>Feature sequence001 >Feature sequence002 875 120 gene locus_tag LOCUS_00010 gene istB 875 120 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_00010 >Feature sequence003 >Feature sequence004 >Feature sequence005 >Feature sequence006 <1 748 gene locus_tag LOCUS_00020 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118077.1:ISAs1-like element ISRba7 family transposase >Feature sequence007 86 484 gene locus_tag LOCUS_00030 86 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 >Feature sequence008 322 101 gene locus_tag LOCUS_00040 322 101 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669263.1 protein_id gnl|my_center|LOCUS_00040 >Feature sequence009 >Feature sequence010 >Feature sequence011 883 212 gene locus_tag LOCUS_00050 883 212 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385558.1 protein_id gnl|my_center|LOCUS_00050 1527 880 gene locus_tag LOCUS_00060 1527 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00060 1895 1695 gene locus_tag LOCUS_00070 1895 1695 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040115264.1 protein_id gnl|my_center|LOCUS_00070 2126 4603 gene locus_tag LOCUS_00080 2126 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 4613 5986 gene locus_tag LOCUS_00090 4613 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6176 6499 gene locus_tag LOCUS_00100 6176 6499 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938892.1 protein_id gnl|my_center|LOCUS_00100 6767 9043 gene locus_tag LOCUS_00110 gene clpA 6767 9043 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_00110 9134 9889 gene locus_tag LOCUS_00120 gene pgeF 9134 9889 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227882.1 protein_id gnl|my_center|LOCUS_00120 10779 10048 gene locus_tag LOCUS_00130 10779 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12220 10802 gene locus_tag LOCUS_00140 12220 10802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 13261 12275 gene locus_tag LOCUS_00150 13261 12275 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813418.1 protein_id gnl|my_center|LOCUS_00150 13714 14988 gene locus_tag LOCUS_00160 gene hisS 13714 14988 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_00160 15099 16877 gene locus_tag LOCUS_00170 gene aspS 15099 16877 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_00170 17064 17234 gene locus_tag LOCUS_00180 17064 17234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18421 17417 gene locus_tag LOCUS_00190 gene gap 18421 17417 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_00190 20989 18716 gene locus_tag LOCUS_00200 20989 18716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21116 22063 gene locus_tag LOCUS_00210 21116 22063 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_00210 22065 22373 gene locus_tag LOCUS_00220 22065 22373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22410 23765 gene locus_tag LOCUS_00230 22410 23765 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895536.1 protein_id gnl|my_center|LOCUS_00230 23762 24202 gene locus_tag LOCUS_00240 23762 24202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24222 24626 gene locus_tag LOCUS_00250 24222 24626 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582543.1 protein_id gnl|my_center|LOCUS_00250 25007 24756 gene locus_tag LOCUS_00260 25007 24756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25338 25072 gene locus_tag LOCUS_00270 25338 25072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 25228 27000 gene locus_tag LOCUS_00280 25228 27000 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695320.1 protein_id gnl|my_center|LOCUS_00280 27067 27810 gene locus_tag LOCUS_00290 27067 27810 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_00290 27934 28218 gene locus_tag LOCUS_00300 27934 28218 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_00300 29581 28232 gene locus_tag LOCUS_00310 gene rimO 29581 28232 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_00310 30394 29684 gene locus_tag LOCUS_00320 30394 29684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 30890 30630 gene locus_tag LOCUS_00330 30890 30630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 31700 30978 gene locus_tag LOCUS_00340 31700 30978 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_00340 32161 31715 gene locus_tag LOCUS_00350 32161 31715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 32381 32154 gene locus_tag LOCUS_00360 32381 32154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 33664 32465 gene locus_tag LOCUS_00370 gene hemL 33664 32465 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_00370 34240 34569 gene locus_tag LOCUS_00380 gene trxA 34240 34569 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939125.1 protein_id gnl|my_center|LOCUS_00380 34737 35582 gene locus_tag LOCUS_00390 34737 35582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 36340 35723 gene locus_tag LOCUS_00400 36340 35723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00400 37353 36337 gene locus_tag LOCUS_00410 37353 36337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00410 37525 37722 gene locus_tag LOCUS_00420 37525 37722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 37730 38485 gene locus_tag LOCUS_00430 gene larB 37730 38485 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141462.1 