS product glycoside hydrolase family 11 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028255.1 protein_id gnl|my_center|LOCUS_59840 21688 22428 gene locus_tag LOCUS_59850 21688 22428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59850 22582 23229 gene locus_tag LOCUS_59860 22582 23229 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_59860 24355 23708 gene locus_tag LOCUS_59870 24355 23708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59870 24572 24321 gene locus_tag LOCUS_59880 24572 24321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59880 24456 25607 gene locus_tag LOCUS_59890 24456 25607 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_59890 26578 25961 gene locus_tag LOCUS_59900 26578 25961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59900 27576 26650 gene locus_tag LOCUS_59910 27576 26650 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_59910 28160 27585 gene locus_tag LOCUS_59920 28160 27585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 30790 28814 gene locus_tag LOCUS_59930 gene acs 30790 28814 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_59930 31201 32106 gene locus_tag LOCUS_59940 31201 32106 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_59940 33242 34282 gene locus_tag LOCUS_59950 33242 34282 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029084.1 protein_id gnl|my_center|LOCUS_59950 34821 35978 gene locus_tag LOCUS_59960 34821 35978 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_59960 36185 36907 gene locus_tag LOCUS_59970 36185 36907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59970 37588 38190 gene locus_tag LOCUS_59980 37588 38190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59980 38237 38449 gene locus_tag LOCUS_59990 38237 38449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59990 38469 38774 gene locus_tag LOCUS_60000 38469 38774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60000 38824 39315 gene locus_tag LOCUS_60010 38824 39315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60010 39617 39243 gene locus_tag LOCUS_60020 39617 39243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60020 39800 40096 gene locus_tag LOCUS_60030 39800 40096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60030 42314 40251 gene locus_tag LOCUS_60040 42314 40251 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_60040 42327 42533 gene locus_tag LOCUS_60050 42327 42533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60050 42728 43078 gene locus_tag LOCUS_60060 gene bldG 42728 43078 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_60060 43081 43551 gene locus_tag LOCUS_60070 43081 43551 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975387.1 protein_id gnl|my_center|LOCUS_60070 43893 43606 gene locus_tag LOCUS_60080 43893 43606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60080 44020 44289 gene locus_tag LOCUS_60090 44020 44289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60090 44948 47284 gene locus_tag LOCUS_60100 44948 47284 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_60100 47359 47847 gene locus_tag LOCUS_60110 47359 47847 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 protein_id gnl|my_center|LOCUS_60110 49174 47909 gene locus_tag LOCUS_60120 gene serB 49174 47909 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_60120 49248 50249 gene locus_tag LOCUS_60130 49248 50249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60130 50246 51106 gene locus_tag LOCUS_60140 50246 51106 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027447.1 protein_id gnl|my_center|LOCUS_60140 51878 51240 gene locus_tag LOCUS_60150 51878 51240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60150 52729 52160 gene locus_tag LOCUS_60160 52729 52160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60160 53811 52822 gene locus_tag LOCUS_60170 53811 52822 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027987.1 protein_id gnl|my_center|LOCUS_60170 54557 53808 gene locus_tag LOCUS_60180 54557 53808 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027986.1 protein_id gnl|my_center|LOCUS_60180 54676 55845 gene locus_tag LOCUS_60190 54676 55845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60190 55842 56564 gene locus_tag LOCUS_60200 55842 56564 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_60200 57376 56630 gene locus_tag LOCUS_60210 57376 56630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027983.1 protein_id gnl|my_center|LOCUS_60210 57500 58294 gene locus_tag LOCUS_60220 57500 58294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_60220 58455 59384 gene locus_tag LOCUS_60230 58455 59384 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_60230 59528 60283 gene locus_tag LOCUS_60240 59528 60283 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729298.1 protein_id gnl|my_center|LOCUS_60240 60291 60536 gene locus_tag LOCUS_60250 60291 60536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60250 61527 60583 gene locus_tag LOCUS_60260 61527 60583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60260 62212 61595 gene locus_tag LOCUS_60270 62212 61595 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_60270 63829 62381 gene locus_tag LOCUS_60280 63829 62381 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971553.1 protein_id gnl|my_center|LOCUS_60280 64328 63912 gene locus_tag LOCUS_60290 64328 63912 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978301.1 protein_id gnl|my_center|LOCUS_60290 64632 64366 gene locus_tag LOCUS_60300 64632 64366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60300 64514 65617 gene locus_tag LOCUS_60310 64514 65617 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854536.1 protein_id gnl|my_center|LOCUS_60310 66015 66704 gene locus_tag LOCUS_60320 66015 66704 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_60320 66968 66708 gene locus_tag LOCUS_60330 66968 66708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60330 67127 67666 gene locus_tag LOCUS_60340 67127 67666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60340 68380 67784 gene locus_tag LOCUS_60350 68380 67784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60350 71057 68478 gene locus_tag LOCUS_60360 gene clpB 71057 68478 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_60360 71625 71278 gene locus_tag LOCUS_60370 71625 71278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60370 72829 71648 gene locus_tag LOCUS_60380 gene dnaJ 72829 71648 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_60380 73509 72865 gene locus_tag LOCUS_60390 gene grpE 73509 72865 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975269.1 protein_id gnl|my_center|LOCUS_60390 75380 73506 gene locus_tag LOCUS_60400 gene dnaK 75380 73506 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_60400 75832 75587 gene locus_tag LOCUS_60410 75832 75587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60410 76370 75858 gene locus_tag LOCUS_60420 76370 75858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60420 76935 76597 gene locus_tag LOCUS_60430 76935 76597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60430 77117 78448 gene locus_tag LOCUS_60440 77117 78448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60440 79026 78562 gene locus_tag LOCUS_60450 79026 78562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60450 80742 79177 gene locus_tag LOCUS_60460 80742 79177 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030952.1 protein_id gnl|my_center|LOCUS_60460 80965 81879 gene locus_tag LOCUS_60470 80965 81879 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_60470 82015 82809 gene locus_tag LOCUS_60480 gene proC 82015 82809 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_60480 83033 82812 gene locus_tag LOCUS_60490 83033 82812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60490 83360 84595 gene locus_tag LOCUS_60500 83360 84595 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031193.1 protein_id gnl|my_center|LOCUS_60500 84649 86073 gene locus_tag LOCUS_60510 84649 86073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60510 86070 86849 gene locus_tag LOCUS_60520 86070 86849 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583200.1 protein_id gnl|my_center|LOCUS_60520 86846 88030 gene locus_tag LOCUS_60530 86846 88030 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_60530 88089 89252 gene locus_tag LOCUS_60540 88089 89252 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_60540 89713 90510 gene locus_tag LOCUS_60550 89713 90510 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 protein_id gnl|my_center|LOCUS_60550 90832 91035 gene locus_tag LOCUS_60560 90832 91035 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_60560 91270 91473 gene locus_tag LOCUS_60570 91270 91473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 91599 92639 gene locus_tag LOCUS_60580 91599 92639 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_60580 92636 93589 gene locus_tag LOCUS_60590 92636 93589 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 protein_id gnl|my_center|LOCUS_60590 93711 94256 gene locus_tag LOCUS_60600 93711 94256 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223304.1 protein_id gnl|my_center|LOCUS_60600 94374 94550 gene locus_tag LOCUS_60610 94374 94550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60610 94547 94876 gene locus_tag LOCUS_60620 94547 94876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60620 95749 94883 gene locus_tag LOCUS_60630 95749 94883 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878084.1 protein_id gnl|my_center|LOCUS_60630 96569 95877 gene locus_tag LOCUS_60640 96569 95877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60640 97344 96691 gene locus_tag LOCUS_60650 97344 96691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 97520 99139 gene locus_tag LOCUS_60660 97520 99139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 99418 99170 gene locus_tag LOCUS_60670 99418 99170 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030145241.1 protein_id gnl|my_center|LOCUS_60670 99697 100392 gene locus_tag LOCUS_60680 99697 100392 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_60680 100389 101735 gene locus_tag LOCUS_60690 100389 101735 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402699.1 protein_id gnl|my_center|LOCUS_60690 101732 102673 gene locus_tag LOCUS_60700 gene hemC 101732 102673 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975518.1 protein_id gnl|my_center|LOCUS_60700 102670 104337 gene locus_tag LOCUS_60710 102670 104337 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_60710 104434 105423 gene locus_tag LOCUS_60720 gene hemB 104434 105423 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028903.1 protein_id gnl|my_center|LOCUS_60720 105508 106161 gene locus_tag LOCUS_60730 105508 106161 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976534.1 protein_id gnl|my_center|LOCUS_60730 106233 107528 gene locus_tag LOCUS_60740 gene hemL 106233 107528 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_60740 107596 108717 gene locus_tag LOCUS_60750 107596 108717 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027744.1 protein_id gnl|my_center|LOCUS_60750 108701 109351 gene locus_tag LOCUS_60760 108701 109351 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974480.1 protein_id gnl|my_center|LOCUS_60760 109448 110029 gene locus_tag LOCUS_60770 109448 110029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60770 110069 110800 gene locus_tag LOCUS_60780 110069 110800 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_60780 110802 112544 gene locus_tag LOCUS_60790 110802 112544 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_60790 112534 113559 gene locus_tag LOCUS_60800 gene ccsB 112534 113559 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_60800 114241 113858 gene locus_tag LOCUS_60810 114241 113858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60810 114351 115361 gene locus_tag LOCUS_60820 114351 115361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60820 115372 115620 gene locus_tag LOCUS_60830 115372 115620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60830 116087 115848 gene locus_tag LOCUS_60840 116087 115848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60840 116380 116580 gene locus_tag LOCUS_60850 116380 116580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60850 117866 116577 gene locus_tag LOCUS_60860 117866 116577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60860 117945 118679 gene locus_tag LOCUS_60870 117945 118679 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_60870 118809 120083 gene locus_tag LOCUS_60880 118809 120083 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_60880 120175 120534 gene locus_tag LOCUS_60890 120175 120534 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_60890 120563 121114 gene locus_tag LOCUS_60900 120563 121114 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061196.1 protein_id gnl|my_center|LOCUS_60900 121111 121788 gene locus_tag LOCUS_60910 121111 121788 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_60910 121785 123137 gene locus_tag LOCUS_60920 121785 123137 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_60920 123134 123799 gene locus_tag LOCUS_60930 123134 123799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60930 123796 125085 gene locus_tag LOCUS_60940 gene nuoF 123796 125085 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974379.1 protein_id gnl|my_center|LOCUS_60940 125082 127511 gene locus_tag LOCUS_60950 125082 127511 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899937.1 protein_id gnl|my_center|LOCUS_60950 127508 128875 gene locus_tag LOCUS_60960 gene nuoH 127508 128875 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_60960 128862 129377 gene locus_tag LOCUS_60970 128862 129377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60970 129370 130251 gene locus_tag LOCUS_60980 129370 130251 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893423.1 protein_id gnl|my_center|LOCUS_60980 130248 130544 gene locus_tag LOCUS_60990 gene nuoK 130248 130544 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_60990 130554 132464 gene locus_tag LOCUS_61000 gene nuoL 130554 132464 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_61000 132464 133993 gene locus_tag LOCUS_61010 132464 133993 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728119.1 protein_id gnl|my_center|LOCUS_61010 133990 135549 gene locus_tag LOCUS_61020 gene nuoN 133990 135549 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_61020 135562 136557 gene locus_tag LOCUS_61030 135562 136557 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_61030 137442 136627 gene locus_tag LOCUS_61040 137442 136627 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227668.1 protein_id gnl|my_center|LOCUS_61040 138510 137584 gene locus_tag LOCUS_61050 gene rarD 138510 137584 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_61050 138644 139330 gene locus_tag LOCUS_61060 gene msrA 138644 139330 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056729.1 protein_id gnl|my_center|LOCUS_61060 140268 139717 gene locus_tag LOCUS_61070 140268 139717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61070 140448 141269 gene locus_tag LOCUS_61080 140448 141269 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486778.1 protein_id gnl|my_center|LOCUS_61080 141262 141456 gene locus_tag LOCUS_61090 141262 141456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61090 141727 141542 gene locus_tag LOCUS_61100 141727 141542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61100 142375 143883 gene locus_tag LOCUS_61110 142375 143883 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267608.1 protein_id gnl|my_center|LOCUS_61110 143883 144782 gene locus_tag LOCUS_61120 143883 144782 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770800.1 protein_id gnl|my_center|LOCUS_61120 144863 146029 gene locus_tag LOCUS_61130 144863 146029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61130 146458 147942 gene locus_tag LOCUS_61140 146458 147942 CDS product ISL3-like element IS469 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029007.1 protein_id gnl|my_center|LOCUS_61140 148581 148778 gene locus_tag LOCUS_61150 148581 148778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61150 150196 148775 gene locus_tag LOCUS_61160 150196 148775 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903979.1 protein_id gnl|my_center|LOCUS_61160 151225 150353 gene locus_tag LOCUS_61170 151225 150353 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093945347.1 protein_id gnl|my_center|LOCUS_61170 151359 152654 gene locus_tag LOCUS_61180 151359 152654 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029800.1 protein_id gnl|my_center|LOCUS_61180 152645 153304 gene locus_tag LOCUS_61190 152645 153304 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 protein_id gnl|my_center|LOCUS_61190 >Feature sequence045 571 3345 gene locus_tag LOCUS_61200 571 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61200 3551 5260 gene locus_tag LOCUS_61210 3551 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 5445 6806 gene locus_tag LOCUS_61220 5445 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976912.1 protein_id gnl|my_center|LOCUS_61220 7287 7835 gene locus_tag LOCUS_61230 gene def 7287 7835 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_61230 7840 8790 gene locus_tag LOCUS_61240 gene fmt 7840 8790 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_61240 8790 10190 gene locus_tag LOCUS_61250 8790 10190 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_61250 10422 11111 gene locus_tag LOCUS_61260 10422 11111 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224576.1 protein_id gnl|my_center|LOCUS_61260 11134 12351 gene locus_tag LOCUS_61270 11134 12351 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285939.1 protein_id gnl|my_center|LOCUS_61270 12775 15219 gene locus_tag LOCUS_61280 12775 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61280 15821 15327 gene locus_tag LOCUS_61290 15821 15327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61290 16287 16784 gene locus_tag LOCUS_61300 16287 16784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61300 17113 16781 gene locus_tag LOCUS_61310 17113 16781 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727879.1 protein_id gnl|my_center|LOCUS_61310 17167 18135 gene locus_tag LOCUS_61320 17167 18135 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467673.1 protein_id gnl|my_center|LOCUS_61320 18132 18458 gene locus_tag LOCUS_61330 18132 18458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61330 18462 18968 gene locus_tag LOCUS_61340 18462 18968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 20341 19121 gene locus_tag LOCUS_61350 gene tnpB 20341 19121 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888231.1 protein_id gnl|my_center|LOCUS_61350 21423 20338 gene locus_tag LOCUS_61360 21423 20338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61360 21729 22583 gene locus_tag LOCUS_61370 21729 22583 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_61370 22686 23033 gene locus_tag LOCUS_61380 22686 23033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61380 24367 23192 gene locus_tag LOCUS_61390 24367 23192 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246304.1 protein_id gnl|my_center|LOCUS_61390 24324 24509 gene locus_tag LOCUS_61400 24324 24509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61400 26025 24838 gene locus_tag LOCUS_61410 26025 24838 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083703.1 protein_id gnl|my_center|LOCUS_61410 26469 26807 gene locus_tag LOCUS_61420 26469 26807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61420 27116 27847 gene locus_tag LOCUS_61430 27116 27847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61430 28003 28293 gene locus_tag LOCUS_61440 28003 28293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61440 28393 28671 gene locus_tag LOCUS_61450 28393 28671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61450 28685 29407 gene locus_tag LOCUS_61460 28685 29407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61460 29457 31592 gene locus_tag LOCUS_61470 29457 31592 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_61470 31589 34564 gene locus_tag LOCUS_61480 31589 34564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61480 34565 37741 gene locus_tag LOCUS_61490 34565 37741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61490 37896 40127 gene locus_tag LOCUS_61500 37896 40127 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086860976.1 protein_id gnl|my_center|LOCUS_61500 40124 41506 gene locus_tag LOCUS_61510 40124 41506 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228653.1 protein_id gnl|my_center|LOCUS_61510 41613 41930 gene locus_tag LOCUS_61520 41613 41930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61520 41939 42844 gene locus_tag LOCUS_61530 41939 42844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974897.1 protein_id gnl|my_center|LOCUS_61530 42841 43644 gene locus_tag LOCUS_61540 42841 43644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61540 43623 44810 gene locus_tag LOCUS_61550 43623 44810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61550 44807 45445 gene locus_tag LOCUS_61560 44807 45445 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228651.1 protein_id gnl|my_center|LOCUS_61560 45515 46645 gene locus_tag LOCUS_61570 45515 46645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61570 46642 47265 gene locus_tag LOCUS_61580 46642 47265 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_61580 47459 48067 gene locus_tag LOCUS_61590 47459 48067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61590 48177 48848 gene locus_tag LOCUS_61600 gene rpe 48177 48848 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_61600 50130 48991 gene locus_tag LOCUS_61610 50130 48991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61610 51652 50612 gene locus_tag LOCUS_61620 51652 50612 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973861.1 protein_id gnl|my_center|LOCUS_61620 52707 51649 gene locus_tag LOCUS_61630 52707 51649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973862.1 protein_id gnl|my_center|LOCUS_61630 53698 52718 gene locus_tag LOCUS_61640 53698 52718 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973863.1 protein_id gnl|my_center|LOCUS_61640 55559 53769 gene locus_tag LOCUS_61650 55559 53769 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973864.1 protein_id gnl|my_center|LOCUS_61650 56599 55616 gene locus_tag LOCUS_61660 56599 55616 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973865.1 protein_id gnl|my_center|LOCUS_61660 57578 58186 gene locus_tag LOCUS_61670 57578 58186 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_61670 58183 58809 gene locus_tag LOCUS_61680 58183 58809 CDS product nicotinamide mononucleotide transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977383.1 protein_id gnl|my_center|LOCUS_61680 58806 60131 gene locus_tag LOCUS_61690 58806 60131 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_61690 60169 60639 gene locus_tag LOCUS_61700 gene ribH 60169 60639 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224642.1 protein_id gnl|my_center|LOCUS_61700 60689 61144 gene locus_tag LOCUS_61710 60689 61144 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805205.1 protein_id gnl|my_center|LOCUS_61710 61906 61418 gene locus_tag LOCUS_61720 61906 61418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61720 62754 63653 gene locus_tag LOCUS_61730 62754 63653 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_61730 63712 64986 gene locus_tag LOCUS_61740 63712 64986 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_61740 64979 66094 gene locus_tag LOCUS_61750 64979 66094 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_61750 66091 66666 gene locus_tag LOCUS_61760 66091 66666 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_61760 66743 67546 gene locus_tag LOCUS_61770 66743 67546 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_61770 67668 68708 gene locus_tag LOCUS_61780 67668 68708 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224840.1 protein_id gnl|my_center|LOCUS_61780 68974 70551 gene locus_tag LOCUS_61790 68974 70551 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978239.1 protein_id gnl|my_center|LOCUS_61790 70568 71620 gene locus_tag LOCUS_61800 70568 71620 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_61800 71666 72226 gene locus_tag LOCUS_61810 gene efp 71666 72226 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 protein_id gnl|my_center|LOCUS_61810 72228 72638 gene locus_tag LOCUS_61820 gene nusB 72228 72638 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_61820 72712 73473 gene locus_tag LOCUS_61830 72712 73473 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_61830 73548 74801 gene locus_tag LOCUS_61840 gene dinB 73548 74801 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_61840 74949 75338 gene locus_tag LOCUS_61850 74949 75338 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_61850 78059 75582 gene locus_tag LOCUS_61860 78059 75582 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_61860 79336 78056 gene locus_tag LOCUS_61870 79336 78056 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_61870 80340 79336 gene locus_tag LOCUS_61880 80340 79336 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_61880 80284 80496 gene locus_tag LOCUS_61890 80284 80496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61890 81015 81446 gene locus_tag LOCUS_61900 gene mraZ 81015 81446 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_61900 81740 82711 gene locus_tag LOCUS_61910 gene rsmH 81740 82711 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_61910 82708 83289 gene locus_tag LOCUS_61920 82708 83289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61920 83286 85712 gene locus_tag LOCUS_61930 83286 85712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61930 85709 87271 gene locus_tag LOCUS_61940 85709 87271 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_61940 87380 88753 gene locus_tag LOCUS_61950 87380 88753 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_61950 88750 89808 gene locus_tag LOCUS_61960 gene mraY 88750 89808 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_61960 89805 91190 gene locus_tag LOCUS_61970 gene murD 89805 91190 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228039.1 protein_id gnl|my_center|LOCUS_61970 91262 92524 gene locus_tag LOCUS_61980 gene ftsW 91262 92524 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_61980 92527 93612 gene locus_tag LOCUS_61990 gene murG 92527 93612 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_61990 93609 95018 gene locus_tag LOCUS_62000 gene murC 93609 95018 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_62000 95026 95697 gene locus_tag LOCUS_62010 95026 95697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62010 95934 97397 gene locus_tag LOCUS_62020 gene ftsZ 95934 97397 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_62020 97465 98175 gene locus_tag LOCUS_62030 97465 98175 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_62030 98281 98790 gene locus_tag LOCUS_62040 98281 98790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62040 98876 99166 gene locus_tag LOCUS_62050 98876 99166 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976737.1 protein_id gnl|my_center|LOCUS_62050 99215 100087 gene locus_tag LOCUS_62060 99215 100087 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908029.1 protein_id gnl|my_center|LOCUS_62060 101192 100623 gene locus_tag LOCUS_62070 101192 100623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62070 101756 101226 gene locus_tag LOCUS_62080 101756 101226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62080 101719 102594 gene locus_tag LOCUS_62090 101719 102594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62090 103440 102739 gene locus_tag LOCUS_62100 103440 102739 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224827.1 protein_id gnl|my_center|LOCUS_62100 103582 103935 gene locus_tag LOCUS_62110 103582 103935 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088099.1 protein_id gnl|my_center|LOCUS_62110 104063 104470 gene locus_tag LOCUS_62120 104063 104470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460651.1 protein_id gnl|my_center|LOCUS_62120 105497 104655 gene locus_tag LOCUS_62130 105497 104655 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_62130 105774 107267 gene locus_tag LOCUS_62140 105774 107267 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221981.1 protein_id gnl|my_center|LOCUS_62140 107420 108646 gene locus_tag LOCUS_62150 107420 108646 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223986.1 protein_id gnl|my_center|LOCUS_62150 109328 108720 gene locus_tag LOCUS_62160 109328 108720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62160 109786 109505 gene locus_tag LOCUS_62170 109786 109505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 110303 110115 gene locus_tag LOCUS_62180 110303 110115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 110302 110454 gene locus_tag LOCUS_62190 110302 110454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62190 110848 110480 gene locus_tag LOCUS_62200 110848 110480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62200 111088 110879 gene locus_tag LOCUS_62210 111088 110879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62210 111560 111126 gene locus_tag LOCUS_62220 111560 111126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62220 111765 112625 gene locus_tag LOCUS_62230 111765 112625 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_62230 112639 112842 gene locus_tag LOCUS_62240 112639 112842 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224345.1 protein_id gnl|my_center|LOCUS_62240 116357 113199 gene locus_tag LOCUS_62250 gene ileS 116357 113199 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_62250 116660 116977 gene locus_tag LOCUS_62260 116660 116977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 117063 117473 gene locus_tag LOCUS_62270 117063 117473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62270 117437 118234 gene locus_tag LOCUS_62280 117437 118234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62280 118170 119156 gene locus_tag LOCUS_62290 118170 119156 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_62290 120815 119382 gene locus_tag LOCUS_62300 120815 119382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62300 122538 120931 gene locus_tag LOCUS_62310 122538 120931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62310 125190 122740 gene locus_tag LOCUS_62320 125190 122740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62320 125496 126635 gene locus_tag LOCUS_62330 125496 126635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62330 126726 130247 gene locus_tag LOCUS_62340 gene dnaE 126726 130247 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976751.1 protein_id gnl|my_center|LOCUS_62340 131153 130314 gene locus_tag LOCUS_62350 131153 130314 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224885.1 protein_id gnl|my_center|LOCUS_62350 131488 132645 gene locus_tag LOCUS_62360 131488 132645 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_62360 133121 132615 gene locus_tag LOCUS_62370 133121 132615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62370 133444 133118 gene locus_tag LOCUS_62380 133444 133118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62380 133702 134541 gene locus_tag LOCUS_62390 133702 134541 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749477.1 protein_id gnl|my_center|LOCUS_62390 134523 134738 gene locus_tag LOCUS_62400 134523 134738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 134746 134976 gene locus_tag LOCUS_62410 134746 134976 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976289.1 protein_id gnl|my_center|LOCUS_62410 135553 135011 gene locus_tag LOCUS_62420 135553 135011 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201788935.1 protein_id gnl|my_center|LOCUS_62420 135832 135617 gene locus_tag LOCUS_62430 135832 135617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62430 136057 135938 gene locus_tag LOCUS_62440 136057 135938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62440 136561 136148 gene locus_tag LOCUS_62450 136561 136148 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975062.1 protein_id gnl|my_center|LOCUS_62450 137631 136609 gene locus_tag LOCUS_62460 137631 136609 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_62460 139085 137649 gene locus_tag LOCUS_62470 139085 137649 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223303.1 protein_id gnl|my_center|LOCUS_62470 139210 139872 gene locus_tag LOCUS_62480 139210 139872 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223207.1 protein_id gnl|my_center|LOCUS_62480 140128 140757 gene locus_tag LOCUS_62490 140128 140757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_62490 140803 140964 gene locus_tag LOCUS_62500 140803 140964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62500 >Feature sequence046 390 983 gene locus_tag LOCUS_62510 390 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62510 1260 2270 gene locus_tag LOCUS_62520 1260 2270 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167468068.1 protein_id gnl|my_center|LOCUS_62520 3619 2267 gene locus_tag LOCUS_62530 3619 2267 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855336.1 protein_id gnl|my_center|LOCUS_62530 4004 4180 gene locus_tag LOCUS_62540 4004 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62540 4186 4374 gene locus_tag LOCUS_62550 4186 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62550 4437 6464 gene locus_tag LOCUS_62560 4437 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62560 6461 7522 gene locus_tag LOCUS_62570 6461 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62570 7559 9601 gene locus_tag LOCUS_62580 gene fxlM 7559 9601 CDS product methyltransferase, FxLD system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031310.1 protein_id gnl|my_center|LOCUS_62580 9614 10744 gene locus_tag LOCUS_62590 9614 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031309.1 protein_id gnl|my_center|LOCUS_62590 11106 11570 gene locus_tag LOCUS_62600 11106 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62600 11581 12030 gene locus_tag LOCUS_62610 11581 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62610 12392 12186 gene locus_tag LOCUS_62620 12392 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62620 12913 12455 gene locus_tag LOCUS_62630 12913 12455 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_62630 13779 13066 gene locus_tag LOCUS_62640 13779 13066 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903333.1 protein_id gnl|my_center|LOCUS_62640 14957 13791 gene locus_tag LOCUS_62650 14957 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62650 15253 16122 gene locus_tag LOCUS_62660 15253 16122 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_62660 16119 16388 gene locus_tag LOCUS_62670 16119 16388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62670 16507 17493 gene locus_tag LOCUS_62680 16507 17493 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225347.1 protein_id gnl|my_center|LOCUS_62680 17490 18581 gene locus_tag LOCUS_62690 17490 18581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62690 18619 21144 gene locus_tag LOCUS_62700 18619 21144 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201843320.1 protein_id gnl|my_center|LOCUS_62700 21176 22537 gene locus_tag LOCUS_62710 21176 22537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62710 22702 24081 gene locus_tag LOCUS_62720 22702 24081 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027221.1 protein_id gnl|my_center|LOCUS_62720 23964 25160 gene locus_tag LOCUS_62730 23964 25160 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031650.1 protein_id gnl|my_center|LOCUS_62730 25393 25962 gene locus_tag LOCUS_62740 25393 25962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 27275 26181 gene locus_tag LOCUS_62750 27275 26181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62750 27454 27684 gene locus_tag LOCUS_62760 27454 27684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62760 27701 28279 gene locus_tag LOCUS_62770 27701 28279 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259737.1 protein_id gnl|my_center|LOCUS_62770 28916 28455 gene locus_tag LOCUS_62780 28916 28455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62780 33305 29130 gene locus_tag LOCUS_62790 33305 29130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62790 33794 34315 gene locus_tag LOCUS_62800 33794 34315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62800 34561 34358 gene locus_tag LOCUS_62810 34561 34358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62810 36008 35031 gene locus_tag LOCUS_62820 36008 35031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62820 36536 36153 gene locus_tag LOCUS_62830 36536 36153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62830 36593 36811 gene locus_tag LOCUS_62840 36593 36811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62840 37512 37015 gene locus_tag LOCUS_62850 37512 37015 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 protein_id gnl|my_center|LOCUS_62850 37876 37505 gene locus_tag LOCUS_62860 37876 37505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62860 39214 38066 gene locus_tag LOCUS_62870 39214 38066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62870 39539 39775 gene locus_tag LOCUS_62880 39539 39775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62880 39762 40598 gene locus_tag LOCUS_62890 39762 40598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62890 42108 40531 gene locus_tag LOCUS_62900 42108 40531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62900 42845 44077 gene locus_tag LOCUS_62910 42845 44077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62910 44074 47379 gene locus_tag LOCUS_62920 44074 47379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62920 47379 49958 gene locus_tag LOCUS_62930 47379 49958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62930 51366 50137 gene locus_tag LOCUS_62940 51366 50137 CDS product McrBC 5-methylcytosine restriction system component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804187.1 protein_id gnl|my_center|LOCUS_62940 53546 51363 gene locus_tag LOCUS_62950 53546 51363 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804186.1 protein_id gnl|my_center|LOCUS_62950 57708 53482 gene locus_tag LOCUS_62960 57708 53482 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_62960 60670 57782 gene locus_tag LOCUS_62970 60670 57782 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_62970 65781 60667 gene locus_tag LOCUS_62980 65781 60667 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_62980 67372 66266 gene locus_tag LOCUS_62990 67372 66266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62990 69858 67357 gene locus_tag LOCUS_63000 69858 67357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63000 71150 69855 gene locus_tag LOCUS_63010 71150 69855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63010 71302 71739 gene locus_tag LOCUS_63020 71302 71739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63020 72108 72431 gene locus_tag LOCUS_63030 72108 72431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63030 73471 72632 gene locus_tag LOCUS_63040 73471 72632 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230953.1 protein_id gnl|my_center|LOCUS_63040 73990 74352 gene locus_tag LOCUS_63050 73990 74352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63050 74778 74545 gene locus_tag LOCUS_63060 74778 74545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63060 75368 74790 gene locus_tag LOCUS_63070 75368 74790 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026857.1 protein_id gnl|my_center|LOCUS_63070 75668 75462 gene locus_tag LOCUS_63080 75668 75462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63080 77090 76059 gene locus_tag LOCUS_63090 77090 76059 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112717.1 protein_id gnl|my_center|LOCUS_63090 77790 78542 gene locus_tag LOCUS_63100 77790 78542 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971996.1 protein_id gnl|my_center|LOCUS_63100 78569 78940 gene locus_tag LOCUS_63110 78569 78940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63110 79088 79507 gene locus_tag LOCUS_63120 79088 79507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63120 79504 79698 gene locus_tag LOCUS_63130 79504 79698 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_63130 80778 79996 gene locus_tag LOCUS_63140 80778 79996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 81129 81749 gene locus_tag LOCUS_63150 81129 81749 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225604.1 protein_id gnl|my_center|LOCUS_63150 >Feature sequence047 1723 236 gene locus_tag LOCUS_63160 1723 236 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639946.1 protein_id gnl|my_center|LOCUS_63160 3707 2400 gene locus_tag LOCUS_63170 3707 2400 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466944.1 protein_id gnl|my_center|LOCUS_63170 4472 4774 gene locus_tag LOCUS_63180 4472 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63180 4916 5914 gene locus_tag LOCUS_63190 4916 5914 CDS product RNA polymerase subunit sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203909262.1 protein_id gnl|my_center|LOCUS_63190 7449 6151 gene locus_tag LOCUS_63200 7449 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63200 9222 8092 gene locus_tag LOCUS_63210 9222 8092 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226355.1 protein_id gnl|my_center|LOCUS_63210 10310 9822 gene locus_tag LOCUS_63220 10310 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63220 10207 11787 gene locus_tag LOCUS_63230 10207 11787 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583934.1 protein_id gnl|my_center|LOCUS_63230 11843 13783 gene locus_tag LOCUS_63240 11843 13783 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225152.1 protein_id gnl|my_center|LOCUS_63240 14352 15419 gene locus_tag LOCUS_63250 14352 15419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63250 15419 16045 gene locus_tag LOCUS_63260 15419 16045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63260 16069 19206 gene locus_tag LOCUS_63270 16069 19206 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729190.1 protein_id gnl|my_center|LOCUS_63270 19927 21162 gene locus_tag LOCUS_63280 19927 21162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63280 21294 22457 gene locus_tag LOCUS_63290 21294 22457 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976694.1 protein_id gnl|my_center|LOCUS_63290 22490 23140 gene locus_tag LOCUS_63300 22490 23140 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_63300 23442 23152 gene locus_tag LOCUS_63310 23442 23152 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977125.1 protein_id gnl|my_center|LOCUS_63310 23766 27905 gene locus_tag LOCUS_63320 23766 27905 CDS product bifunctional nitrate reductase/sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205569.1 protein_id gnl|my_center|LOCUS_63320 28476 27916 gene locus_tag LOCUS_63330 28476 27916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030751.1 protein_id gnl|my_center|LOCUS_63330 28710 30578 gene locus_tag LOCUS_63340 28710 30578 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_63340 30721 31686 gene locus_tag LOCUS_63350 30721 31686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 34097 31704 gene locus_tag LOCUS_63360 34097 31704 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469742.1 protein_id gnl|my_center|LOCUS_63360 34876 34091 gene locus_tag LOCUS_63370 34876 34091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 protein_id gnl|my_center|LOCUS_63370 34987 36195 gene locus_tag LOCUS_63380 34987 36195 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029800.1 protein_id gnl|my_center|LOCUS_63380 36177 36866 gene locus_tag LOCUS_63390 36177 36866 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 protein_id gnl|my_center|LOCUS_63390 39348 36946 gene locus_tag LOCUS_63400 39348 36946 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225154.1 protein_id gnl|my_center|LOCUS_63400 >Feature sequence048 985 269 gene locus_tag LOCUS_63410 985 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 1743 982 gene locus_tag LOCUS_63420 1743 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63420 2215 3429 gene locus_tag LOCUS_63430 2215 3429 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326457.1 protein_id gnl|my_center|LOCUS_63430 4348 3449 gene locus_tag LOCUS_63440 4348 3449 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053126304.1 protein_id gnl|my_center|LOCUS_63440 4664 5395 gene locus_tag LOCUS_63450 4664 5395 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978487.1 protein_id gnl|my_center|LOCUS_63450 5666 6943 gene locus_tag LOCUS_63460 5666 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63460 8052 6994 gene locus_tag LOCUS_63470 8052 6994 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258589.1 protein_id gnl|my_center|LOCUS_63470 8364 8119 gene locus_tag LOCUS_63480 8364 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63480 8252 9562 gene locus_tag LOCUS_63490 8252 9562 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803742.1 protein_id gnl|my_center|LOCUS_63490 9569 10495 gene locus_tag LOCUS_63500 9569 10495 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 protein_id gnl|my_center|LOCUS_63500 10492 11316 gene locus_tag LOCUS_63510 10492 11316 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726998.1 protein_id gnl|my_center|LOCUS_63510 11322 12218 gene locus_tag LOCUS_63520 11322 12218 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_63520 12390 13556 gene locus_tag LOCUS_63530 12390 13556 CDS product glycoside hydrolase family 68 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267437.1 protein_id gnl|my_center|LOCUS_63530 <14340 13632 gene locus_tag LOCUS_63540 <14340 13632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225834.1:glycoside hydrolase N-terminal domain-containing protein >Feature sequence049 559 2436 gene locus_tag LOCUS_63550 559 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63550 2433 5384 gene locus_tag LOCUS_63560 2433 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63560 5760 6755 gene locus_tag LOCUS_63570 5760 6755 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582817.1 protein_id gnl|my_center|LOCUS_63570 6835 8103 gene locus_tag LOCUS_63580 6835 8103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63580 9510 8221 gene locus_tag LOCUS_63590 9510 8221 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285284.1 protein_id gnl|my_center|LOCUS_63590 9896 11287 gene locus_tag LOCUS_63600 9896 11287 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_63600 11386 12498 gene locus_tag LOCUS_63610 gene ald 11386 12498 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_63610 13923 12520 gene locus_tag LOCUS_63620 13923 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63620 15402 14143 gene locus_tag LOCUS_63630 15402 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63630 15863 15591 gene locus_tag LOCUS_63640 15863 15591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63640 16692 16084 gene locus_tag LOCUS_63650 16692 16084 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971478.1 protein_id gnl|my_center|LOCUS_63650 17550 16903 gene locus_tag LOCUS_63660 17550 16903 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_63660 18668 17547 gene locus_tag LOCUS_63670 18668 17547 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027559.1 protein_id gnl|my_center|LOCUS_63670 19307 18834 gene locus_tag LOCUS_63680 19307 18834 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970935.1 protein_id gnl|my_center|LOCUS_63680 19388 20137 gene locus_tag LOCUS_63690 19388 20137 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087138.1 protein_id gnl|my_center|LOCUS_63690 20194 20661 gene locus_tag LOCUS_63700 20194 20661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63700 21048 22904 gene locus_tag LOCUS_63710 gene ggt 21048 22904 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224631.1 protein_id gnl|my_center|LOCUS_63710 23375 23187 gene locus_tag LOCUS_63720 23375 23187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63720 23640 24602 gene locus_tag LOCUS_63730 23640 24602 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_63730 24666 24986 gene locus_tag LOCUS_63740 24666 24986 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224358.1 protein_id gnl|my_center|LOCUS_63740 25225 25034 gene locus_tag LOCUS_63750 25225 25034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63750 26391 25447 gene locus_tag LOCUS_63760 26391 25447 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228718.1 protein_id gnl|my_center|LOCUS_63760 26743 27750 gene locus_tag LOCUS_63770 26743 27750 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086676092.1 protein_id gnl|my_center|LOCUS_63770 27923 29206 gene locus_tag LOCUS_63780 27923 29206 CDS product cellulose-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227009.1 protein_id gnl|my_center|LOCUS_63780 29929 29438 gene locus_tag LOCUS_63790 29929 29438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63790 30505 31188 gene locus_tag LOCUS_63800 30505 31188 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973686.1 protein_id gnl|my_center|LOCUS_63800 31185 34100 gene locus_tag LOCUS_63810 31185 