protein_id gnl|my_center|LOCUS_00430 38881 41448 gene locus_tag LOCUS_00440 gene secDF 38881 41448 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971714.1 protein_id gnl|my_center|LOCUS_00440 41441 42184 gene locus_tag LOCUS_00450 41441 42184 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937454.1 protein_id gnl|my_center|LOCUS_00450 42190 42882 gene locus_tag LOCUS_00460 42190 42882 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_00460 42893 43543 gene locus_tag LOCUS_00470 42893 43543 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938666.1 protein_id gnl|my_center|LOCUS_00470 44285 43653 gene locus_tag LOCUS_00480 44285 43653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 44663 47050 gene locus_tag LOCUS_00490 44663 47050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 48069 47098 gene locus_tag LOCUS_00500 48069 47098 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937471.1 protein_id gnl|my_center|LOCUS_00500 49204 48470 gene locus_tag LOCUS_00510 49204 48470 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389076.1 protein_id gnl|my_center|LOCUS_00510 49967 49737 gene locus_tag LOCUS_00520 49967 49737 CDS product dissimilatory sulfite reductase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393105.1 protein_id gnl|my_center|LOCUS_00520 51187 50045 gene locus_tag LOCUS_00530 gene dsrB 51187 50045 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393106.1 protein_id gnl|my_center|LOCUS_00530 52520 51234 gene locus_tag LOCUS_00540 gene dsrA 52520 51234 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937709.1 protein_id gnl|my_center|LOCUS_00540 54387 52789 gene locus_tag LOCUS_00550 54387 52789 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873769.1 protein_id gnl|my_center|LOCUS_00550 55079 54417 gene locus_tag LOCUS_00560 gene rpe 55079 54417 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_00560 56558 55431 gene locus_tag LOCUS_00570 gene dprA 56558 55431 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_00570 58095 56566 gene locus_tag LOCUS_00580 gene rpoD 58095 56566 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_00580 60102 58309 gene locus_tag LOCUS_00590 60102 58309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 60668 61393 gene locus_tag LOCUS_00600 60668 61393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 62890 61427 gene locus_tag LOCUS_00610 62890 61427 CDS product DNA integrity scanning protein DisA nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791846.1 protein_id gnl|my_center|LOCUS_00610 63421 63615 gene locus_tag LOCUS_00620 63421 63615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 64535 63909 gene locus_tag LOCUS_00630 gene upp 64535 63909 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938324.1 protein_id gnl|my_center|LOCUS_00630 65585 64710 gene locus_tag LOCUS_00640 65585 64710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 65972 65640 gene locus_tag LOCUS_00650 65972 65640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 65971 66195 gene locus_tag LOCUS_00660 65971 66195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 67369 66713 gene locus_tag LOCUS_00670 67369 66713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 67253 67525 gene locus_tag LOCUS_00680 67253 67525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 67647 68918 gene locus_tag LOCUS_00690 gene serS 67647 68918 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940715.1 protein_id gnl|my_center|LOCUS_00690 70036 69083 gene locus_tag LOCUS_00700 70036 69083 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937641.1 protein_id gnl|my_center|LOCUS_00700 70575 70769 gene locus_tag LOCUS_00710 70575 70769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 70804 71730 gene locus_tag LOCUS_00720 gene xerD 70804 71730 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_00720 73966 71792 gene locus_tag LOCUS_00730 73966 71792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 75006 74224 gene locus_tag LOCUS_00740 75006 74224 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_00740 75589 75128 gene locus_tag LOCUS_00750 gene dut 75589 75128 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_00750 77857 75764 gene locus_tag LOCUS_00760 gene pnp 77857 75764 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_00760 78347 78078 gene locus_tag LOCUS_00770 gene rpsO 78347 78078 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_00770 79271 78504 gene locus_tag LOCUS_00780 79271 78504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 80267 79275 gene locus_tag LOCUS_00790 80267 79275 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_00790 80658 80254 gene locus_tag LOCUS_00800 gene rbfA 80658 80254 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948461.1 protein_id gnl|my_center|LOCUS_00800 83438 80664 gene locus_tag LOCUS_00810 gene infB 83438 80664 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_00810 85091 83685 gene locus_tag LOCUS_00820 gene nusA 85091 83685 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937816.1 protein_id gnl|my_center|LOCUS_00820 85654 85112 gene locus_tag LOCUS_00830 85654 85112 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_00830 85874 85799 gene locus_tag LOCUS_t00010 85874 85799 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 86012 88702 gene locus_tag LOCUS_00840 86012 88702 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_00840 88934 89560 gene locus_tag LOCUS_00850 88934 89560 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937452.1 protein_id gnl|my_center|LOCUS_00850 91462 89732 gene locus_tag LOCUS_00860 91462 89732 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_00860 92228 92064 gene locus_tag LOCUS_00870 92228 92064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 92323 93075 gene locus_tag LOCUS_00880 92323 93075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 93656 93285 gene locus_tag LOCUS_00890 93656 93285 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933714.1 protein_id gnl|my_center|LOCUS_00890 94687 93752 gene locus_tag LOCUS_00900 94687 93752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 95119 97101 gene locus_tag LOCUS_00910 gene glgX 95119 97101 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_00910 97106 97639 gene locus_tag LOCUS_00920 97106 97639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 98381 99250 gene locus_tag LOCUS_00930 98381 99250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_00930 99265 99843 gene locus_tag LOCUS_00940 99265 99843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 99871 100329 gene locus_tag LOCUS_00950 99871 100329 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_00950 101150 100368 gene locus_tag LOCUS_00960 101150 100368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 103402 101603 gene locus_tag LOCUS_00970 gene typA 103402 101603 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219266.1 protein_id gnl|my_center|LOCUS_00970 103352 103600 gene locus_tag LOCUS_00980 103352 103600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 105014 103629 gene locus_tag LOCUS_00990 105014 103629 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249879.1 protein_id gnl|my_center|LOCUS_00990 105300 105920 gene locus_tag LOCUS_01000 105300 105920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 105957 106298 gene locus_tag LOCUS_01010 105957 106298 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942071.1 protein_id gnl|my_center|LOCUS_01010 107710 106412 gene locus_tag LOCUS_01020 107710 106412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 109787 107772 gene locus_tag LOCUS_01030 109787 107772 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976250.1 protein_id gnl|my_center|LOCUS_01030 111349 109796 gene locus_tag LOCUS_01040 111349 109796 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_01040 112610 111483 gene locus_tag LOCUS_01050 112610 111483 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922322.1 protein_id gnl|my_center|LOCUS_01050 113182 112775 gene locus_tag LOCUS_01060 113182 112775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 114367 114831 gene locus_tag LOCUS_01070 114367 114831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 115443 114847 gene locus_tag LOCUS_01080 115443 114847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 116488 115394 gene locus_tag LOCUS_01090 gene cobT 116488 115394 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541537.1 protein_id gnl|my_center|LOCUS_01090 117096 116497 gene locus_tag LOCUS_01100 gene cobC 117096 116497 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_01100 117869 117093 gene locus_tag LOCUS_01110 gene cobS 117869 117093 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168496.1 protein_id gnl|my_center|LOCUS_01110 118443 117880 gene locus_tag LOCUS_01120 gene cobU 118443 117880 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258421.1 protein_id gnl|my_center|LOCUS_01120 119317 118874 gene locus_tag LOCUS_01130 119317 118874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 119513 120208 gene locus_tag LOCUS_01140 gene lexA 119513 120208 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_01140 120379 120666 gene locus_tag LOCUS_01150 120379 120666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 120872 121144 gene locus_tag LOCUS_01160 120872 121144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 >Feature sequence012 373 80 gene locus_tag LOCUS_01170 373 80 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967243.1 protein_id gnl|my_center|LOCUS_01170 >Feature sequence013 >Feature sequence014 <1 638 gene locus_tag LOCUS_01180 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974480.1:histidine phosphatase family protein >Feature sequence015 637 89 gene locus_tag LOCUS_01190 637 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 >Feature sequence016 >Feature sequence017 >Feature sequence018 <643 30 gene locus_tag LOCUS_01200 <643 30 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921475.1:histone deacetylase >Feature sequence019 561 16 gene locus_tag LOCUS_01210 561 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 >Feature sequence020 <627 110 gene locus_tag LOCUS_01220 <627 110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704602.1:PAS domain-containing methyl-accepting chemotaxis protein >Feature sequence021 >Feature sequence022 1588 1070 gene locus_tag LOCUS_01230 1588 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 2951 4411 gene locus_tag LOCUS_01240 2951 