34100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63810 34135 35352 gene locus_tag LOCUS_63820 34135 35352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028037.1 protein_id gnl|my_center|LOCUS_63820 35909 38761 gene locus_tag LOCUS_63830 35909 38761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63830 38846 42175 gene locus_tag LOCUS_63840 38846 42175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63840 42685 42278 gene locus_tag LOCUS_63850 42685 42278 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030200.1 protein_id gnl|my_center|LOCUS_63850 43111 44130 gene locus_tag LOCUS_63860 43111 44130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63860 44418 44490 gene locus_tag LOCUS_t00640 44418 44490 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 44933 45967 gene locus_tag LOCUS_63870 44933 45967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63870 46463 46230 gene locus_tag LOCUS_63880 46463 46230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63880 47339 46701 gene locus_tag LOCUS_63890 47339 46701 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930032.1 protein_id gnl|my_center|LOCUS_63890 47411 48133 gene locus_tag LOCUS_63900 47411 48133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139575.1 protein_id gnl|my_center|LOCUS_63900 48461 48249 gene locus_tag LOCUS_63910 48461 48249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63910 48903 48592 gene locus_tag LOCUS_63920 48903 48592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63920 50899 48944 gene locus_tag LOCUS_63930 50899 48944 CDS product RiPP maturation radical SAM C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_63930 53121 50971 gene locus_tag LOCUS_63940 53121 50971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63940 53371 53559 gene locus_tag LOCUS_63950 53371 53559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63950 53635 54996 gene locus_tag LOCUS_63960 53635 54996 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963983.1 protein_id gnl|my_center|LOCUS_63960 55001 55684 gene locus_tag LOCUS_63970 55001 55684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63970 55681 57075 gene locus_tag LOCUS_63980 55681 57075 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161162.1 protein_id gnl|my_center|LOCUS_63980 57078 57989 gene locus_tag LOCUS_63990 57078 57989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63990 57931 58584 gene locus_tag LOCUS_64000 57931 58584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64000 58581 59885 gene locus_tag LOCUS_64010 58581 59885 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417516.1 protein_id gnl|my_center|LOCUS_64010 59882 60685 gene locus_tag LOCUS_64020 59882 60685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64020 60682 62637 gene locus_tag LOCUS_64030 60682 62637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64030 62802 63890 gene locus_tag LOCUS_64040 62802 63890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64040 64906 64046 gene locus_tag LOCUS_64050 64906 64046 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206589.1 protein_id gnl|my_center|LOCUS_64050 66396 65167 gene locus_tag LOCUS_64060 66396 65167 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226021.1 protein_id gnl|my_center|LOCUS_64060 67403 66399 gene locus_tag LOCUS_64070 67403 66399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64070 69198 67384 gene locus_tag LOCUS_64080 69198 67384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64080 70322 69228 gene locus_tag LOCUS_64090 70322 69228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64090 71581 70358 gene locus_tag LOCUS_64100 71581 70358 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238677.1 protein_id gnl|my_center|LOCUS_64100 72819 71578 gene locus_tag LOCUS_64110 72819 71578 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101032.1 protein_id gnl|my_center|LOCUS_64110 73863 72841 gene locus_tag LOCUS_64120 73863 72841 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703489.1 protein_id gnl|my_center|LOCUS_64120 73763 74185 gene locus_tag LOCUS_64130 73763 74185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64130 76532 74403 gene locus_tag LOCUS_64140 76532 74403 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_64140 76607 77134 gene locus_tag LOCUS_64150 76607 77134 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_64150 78131 77163 gene locus_tag LOCUS_64160 78131 77163 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173142140.1 protein_id gnl|my_center|LOCUS_64160 78735 79910 gene locus_tag LOCUS_64170 78735 79910 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890808.1 protein_id gnl|my_center|LOCUS_64170 79986 80756 gene locus_tag LOCUS_64180 79986 80756 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229957.1 protein_id gnl|my_center|LOCUS_64180 81828 80842 gene locus_tag LOCUS_64190 81828 80842 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908672.1 protein_id gnl|my_center|LOCUS_64190 82238 82708 gene locus_tag LOCUS_64200 gene tsaA 82238 82708 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458878.1 protein_id gnl|my_center|LOCUS_64200 84235 82853 gene locus_tag LOCUS_64210 84235 82853 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031441.1 protein_id gnl|my_center|LOCUS_64210 85344 84235 gene locus_tag LOCUS_64220 85344 84235 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031442.1 protein_id gnl|my_center|LOCUS_64220 86129 85428 gene locus_tag LOCUS_64230 86129 85428 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392977.1 protein_id gnl|my_center|LOCUS_64230 86797 86126 gene locus_tag LOCUS_64240 86797 86126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64240 88220 86784 gene locus_tag LOCUS_64250 88220 86784 CDS product adenylosuccinate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018348301.1 protein_id gnl|my_center|LOCUS_64250 89452 88217 gene locus_tag LOCUS_64260 89452 88217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64260 90514 90248 gene locus_tag LOCUS_64270 90514 90248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64270 90756 91427 gene locus_tag LOCUS_64280 90756 91427 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978773.1 protein_id gnl|my_center|LOCUS_64280 91432 92562 gene locus_tag LOCUS_64290 91432 92562 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978774.1 protein_id gnl|my_center|LOCUS_64290 93660 92590 gene locus_tag LOCUS_64300 93660 92590 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 protein_id gnl|my_center|LOCUS_64300 94647 93754 gene locus_tag LOCUS_64310 94647 93754 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230653.1 protein_id gnl|my_center|LOCUS_64310 96653 94686 gene locus_tag LOCUS_64320 96653 94686 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230654.1 protein_id gnl|my_center|LOCUS_64320 96780 97517 gene locus_tag LOCUS_64330 96780 97517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64330 97654 98658 gene locus_tag LOCUS_64340 97654 98658 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268643.1 protein_id gnl|my_center|LOCUS_64340 98655 99461 gene locus_tag LOCUS_64350 98655 99461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64350 99445 100191 gene locus_tag LOCUS_64360 99445 100191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64360 100894 100274 gene locus_tag LOCUS_64370 100894 100274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64370 105732 100993 gene locus_tag LOCUS_64380 105732 100993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64380 109411 106139 gene locus_tag LOCUS_64390 109411 106139 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_64390 111142 109502 gene locus_tag LOCUS_64400 111142 109502 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226038.1 protein_id gnl|my_center|LOCUS_64400 113825 111462 gene locus_tag LOCUS_64410 113825 111462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64410 116908 114023 gene locus_tag LOCUS_64420 116908 114023 CDS product glycoside hydrolase family 48 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031000.1 protein_id gnl|my_center|LOCUS_64420 117567 117761 gene locus_tag LOCUS_64430 117567 117761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64430 119282 117840 gene locus_tag LOCUS_64440 119282 117840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64440 >Feature sequence050 3216 1723 gene locus_tag LOCUS_64450 3216 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64450 4213 3203 gene locus_tag LOCUS_64460 4213 3203 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224960.1 protein_id gnl|my_center|LOCUS_64460 4782 4531 gene locus_tag LOCUS_64470 4782 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64470 5385 4981 gene locus_tag LOCUS_64480 gene mscL 5385 4981 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_64480 5899 5690 gene locus_tag LOCUS_64490 5899 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64490 6853 6008 gene locus_tag LOCUS_64500 6853 6008 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_64500 7285 6947 gene locus_tag LOCUS_64510 7285 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64510 7239 7547 gene locus_tag LOCUS_64520 7239 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64520 >Feature sequence051 1410 724 gene locus_tag LOCUS_64530 1410 724 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028048.1 protein_id gnl|my_center|LOCUS_64530 2035 1445 gene locus_tag LOCUS_64540 2035 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 2667 2194 gene locus_tag LOCUS_64550 2667 2194 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027459.1 protein_id gnl|my_center|LOCUS_64550 2725 3501 gene locus_tag LOCUS_64560 2725 3501 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484565.1 protein_id gnl|my_center|LOCUS_64560 3819 3589 gene locus_tag LOCUS_64570 3819 3589 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104925.1 protein_id gnl|my_center|LOCUS_64570 4184 4345 gene locus_tag LOCUS_64580 4184 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 4449 5177 gene locus_tag LOCUS_64590 4449 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64590 6301 5198 gene locus_tag LOCUS_64600 6301 5198 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028897.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_64600 9172 6464 gene locus_tag LOCUS_64610 9172 6464 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666873.1 protein_id gnl|my_center|LOCUS_64610 16532 9222 gene locus_tag LOCUS_64620 16532 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64620 16726 17565 gene locus_tag LOCUS_64630 16726 17565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64630 17718 18020 gene locus_tag LOCUS_64640 17718 18020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64640 23021 18273 gene locus_tag LOCUS_64650 23021 18273 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029700.1 protein_id gnl|my_center|LOCUS_64650 24696 23140 gene locus_tag LOCUS_64660 24696 23140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64660 25361 24693 gene locus_tag LOCUS_64670 25361 24693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64670 25576 26760 gene locus_tag LOCUS_64680 25576 26760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64680 27813 26878 gene locus_tag LOCUS_64690 27813 26878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64690 28133 27810 gene locus_tag LOCUS_64700 28133 27810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64700 28767 29582 gene locus_tag LOCUS_64710 28767 29582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64710 29579 30571 gene locus_tag LOCUS_64720 29579 30571 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228266.1 protein_id gnl|my_center|LOCUS_64720 32847 30622 gene locus_tag LOCUS_64730 32847 30622 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027934.1 protein_id gnl|my_center|LOCUS_64730 33278 33655 gene locus_tag LOCUS_64740 33278 33655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64740 34448 33729 gene locus_tag LOCUS_64750 34448 33729 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028771.1 protein_id gnl|my_center|LOCUS_64750 34663 35250 gene locus_tag LOCUS_64760 34663 35250 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230926.1 protein_id gnl|my_center|LOCUS_64760 36200 35385 gene locus_tag LOCUS_64770 36200 35385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64770 37211 36393 gene locus_tag LOCUS_64780 37211 36393 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_64780 37493 38284 gene locus_tag LOCUS_64790 37493 38284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64790 39086 38322 gene locus_tag LOCUS_64800 39086 38322 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223518.1 protein_id gnl|my_center|LOCUS_64800 39225 39989 gene locus_tag LOCUS_64810 39225 39989 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777055.1 protein_id gnl|my_center|LOCUS_64810 40335 39997 gene locus_tag LOCUS_64820 40335 39997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64820 40280 40618 gene locus_tag LOCUS_64830 40280 40618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64830 40764 42500 gene locus_tag LOCUS_64840 40764 42500 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850187.1 protein_id gnl|my_center|LOCUS_64840 42491 43537 gene locus_tag LOCUS_64850 42491 43537 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897959.1 protein_id gnl|my_center|LOCUS_64850 43721 44800 gene locus_tag LOCUS_64860 43721 44800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64860 44823 45908 gene locus_tag LOCUS_64870 44823 45908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64870 46332 46799 gene locus_tag LOCUS_64880 46332 46799 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191984393.1 protein_id gnl|my_center|LOCUS_64880 46796 47473 gene locus_tag LOCUS_64890 46796 47473 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411885.1 protein_id gnl|my_center|LOCUS_64890 47858 47646 gene locus_tag LOCUS_64900 47858 47646 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_64900 48135 47923 gene locus_tag LOCUS_64910 48135 47923 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_64910 48386 48174 gene locus_tag LOCUS_64920 48386 48174 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_64920 48913 48377 gene locus_tag LOCUS_64930 48913 48377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64930 48935 49189 gene locus_tag LOCUS_64940 48935 49189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64940 50328 49981 gene locus_tag LOCUS_64950 50328 49981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64950 50481 51398 gene locus_tag LOCUS_64960 50481 51398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64960 51651 51310 gene locus_tag LOCUS_64970 51651 51310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64970 52314 51709 gene locus_tag LOCUS_64980 52314 51709 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_64980 53569 52274 gene locus_tag LOCUS_64990 53569 52274 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_64990 53773 54396 gene locus_tag LOCUS_65000 53773 54396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65000 55539 54520 gene locus_tag LOCUS_65010 55539 54520 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974500.1 protein_id gnl|my_center|LOCUS_65010 56333 55536 gene locus_tag LOCUS_65020 56333 55536 CDS product DUF4184 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227782.1 protein_id gnl|my_center|LOCUS_65020 56502 56675 gene locus_tag LOCUS_65030 56502 56675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65030 56758 57405 gene locus_tag LOCUS_65040 56758 57405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65040 57645 57971 gene locus_tag LOCUS_65050 57645 57971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65050 58343 58756 gene locus_tag LOCUS_65060 58343 58756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65060 59194 60831 gene locus_tag LOCUS_65070 59194 60831 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226120.1 protein_id gnl|my_center|LOCUS_65070 60831 61787 gene locus_tag LOCUS_65080 60831 61787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65080 61793 62938 gene locus_tag LOCUS_65090 61793 62938 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226109.1 protein_id gnl|my_center|LOCUS_65090 62935 64257 gene locus_tag LOCUS_65100 62935 64257 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030721.1 protein_id gnl|my_center|LOCUS_65100 64263 64946 gene locus_tag LOCUS_65110 64263 64946 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226119.1 protein_id gnl|my_center|LOCUS_65110 64943 66316 gene locus_tag LOCUS_65120 64943 66316 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226118.1 protein_id gnl|my_center|LOCUS_65120 66414 67094 gene locus_tag LOCUS_65130 66414 67094 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226117.1 protein_id gnl|my_center|LOCUS_65130 67085 68149 gene locus_tag LOCUS_65140 67085 68149 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226116.1 protein_id gnl|my_center|LOCUS_65140 68146 69114 gene locus_tag LOCUS_65150 68146 69114 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030715.1 protein_id gnl|my_center|LOCUS_65150 69428 71704 gene locus_tag LOCUS_65160 69428 71704 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030997.1 protein_id gnl|my_center|LOCUS_65160 72475 71939 gene locus_tag LOCUS_65170 72475 71939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65170 72858 74060 gene locus_tag LOCUS_65180 72858 74060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65180 74217 74498 gene locus_tag LOCUS_65190 74217 74498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65190 74495 74833 gene locus_tag LOCUS_65200 74495 74833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65200 74830 75120 gene locus_tag LOCUS_65210 74830 75120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65210 75568 75239 gene locus_tag LOCUS_65220 75568 75239 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028253.1 protein_id gnl|my_center|LOCUS_65220 76100 75612 gene locus_tag LOCUS_65230 76100 75612 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184978408.1 protein_id gnl|my_center|LOCUS_65230 76381 77643 gene locus_tag LOCUS_65240 76381 77643 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104427.1 protein_id gnl|my_center|LOCUS_65240 78574 77777 gene locus_tag LOCUS_65250 78574 77777 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967956.1 protein_id gnl|my_center|LOCUS_65250 79284 78868 gene locus_tag LOCUS_65260 79284 78868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65260 79271 80527 gene locus_tag LOCUS_65270 79271 80527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65270 81215 80553 gene locus_tag LOCUS_65280 81215 80553 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_65280 81291 81905 gene locus_tag LOCUS_65290 81291 81905 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222250.1 protein_id gnl|my_center|LOCUS_65290 82092 83291 gene locus_tag LOCUS_65300 82092 83291 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030603.1 protein_id gnl|my_center|LOCUS_65300 83288 85381 gene locus_tag LOCUS_65310 83288 85381 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224500.1 protein_id gnl|my_center|LOCUS_65310 86600 85404 gene locus_tag LOCUS_65320 86600 85404 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466614.1 protein_id gnl|my_center|LOCUS_65320 86872 87840 gene locus_tag LOCUS_65330 86872 87840 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223519.1 protein_id gnl|my_center|LOCUS_65330 87883 88809 gene locus_tag LOCUS_65340 87883 88809 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 protein_id gnl|my_center|LOCUS_65340 88925 90718 gene locus_tag LOCUS_65350 88925 90718 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142567766.1 protein_id gnl|my_center|LOCUS_65350 92424 90889 gene locus_tag LOCUS_65360 92424 90889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65360 92567 96760 gene locus_tag LOCUS_65370 92567 96760 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030433.1 protein_id gnl|my_center|LOCUS_65370 96757 97386 gene locus_tag LOCUS_65380 96757 97386 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030434.1 protein_id gnl|my_center|LOCUS_65380 100140 97504 gene locus_tag LOCUS_65390 100140 97504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65390 100376 100912 gene locus_tag LOCUS_65400 gene pyrE 100376 100912 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_65400 101414 100938 gene locus_tag LOCUS_65410 101414 100938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65410 102194 101499 gene locus_tag LOCUS_65420 102194 101499 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184762868.1 protein_id gnl|my_center|LOCUS_65420 102443 103465 gene locus_tag LOCUS_65430 gene fbaA 102443 103465 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_65430 103623 104327 gene locus_tag LOCUS_65440 103623 104327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65440 104377 105501 gene locus_tag LOCUS_65450 104377 105501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65450 105498 107699 gene locus_tag LOCUS_65460 105498 107699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65460 107946 107710 gene locus_tag LOCUS_65470 107946 107710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65470 107915 109615 gene locus_tag LOCUS_65480 107915 109615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65480 109711 110133 gene locus_tag LOCUS_65490 109711 110133 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_65490 110274 111557 gene locus_tag LOCUS_65500 110274 111557 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_65500 111916 112836 gene locus_tag LOCUS_65510 111916 112836 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085410.1 protein_id gnl|my_center|LOCUS_65510 112949 113785 gene locus_tag LOCUS_65520 112949 113785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65520 113920 115074 gene locus_tag LOCUS_65530 113920 115074 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236073048.1 protein_id gnl|my_center|LOCUS_65530 115330 115091 gene locus_tag LOCUS_65540 115330 115091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65540 115627 116316 gene locus_tag LOCUS_65550 gene tenA 115627 116316 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877712.1 protein_id gnl|my_center|LOCUS_65550 117577 116444 gene locus_tag LOCUS_65560 gene corA 117577 116444 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950508.1 protein_id gnl|my_center|LOCUS_65560 118002 119234 gene locus_tag LOCUS_65570 gene purD 118002 119234 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_65570 119416 120579 gene locus_tag LOCUS_65580 119416 120579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727642.1 protein_id gnl|my_center|LOCUS_65580 120718 121989 gene locus_tag LOCUS_65590 gene murA 120718 121989 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227695.1 protein_id gnl|my_center|LOCUS_65590 122363 123661 gene locus_tag LOCUS_65600 122363 123661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65600 >Feature sequence052 163 1650 gene locus_tag LOCUS_65610 163 1650 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028557.1 protein_id gnl|my_center|LOCUS_65610 1647 2648 gene locus_tag LOCUS_65620 1647 2648 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141728.1 protein_id gnl|my_center|LOCUS_65620 2645 3574 gene locus_tag LOCUS_65630 2645 3574 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975106.1 protein_id gnl|my_center|LOCUS_65630 3602 4816 gene locus_tag LOCUS_65640 3602 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65640 4762 5775 gene locus_tag LOCUS_65650 4762 5775 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_65650 5745 9266 gene locus_tag LOCUS_65660 5745 9266 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221463383.1 protein_id gnl|my_center|LOCUS_65660 10367 9327 gene locus_tag LOCUS_65670 10367 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225442.1 protein_id gnl|my_center|LOCUS_65670 10258 10638 gene locus_tag LOCUS_65680 10258 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65680 11118 11237 gene locus_tag LOCUS_65690 11118 11237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65690 11406 12122 gene locus_tag LOCUS_65700 11406 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65700 12486 12983 gene locus_tag LOCUS_65710 12486 12983 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026883.1 protein_id gnl|my_center|LOCUS_65710 12983 13219 gene locus_tag LOCUS_65720 12983 13219 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978728.1 protein_id gnl|my_center|LOCUS_65720 13350 14168 gene locus_tag LOCUS_65730 13350 14168 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223750.1 protein_id gnl|my_center|LOCUS_65730 14168 15031 gene locus_tag LOCUS_65740 14168 15031 