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 5509 6024 gene locus_tag LOCUS_01250 5509 6024 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980178.1 protein_id gnl|my_center|LOCUS_01250 6044 8509 gene locus_tag LOCUS_01260 6044 8509 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_01260 8885 9283 gene locus_tag LOCUS_01270 gene rsfS 8885 9283 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067112.1 protein_id gnl|my_center|LOCUS_01270 9301 10863 gene locus_tag LOCUS_01280 gene gpmI 9301 10863 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_01280 11027 12418 gene locus_tag LOCUS_01290 gene thrC 11027 12418 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_01290 12521 13363 gene locus_tag LOCUS_01300 12521 13363 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174269896.1 protein_id gnl|my_center|LOCUS_01300 13356 14687 gene locus_tag LOCUS_01310 13356 14687 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_01310 14892 15080 gene locus_tag LOCUS_01320 14892 15080 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_01320 15129 15377 gene locus_tag LOCUS_01330 15129 15377 CDS product TatA/E family twin arginine-targeting protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057225.1 protein_id gnl|my_center|LOCUS_01330 15620 15429 gene locus_tag LOCUS_01340 15620 15429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 15619 16761 gene locus_tag LOCUS_01350 15619 16761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791395.1 protein_id gnl|my_center|LOCUS_01350 16719 18359 gene locus_tag LOCUS_01360 16719 18359 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940548.1 protein_id gnl|my_center|LOCUS_01360 18392 20749 gene locus_tag LOCUS_01370 18392 20749 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940549.1 protein_id gnl|my_center|LOCUS_01370 21177 20905 gene locus_tag LOCUS_01380 21177 20905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 21740 21240 gene locus_tag LOCUS_01390 21740 21240 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037783.1 protein_id gnl|my_center|LOCUS_01390 21930 21685 gene locus_tag LOCUS_01400 21930 21685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 22607 22098 gene locus_tag LOCUS_01410 22607 22098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 24422 22635 gene locus_tag LOCUS_01420 24422 22635 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545662.1 protein_id gnl|my_center|LOCUS_01420 24628 26493 gene locus_tag LOCUS_01430 gene mutL 24628 26493 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_01430 26907 28220 gene locus_tag LOCUS_01440 gene hisD 26907 28220 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938097.1 protein_id gnl|my_center|LOCUS_01440 28252 28869 gene locus_tag LOCUS_01450 gene rsmG 28252 28869 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462328.1 protein_id gnl|my_center|LOCUS_01450 29061 30149 gene locus_tag LOCUS_01460 gene leuB 29061 30149 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704821.1 protein_id gnl|my_center|LOCUS_01460 30391 31311 gene locus_tag LOCUS_01470 30391 31311 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254080.1 protein_id gnl|my_center|LOCUS_01470 31566 32699 gene locus_tag LOCUS_01480 gene asd 31566 32699 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552957.1 protein_id gnl|my_center|LOCUS_01480 33694 33119 gene locus_tag LOCUS_01490 33694 33119 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_01490 34765 34073 gene locus_tag LOCUS_01500 gene lolD 34765 34073 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925702.1 protein_id gnl|my_center|LOCUS_01500 35984 34758 gene locus_tag LOCUS_01510 35984 34758 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_01510 37481 35994 gene locus_tag LOCUS_01520 gene lysS 37481 35994 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_01520 38987 37686 gene locus_tag LOCUS_01530 gene rlmD 38987 37686 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102417.1 protein_id gnl|my_center|LOCUS_01530 39561 40919 gene locus_tag LOCUS_01540 39561 40919 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_01540 41096 43747 gene locus_tag LOCUS_01550 41096 43747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 44524 45108 gene locus_tag LOCUS_01560 gene grpE 44524 45108 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 protein_id gnl|my_center|LOCUS_01560 45202 47145 gene locus_tag LOCUS_01570 gene dnaK 45202 47145 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_01570 47405 48373 gene locus_tag LOCUS_01580 gene trpS 47405 48373 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858719.1 protein_id gnl|my_center|LOCUS_01580 49637 48684 gene locus_tag LOCUS_01590 49637 48684 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680321.1 protein_id gnl|my_center|LOCUS_01590 51035 49917 gene locus_tag LOCUS_01600 51035 49917 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088284.1 protein_id gnl|my_center|LOCUS_01600 51680 52975 gene locus_tag LOCUS_01610 51680 52975 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_01610 53205 54320 gene locus_tag LOCUS_01620 gene carA 53205 54320 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_01620 54343 57567 gene locus_tag LOCUS_01630 gene carB 54343 57567 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_01630 