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_65740 15340 16521 gene locus_tag LOCUS_65750 15340 16521 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031117.1 protein_id gnl|my_center|LOCUS_65750 16532 17413 gene locus_tag LOCUS_65760 gene pcaH 16532 17413 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031116.1 protein_id gnl|my_center|LOCUS_65760 17410 18066 gene locus_tag LOCUS_65770 gene pcaG 17410 18066 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031115.1 protein_id gnl|my_center|LOCUS_65770 18053 19516 gene locus_tag LOCUS_65780 gene pcaB 18053 19516 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031114.1 protein_id gnl|my_center|LOCUS_65780 19548 20798 gene locus_tag LOCUS_65790 gene pcaD 19548 20798 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284957.1 protein_id gnl|my_center|LOCUS_65790 >Feature sequence053 2767 2132 gene locus_tag LOCUS_65800 2767 2132 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141508.1 protein_id gnl|my_center|LOCUS_65800 3098 4804 gene locus_tag LOCUS_65810 3098 4804 CDS product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113213.1 protein_id gnl|my_center|LOCUS_65810 5731 4820 gene locus_tag LOCUS_65820 5731 4820 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_65820 5962 9714 gene locus_tag LOCUS_65830 5962 9714 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031481.1 protein_id gnl|my_center|LOCUS_65830 10341 9880 gene locus_tag LOCUS_65840 10341 9880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65840 12642 10573 gene locus_tag LOCUS_65850 12642 10573 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225090.1 protein_id gnl|my_center|LOCUS_65850 12545 12742 gene locus_tag LOCUS_65860 12545 12742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65860 13244 12846 gene locus_tag LOCUS_65870 13244 12846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65870 14735 13920 gene locus_tag LOCUS_65880 14735 13920 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897233.1 protein_id gnl|my_center|LOCUS_65880 15796 14732 gene locus_tag LOCUS_65890 15796 14732 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031498.1 protein_id gnl|my_center|LOCUS_65890 17213 16122 gene locus_tag LOCUS_65900 17213 16122 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530306.1 protein_id gnl|my_center|LOCUS_65900 18062 17415 gene locus_tag LOCUS_65910 18062 17415 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227659.1 protein_id gnl|my_center|LOCUS_65910 18149 18613 gene locus_tag LOCUS_65920 18149 18613 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227660.1 protein_id gnl|my_center|LOCUS_65920 19022 18735 gene locus_tag LOCUS_65930 19022 18735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65930 19651 23190 gene locus_tag LOCUS_65940 19651 23190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65940 23909 23262 gene locus_tag LOCUS_65950 23909 23262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65950 25508 24135 gene locus_tag LOCUS_65960 25508 24135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65960 27067 25676 gene locus_tag LOCUS_65970 27067 25676 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_65970 28191 27064 gene locus_tag LOCUS_65980 gene eboE 28191 27064 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031018.1 protein_id gnl|my_center|LOCUS_65980 29042 28191 gene locus_tag LOCUS_65990 29042 28191 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028849.1 protein_id gnl|my_center|LOCUS_65990 29674 29042 gene locus_tag LOCUS_66000 29674 29042 CDS product EboA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028850.1 protein_id gnl|my_center|LOCUS_66000 30528 29671 gene locus_tag LOCUS_66010 30528 29671 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_66010 31451 30525 gene locus_tag LOCUS_66020 31451 30525 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028852.1 protein_id gnl|my_center|LOCUS_66020 32628 31459 gene locus_tag LOCUS_66030 32628 31459 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_66030 34444 33104 gene locus_tag LOCUS_66040 34444 33104 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776795.1 protein_id gnl|my_center|LOCUS_66040 36730 34763 gene locus_tag LOCUS_66050 36730 34763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66050 37025 37792 gene locus_tag LOCUS_66060 37025 37792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66060 37913 38344 gene locus_tag LOCUS_66070 37913 38344 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229230.1 protein_id gnl|my_center|LOCUS_66070 41149 38426 gene locus_tag LOCUS_66080 41149 38426 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229233.1 protein_id gnl|my_center|LOCUS_66080 41601 43217 gene locus_tag LOCUS_66090 41601 43217 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229234.1 protein_id gnl|my_center|LOCUS_66090 43557 44561 gene locus_tag LOCUS_66100 43557 44561 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613244.1 protein_id gnl|my_center|LOCUS_66100 44850 44632 gene locus_tag LOCUS_66110 44850 44632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66110 45203 45907 gene locus_tag LOCUS_66120 45203 45907 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803815.1 protein_id gnl|my_center|LOCUS_66120 45892 46980 gene locus_tag LOCUS_66130 45892 46980 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803814.1 protein_id gnl|my_center|LOCUS_66130 47308 49131 gene locus_tag LOCUS_66140 47308 49131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030802.1 protein_id gnl|my_center|LOCUS_66140 49984 49262 gene locus_tag LOCUS_66150 49984 49262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66150 50640 53282 gene locus_tag LOCUS_66160 50640 53282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66160 53954 55489 gene locus_tag LOCUS_66170 53954 55489 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031784.1 protein_id gnl|my_center|LOCUS_66170 55492 56892 gene locus_tag LOCUS_66180 gene pntB 55492 56892 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971522.1 protein_id gnl|my_center|LOCUS_66180 57984 56965 gene locus_tag LOCUS_66190 57984 56965 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655931.1 protein_id gnl|my_center|LOCUS_66190 58163 58372 gene locus_tag LOCUS_66200 58163 58372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66200 59841 58279 gene locus_tag LOCUS_66210 59841 58279 CDS product alpha-L-arabinofuranosidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224931.1 protein_id gnl|my_center|LOCUS_66210 59840 60202 gene locus_tag LOCUS_66220 59840 60202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66220 61015 62994 gene locus_tag LOCUS_66230 61015 62994 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225152.1 protein_id gnl|my_center|LOCUS_66230 63284 64837 gene locus_tag LOCUS_66240 63284 64837 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730039.1 protein_id gnl|my_center|LOCUS_66240 65093 66526 gene locus_tag LOCUS_66250 65093 66526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66250 66633 67865 gene locus_tag LOCUS_66260 66633 67865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66260 69161 67974 gene locus_tag LOCUS_66270 gene gmuG 69161 67974 CDS product mannan endo-1,4-beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244107.1 protein_id gnl|my_center|LOCUS_66270 71159 69618 gene locus_tag LOCUS_66280 71159 69618 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229871.1 protein_id gnl|my_center|LOCUS_66280 72620 71580 gene locus_tag LOCUS_66290 72620 71580 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972694.1 protein_id gnl|my_center|LOCUS_66290 72841 73620 gene locus_tag LOCUS_66300 72841 73620 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031462.1 protein_id gnl|my_center|LOCUS_66300 74856 73675 gene locus_tag LOCUS_66310 74856 73675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66310 75147 75737 gene locus_tag LOCUS_66320 75147 75737 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110163.1 protein_id gnl|my_center|LOCUS_66320 77267 75921 gene locus_tag LOCUS_66330 77267 75921 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226634.1 protein_id gnl|my_center|LOCUS_66330 78783 77569 gene locus_tag LOCUS_66340 78783 77569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66340 80159 78780 gene locus_tag LOCUS_66350 80159 78780 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226592.1 protein_id gnl|my_center|LOCUS_66350 80485 80156 gene locus_tag LOCUS_66360 80485 80156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66360 80695 81744 gene locus_tag LOCUS_66370 80695 81744 CDS product questin oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484207.1 protein_id gnl|my_center|LOCUS_66370 82080 84002 gene locus_tag LOCUS_66380 82080 84002 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230810.1 protein_id gnl|my_center|LOCUS_66380 85096 84101 gene locus_tag LOCUS_66390 85096 84101 CDS product clavaminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028519.1 protein_id gnl|my_center|LOCUS_66390 86739 85117 gene locus_tag LOCUS_66400 86739 85117 CDS product class I tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030917.1 protein_id gnl|my_center|LOCUS_66400 87152 86736 gene locus_tag LOCUS_66410 87152 86736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66410 88514 87171 gene locus_tag LOCUS_66420 88514 87171 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226866.1 protein_id gnl|my_center|LOCUS_66420 90325 89252 gene locus_tag LOCUS_66430 90325 89252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66430 95234 90534 gene locus_tag LOCUS_66440 95234 90534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66440 96395 95265 gene locus_tag LOCUS_66450 96395 95265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66450 97726 96674 gene locus_tag LOCUS_66460 97726 96674 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226355.1 protein_id gnl|my_center|LOCUS_66460 97914 100226 gene locus_tag LOCUS_66470 97914 100226 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742130.1 protein_id gnl|my_center|LOCUS_66470 101252 100284 gene locus_tag LOCUS_66480 101252 100284 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728493.1 protein_id gnl|my_center|LOCUS_66480 102403 101249 gene locus_tag LOCUS_66490 102403 101249 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028561.1 protein_id gnl|my_center|LOCUS_66490 >Feature sequence054 1355 51 gene locus_tag LOCUS_66500 1355 51 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030397.1 protein_id gnl|my_center|LOCUS_66500 1600 2205 gene locus_tag LOCUS_66510 1600 2205 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228651.1 protein_id gnl|my_center|LOCUS_66510 3231 2215 gene locus_tag LOCUS_66520 3231 2215 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976175.1 protein_id gnl|my_center|LOCUS_66520 3125 3382 gene locus_tag LOCUS_66530 3125 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66530 3429 4709 gene locus_tag LOCUS_66540 3429 4709 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028461.1 protein_id gnl|my_center|LOCUS_66540 4719 4928 gene locus_tag LOCUS_66550 4719 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66550 5474 4992 gene locus_tag LOCUS_66560 5474 4992 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_66560 5599 6087 gene locus_tag LOCUS_66570 gene def 5599 6087 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_66570 6574 6113 gene locus_tag LOCUS_66580 6574 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66580 7998 6592 gene locus_tag LOCUS_66590 7998 6592 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027930.1 protein_id gnl|my_center|LOCUS_66590 8919 8269 gene locus_tag LOCUS_66600 8919 8269 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_66600 9128 11695 gene locus_tag LOCUS_66610 gene pepN 9128 11695 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228585.1 protein_id gnl|my_center|LOCUS_66610 11918 12469 gene locus_tag LOCUS_66620 11918 12469 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_66620 12486 14351 gene locus_tag LOCUS_66630 12486 14351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66630 14366 15445 gene locus_tag LOCUS_66640 14366 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66640 15726 16490 gene locus_tag LOCUS_66650 15726 16490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66650 16676 18517 gene locus_tag LOCUS_66660 gene ilvD 16676 18517 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028925.1 protein_id gnl|my_center|LOCUS_66660 18692 19219 gene locus_tag LOCUS_66670 18692 19219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66670 20197 19688 gene locus_tag LOCUS_66680 20197 19688 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878108.1 protein_id gnl|my_center|LOCUS_66680 20563 22635 gene locus_tag LOCUS_66690 20563 22635 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_66690 23550 22702 gene locus_tag LOCUS_66700 gene purU 23550 22702 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 protein_id gnl|my_center|LOCUS_66700 23800 23928 gene locus_tag LOCUS_66710 23800 23928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66710 24037 24510 gene locus_tag LOCUS_66720 24037 24510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66720 24523 24981 gene locus_tag LOCUS_66730 24523 24981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66730 27061 25028 gene locus_tag LOCUS_66740 27061 25028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66740 27736 27239 gene locus_tag LOCUS_66750 27736 27239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66750 29103 27733 gene locus_tag LOCUS_66760 29103 27733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66760 29005 29427 gene locus_tag LOCUS_66770 29005 29427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66770 29636 29905 gene locus_tag LOCUS_66780 29636 29905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66780 30039 29809 gene locus_tag LOCUS_66790 30039 29809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66790 30592 30221 gene locus_tag LOCUS_66800 30592 30221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66800 30477 31397 gene locus_tag LOCUS_66810 30477 31397 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 protein_id gnl|my_center|LOCUS_66810 31436 31801 gene locus_tag LOCUS_66820 31436 31801 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_66820 31903 33441 gene locus_tag LOCUS_66830 31903 33441 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228685.1 protein_id gnl|my_center|LOCUS_66830 35457 33793 gene locus_tag LOCUS_66840 gene ettA 35457 33793 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976122.1 protein_id gnl|my_center|LOCUS_66840 36732 35467 gene locus_tag LOCUS_66850 36732 35467 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227346.1 protein_id gnl|my_center|LOCUS_66850 37856 37227 gene locus_tag LOCUS_66860 37856 37227 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974671.1 protein_id gnl|my_center|LOCUS_66860 38145 38894 gene locus_tag LOCUS_66870 38145 38894 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731561.1 protein_id gnl|my_center|LOCUS_66870 39910 39092 gene locus_tag LOCUS_66880 39910 39092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66880 42089 40443 gene locus_tag LOCUS_66890 42089 40443 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_66890 44995 42086 gene locus_tag LOCUS_66900 44995 42086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66900 46227 44992 gene locus_tag LOCUS_66910 gene cobA 46227 44992 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977272.1 protein_id gnl|my_center|LOCUS_66910 47323 46283 gene locus_tag LOCUS_66920 gene speB 47323 46283 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_66920 48652 47492 gene locus_tag LOCUS_66930 48652 47492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66930 49824 48649 gene locus_tag LOCUS_66940 49824 48649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66940 51247 50138 gene locus_tag LOCUS_66950 51247 50138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66950 52558 51425 gene locus_tag LOCUS_66960 52558 51425 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 protein_id gnl|my_center|LOCUS_66960 53514 52594 gene locus_tag LOCUS_66970 53514 52594 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 protein_id gnl|my_center|LOCUS_66970 53824 53507 gene locus_tag LOCUS_66980 53824 53507 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862490.1 protein_id gnl|my_center|LOCUS_66980 54318 53821 gene locus_tag LOCUS_66990 54318 53821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66990 55386 54481 gene locus_tag LOCUS_67000 55386 54481 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259109.1 protein_id gnl|my_center|LOCUS_67000 56048 55440 gene locus_tag LOCUS_67010 56048 55440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67010 56879 56262 gene locus_tag LOCUS_67020 56879 56262 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_67020 58332 56866 gene locus_tag LOCUS_67030 58332 56866 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027372.1 protein_id gnl|my_center|LOCUS_67030 59105 58329 gene locus_tag LOCUS_67040 59105 58329 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027371.1 protein_id gnl|my_center|LOCUS_67040 59180 59926 gene locus_tag LOCUS_67050 59180 59926 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727054.1 protein_id gnl|my_center|LOCUS_67050 59986 61005 gene locus_tag LOCUS_67060 59986 61005 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_67060 62628 61039 gene locus_tag LOCUS_67070 62628 61039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67070 63607 62984 gene locus_tag LOCUS_67080 63607 62984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67080 64311 63643 gene locus_tag LOCUS_67090 64311 63643 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_67090 65392 64304 gene locus_tag LOCUS_67100 65392 64304 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_67100 65735 66718 gene locus_tag LOCUS_67110 65735 66718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67110 68220 66733 gene locus_tag LOCUS_67120 68220 66733 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225551.1 protein_id gnl|my_center|LOCUS_67120 68271 68897 gene locus_tag LOCUS_67130 68271 68897 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974777.1 protein_id gnl|my_center|LOCUS_67130 69359 70324 gene locus_tag LOCUS_67140 69359 70324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67140 70420 70902 gene locus_tag LOCUS_67150 70420 70902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67150 71512 70973 gene locus_tag LOCUS_67160 71512 70973 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030960.1 protein_id gnl|my_center|LOCUS_67160 71435 71710 gene locus_tag LOCUS_67170 71435 71710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67170 71811 72497 gene locus_tag LOCUS_67180 71811 72497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67180 74369 72645 gene locus_tag LOCUS_67190 74369 72645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67190 75082 74366 gene locus_tag LOCUS_67200 75082 74366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225031.1 protein_id gnl|my_center|LOCUS_67200 75264 75875 gene locus_tag LOCUS_67210 75264 75875 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230978.1 protein_id gnl|my_center|LOCUS_67210 76173 76850 gene locus_tag LOCUS_67220 76173 76850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67220 80586 76759 gene locus_tag LOCUS_67230 gene dnaE 80586 76759 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_67230 80852 80586 gene locus_tag LOCUS_67240 80852 80586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67240 81181 82347 gene locus_tag LOCUS_67250 81181 82347 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_67250 82381 83265 gene locus_tag LOCUS_67260 82381 83265 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897937.1 protein_id gnl|my_center|LOCUS_67260 83253 84134 gene locus_tag LOCUS_67270 83253 84134 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 protein_id gnl|my_center|LOCUS_67270 84131 85210 gene locus_tag LOCUS_67280 84131 85210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 protein_id gnl|my_center|LOCUS_67280 86074 85322 gene locus_tag LOCUS_67290 86074 85322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67290 86902 86150 gene locus_tag LOCUS_67300 86902 86150 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114809.1 protein_id gnl|my_center|LOCUS_67300 87168 89168 gene locus_tag LOCUS_67310 87168 89168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67310 90824 89184 gene locus_tag LOCUS_67320 90824 89184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67320 93591 91186 gene locus_tag LOCUS_67330 93591 91186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67330 93919 94881 gene locus_tag LOCUS_67340 93919 94881 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224686.1 protein_id gnl|my_center|LOCUS_67340 96194 95274 gene locus_tag LOCUS_67350 96194 95274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67350 96394 96972 gene locus_tag LOCUS_67360 96394 96972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67360 98239 97061 gene locus_tag LOCUS_67370 98239 97061 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975333.1 protein_id gnl|my_center|LOCUS_67370 99039 98239 gene locus_tag LOCUS_67380 99039 98239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67380 99925 99020 gene locus_tag LOCUS_67390 99925 99020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_67390 100536 100171 gene locus_tag LOCUS_67400 100536 100171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67400 102443 100800 gene locus_tag LOCUS_67410 102443 100800 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228807.1 protein_id gnl|my_center|LOCUS_67410 102689 103048 gene locus_tag LOCUS_67420 102689 103048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67420 104184 103138 gene locus_tag LOCUS_67430 104184 103138 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028006.1 protein_id gnl|my_center|LOCUS_67430 104998 104195 gene locus_tag LOCUS_67440 104998 104195 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975366.1 protein_id gnl|my_center|LOCUS_67440 105069 106025 gene locus_tag LOCUS_67450 105069 106025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67450 >Feature sequence055 1488 4 gene locus_tag LOCUS_67460 1488 4 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026894.1 protein_id gnl|my_center|LOCUS_67460 1710 2201 gene locus_tag LOCUS_67470 1710 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67470 2254 2748 gene locus_tag LOCUS_67480 2254 2748 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_67480 3792 2803 gene locus_tag LOCUS_67490 3792 2803 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866323.1 protein_id gnl|my_center|LOCUS_67490 5063 3789 gene locus_tag LOCUS_67500 5063 3789 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028492.1 protein_id gnl|my_center|LOCUS_67500 5951 5064 gene locus_tag LOCUS_67510 5951 5064 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028491.1 protein_id gnl|my_center|LOCUS_67510 6913 5948 gene locus_tag LOCUS_67520 6913 5948 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976142.1 protein_id gnl|my_center|LOCUS_67520 8254 6917 gene locus_tag LOCUS_67530 8254 6917 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028490.1 protein_id gnl|my_center|LOCUS_67530 9774 8557 gene locus_tag LOCUS_67540 9774 8557 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_67540 10316 12574 gene locus_tag LOCUS_67550 10316 12574 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_67550 13131 14729 gene locus_tag LOCUS_67560 gene lnt 13131 14729 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_67560 14729 15472 gene locus_tag LOCUS_67570 14729 15472 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_67570 15719 16252 gene locus_tag LOCUS_67580 15719 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67580 16863 16519 gene locus_tag LOCUS_67590 16863 16519 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977404.1 protein_id gnl|my_center|LOCUS_67590 18554 17208 gene locus_tag LOCUS_67600 18554 17208 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_67600 19473 18673 gene locus_tag LOCUS_67610 19473 18673 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_67610 20155 19577 gene locus_tag LOCUS_67620 20155 19577 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_67620 20816 20163 gene locus_tag LOCUS_67630 20816 20163 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054390.1 protein_id gnl|my_center|LOCUS_67630 21868 20921 gene locus_tag LOCUS_67640 21868 20921 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_67640 22836 21865 gene locus_tag LOCUS_67650 22836 21865 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728848.1 protein_id gnl|my_center|LOCUS_67650 23861 22833 gene locus_tag LOCUS_67660 23861 22833 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_67660 23891 24697 gene locus_tag LOCUS_67670 23891 24697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67670 24786 25811 gene locus_tag LOCUS_67680 24786 25811 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_67680 26283 25789 gene locus_tag LOCUS_67690 26283 25789 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_67690 26940 26353 gene locus_tag LOCUS_67700 26940 26353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67700 28352 27009 gene locus_tag LOCUS_67710 28352 27009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67710 28878 28510 gene locus_tag LOCUS_67720 28878 28510 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029168.1 protein_id gnl|my_center|LOCUS_67720 29587 29159 gene locus_tag LOCUS_67730 29587 29159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67730 29812 30675 gene locus_tag LOCUS_67740 gene csnA 29812 30675 CDS product chitosanase CsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027289.1 protein_id gnl|my_center|LOCUS_67740 30758 31771 gene locus_tag LOCUS_67750 30758 31771 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029602.1 protein_id gnl|my_center|LOCUS_67750 31797 32639 gene locus_tag LOCUS_67760 31797 32639 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226542.1 protein_id gnl|my_center|LOCUS_67760 33473 32676 gene locus_tag LOCUS_67770 33473 32676 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_67770 33766 34719 gene locus_tag LOCUS_67780 33766 34719 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230336.1 protein_id gnl|my_center|LOCUS_67780 35181 34822 gene locus_tag LOCUS_67790 35181 34822 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977520.1 protein_id gnl|my_center|LOCUS_67790 35568 35257 gene locus_tag LOCUS_67800 35568 35257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67800 35620 36606 gene locus_tag LOCUS_67810 35620 36606 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027713.1 protein_id gnl|my_center|LOCUS_67810 36862 37851 gene locus_tag LOCUS_67820 36862 37851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67820 38867 37968 gene locus_tag LOCUS_67830 38867 37968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67830 39263 39649 gene locus_tag LOCUS_67840 39263 39649 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061701.1 protein_id gnl|my_center|LOCUS_67840 39952 41496 gene locus_tag LOCUS_67850 39952 41496 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224111.1 protein_id gnl|my_center|LOCUS_67850 41684 42310 gene locus_tag LOCUS_67860 41684 42310 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742088.1 protein_id gnl|my_center|LOCUS_67860 42307 43071 gene locus_tag LOCUS_67870 42307 43071 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226469.1 protein_id gnl|my_center|LOCUS_67870 43102 43464 gene locus_tag LOCUS_67880 43102 43464 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_67880 44790 43594 gene locus_tag LOCUS_67890 44790 43594 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195164.1 protein_id gnl|my_center|LOCUS_67890 44857 45528 gene locus_tag LOCUS_67900 44857 45528 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228507.1 protein_id gnl|my_center|LOCUS_67900 47061 45685 gene locus_tag LOCUS_67910 47061 45685 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_67910 47295 47843 gene locus_tag LOCUS_67920 47295 47843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67920 47965 48450 gene locus_tag LOCUS_67930 47965 48450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67930 48458 51115 gene locus_tag LOCUS_67940 48458 51115 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_67940 51143 51577 gene locus_tag LOCUS_67950 51143 51577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67950 51898 54159 gene locus_tag LOCUS_67960 gene pflB 51898 54159 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390748.1 protein_id gnl|my_center|LOCUS_67960 54197 54883 gene locus_tag LOCUS_67970 gene pflA 54197 54883 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390747.1 protein_id gnl|my_center|LOCUS_67970 55017 55640 gene locus_tag LOCUS_67980 55017 55640 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_67980 55748 56569 gene locus_tag LOCUS_67990 55748 56569 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227300.1 protein_id gnl|my_center|LOCUS_67990 57122 56592 gene locus_tag LOCUS_68000 57122 56592 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227282.1 protein_id gnl|my_center|LOCUS_68000 57351 59060 gene locus_tag LOCUS_68010 57351 59060 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_68010 59555 59148 gene locus_tag LOCUS_68020 59555 59148 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730338.1 protein_id gnl|my_center|LOCUS_68020 60342 59734 gene locus_tag LOCUS_68030 60342 59734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68030 61047 60355 gene locus_tag LOCUS_68040 61047 60355 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110820.1 protein_id gnl|my_center|LOCUS_68040 61140 61535 gene locus_tag LOCUS_68050 61140 61535 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080703.1 protein_id gnl|my_center|LOCUS_68050 61638 62048 gene locus_tag LOCUS_68060 61638 62048 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974546.1 protein_id gnl|my_center|LOCUS_68060 63308 62100 gene locus_tag LOCUS_68070 63308 62100 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929725.1 protein_id gnl|my_center|LOCUS_68070 64054 63386 gene locus_tag LOCUS_68080 64054 63386 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530055.1 protein_id gnl|my_center|LOCUS_68080 65614 64220 gene locus_tag LOCUS_68090 65614 64220 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230107.1 protein_id gnl|my_center|LOCUS_68090 67774 65840 gene locus_tag LOCUS_68100 67774 65840 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284089.1 protein_id gnl|my_center|LOCUS_68100 67997 68734 gene locus_tag LOCUS_68110 67997 68734 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230869.1 protein_id gnl|my_center|LOCUS_68110 69583 68798 gene locus_tag LOCUS_68120 69583 68798 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_68120 69717 70316 gene locus_tag LOCUS_68130 69717 70316 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974324.1 protein_id gnl|my_center|LOCUS_68130 70393 71190 gene locus_tag LOCUS_68140 70393 71190 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031856.1 protein_id gnl|my_center|LOCUS_68140 71690 73231 gene locus_tag LOCUS_68150 71690 73231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68150 73614 74570 gene locus_tag LOCUS_68160 73614 74570 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887007.1 protein_id gnl|my_center|LOCUS_68160 74567 75955 gene locus_tag LOCUS_68170 74567 75955 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_68170 77655 76093 gene locus_tag LOCUS_68180 77655 76093 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226513.1 protein_id gnl|my_center|LOCUS_68180 77777 78424 gene locus_tag LOCUS_68190 77777 78424 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031854.1 protein_id gnl|my_center|LOCUS_68190 78552 79244 gene locus_tag LOCUS_68200 78552 79244 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229457.1 protein_id gnl|my_center|LOCUS_68200 81225 79303 gene locus_tag LOCUS_68210 81225 79303 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143126.1 protein_id gnl|my_center|LOCUS_68210 82003 81431 gene locus_tag LOCUS_68220 82003 81431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68220 82102 82869 gene locus_tag LOCUS_68230 82102 82869 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224879.1 protein_id gnl|my_center|LOCUS_68230 82878 84359 gene locus_tag LOCUS_68240 82878 84359 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971914.1 protein_id gnl|my_center|LOCUS_68240 84356 84838 gene locus_tag LOCUS_68250 84356 84838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68250 85710 84952 gene locus_tag LOCUS_68260 85710 84952 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286332.1 protein_id gnl|my_center|LOCUS_68260 85783 86994 gene locus_tag LOCUS_68270 85783 86994 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227636.1 protein_id gnl|my_center|LOCUS_68270 87148 87606 gene locus_tag LOCUS_68280 87148 87606 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975744.1 protein_id gnl|my_center|LOCUS_68280 87606 88139 gene locus_tag LOCUS_68290 87606 88139 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153437081.1 protein_id gnl|my_center|LOCUS_68290 88342 89247 gene locus_tag LOCUS_68300 88342 89247 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027366.1 protein_id gnl|my_center|LOCUS_68300 89320 89565 gene locus_tag LOCUS_68310 89320 89565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68310 89558 90088 gene locus_tag LOCUS_68320 89558 90088 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028212.1 protein_id gnl|my_center|LOCUS_68320 90275 91180 gene locus_tag LOCUS_68330 90275 91180 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_68330 92299 91421 gene locus_tag LOCUS_68340 92299 91421 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225658.1 protein_id gnl|my_center|LOCUS_68340 92411 94348 gene locus_tag LOCUS_68350 92411 94348 CDS product AfsR/SARP family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225657.1 protein_id gnl|my_center|LOCUS_68350 96333 94471 gene locus_tag LOCUS_68360 96333 94471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68360 96480 97049 gene locus_tag LOCUS_68370 96480 97049 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284050.1 protein_id gnl|my_center|LOCUS_68370 97183 98406 gene locus_tag LOCUS_68380 97183 98406 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 protein_id gnl|my_center|LOCUS_68380 >Feature sequence056 <1 803 gene locus_tag LOCUS_68390 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486031.1:non-ribosomal peptide synthetase 800 6415 gene locus_tag LOCUS_68400 800 6415 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031828.1 protein_id gnl|my_center|LOCUS_68400 6412 7488 gene locus_tag LOCUS_68410 6412 7488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68410 7485 8522 gene locus_tag LOCUS_68420 7485 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68420 8519 9262 gene locus_tag LOCUS_68430 8519 9262 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031832.1 protein_id gnl|my_center|LOCUS_68430 9337 10311 gene locus_tag LOCUS_68440 9337 10311 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_68440 13060 10517 gene locus_tag LOCUS_68450 13060 10517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68450 13928 13290 gene locus_tag LOCUS_68460 13928 13290 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_68460 15187 13931 gene locus_tag LOCUS_68470 15187 13931 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870027.1 protein_id gnl|my_center|LOCUS_68470 15906 15184 gene locus_tag LOCUS_68480 15906 15184 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900606.1 protein_id gnl|my_center|LOCUS_68480 16619 15903 gene locus_tag LOCUS_68490 16619 15903 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221995.1 protein_id gnl|my_center|LOCUS_68490 16876 17670 gene locus_tag LOCUS_68500 16876 17670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_68500 17667 18518 gene locus_tag LOCUS_68510 17667 18518 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230182.1 protein_id gnl|my_center|LOCUS_68510 18620 18892 gene locus_tag LOCUS_68520 18620 18892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68520 19314 22019 gene locus_tag LOCUS_68530 19314 22019 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156089687.1 protein_id gnl|my_center|LOCUS_68530 22419 23369 gene locus_tag LOCUS_68540 22419 23369 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225015.1 protein_id gnl|my_center|LOCUS_68540 23353 24054 gene locus_tag LOCUS_68550 23353 24054 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225016.1 protein_id gnl|my_center|LOCUS_68550 24059 24808 gene locus_tag LOCUS_68560 24059 24808 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 protein_id gnl|my_center|LOCUS_68560 27859 24839 gene locus_tag LOCUS_68570 27859 24839 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003078144.1 protein_id gnl|my_center|LOCUS_68570 28745 28059 gene locus_tag LOCUS_68580 28745 28059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68580 28958 29236 gene locus_tag LOCUS_68590 28958 29236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68590 29236 29892 gene locus_tag LOCUS_68600 29236 29892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029717.1 protein_id gnl|my_center|LOCUS_68600 34577 30198 gene locus_tag LOCUS_68610 34577 30198 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029700.1 protein_id gnl|my_center|LOCUS_68610 35025 34732 gene locus_tag LOCUS_68620 35025 34732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68620 37553 35112 gene locus_tag LOCUS_68630 37553 35112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68630 37937 39514 gene locus_tag LOCUS_68640 37937 39514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133404327.1 protein_id gnl|my_center|LOCUS_68640 40085 39522 gene locus_tag LOCUS_68650 40085 39522 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958345.1 protein_id gnl|my_center|LOCUS_68650 40390 40082 gene locus_tag LOCUS_68660 40390 40082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68660 41274 40405 gene locus_tag LOCUS_68670 41274 40405 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_68670 41177 41413 gene locus_tag LOCUS_68680 41177 41413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68680 42153 41584 gene locus_tag LOCUS_68690 42153 41584 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030768.1 protein_id gnl|my_center|LOCUS_68690 44622 42541 gene locus_tag LOCUS_68700 44622 42541 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028686.1 protein_id gnl|my_center|LOCUS_68700 45338 44781 gene locus_tag LOCUS_68710 45338 44781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_68710 45480 46520 gene locus_tag LOCUS_68720 45480 46520 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226051.1 protein_id gnl|my_center|LOCUS_68720 46928 46605 gene locus_tag LOCUS_68730 46928 46605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68730 47894 47058 gene locus_tag LOCUS_68740 47894 47058 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_68740 48146 49792 gene locus_tag LOCUS_68750 48146 49792 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226873.1 protein_id gnl|my_center|LOCUS_68750 50072 51064 gene locus_tag LOCUS_68760 50072 51064 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_68760 51191 51472 gene locus_tag LOCUS_68770 51191 51472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68770 51717 51451 gene locus_tag LOCUS_68780 51717 51451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68780 51716 52108 gene locus_tag LOCUS_68790 51716 52108 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228348.1 protein_id gnl|my_center|LOCUS_68790 52548 52979 gene locus_tag LOCUS_68800 52548 52979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68800 52976 53239 gene locus_tag LOCUS_68810 52976 53239 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978083.1 protein_id gnl|my_center|LOCUS_68810 54595 53573 gene locus_tag LOCUS_68820 54595 53573 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742152.1 protein_id gnl|my_center|LOCUS_68820 54861 54607 gene locus_tag LOCUS_68830 54861 54607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68830 55951 55055 gene locus_tag LOCUS_68840 55951 55055 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226116.1 protein_id gnl|my_center|LOCUS_68840 56143 56424 gene locus_tag LOCUS_68850 56143 56424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68850 56421 57152 gene locus_tag LOCUS_68860 56421 57152 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031621.1 protein_id gnl|my_center|LOCUS_68860 57288 57473 gene locus_tag LOCUS_68870 57288 57473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68870 58128 57556 gene locus_tag LOCUS_68880 58128 57556 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031882.1 protein_id gnl|my_center|LOCUS_68880 58373 58125 gene locus_tag LOCUS_68890 58373 58125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68890 58951 58370 gene locus_tag LOCUS_68900 58951 58370 CDS product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226138.1 protein_id gnl|my_center|LOCUS_68900 59054 59656 gene locus_tag LOCUS_68910 59054 59656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68910 60269 59904 gene locus_tag LOCUS_68920 60269 59904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68920 60556 60631 gene locus_tag LOCUS_t00650 60556 60631 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 61698 60811 gene locus_tag LOCUS_68930 61698 60811 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972048.1 protein_id gnl|my_center|LOCUS_68930 63462 61816 gene locus_tag LOCUS_68940 63462 61816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68940 64560 63571 gene locus_tag LOCUS_68950 64560 63571 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876395.1 protein_id gnl|my_center|LOCUS_68950 64942 65970 gene locus_tag LOCUS_68960 64942 65970 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284494.1 protein_id gnl|my_center|LOCUS_68960 66114 66500 gene locus_tag LOCUS_68970 66114 66500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68970 66606 67097 gene locus_tag LOCUS_68980 66606 67097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68980 67927 67091 gene locus_tag LOCUS_68990 67927 67091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68990 68204 69064 gene locus_tag LOCUS_69000 68204 69064 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_69000 69085 69270 gene locus_tag LOCUS_69010 69085 69270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69010 69527 70294 gene locus_tag LOCUS_69020 69527 70294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69020 71017 70448 gene locus_tag LOCUS_69030 71017 70448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69030 71727 71014 gene locus_tag LOCUS_69040 71727 71014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69040 77908 71882 gene locus_tag LOCUS_69050 77908 71882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69050 79409 78126 gene locus_tag LOCUS_69060 79409 78126 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776795.1 protein_id gnl|my_center|LOCUS_69060 79650 80936 gene locus_tag LOCUS_69070 79650 80936 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776795.1 protein_id gnl|my_center|LOCUS_69070 81147 82673 gene locus_tag LOCUS_69080 81147 82673 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972412.1 protein_id gnl|my_center|LOCUS_69080 >Feature sequence057 1412 2869 gene locus_tag LOCUS_69090 1412 2869 CDS product arabinofuranosidase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225158.1 protein_id gnl|my_center|LOCUS_69090 3719 2949 gene locus_tag LOCUS_69100 3719 2949 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225805.1 protein_id gnl|my_center|LOCUS_69100 3899 4882 gene locus_tag LOCUS_69110 gene ppk2 3899 4882 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062218.1 protein_id gnl|my_center|LOCUS_69110 5028 5492 gene locus_tag LOCUS_69120 5028 5492 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326908.1 protein_id gnl|my_center|LOCUS_69120 6512 5538 gene locus_tag LOCUS_69130 6512 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69130 6641 8245 gene locus_tag LOCUS_69140 6641 8245 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086928.1 protein_id gnl|my_center|LOCUS_69140 8328 9254 gene locus_tag LOCUS_69150 8328 9254 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113014.1 protein_id gnl|my_center|LOCUS_69150 9247 10155 gene locus_tag LOCUS_69160 9247 10155 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 protein_id gnl|my_center|LOCUS_69160 10508 14311 gene locus_tag LOCUS_69170 10508 14311 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031481.1 protein_id gnl|my_center|LOCUS_69170 14902 14390 gene locus_tag LOCUS_69180 14902 14390 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027132.1 protein_id gnl|my_center|LOCUS_69180 14998 15882 gene locus_tag LOCUS_69190 14998 15882 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726677.1 protein_id gnl|my_center|LOCUS_69190 16089 17021 gene locus_tag LOCUS_69200 16089 17021 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867073.1 protein_id gnl|my_center|LOCUS_69200 17895 17620 gene locus_tag LOCUS_69210 17895 17620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69210 17888 18370 gene locus_tag LOCUS_69220 17888 18370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69220 18367 18573 gene locus_tag LOCUS_69230 18367 18573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69230 19106 18465 gene locus_tag LOCUS_69240 19106 18465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69240 20639 19125 gene locus_tag LOCUS_69250 20639 19125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69250 21353 20748 gene locus_tag LOCUS_69260 21353 20748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69260 23143 21785 gene locus_tag LOCUS_69270 23143 21785 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_69270 25051 23180 gene locus_tag LOCUS_69280 25051 23180 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972490.1 protein_id gnl|my_center|LOCUS_69280 26199 25048 gene locus_tag LOCUS_69290 26199 25048 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742198.1 protein_id gnl|my_center|LOCUS_69290 27014 26295 gene locus_tag LOCUS_69300 27014 26295 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228368.1 protein_id gnl|my_center|LOCUS_69300 27091 27729 gene locus_tag LOCUS_69310 27091 27729 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467496.1 protein_id gnl|my_center|LOCUS_69310 29198 28053 gene locus_tag LOCUS_69320 29198 28053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69320 29413 30186 gene locus_tag LOCUS_69330 29413 30186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69330 30410 32227 gene locus_tag LOCUS_69340 30410 32227 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742071.1 protein_id gnl|my_center|LOCUS_69340 32224 34413 gene locus_tag LOCUS_69350 gene scpA 32224 34413 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_69350 34400 35380 gene locus_tag LOCUS_69360 gene meaB 34400 35380 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_69360 35558 37639 gene locus_tag LOCUS_69370 35558 37639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69370 37792 38091 gene locus_tag LOCUS_69380 37792 38091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69380 38125 39606 gene locus_tag LOCUS_69390 38125 39606 CDS product bifunctional phosphatase PAP2/diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030974.1 protein_id gnl|my_center|LOCUS_69390 40009 39749 gene locus_tag LOCUS_69400 40009 39749 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033875.1 protein_id gnl|my_center|LOCUS_69400 41061 40045 gene locus_tag LOCUS_69410 41061 40045 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027843.1 protein_id gnl|my_center|LOCUS_69410 41134 42021 gene locus_tag LOCUS_69420 41134 42021 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222522.1 protein_id gnl|my_center|LOCUS_69420 42785 42018 gene locus_tag LOCUS_69430 42785 42018 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969730.1 protein_id gnl|my_center|LOCUS_69430 42918 43700 gene locus_tag LOCUS_69440 42918 43700 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_69440 43787 44425 gene locus_tag LOCUS_69450 43787 44425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69450 44929 44504 gene locus_tag LOCUS_69460 gene arfB 44929 44504 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974697.1 protein_id gnl|my_center|LOCUS_69460 45214 46074 gene locus_tag LOCUS_69470 45214 46074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69470 46085 46687 gene locus_tag LOCUS_69480 46085 46687 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230784.1 protein_id gnl|my_center|LOCUS_69480 46784 47056 gene locus_tag LOCUS_69490 46784 47056 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230904.1 protein_id gnl|my_center|LOCUS_69490 47249 48829 gene locus_tag LOCUS_69500 gene phoD 47249 48829 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_69500 50262 49027 gene locus_tag LOCUS_69510 50262 49027 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223986.1 protein_id gnl|my_center|LOCUS_69510 50399 50926 gene locus_tag LOCUS_69520 50399 50926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69520 52720 51173 gene locus_tag