57671 59662 gene locus_tag LOCUS_01640 gene ftsH 57671 59662 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_01640 60000 60806 gene locus_tag LOCUS_01650 60000 60806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 63946 60902 gene locus_tag LOCUS_01660 63946 60902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 64157 65368 gene locus_tag LOCUS_01670 64157 65368 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_01670 66086 67066 gene locus_tag LOCUS_01680 66086 67066 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294642.1 protein_id gnl|my_center|LOCUS_01680 67457 67230 gene locus_tag LOCUS_01690 67457 67230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 67984 69147 gene locus_tag LOCUS_01700 gene metK 67984 69147 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_01700 69403 70689 gene locus_tag LOCUS_01710 gene ahcY 69403 70689 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_01710 70704 72041 gene locus_tag LOCUS_01720 gene trmFO 70704 72041 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_01720 73834 72044 gene locus_tag LOCUS_01730 73834 72044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 78365 73989 gene locus_tag LOCUS_01740 78365 73989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 78758 78943 gene locus_tag LOCUS_01750 78758 78943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 79709 79116 gene locus_tag LOCUS_01760 79709 79116 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937833.1 protein_id gnl|my_center|LOCUS_01760 80507 79722 gene locus_tag LOCUS_01770 gene truA 80507 79722 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_01770 81547 80507 gene locus_tag LOCUS_01780 gene argC 81547 80507 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_01780 82201 81809 gene locus_tag LOCUS_01790 gene rpsI 82201 81809 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939789.1 protein_id gnl|my_center|LOCUS_01790 82646 82218 gene locus_tag LOCUS_01800 gene rplM 82646 82218 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881226.1 protein_id gnl|my_center|LOCUS_01800 82783 82709 gene locus_tag LOCUS_t00020 82783 82709 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 83350 83952 gene locus_tag LOCUS_01810 gene hisB 83350 83952 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_01810 84049 84693 gene locus_tag LOCUS_01820 84049 84693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 84720 85499 gene locus_tag LOCUS_01830 gene ttcA 84720 85499 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268597.1 protein_id gnl|my_center|LOCUS_01830 85483 86355 gene locus_tag LOCUS_01840 85483 86355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 86365 87102 gene locus_tag LOCUS_01850 86365 87102 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937785.1 protein_id gnl|my_center|LOCUS_01850 87164 88495 gene locus_tag LOCUS_01860 87164 88495 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937786.1 protein_id gnl|my_center|LOCUS_01860 88522 89001 gene locus_tag LOCUS_01870 88522 89001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 89085 91052 gene locus_tag LOCUS_01880 89085 91052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 91055 92623 gene locus_tag LOCUS_01890 91055 92623 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294598.1 protein_id gnl|my_center|LOCUS_01890 93798 93022 gene locus_tag LOCUS_01900 93798 93022 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390489.1 protein_id gnl|my_center|LOCUS_01900 94199 93795 gene locus_tag LOCUS_01910 94199 93795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 94970 94467 gene locus_tag LOCUS_01920 94970 94467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 96191 95241 gene locus_tag LOCUS_01930 gene hemB 96191 95241 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_01930 97850 96486 gene locus_tag LOCUS_01940 97850 96486 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_01940 98635 97883 gene locus_tag LOCUS_01950 98635 97883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 100925 98700 gene locus_tag LOCUS_01960 100925 98700 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_01960 101559 100981 gene locus_tag LOCUS_01970 101559 100981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 102024 103115 gene locus_tag LOCUS_01980 gene rfbB 102024 103115 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723092.1 protein_id gnl|my_center|LOCUS_01980 103112 103657 gene locus_tag LOCUS_01990 gene rfbC 103112 103657 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_01990 105958 103955 gene locus_tag LOCUS_02000 105958 103955 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141615.1 protein_id gnl|my_center|LOCUS_02000 106079 106984 gene locus_tag LOCUS_02010 gene era 106079 106984 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_02010 108736 107390 gene locus_tag LOCUS_02020 108736 107390 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_02020 110626 109472 gene locus_tag LOCUS_02030 110626 109472 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_02030 111525 110635 gene locus_tag LOCUS_02040 gene ftsX 111525 110635 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 protein_id gnl|my_center|LOCUS_02040 112286 111522 gene locus_tag LOCUS_02050 gene ftsE 112286 111522 