LOCUS_69530 52720 51173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69530 52962 56408 gene locus_tag LOCUS_69540 52962 56408 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228485.1 protein_id gnl|my_center|LOCUS_69540 56630 56418 gene locus_tag LOCUS_69550 56630 56418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69550 57415 56687 gene locus_tag LOCUS_69560 57415 56687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69560 57666 59036 gene locus_tag LOCUS_69570 57666 59036 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222041.1 protein_id gnl|my_center|LOCUS_69570 59033 59944 gene locus_tag LOCUS_69580 59033 59944 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222042.1 protein_id gnl|my_center|LOCUS_69580 60024 61397 gene locus_tag LOCUS_69590 gene cyp124 60024 61397 CDS product methyl-branched lipid omega-hydroxylase Cyp124 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411654.1 protein_id gnl|my_center|LOCUS_69590 62051 61485 gene locus_tag LOCUS_69600 62051 61485 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895416.1 protein_id gnl|my_center|LOCUS_69600 62114 63040 gene locus_tag LOCUS_69610 62114 63040 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113182.1 protein_id gnl|my_center|LOCUS_69610 63151 63534 gene locus_tag LOCUS_69620 63151 63534 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973901.1 protein_id gnl|my_center|LOCUS_69620 64560 63583 gene locus_tag LOCUS_69630 64560 63583 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224055.1 protein_id gnl|my_center|LOCUS_69630 66671 64557 gene locus_tag LOCUS_69640 66671 64557 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892409.1 protein_id gnl|my_center|LOCUS_69640 67247 66837 gene locus_tag LOCUS_69650 67247 66837 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087447.1 protein_id gnl|my_center|LOCUS_69650 67612 67968 gene locus_tag LOCUS_69660 67612 67968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222450.1 protein_id gnl|my_center|LOCUS_69660 69040 68084 gene locus_tag LOCUS_69670 69040 68084 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_69670 69213 70349 gene locus_tag LOCUS_69680 69213 70349 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033518021.1 protein_id gnl|my_center|LOCUS_69680 >Feature sequence058 721 41 gene locus_tag LOCUS_69690 721 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69690 1013 750 gene locus_tag LOCUS_69700 1013 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69700 2219 2953 gene locus_tag LOCUS_69710 2219 2953 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028937.1 protein_id gnl|my_center|LOCUS_69710 2944 3156 gene locus_tag LOCUS_69720 2944 3156 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_69720 3397 3542 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgctccccgcgcacgcggggatgg 5548 3725 gene locus_tag LOCUS_69730 5548 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69730 8474 5748 gene locus_tag LOCUS_69740 8474 5748 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202630.1 protein_id gnl|my_center|LOCUS_69740 8446 8652 gene locus_tag LOCUS_69750 8446 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69750 9177 10058 gene locus_tag LOCUS_69760 9177 10058 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728749.1 protein_id gnl|my_center|LOCUS_69760 11368 10274 gene locus_tag LOCUS_69770 11368 10274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69770 11766 12827 gene locus_tag LOCUS_69780 11766 12827 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223306.1 protein_id gnl|my_center|LOCUS_69780 13259 12840 gene locus_tag LOCUS_69790 13259 12840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69790 14151 13384 gene locus_tag LOCUS_69800 14151 13384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69800 14666 14385 gene locus_tag LOCUS_69810 14666 14385 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272729.1 protein_id gnl|my_center|LOCUS_69810 14608 14889 gene locus_tag LOCUS_69820 14608 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69820 14967 15827 gene locus_tag LOCUS_69830 14967 15827 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866806.1 protein_id gnl|my_center|LOCUS_69830 15839 18700 gene locus_tag LOCUS_69840 15839 18700 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227286.1 protein_id gnl|my_center|LOCUS_69840 18796 21255 gene locus_tag LOCUS_69850 18796 21255 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027248.1 protein_id gnl|my_center|LOCUS_69850 21252 21941 gene locus_tag LOCUS_69860 21252 21941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69860 24631 21950 gene locus_tag LOCUS_69870 gene fdhF 24631 21950 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527515.1 protein_id gnl|my_center|LOCUS_69870 26527 24851 gene locus_tag LOCUS_69880 26527 24851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69880 27610 26675 gene locus_tag LOCUS_69890 27610 26675 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173595.1 protein_id gnl|my_center|LOCUS_69890 28963 27617 gene locus_tag LOCUS_69900 28963 27617 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_69900 29811 29209 gene locus_tag LOCUS_69910 29811 29209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69910 31002 29998 gene locus_tag LOCUS_69920 gene yjfF 31002 29998 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_69920 32054 30999 gene locus_tag LOCUS_69930 32054 30999 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_69930 33580 32051 gene locus_tag LOCUS_69940 33580 32051 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_69940 34825 33821 gene locus_tag LOCUS_69950 34825 33821 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_69950 35458 35270 gene locus_tag LOCUS_69960 35458 35270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69960 35859 35617 gene locus_tag LOCUS_69970 35859 35617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69970 35853 37514 gene locus_tag LOCUS_69980 gene kdpA 35853 37514 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730504.1 protein_id gnl|my_center|LOCUS_69980 37514 39676 gene locus_tag LOCUS_69990 gene kdpB 37514 39676 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730505.1 protein_id gnl|my_center|LOCUS_69990 39677 40534 gene locus_tag LOCUS_70000 39677 40534 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730506.1 protein_id gnl|my_center|LOCUS_70000 45116 40722 gene locus_tag LOCUS_70010 45116 40722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221460661.1 protein_id gnl|my_center|LOCUS_70010 45985 45113 gene locus_tag LOCUS_70020 45985 45113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70020 47076 48446 gene locus_tag LOCUS_70030 47076 48446 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_70030 48439 49101 gene locus_tag LOCUS_70040 48439 49101 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_70040 49220 50488 gene locus_tag LOCUS_70050 gene nhaA 49220 50488 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081951.1 protein_id gnl|my_center|LOCUS_70050 50891 50571 gene locus_tag LOCUS_70060 50891 50571 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899955.1 protein_id gnl|my_center|LOCUS_70060 51265 50888 gene locus_tag LOCUS_70070 51265 50888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70070 52419 51391 gene locus_tag LOCUS_70080 52419 51391 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584074.1 protein_id gnl|my_center|LOCUS_70080 53534 55915 gene locus_tag LOCUS_70090 53534 55915 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031390.1 protein_id gnl|my_center|LOCUS_70090 56055 56849 gene locus_tag LOCUS_70100 56055 56849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70100 58081 56969 gene locus_tag LOCUS_70110 58081 56969 CDS product DUF3103 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707631.1 protein_id gnl|my_center|LOCUS_70110 >Feature sequence059 225 830 gene locus_tag LOCUS_70120 225 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70120 2060 1062 gene locus_tag LOCUS_70130 2060 1062 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026931.1 protein_id gnl|my_center|LOCUS_70130 2343 3044 gene locus_tag LOCUS_70140 2343 3044 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978707.1 protein_id gnl|my_center|LOCUS_70140 3074 3973 gene locus_tag LOCUS_70150 3074 3973 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227300.1 protein_id gnl|my_center|LOCUS_70150 4259 4080 gene locus_tag LOCUS_70160 4259 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70160 5370 7079 gene locus_tag LOCUS_70170 5370 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70170 7601 7272 gene locus_tag LOCUS_70180 7601 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70180 8092 7622 gene locus_tag LOCUS_70190 8092 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70190 >Feature sequence060 275 1354 gene locus_tag LOCUS_70200 275 1354 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225761.1 protein_id gnl|my_center|LOCUS_70200 2629 1382 gene locus_tag LOCUS_70210 2629 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70210 4414 2861 gene locus_tag LOCUS_70220 4414 2861 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222228.1 protein_id gnl|my_center|LOCUS_70220 5772 4426 gene locus_tag LOCUS_70230 5772 4426 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028592.1 protein_id gnl|my_center|LOCUS_70230 6304 6957 gene locus_tag LOCUS_70240 gene leuE 6304 6957 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192135.1 protein_id gnl|my_center|LOCUS_70240 7447 7106 gene locus_tag LOCUS_70250 7447 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70250 7724 8377 gene locus_tag LOCUS_70260 7724 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70260 8517 9236 gene locus_tag LOCUS_70270 8517 9236 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612370.1 protein_id gnl|my_center|LOCUS_70270 9387 12041 gene locus_tag LOCUS_70280 9387 12041 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461688.1 protein_id gnl|my_center|LOCUS_70280 12949 12038 gene locus_tag LOCUS_70290 12949 12038 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205660833.1 protein_id gnl|my_center|LOCUS_70290 13250 13684 gene locus_tag LOCUS_70300 13250 13684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70300 13758 13833 gene locus_tag LOCUS_t00660 13758 13833 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14895 13948 gene locus_tag LOCUS_70310 14895 13948 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223370.1 protein_id gnl|my_center|LOCUS_70310 15840 14953 gene locus_tag LOCUS_70320 15840 14953 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786554.1 protein_id gnl|my_center|LOCUS_70320 17731 15956 gene locus_tag LOCUS_70330 17731 15956 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205621810.1 protein_id gnl|my_center|LOCUS_70330 19539 17707 gene locus_tag LOCUS_70340 19539 17707 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 protein_id gnl|my_center|LOCUS_70340 22016 19539 gene locus_tag LOCUS_70350 22016 19539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70350 21939 22127 gene locus_tag LOCUS_70360 21939 22127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70360 22315 24522 gene locus_tag LOCUS_70370 22315 24522 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222670.1 protein_id gnl|my_center|LOCUS_70370 25976 24582 gene locus_tag LOCUS_70380 25976 24582 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_70380 26905 26057 gene locus_tag LOCUS_70390 26905 26057 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894682.1 protein_id gnl|my_center|LOCUS_70390 27756 26902 gene locus_tag LOCUS_70400 27756 26902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894683.1 protein_id gnl|my_center|LOCUS_70400 29032 27761 gene locus_tag LOCUS_70410 29032 27761 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973358.1 protein_id gnl|my_center|LOCUS_70410 30195 29041 gene locus_tag LOCUS_70420 30195 29041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_70420 31700 30267 gene locus_tag LOCUS_70430 31700 30267 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_70430 31918 32421 gene locus_tag LOCUS_70440 31918 32421 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_70440 33937 32594 gene locus_tag LOCUS_70450 33937 32594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70450 34052 34915 gene locus_tag LOCUS_70460 34052 34915 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030617.1 protein_id gnl|my_center|LOCUS_70460 34912 35595 gene locus_tag LOCUS_70470 34912 35595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70470 35785 36585 gene locus_tag LOCUS_70480 35785 36585 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_70480 37497 36619 gene locus_tag LOCUS_70490 37497 36619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70490 38239 37691 gene locus_tag LOCUS_70500 gene rnhA 38239 37691 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227882.1 protein_id gnl|my_center|LOCUS_70500 38509 38763 gene locus_tag LOCUS_70510 38509 38763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70510 39946 38840 gene locus_tag LOCUS_70520 gene rlmN 39946 38840 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_70520 40198 40001 gene locus_tag LOCUS_70530 40198 40001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70530 40181 41086 gene locus_tag LOCUS_70540 40181 41086 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210785.1 protein_id gnl|my_center|LOCUS_70540 42215 41100 gene locus_tag LOCUS_70550 42215 41100 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852129.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70550 42938 42381 gene locus_tag LOCUS_70560 gene frr 42938 42381 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_70560 43646 42948 gene locus_tag LOCUS_70570 gene pyrH 43646 42948 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973384.1 protein_id gnl|my_center|LOCUS_70570 44609 43776 gene locus_tag LOCUS_70580 gene tsf 44609 43776 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973385.1 protein_id gnl|my_center|LOCUS_70580 45686 44724 gene locus_tag LOCUS_70590 gene rpsB 45686 44724 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_70590 46097 46333 gene locus_tag LOCUS_70600 46097 46333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70600 46830 47396 gene locus_tag LOCUS_70610 46830 47396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70610 49370 47550 gene locus_tag LOCUS_70620 49370 47550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70620 51002 49458 gene locus_tag LOCUS_70630 51002 49458 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030329.1 protein_id gnl|my_center|LOCUS_70630 51356 51003 gene locus_tag LOCUS_70640 51356 51003 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_70640 52405 52082 gene locus_tag LOCUS_70650 52405 52082 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_70650 53140 52445 gene locus_tag LOCUS_70660 53140 52445 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414713.1 protein_id gnl|my_center|LOCUS_70660 54211 53333 gene locus_tag LOCUS_70670 54211 53333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_70670 55099 54317 gene locus_tag LOCUS_70680 55099 54317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70680 56070 55192 gene locus_tag LOCUS_70690 gene lepB 56070 55192 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973395.1 protein_id gnl|my_center|LOCUS_70690 56636 56271 gene locus_tag LOCUS_70700 gene rplS 56636 56271 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973398.1 protein_id gnl|my_center|LOCUS_70700 57636 56860 gene locus_tag LOCUS_70710 gene trmD 57636 56860 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973399.1 protein_id gnl|my_center|LOCUS_70710 58189 57674 gene locus_tag LOCUS_70720 gene rimM 58189 57674 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973400.1 protein_id gnl|my_center|LOCUS_70720 58549 58307 gene locus_tag LOCUS_70730 58549 58307 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_70730 59015 58551 gene locus_tag LOCUS_70740 gene rpsP 59015 58551 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728340.1 protein_id gnl|my_center|LOCUS_70740 60810 59266 gene locus_tag LOCUS_70750 gene ffh 60810 59266 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_70750 <61447 60925 gene locus_tag LOCUS_70760 <61447 60925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009314218.1:ATP/GTP-binding protein >Feature sequence061 743 399 gene locus_tag LOCUS_70770 743 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70770 742 951 gene locus_tag LOCUS_70780 742 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70780 918 2756 gene locus_tag LOCUS_70790 918 2756 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969672.1 protein_id gnl|my_center|LOCUS_70790 2753 5920 gene locus_tag LOCUS_70800 2753 5920 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228347.1 protein_id gnl|my_center|LOCUS_70800 5769 5677 gene locus_tag LOCUS_t00670 5769 5677 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5917 7002 gene locus_tag LOCUS_70810 5917 7002 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228346.1 protein_id gnl|my_center|LOCUS_70810 8239 7133 gene locus_tag LOCUS_70820 8239 7133 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805204.1 protein_id gnl|my_center|LOCUS_70820 8277 9224 gene locus_tag LOCUS_70830 8277 9224 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080096.1 protein_id gnl|my_center|LOCUS_70830 9286 10242 gene locus_tag LOCUS_70840 9286 10242 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_70840 10303 10623 gene locus_tag LOCUS_70850 10303 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70850 10690 11061 gene locus_tag LOCUS_70860 10690 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70860 11133 11996 gene locus_tag LOCUS_70870 gene tatC 11133 11996 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729395.1 protein_id gnl|my_center|LOCUS_70870 13638 12181 gene locus_tag LOCUS_70880 13638 12181 CDS product arabinofuranosidase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225843.1 protein_id gnl|my_center|LOCUS_70880 15320 14037 gene locus_tag LOCUS_70890 15320 14037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70890 15637 16521 gene locus_tag LOCUS_70900 15637 16521 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_70900 17154 20939 gene locus_tag LOCUS_70910 17154 20939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221460661.1 protein_id gnl|my_center|LOCUS_70910 21186 21647 gene locus_tag LOCUS_70920 21186 21647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70920 23147 21864 gene locus_tag LOCUS_70930 23147 21864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70930 25258 23657 gene locus_tag LOCUS_70940 25258 23657 CDS product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030163.1 protein_id gnl|my_center|LOCUS_70940 27335 25260 gene locus_tag LOCUS_70950 27335 25260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70950 27690 30434 gene locus_tag LOCUS_70960 27690 30434 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_70960 30964 31617 gene locus_tag LOCUS_70970 30964 31617 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530368.1 protein_id gnl|my_center|LOCUS_70970 31673 31846 gene locus_tag LOCUS_70980 31673 31846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70980 32077 32970 gene locus_tag LOCUS_70990 32077 32970 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229949.1 protein_id gnl|my_center|LOCUS_70990 33678 33013 gene locus_tag LOCUS_71000 33678 33013 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873188.1 protein_id gnl|my_center|LOCUS_71000 33805 34788 gene locus_tag LOCUS_71010 33805 34788 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224988.1 protein_id gnl|my_center|LOCUS_71010 36409 35009 gene locus_tag LOCUS_71020 36409 35009 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_71020 36523 37281 gene locus_tag LOCUS_71030 36523 37281 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_71030 38505 37588 gene locus_tag LOCUS_71040 38505 37588 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_71040 38979 40064 gene locus_tag LOCUS_71050 38979 40064 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_71050 40532 41680 gene locus_tag LOCUS_71060 40532 41680 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027782.1 protein_id gnl|my_center|LOCUS_71060 41985 49832 gene locus_tag LOCUS_71070 41985 49832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71070 49829 50860 gene locus_tag LOCUS_71080 49829 50860 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225858.1 protein_id gnl|my_center|LOCUS_71080 50864 52774 gene locus_tag LOCUS_71090 gene oleC 50864 52774 CDS product olefin beta-lactone synthetase OleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035474.1 protein_id gnl|my_center|LOCUS_71090 52783 53766 gene locus_tag LOCUS_71100 52783 53766 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275143.1 protein_id gnl|my_center|LOCUS_71100 53772 54698 gene locus_tag LOCUS_71110 53772 54698 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035472.1 protein_id gnl|my_center|LOCUS_71110 54773 55393 gene locus_tag LOCUS_71120 54773 55393 CDS product DUF6230 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030235.1 protein_id gnl|my_center|LOCUS_71120 55398 56771 gene locus_tag LOCUS_71130 55398 56771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71130 56988 58283 gene locus_tag LOCUS_71140 56988 58283 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031615.1 protein_id gnl|my_center|LOCUS_71140 58369 58911 gene locus_tag LOCUS_71150 58369 58911 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029338.1 protein_id gnl|my_center|LOCUS_71150 59860 58937 gene locus_tag LOCUS_71160 59860 58937 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029243.1 protein_id gnl|my_center|LOCUS_71160 60102 61091 gene locus_tag LOCUS_71170 60102 61091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_71170 >Feature sequence062 843 2231 gene locus_tag LOCUS_71180 843 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71180 3022 2354 gene locus_tag LOCUS_71190 3022 2354 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_71190 5724 3019 gene locus_tag LOCUS_71200 5724 3019 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_71200 5908 5729 gene locus_tag LOCUS_71210 5908 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71210 7437 6292 gene locus_tag LOCUS_71220 7437 6292 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081873.1 protein_id gnl|my_center|LOCUS_71220 7948 9363 gene locus_tag LOCUS_71230 7948 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71230 9360 10343 gene locus_tag LOCUS_71240 9360 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71240 11857 10508 gene locus_tag LOCUS_71250 11857 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71250 12495 11854 gene locus_tag LOCUS_71260 12495 11854 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230285.1 protein_id gnl|my_center|LOCUS_71260 14360 12729 gene locus_tag LOCUS_71270 14360 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71270 15029 14622 gene locus_tag LOCUS_71280 15029 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71280 15100 15888 gene locus_tag LOCUS_71290 15100 15888 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088525.1 protein_id gnl|my_center|LOCUS_71290 17190 15910 gene locus_tag LOCUS_71300 17190 15910 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027368.1 protein_id gnl|my_center|LOCUS_71300 17800 17279 gene locus_tag LOCUS_71310 17800 17279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71310 17933 18715 gene locus_tag LOCUS_71320 17933 18715 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028316.1 protein_id gnl|my_center|LOCUS_71320 >Feature sequence063 244 501 gene locus_tag LOCUS_71330 244 501 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029565.1 protein_id gnl|my_center|LOCUS_71330 750 1298 gene locus_tag LOCUS_71340 750 1298 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259518.1 protein_id gnl|my_center|LOCUS_71340 1778 2698 gene locus_tag LOCUS_71350 1778 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71350 2711 3580 gene locus_tag LOCUS_71360 2711 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71360 4798 3686 gene locus_tag LOCUS_71370 4798 3686 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728962.1 protein_id gnl|my_center|LOCUS_71370 5845 4904 gene locus_tag LOCUS_71380 5845 4904 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877923.1 protein_id gnl|my_center|LOCUS_71380 6352 5909 gene locus_tag LOCUS_71390 6352 5909 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893617.1 protein_id gnl|my_center|LOCUS_71390 7014 6433 gene locus_tag LOCUS_71400 7014 6433 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 protein_id gnl|my_center|LOCUS_71400 7220 8365 gene locus_tag LOCUS_71410 7220 8365 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897409.1 protein_id gnl|my_center|LOCUS_71410 8571 9779 gene locus_tag LOCUS_71420 8571 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71420 10228 9752 gene locus_tag LOCUS_71430 10228 9752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71430 11530 10490 gene locus_tag LOCUS_71440 11530 10490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71440 12086 11553 gene locus_tag LOCUS_71450 12086 11553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71450 12400 16503 gene locus_tag LOCUS_71460 12400 16503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71460 17033 16692 gene locus_tag LOCUS_71470 17033 16692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71470 18718 17363 gene locus_tag LOCUS_71480 18718 17363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71480 19440 18715 gene locus_tag LOCUS_71490 19440 18715 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_71490 19983 19453 gene locus_tag LOCUS_71500 19983 19453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71500 20874 20188 gene locus_tag LOCUS_71510 20874 20188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71510 21208 21690 gene locus_tag LOCUS_71520 gene rpoE 21208 21690 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_71520 21677 22690 gene locus_tag LOCUS_71530 21677 22690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71530 23321 22773 gene locus_tag LOCUS_71540 23321 22773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71540 23668 25389 gene locus_tag LOCUS_71550 23668 25389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71550 24838 24744 gene locus_tag LOCUS_t00680 24838 24744 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence064 452 1531 gene locus_tag LOCUS_71560 452 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71560 1956 1747 gene locus_tag LOCUS_71570 1956 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71570 1841 2827 gene locus_tag LOCUS_71580 1841 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71580 4262 2901 gene locus_tag LOCUS_71590 4262 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029632.1 protein_id gnl|my_center|LOCUS_71590 5918 4728 gene locus_tag LOCUS_71600 5918 4728 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_71600 6304 6846 gene locus_tag LOCUS_71610 6304 6846 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 protein_id gnl|my_center|LOCUS_71610 7143 6862 gene locus_tag LOCUS_71620 7143 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_71620 7263 7664 gene locus_tag LOCUS_71630 gene sodN 7263 7664 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_71630 7895 8332 gene locus_tag LOCUS_71640 7895 8332 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_71640 8350 9129 gene locus_tag LOCUS_71650 8350 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71650 9557 9180 gene locus_tag LOCUS_71660 9557 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71660 9597 10604 gene locus_tag LOCUS_71670 9597 10604 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_71670 10895 11149 gene locus_tag LOCUS_71680 10895 11149 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_71680 12820 11363 gene locus_tag LOCUS_71690 12820 11363 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_71690 12933 14123 gene locus_tag LOCUS_71700 12933 14123 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728881.1 protein_id gnl|my_center|LOCUS_71700 14120 14854 gene locus_tag LOCUS_71710 14120 14854 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973740.1 protein_id gnl|my_center|LOCUS_71710 14856 15581 gene locus_tag LOCUS_71720 gene bioD 14856 15581 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742103.1 protein_id gnl|my_center|LOCUS_71720 15611 16627 gene locus_tag LOCUS_71730 gene bioB 15611 16627 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057907.1 protein_id gnl|my_center|LOCUS_71730 16725 18371 gene locus_tag LOCUS_71740 16725 18371 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409218.1 protein_id gnl|my_center|LOCUS_71740 20375 18549 gene locus_tag LOCUS_71750 20375 18549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71750 20848 21228 gene locus_tag LOCUS_71760 20848 21228 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_71760 21463 21272 gene locus_tag LOCUS_71770 21463 21272 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877243.1 protein_id gnl|my_center|LOCUS_71770 22949 21600 gene locus_tag LOCUS_71780 22949 21600 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179728959.1 protein_id gnl|my_center|LOCUS_71780 24514 23234 gene locus_tag LOCUS_71790 24514 23234 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495247.1 protein_id gnl|my_center|LOCUS_71790 25866 24511 gene locus_tag LOCUS_71800 25866 24511 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030117.1 protein_id gnl|my_center|LOCUS_71800 26048 25899 gene locus_tag LOCUS_71810 26048 25899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71810 27071 26139 gene locus_tag LOCUS_71820 gene galE1 27071 26139 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104180.1 protein_id gnl|my_center|LOCUS_71820 27474 27202 gene locus_tag LOCUS_71830 27474 27202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71830 28239 27553 gene locus_tag LOCUS_71840 gene sigR 28239 27553 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_71840 28397 29143 gene locus_tag LOCUS_71850 28397 29143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71850 29932 29183 gene locus_tag LOCUS_71860 29932 29183 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_71860 30079 31356 gene locus_tag LOCUS_71870 gene aroA 30079 31356 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_71870 31326 32456 gene locus_tag LOCUS_71880 gene rsgA 31326 32456 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775972.1 protein_id gnl|my_center|LOCUS_71880 32632 33417 gene locus_tag LOCUS_71890 gene hisN 32632 33417 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_71890 33935 34912 gene locus_tag LOCUS_71900 33935 34912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71900 35421 34924 gene locus_tag LOCUS_71910 35421 34924 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_71910 35692 36801 gene locus_tag LOCUS_71920 gene pstS 35692 36801 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974827.1 protein_id gnl|my_center|LOCUS_71920 36846 37787 gene locus_tag LOCUS_71930 gene pstC 36846 37787 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029460.1 protein_id gnl|my_center|LOCUS_71930 37784 38671 gene locus_tag LOCUS_71940 gene pstA 37784 38671 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_71940 38684 39460 gene locus_tag LOCUS_71950 gene pstB 38684 39460 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974830.1 protein_id gnl|my_center|LOCUS_71950 39482 40195 gene locus_tag LOCUS_71960 gene regX 39482 40195 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 protein_id gnl|my_center|LOCUS_71960 41140 40241 gene locus_tag LOCUS_71970 41140 40241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71970 41404 41895 gene locus_tag LOCUS_71980 41404 41895 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229828.1 protein_id gnl|my_center|LOCUS_71980 43873 42092 gene locus_tag LOCUS_71990 43873 42092 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742065.1 protein_id gnl|my_center|LOCUS_71990 >Feature sequence065 1030 452 gene locus_tag LOCUS_72000 1030 452 CDS product DUF3291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228440.1 protein_id gnl|my_center|LOCUS_72000 1632 1027 gene locus_tag LOCUS_72010 1632 1027 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971473.1 protein_id gnl|my_center|LOCUS_72010 1513 1749 gene locus_tag LOCUS_72020 1513 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72020 2295 4385 gene locus_tag LOCUS_72030 2295 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72030 5858 4905 gene locus_tag LOCUS_72040 5858 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72040 7476 6118 gene locus_tag LOCUS_72050 gene pafA 7476 6118 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_72050 8576 7791 gene locus_tag LOCUS_72060 gene prcA 8576 7791 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_72060 9446 8610 gene locus_tag LOCUS_72070 gene prcB 9446 8610 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_72070 10072 9614 gene locus_tag LOCUS_72080 10072 9614 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 protein_id gnl|my_center|LOCUS_72080 10159 10584 gene locus_tag LOCUS_72090 10159 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72090 11122 10913 gene locus_tag LOCUS_72100 11122 10913 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_72100 11350 11754 gene locus_tag LOCUS_72110 11350 11754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72110 11868 12749 gene locus_tag LOCUS_72120 11868 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_72120 14336 12819 gene locus_tag LOCUS_72130 gene dop 14336 12819 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_72130 16290 14527 gene locus_tag LOCUS_72140 gene arc 16290 14527 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_72140 17373 16513 gene locus_tag LOCUS_72150 17373 16513 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_72150 17525 18625 gene locus_tag LOCUS_72160 17525 18625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72160 19883 18651 gene locus_tag LOCUS_72170 19883 18651 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_72170 20846 19887 gene locus_tag LOCUS_72180 20846 19887 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225340.1 protein_id gnl|my_center|LOCUS_72180 20949 21539 gene locus_tag LOCUS_72190 20949 21539 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 protein_id gnl|my_center|LOCUS_72190 21616 22239 gene locus_tag LOCUS_72200 21616 22239 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230414.1 protein_id gnl|my_center|LOCUS_72200 23800 22283 gene locus_tag LOCUS_72210 23800 22283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72210 25514 24378 gene locus_tag LOCUS_72220 25514 24378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72220 25628 26488 gene locus_tag LOCUS_72230 25628 26488 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_72230 26755 26492 gene locus_tag LOCUS_72240 26755 26492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72240 26993 27817 gene locus_tag LOCUS_72250 26993 27817 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028937.1 protein_id gnl|my_center|LOCUS_72250 27805 28020 gene locus_tag LOCUS_72260 27805 28020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72260 28885 28031 gene locus_tag LOCUS_72270 28885 28031 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727008.1 protein_id gnl|my_center|LOCUS_72270 29083 29853 gene locus_tag LOCUS_72280 29083 29853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72280 30091 31314 gene locus_tag LOCUS_72290 30091 31314 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_72290 31311 31994 gene locus_tag LOCUS_72300 31311 31994 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_72300 32619 32044 gene locus_tag LOCUS_72310 32619 32044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72310 33811 32759 gene locus_tag LOCUS_72320 33811 32759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72320 34833 33808 gene locus_tag LOCUS_72330 34833 33808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_72330 35849 34830 gene locus_tag LOCUS_72340 35849 34830 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_72340 37718 35937 gene locus_tag LOCUS_72350 37718 35937 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_72350 38764 37772 gene locus_tag LOCUS_72360 38764 37772 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_72360 39744 39238 gene locus_tag LOCUS_72370 39744 39238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72370 40696 40055 gene locus_tag LOCUS_72380 40696 40055 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_72380 >Feature sequence066 2494 1133 gene locus_tag LOCUS_72390 2494 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72390 3990 2614 gene locus_tag LOCUS_72400 3990 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72400 4618 4163 gene locus_tag LOCUS_72410 4618 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72410 5927 4887 gene locus_tag LOCUS_72420 5927 4887 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_72420 6306 7583 gene locus_tag LOCUS_72430 6306 7583 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 protein_id gnl|my_center|LOCUS_72430 7747 8616 gene locus_tag LOCUS_72440 7747 8616 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_72440 8628 9485 gene locus_tag LOCUS_72450 8628 9485 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227021.1 protein_id gnl|my_center|LOCUS_72450 9535 11073 gene locus_tag LOCUS_72460 9535 11073 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_72460 12171 11164 gene locus_tag LOCUS_72470 12171 11164 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_72470 12847 15708 gene locus_tag LOCUS_72480 12847 15708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72480 18232 15872 gene locus_tag LOCUS_72490 18232 15872 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225837.1 protein_id gnl|my_center|LOCUS_72490 20544 18505 gene locus_tag LOCUS_72500 20544 18505 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190907.1 protein_id gnl|my_center|LOCUS_72500 21596 23044 gene locus_tag LOCUS_72510 21596 23044 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466941.1 protein_id gnl|my_center|LOCUS_72510 23407 24132 gene locus_tag LOCUS_72520 23407 24132 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972011.1 protein_id gnl|my_center|LOCUS_72520 24748 24149 gene locus_tag LOCUS_72530 24748 24149 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027648.1 protein_id gnl|my_center|LOCUS_72530 26004 24880 gene locus_tag LOCUS_72540 gene solA 26004 24880 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_72540 26147 27163 gene locus_tag LOCUS_72550 26147 27163 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189232996.1 protein_id gnl|my_center|LOCUS_72550 28695 27193 gene locus_tag LOCUS_72560 28695 27193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72560 29318 28692 gene locus_tag LOCUS_72570 gene skfE 29318 28692 CDS product sporulation killing factor ABC transporter ATP-binding protein SkfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234899.1 protein_id gnl|my_center|LOCUS_72570 30678 29560 gene locus_tag LOCUS_72580 30678 29560 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_72580 30911 31891 gene locus_tag LOCUS_72590 30911 31891 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225042.1 protein_id gnl|my_center|LOCUS_72590 33162 31996 gene locus_tag LOCUS_72600 gene trpS 33162 31996 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804845.1 protein_id gnl|my_center|LOCUS_72600 33907 33419 gene locus_tag LOCUS_72610 33907 33419 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081306.1 protein_id gnl|my_center|LOCUS_72610 34244 33888 gene locus_tag LOCUS_72620 34244 33888 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081309.1 protein_id gnl|my_center|LOCUS_72620 35300 34452 gene locus_tag LOCUS_72630 35300 34452 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030055.1 protein_id gnl|my_center|LOCUS_72630 35422 36312 gene locus_tag LOCUS_72640 35422 36312 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226458.1 protein_id gnl|my_center|LOCUS_72640 36617 36354 gene locus_tag LOCUS_72650 36617 36354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72650 >Feature sequence067 1901 675 gene locus_tag LOCUS_72660 1901 675 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390074.1 protein_id gnl|my_center|LOCUS_72660 3617 2109 gene locus_tag LOCUS_72670 3617 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72670 3943 4659 gene locus_tag LOCUS_72680 3943 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72680 5051 9931 gene locus_tag LOCUS_72690 5051 9931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72690 10000 10965 gene locus_tag LOCUS_72700 10000 10965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72700 12012 11323 gene locus_tag LOCUS_72710 12012 11323 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949618.1 protein_id gnl|my_center|LOCUS_72710 12499 12083 gene locus_tag LOCUS_72720 12499 12083 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222741.1 protein_id gnl|my_center|LOCUS_72720 12757 13605 gene locus_tag LOCUS_72730 12757 13605 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028257.1 protein_id gnl|my_center|LOCUS_72730 13963 13589 gene locus_tag LOCUS_72740 13963 13589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72740 14885 14037 gene locus_tag LOCUS_72750 14885 14037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72750 15851 15000 gene locus_tag LOCUS_72760 15851 15000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72760 16577 16155 gene locus_tag LOCUS_72770 16577 16155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72770 16459 17433 gene locus_tag LOCUS_72780 16459 17433 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_72780 17734 17411 gene locus_tag LOCUS_72790 17734 17411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72790 18489 17734 gene locus_tag LOCUS_72800 18489 17734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72800 19280 18486 gene locus_tag LOCUS_72810 19280 18486 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486398.1 protein_id gnl|my_center|LOCUS_72810 19600 19421 gene locus_tag LOCUS_72820 19600 19421 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_72820 23418 19708 gene locus_tag LOCUS_72830 23418 19708 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_72830 24455 23790 gene locus_tag LOCUS_72840 24455 23790 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366894.1 protein_id gnl|my_center|LOCUS_72840 27143 24543 gene locus_tag LOCUS_72850 27143 24543 CDS product cellulase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027340.1 protein_id gnl|my_center|LOCUS_72850 27058 27426 gene locus_tag LOCUS_72860 27058 27426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72860 27495 28103 gene locus_tag LOCUS_72870 27495 28103 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230395.1 protein_id gnl|my_center|LOCUS_72870 28100 29545 gene locus_tag LOCUS_72880 28100 29545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72880 29749 30900 gene locus_tag LOCUS_72890 29749 30900 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223562.1 protein_id gnl|my_center|LOCUS_72890 31099 31701 gene locus_tag LOCUS_72900 31099 31701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72900 32772 31714 gene locus_tag LOCUS_72910 32772 31714 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 protein_id gnl|my_center|LOCUS_72910 33033 33926 gene locus_tag LOCUS_72920 33033 33926 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876665.1 protein_id gnl|my_center|LOCUS_72920 34146 35327 gene locus_tag LOCUS_72930 34146 35327 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_72930 35406 36914 gene locus_tag LOCUS_72940 35406 36914 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972412.1 protein_id gnl|my_center|LOCUS_72940 >Feature sequence068 989 246 gene locus_tag LOCUS_72950 989 246 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229866.1 protein_id gnl|my_center|LOCUS_72950 1362 1096 gene locus_tag LOCUS_72960 1362 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72960 2948 1362 gene locus_tag LOCUS_72970 2948 1362 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972641.1 protein_id gnl|my_center|LOCUS_72970 3048 3326 gene locus_tag LOCUS_72980 3048 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72980 3453 4493 gene locus_tag LOCUS_72990 3453 4493 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973236.1 protein_id gnl|my_center|LOCUS_72990 4577 5101 gene locus_tag LOCUS_73000 4577 5101 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_73000 5593 5297 gene locus_tag LOCUS_73010 5593 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73010 5807 8272 gene locus_tag LOCUS_73020 5807 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73020 8453 8377 gene locus_tag LOCUS_t00690 8453 8377 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9114 8590 gene locus_tag LOCUS_73030 9114 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73030 9255 9467 gene locus_tag LOCUS_73040 9255 9467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73040 10814 10416 gene locus_tag LOCUS_73050 10814 10416 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229473.1 protein_id gnl|my_center|LOCUS_73050 11122 10847 gene locus_tag LOCUS_73060 11122 10847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73060 11345 11722 gene locus_tag LOCUS_73070 11345 11722 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_73070 12851 11838 gene locus_tag LOCUS_73080 12851 11838 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852489.1 protein_id gnl|my_center|LOCUS_73080 13061 14005 gene locus_tag LOCUS_73090 13061 14005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73090 14002 14568 gene locus_tag LOCUS_73100 14002 14568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73100 15866 14466 gene locus_tag LOCUS_73110 15866 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73110 16830 16012 gene locus_tag LOCUS_73120 16830 16012 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027526.1 protein_id gnl|my_center|LOCUS_73120 17205 18497 gene locus_tag LOCUS_73130 17205 18497 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110400007.1 protein_id gnl|my_center|LOCUS_73130 19805 18510 gene locus_tag LOCUS_73140 19805 18510 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 protein_id gnl|my_center|LOCUS_73140 21345 19882 gene locus_tag LOCUS_73150 21345 19882 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031663.1 protein_id gnl|my_center|LOCUS_73150 21681 22472 gene locus_tag LOCUS_73160 21681 22472 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_73160 22834 23697 gene locus_tag LOCUS_73170 22834 23697 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 protein_id gnl|my_center|LOCUS_73170 23715 24197 gene locus_tag LOCUS_73180 23715 24197 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855798.1 protein_id gnl|my_center|LOCUS_73180 26142 24382 gene locus_tag LOCUS_73190 26142 24382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73190 26939 26235 gene locus_tag LOCUS_73200 26939 26235 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223575.1 protein_id gnl|my_center|LOCUS_73200 27847 26933 gene locus_tag LOCUS_73210 27847 26933 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223574.1 protein_id gnl|my_center|LOCUS_73210 28971 27850 gene locus_tag LOCUS_73220 28971 27850 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027544.1 protein_id gnl|my_center|LOCUS_73220 29820 28984 gene locus_tag LOCUS_73230 29820 28984 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230679.1 protein_id gnl|my_center|LOCUS_73230 30734 29817 gene locus_tag LOCUS_73240 30734 29817 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230680.1 protein_id gnl|my_center|LOCUS_73240 31840 30731 gene locus_tag LOCUS_73250 31840 30731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230681.1 protein_id gnl|my_center|LOCUS_73250 33036 31837 gene locus_tag LOCUS_73260 33036 31837 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876235.1 protein_id gnl|my_center|LOCUS_73260 33374 34408 gene locus_tag LOCUS_73270 33374 34408 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226898.1 protein_id gnl|my_center|LOCUS_73270 34742 35782 gene locus_tag LOCUS_73280 34742 35782 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068174.1 protein_id gnl|my_center|LOCUS_73280 >Feature sequence069 1309 605 gene locus_tag LOCUS_73290 1309 605 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224957.1 protein_id gnl|my_center|LOCUS_73290 2179 1370 gene locus_tag LOCUS_73300 gene larE 2179 1370 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_73300 2592 3848 gene locus_tag LOCUS_73310 gene larA 2592 3848 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224947.1 protein_id gnl|my_center|LOCUS_73310 3871 4536 gene locus_tag LOCUS_73320 gene larB 3871 4536 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224946.1 protein_id gnl|my_center|LOCUS_73320 4533 5648 gene locus_tag LOCUS_73330 gene larC 4533 5648 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_73330 6927 5782 gene locus_tag LOCUS_73340 6927 5782 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225151.1 protein_id gnl|my_center|LOCUS_73340 7640 9406 gene locus_tag LOCUS_73350 7640 9406 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043775883.1 protein_id gnl|my_center|LOCUS_73350 9525 11153 gene locus_tag LOCUS_73360 