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263537.1 protein_id gnl|my_center|LOCUS_02050 112985 113641 gene locus_tag LOCUS_02060 112985 113641 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_02060 113664 115268 gene locus_tag LOCUS_02070 113664 115268 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941565.1 protein_id gnl|my_center|LOCUS_02070 <118162 115448 gene locus_tag LOCUS_02080 <118162 115448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003382460.1:OmpA family protein >Feature sequence023 44 286 gene locus_tag LOCUS_02090 44 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 >Feature sequence024 >Feature sequence025 >Feature sequence026 >Feature sequence027 3 509 gene locus_tag LOCUS_02100 3 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 >Feature sequence028 >Feature sequence029 >Feature sequence030 >Feature sequence031 >Feature sequence032 >Feature sequence033 761 1147 gene locus_tag LOCUS_02110 761 1147 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_02110 1269 3035 gene locus_tag LOCUS_02120 1269 3035 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_02120 3037 3456 gene locus_tag LOCUS_02130 3037 3456 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940222.1 protein_id gnl|my_center|LOCUS_02130 3669 6296 gene locus_tag LOCUS_02140 3669 6296 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940472.1 protein_id gnl|my_center|LOCUS_02140 7106 6420 gene locus_tag LOCUS_02150 7106 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937444.1 protein_id gnl|my_center|LOCUS_02150 8412 7108 gene locus_tag LOCUS_02160 8412 7108 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793113.1 protein_id gnl|my_center|LOCUS_02160 9064 8702 gene locus_tag LOCUS_02170 9064 8702 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545664.1 protein_id gnl|my_center|LOCUS_02170 10978 9215 gene locus_tag LOCUS_02180 10978 9215 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940221.1 protein_id gnl|my_center|LOCUS_02180 12244 10991 gene locus_tag LOCUS_02190 12244 10991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 12964 12350 gene locus_tag LOCUS_02200 12964 12350 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742222.1 protein_id gnl|my_center|LOCUS_02200 13365 14519 gene locus_tag LOCUS_02210 13365 14519 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_02210 14503 15138 gene locus_tag LOCUS_02220 gene metW 14503 15138 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391015.1 protein_id gnl|my_center|LOCUS_02220 15135 16136 gene locus_tag LOCUS_02230 15135 16136 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_02230 16133 17059 gene locus_tag LOCUS_02240 gene cysK 16133 17059 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393469.1 protein_id gnl|my_center|LOCUS_02240 17071 17502 gene locus_tag LOCUS_02250 17071 17502 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454437.1 protein_id gnl|my_center|LOCUS_02250 17962 18951 gene locus_tag LOCUS_02260 17962 18951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 18989 19168 gene locus_tag LOCUS_02270 18989 19168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 19429 19935 gene locus_tag LOCUS_02280 19429 19935 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_02280 19938 20273 gene locus_tag LOCUS_02290 19938 20273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 20286 20666 gene locus_tag LOCUS_02300 20286 20666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 20682 20945 gene locus_tag LOCUS_02310 20682 20945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02310 20942 21691 gene locus_tag LOCUS_02320 20942 21691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 21696 22085 gene locus_tag LOCUS_02330 21696 22085 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_02330 22082 23599 gene locus_tag LOCUS_02340 22082 23599 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_02340 23642 25126 gene locus_tag LOCUS_02350 23642 25126 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_02350 25123 25374 gene locus_tag LOCUS_02360 25123 25374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 25529 27322 gene locus_tag LOCUS_02370 25529 27322 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969263.1 protein_id gnl|my_center|LOCUS_02370 28548 28126 gene locus_tag LOCUS_02380 28548 28126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 29689 28595 gene locus_tag LOCUS_02390 29689 28595 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877636.1 protein_id gnl|my_center|LOCUS_02390 30703 30281 gene locus_tag LOCUS_02400 30703 30281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 31843 30749 gene locus_tag LOCUS_02410 31843 30749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 33328 33789 gene locus_tag LOCUS_02420 33328 33789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 34264 35136 gene locus_tag LOCUS_02430 34264 35136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 36033 35602 gene locus_tag LOCUS_02440 36033 35602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 36313 37836 gene locus_tag LOCUS_02450 36313 37836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 37913 39331 gene locus_tag LOCUS_02460 37913 39331 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_02460 40190 39513 gene locus_tag