9525 11153 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229568.1 protein_id gnl|my_center|LOCUS_73360 12297 11284 gene locus_tag LOCUS_73370 12297 11284 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976856.1 protein_id gnl|my_center|LOCUS_73370 13477 12533 gene locus_tag LOCUS_73380 13477 12533 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 protein_id gnl|my_center|LOCUS_73380 13747 14367 gene locus_tag LOCUS_73390 13747 14367 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229095.1 protein_id gnl|my_center|LOCUS_73390 15814 14609 gene locus_tag LOCUS_73400 15814 14609 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_73400 16049 17368 gene locus_tag LOCUS_73410 16049 17368 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222806.1 protein_id gnl|my_center|LOCUS_73410 17583 17945 gene locus_tag LOCUS_73420 17583 17945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73420 18277 20052 gene locus_tag LOCUS_73430 18277 20052 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027630.1 protein_id gnl|my_center|LOCUS_73430 20163 21224 gene locus_tag LOCUS_73440 20163 21224 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 protein_id gnl|my_center|LOCUS_73440 21575 22489 gene locus_tag LOCUS_73450 21575 22489 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227980.1 protein_id gnl|my_center|LOCUS_73450 25061 22731 gene locus_tag LOCUS_73460 25061 22731 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226349.1 protein_id gnl|my_center|LOCUS_73460 26162 25143 gene locus_tag LOCUS_73470 26162 25143 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_73470 26522 27412 gene locus_tag LOCUS_73480 26522 27412 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_73480 30958 27509 gene locus_tag LOCUS_73490 30958 27509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73490 31137 32105 gene locus_tag LOCUS_73500 31137 32105 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027112.1 protein_id gnl|my_center|LOCUS_73500 32289 33194 gene locus_tag LOCUS_73510 32289 33194 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224285.1 protein_id gnl|my_center|LOCUS_73510 >Feature sequence070 1787 162 gene locus_tag LOCUS_73520 gene groL 1787 162 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_73520 2407 2207 gene locus_tag LOCUS_73530 2407 2207 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_73530 3089 2814 gene locus_tag LOCUS_73540 3089 2814 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_73540 4398 3103 gene locus_tag LOCUS_73550 gene thrC 4398 3103 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 protein_id gnl|my_center|LOCUS_73550 5350 4787 gene locus_tag LOCUS_73560 5350 4787 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284042.1 protein_id gnl|my_center|LOCUS_73560 5514 6941 gene locus_tag LOCUS_73570 5514 6941 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_73570 7084 8316 gene locus_tag LOCUS_73580 7084 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73580 9262 8423 gene locus_tag LOCUS_73590 gene otsB 9262 8423 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_73590 9599 9285 gene locus_tag LOCUS_73600 9599 9285 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230291.1 protein_id gnl|my_center|LOCUS_73600 9877 10689 gene locus_tag LOCUS_73610 9877 10689 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_73610 10839 11333 gene locus_tag LOCUS_73620 10839 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73620 11588 11959 gene locus_tag LOCUS_73630 11588 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73630 13054 12044 gene locus_tag LOCUS_73640 13054 12044 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_73640 14075 13038 gene locus_tag LOCUS_73650 14075 13038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_73650 15011 14091 gene locus_tag LOCUS_73660 15011 14091 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 protein_id gnl|my_center|LOCUS_73660 15945 15004 gene locus_tag LOCUS_73670 15945 15004 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113014.1 protein_id gnl|my_center|LOCUS_73670 17706 16060 gene locus_tag LOCUS_73680 17706 16060 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_73680 18164 19123 gene locus_tag LOCUS_73690 18164 19123 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975816.1 protein_id gnl|my_center|LOCUS_73690 19110 19955 gene locus_tag LOCUS_73700 19110 19955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_73700 20176 20709 gene locus_tag LOCUS_73710 20176 20709 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977028.1 protein_id gnl|my_center|LOCUS_73710 20935 21120 gene locus_tag LOCUS_73720 20935 21120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73720 21292 21924 gene locus_tag LOCUS_73730 21292 21924 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030020.1 protein_id gnl|my_center|LOCUS_73730 22081 23100 gene locus_tag LOCUS_73740 gene plsX 22081 23100 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173767.1 protein_id gnl|my_center|LOCUS_73740 23410 25143 gene locus_tag LOCUS_73750 gene argS 23410 25143 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804295.1 protein_id gnl|my_center|LOCUS_73750 25443 25829 gene locus_tag LOCUS_73760 25443 25829 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974248.1 protein_id gnl|my_center|LOCUS_73760 26808 26011 gene locus_tag LOCUS_73770 26808 26011 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027752.1 protein_id gnl|my_center|LOCUS_73770 26974 27354 gene locus_tag LOCUS_73780 26974 27354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73780 29277 27517 gene locus_tag LOCUS_73790 29277 27517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73790 >Feature sequence071 2262 1186 gene locus_tag LOCUS_73800 gene galT 2262 1186 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 protein_id gnl|my_center|LOCUS_73800 3227 2259 gene locus_tag LOCUS_73810 3227 2259 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230059.1 protein_id gnl|my_center|LOCUS_73810 4220 3651 gene locus_tag LOCUS_73820 4220 3651 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_73820 5679 4324 gene locus_tag LOCUS_73830 5679 4324 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028984.1 protein_id gnl|my_center|LOCUS_73830 6031 5960 gene locus_tag LOCUS_t00700 6031 5960 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6122 6196 gene locus_tag LOCUS_t00710 6122 6196 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6810 6373 gene locus_tag LOCUS_73840 6810 6373 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 protein_id gnl|my_center|LOCUS_73840 7148 8017 gene locus_tag LOCUS_73850 7148 8017 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_73850 8228 9610 gene locus_tag LOCUS_73860 gene tig 8228 9610 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_73860 9818 11398 gene locus_tag LOCUS_73870 9818 11398 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951984.1 protein_id gnl|my_center|LOCUS_73870 11515 12159 gene locus_tag LOCUS_73880 11515 12159 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 protein_id gnl|my_center|LOCUS_73880 12171 12815 gene locus_tag LOCUS_73890 12171 12815 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228511.1 protein_id gnl|my_center|LOCUS_73890 12996 14285 gene locus_tag LOCUS_73900 gene clpX 12996 14285 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_73900 14777 17371 gene locus_tag LOCUS_73910 14777 17371 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028455.1 protein_id gnl|my_center|LOCUS_73910 17923 17399 gene locus_tag LOCUS_73920 17923 17399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73920 19174 18056 gene locus_tag LOCUS_73930 19174 18056 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226309.1 protein_id gnl|my_center|LOCUS_73930 19614 21098 gene locus_tag LOCUS_73940 gene crtI 19614 21098 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026910.1 protein_id gnl|my_center|LOCUS_73940 21095 22030 gene locus_tag LOCUS_73950 21095 22030 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224196.1 protein_id gnl|my_center|LOCUS_73950 22032 23090 gene locus_tag LOCUS_73960 gene plsX 22032 23090 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080328.1 protein_id gnl|my_center|LOCUS_73960 24185 23214 gene locus_tag LOCUS_73970 24185 23214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73970 24145 24756 gene locus_tag LOCUS_73980 24145 24756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73980 26001 24715 gene locus_tag LOCUS_73990 26001 24715 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141357.1 protein_id gnl|my_center|LOCUS_73990 27632 26085 gene locus_tag LOCUS_74000 gene crtI 27632 26085 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225928.1 protein_id gnl|my_center|LOCUS_74000 28258 27608 gene locus_tag LOCUS_74010 28258 27608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74010 >Feature sequence072 15793 2981 gene locus_tag LOCUS_74020 15793 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_74020 16460 17494 gene locus_tag LOCUS_74030 16460 17494 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169618726.1 protein_id gnl|my_center|LOCUS_74030 17544 18335 gene locus_tag LOCUS_74040 17544 18335 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 protein_id gnl|my_center|LOCUS_74040 18339 19109 gene locus_tag LOCUS_74050 18339 19109 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228015.1 protein_id gnl|my_center|LOCUS_74050 19197 19946 gene locus_tag LOCUS_74060 gene fabG 19197 19946 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_74060 19975 21081 gene locus_tag LOCUS_74070 19975 21081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74070 25045 21170 gene locus_tag LOCUS_74080 25045 21170 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_74080 >Feature sequence073 <1 5750 gene locus_tag LOCUS_74090 <1 5750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030787.1:type I polyketide synthase 5817 7418 gene locus_tag LOCUS_74100 5817 7418 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 protein_id gnl|my_center|LOCUS_74100 7598 9019 gene locus_tag LOCUS_74110 7598 9019 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_74110 9176 10078 gene locus_tag LOCUS_74120 9176 10078 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225025.1 protein_id gnl|my_center|LOCUS_74120 10075 10863 gene locus_tag LOCUS_74130 10075 10863 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 protein_id gnl|my_center|LOCUS_74130 11125 12027 gene locus_tag LOCUS_74140 11125 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74140 >Feature sequence074 566 243 gene locus_tag LOCUS_74150 566 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74150 801 1751 gene locus_tag LOCUS_74160 801 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74160 1963 3177 gene locus_tag LOCUS_74170 1963 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74170 3982 3191 gene locus_tag LOCUS_74180 3982 3191 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_74180 5064 3979 gene locus_tag LOCUS_74190 5064 3979 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009675.1 protein_id gnl|my_center|LOCUS_74190 6128 5061 gene locus_tag LOCUS_74200 6128 5061 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226862.1 protein_id gnl|my_center|LOCUS_74200 6328 7341 gene locus_tag LOCUS_74210 6328 7341 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106346642.1 protein_id gnl|my_center|LOCUS_74210 8415 7351 gene locus_tag LOCUS_74220 8415 7351 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222439.1 protein_id gnl|my_center|LOCUS_74220 8741 9349 gene locus_tag LOCUS_74230 gene sigR 8741 9349 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_74230 10326 9496 gene locus_tag LOCUS_74240 10326 9496 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027715.1 protein_id gnl|my_center|LOCUS_74240 10389 10511 gene locus_tag LOCUS_74250 10389 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74250 10781 11086 gene locus_tag LOCUS_74260 10781 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74260 11147 12004 gene locus_tag LOCUS_74270 11147 12004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74270 14024 12171 gene locus_tag LOCUS_74280 gene typA 14024 12171 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_74280 14284 14550 gene locus_tag LOCUS_74290 14284 14550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74290 14560 15315 gene locus_tag LOCUS_74300 14560 15315 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974811.1 protein_id gnl|my_center|LOCUS_74300 15312 16436 gene locus_tag LOCUS_74310 15312 16436 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 protein_id gnl|my_center|LOCUS_74310 18052 16616 gene locus_tag LOCUS_74320 18052 16616 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891663.1 protein_id gnl|my_center|LOCUS_74320 >Feature sequence075 1209 226 gene locus_tag LOCUS_74330 1209 226 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230309.1 protein_id gnl|my_center|LOCUS_74330 1774 1307 gene locus_tag LOCUS_74340 1774 1307 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027466.1 protein_id gnl|my_center|LOCUS_74340 1802 2599 gene locus_tag LOCUS_74350 1802 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74350 2890 3651 gene locus_tag LOCUS_74360 2890 3651 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_74360 3648 4589 gene locus_tag LOCUS_74370 gene pfkB 3648 4589 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028823.1 protein_id gnl|my_center|LOCUS_74370 4759 5868 gene locus_tag LOCUS_74380 4759 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_74380 5875 6183 gene locus_tag LOCUS_74390 5875 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_74390 6176 6646 gene locus_tag LOCUS_74400 6176 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_74400 6643 7683 gene locus_tag LOCUS_74410 6643 7683 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_74410 8058 7717 gene locus_tag LOCUS_74420 8058 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74420 7955 8200 gene locus_tag LOCUS_74430 7955 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74430 8193 9938 gene locus_tag LOCUS_74440 gene ptsP 8193 9938 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231021.1 protein_id gnl|my_center|LOCUS_74440 10770 9943 gene locus_tag LOCUS_74450 10770 9943 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_74450 11519 10959 gene locus_tag LOCUS_74460 11519 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74460 11740 13302 gene locus_tag LOCUS_74470 11740 13302 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223371.1 protein_id gnl|my_center|LOCUS_74470 13299 14756 gene locus_tag LOCUS_74480 13299 14756 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031573.1 protein_id gnl|my_center|LOCUS_74480 15522 14830 gene locus_tag LOCUS_74490 15522 14830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74490 16561 15788 gene locus_tag LOCUS_74500 16561 15788 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143646.1 protein_id gnl|my_center|LOCUS_74500 <17218 16710 gene locus_tag LOCUS_74510 <17218 16710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027374.1:pyridoxal-phosphate dependent enzyme >Feature sequence076 25 1179 gene locus_tag LOCUS_74520 25 1179 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028561.1 protein_id gnl|my_center|LOCUS_74520 1176 2012 gene locus_tag LOCUS_74530 1176 2012 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728493.1 protein_id gnl|my_center|LOCUS_74530 2298 2116 gene locus_tag LOCUS_74540 2298 2116 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_74540 2580 2386 gene locus_tag LOCUS_74550 2580 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74550 3257 2514 gene locus_tag LOCUS_74560 3257 2514 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028937.1 protein_id gnl|my_center|LOCUS_74560 3498 3977 gene locus_tag LOCUS_74570 3498 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74570 4500 4009 gene locus_tag LOCUS_74580 4500 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74580 4571 5782 gene locus_tag LOCUS_74590 4571 5782 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816310.1 protein_id gnl|my_center|LOCUS_74590 5850 6824 gene locus_tag LOCUS_74600 5850 6824 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715389.1 protein_id gnl|my_center|LOCUS_74600 8613 6964 gene locus_tag LOCUS_74610 8613 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74610 8738 9718 gene locus_tag LOCUS_74620 8738 9718 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284397.1 protein_id gnl|my_center|LOCUS_74620 10017 10628 gene locus_tag LOCUS_74630 10017 10628 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223382.1 protein_id gnl|my_center|LOCUS_74630 11436 11230 gene locus_tag LOCUS_74640 11436 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74640 11521 13545 gene locus_tag LOCUS_74650 11521 13545 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230344.1 protein_id gnl|my_center|LOCUS_74650 14210 13770 gene locus_tag LOCUS_74660 14210 13770 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224170.1 protein_id gnl|my_center|LOCUS_74660 14987 14331 gene locus_tag LOCUS_74670 14987 14331 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_74670 15058 16398 gene locus_tag LOCUS_74680 15058 16398 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028409.1 protein_id gnl|my_center|LOCUS_74680 >Feature sequence077 >Feature sequence078 1527 502 gene locus_tag LOCUS_74690 1527 502 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_74690 3032 1827 gene locus_tag LOCUS_74700 3032 1827 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_74700 3225 3298 gene locus_tag LOCUS_t00720 3225 3298 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3372 3632 gene locus_tag LOCUS_74710 gene secE 3372 3632 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974317.1 protein_id gnl|my_center|LOCUS_74710 3769 4602 gene locus_tag LOCUS_74720 3769 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74720 4790 5221 gene locus_tag LOCUS_74730 gene rplK 4790 5221 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776394.1 protein_id gnl|my_center|LOCUS_74730 5287 6006 gene locus_tag LOCUS_74740 gene rplA 5287 6006 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_74740 6251 7120 gene locus_tag LOCUS_74750 6251 7120 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974312.1 protein_id gnl|my_center|LOCUS_74750 7581 8141 gene locus_tag LOCUS_74760 gene rplJ 7581 8141 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_74760 8229 8621 gene locus_tag LOCUS_74770 gene rplL 8229 8621 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403353.1 protein_id gnl|my_center|LOCUS_74770 8974 9492 gene locus_tag LOCUS_74780 8974 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74780 9489 10058 gene locus_tag LOCUS_74790 9489 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74790 >Feature sequence079 538 807 gene locus_tag LOCUS_74800 538 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74800 913 1554 gene locus_tag LOCUS_74810 913 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74810 1499 1846 gene locus_tag LOCUS_74820 1499 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74820 2036 4015 gene locus_tag LOCUS_74830 2036 4015 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225152.1 protein_id gnl|my_center|LOCUS_74830 5180 4146 gene locus_tag LOCUS_74840 5180 4146 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225264.1 protein_id gnl|my_center|LOCUS_74840 5468 7471 gene locus_tag LOCUS_74850 5468 7471 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225268.1 protein_id gnl|my_center|LOCUS_74850 7614 9332 gene locus_tag LOCUS_74860 7614 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74860 >Feature sequence080 <6966 6291 gene locus_tag LOCUS_74870 <6966 6291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015508323.1:type I polyketide synthase >Feature sequence081 <1 664 gene locus_tag LOCUS_74880 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950651.1:type I polyketide synthase 898 1728 gene locus_tag LOCUS_74890 898 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74890 1731 4982 gene locus_tag LOCUS_74900 1731 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74900 >Feature sequence082 >Feature sequence083 <5317 1500 gene locus_tag LOCUS_74910 <5317 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_067456433.1:type I polyketide synthase >Feature sequence084 >Feature sequence085 >Feature sequence086 83 247 gene locus_tag LOCUS_74920 83 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74920 467 276 gene locus_tag LOCUS_74930 467 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74930 2221 434 gene locus_tag LOCUS_74940 2221 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74940 2556 2218 gene locus_tag LOCUS_74950 2556 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74950 3668 2556 gene locus_tag LOCUS_74960 3668 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74960 >Feature sequence087 39 1733 gene locus_tag LOCUS_74970 39 1733 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224937.1 protein_id gnl|my_center|LOCUS_74970 1822 2829 gene locus_tag LOCUS_74980 1822 2829 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224933.1 protein_id gnl|my_center|LOCUS_74980 >Feature sequence088 <1 1156 gene locus_tag LOCUS_74990 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225851.1:glycoside hydrolase family 3 C-terminal domain-containing protein 1679 2524 gene locus_tag LOCUS_75000 1679 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75000 2903 2712 gene locus_tag LOCUS_75010 2903 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75010 >Feature sequence089 416 583 gene locus_tag LOCUS_75020 416 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_75020 929 1942 gene locus_tag LOCUS_75030 929 1942 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224933.1 protein_id gnl|my_center|LOCUS_75030 >Feature sequence090 >Feature sequence091 18 2749 gene locus_tag LOCUS_r00010 18 2749 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2839 2948 gene locus_tag LOCUS_r00020 2839 2948 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence092 >Feature sequence093 >Feature sequence094 1681 545 gene locus_tag LOCUS_75040 1681 545 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976857.1 protein_id gnl|my_center|LOCUS_75040 1878 1678 gene locus_tag LOCUS_75050 1878 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75050 >Feature sequence095 896 144 gene locus_tag LOCUS_75060 896 144 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085699.1 protein_id gnl|my_center|LOCUS_75060 1068 1670 gene locus_tag LOCUS_75070 1068 1670 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730623.1 protein_id gnl|my_center|LOCUS_75070 >Feature sequence096 >Feature sequence097 >Feature sequence098 >Feature sequence099 >Feature sequence100 226 1742 gene locus_tag LOCUS_r00030 226 1742 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence101 250 1470 gene locus_tag LOCUS_75080 250 1470 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084023633.1 protein_id gnl|my_center|LOCUS_75080 >Feature sequence102 >Feature sequence103 >Feature sequence104 >Feature sequence105 >Feature sequence106 >Feature sequence107 >Feature sequence108 >Feature sequence109 >Feature sequence110 >Feature sequence111 <1 977 gene locus_tag LOCUS_75090 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028442.1:VCBS repeat-containing protein >Feature sequence112 438 4 gene locus_tag LOCUS_75100 438 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_75100 899 462 gene locus_tag LOCUS_75110 899 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_75110 >Feature sequence113 76 573 gene locus_tag LOCUS_75120 76 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75120 >Feature sequence114 <1 842 gene locus_tag LOCUS_75130 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225828.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence115 >Feature sequence116 >Feature sequence117 >Feature sequence118 >Feature sequence119 >Feature sequence120 >Feature sequence121 <863 16 gene locus_tag LOCUS_75140 <863 16 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225828.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence122 768 346 gene locus_tag LOCUS_75150 gene tnpA 768 346 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036865.1 protein_id gnl|my_center|LOCUS_75150 >Feature sequence123 >Feature sequence124 >Feature sequence125 >Feature sequence126 >Feature sequence127 >Feature sequence128 >Feature sequence129 >Feature sequence130 >Feature sequence131 <609 9 gene locus_tag LOCUS_75160 <609 9 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000826413.1:RNA-guided endonuclease TnpB family protein >Feature sequence132 >Feature sequence133 >Feature sequence134 >Feature sequence135 >Feature sequence136