LOCUS_02470 40190 39513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 40537 41793 gene locus_tag LOCUS_02480 40537 41793 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403427.1 protein_id gnl|my_center|LOCUS_02480 41797 42936 gene locus_tag LOCUS_02490 41797 42936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 43283 45196 gene locus_tag LOCUS_02500 gene speA 43283 45196 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792905.1 protein_id gnl|my_center|LOCUS_02500 45250 46440 gene locus_tag LOCUS_02510 45250 46440 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_02510 46437 47606 gene locus_tag LOCUS_02520 gene nspC 46437 47606 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937726.1 protein_id gnl|my_center|LOCUS_02520 47964 49157 gene locus_tag LOCUS_02530 47964 49157 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_02530 49334 49867 gene locus_tag LOCUS_02540 49334 49867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 50449 51903 gene locus_tag LOCUS_02550 gene rhbB 50449 51903 CDS product diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968202.1 protein_id gnl|my_center|LOCUS_02550 51963 52658 gene locus_tag LOCUS_02560 51963 52658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 53153 54055 gene locus_tag LOCUS_02570 53153 54055 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932081.1 protein_id gnl|my_center|LOCUS_02570 54055 55095 gene locus_tag LOCUS_02580 54055 55095 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_02580 55076 55894 gene locus_tag LOCUS_02590 55076 55894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 55911 56849 gene locus_tag LOCUS_02600 55911 56849 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868809.1 protein_id gnl|my_center|LOCUS_02600 56846 58219 gene locus_tag LOCUS_02610 56846 58219 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_02610 58434 59054 gene locus_tag LOCUS_02620 58434 59054 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174544.1 protein_id gnl|my_center|LOCUS_02620 59238 60368 gene locus_tag LOCUS_02630 59238 60368 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943627.1 protein_id gnl|my_center|LOCUS_02630 60355 61563 gene locus_tag LOCUS_02640 60355 61563 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258427.1 protein_id gnl|my_center|LOCUS_02640 61560 62321 gene locus_tag LOCUS_02650 gene cobI 61560 62321 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_02650 62323 63102 gene locus_tag LOCUS_02660 gene cobM 62323 63102 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876241.1 protein_id gnl|my_center|LOCUS_02660 63102 64142 gene locus_tag LOCUS_02670 63102 64142 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229228.1 protein_id gnl|my_center|LOCUS_02670 64201 64971 gene locus_tag LOCUS_02680 64201 64971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 66218 65040 gene locus_tag LOCUS_02690 66218 65040 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_02690 66577 67956 gene locus_tag LOCUS_02700 gene mgtE 66577 67956 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071378.1 protein_id gnl|my_center|LOCUS_02700 70126 68039 gene locus_tag LOCUS_02710 70126 68039 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937885.1 protein_id gnl|my_center|LOCUS_02710 71039 70119 gene locus_tag LOCUS_02720 71039 70119 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793043.1 protein_id gnl|my_center|LOCUS_02720 71628 71242 gene locus_tag LOCUS_02730 71628 71242 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_02730 72045 72554 gene locus_tag LOCUS_02740 72045 72554 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060742.1 protein_id gnl|my_center|LOCUS_02740 72861 72601 gene locus_tag LOCUS_02750 72861 72601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 73668 72994 gene locus_tag LOCUS_02760 73668 72994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 75788 73713 gene locus_tag LOCUS_02770 75788 73713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 76998 75844 gene locus_tag LOCUS_02780 76998 75844 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_02780 78344 77169 gene locus_tag LOCUS_02790 78344 77169 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_02790 79949 78732 gene locus_tag LOCUS_02800 79949 78732 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940289.1 protein_id gnl|my_center|LOCUS_02800 82152 80029 gene locus_tag LOCUS_02810 gene pta 82152 80029 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_02810 84633 82402 gene locus_tag LOCUS_02820 84633 82402 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_02820 88886 84630 gene locus_tag LOCUS_02830 88886 84630 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545209.1 protein_id gnl|my_center|LOCUS_02830 88885 89184 gene locus_tag LOCUS_02840 88885 89184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 89325 89942 gene locus_tag LOCUS_02850 89325 89942 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 protein_id gnl|my_center|LOCUS_02850 90107 90973 gene locus_tag LOCUS_02860 90107 90973 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_02860 91999 91115 gene locus_tag LOCUS_02870 91999 91115 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974282.1 protein_id gnl|my_center|LOCUS_02870 92378 93445 gene locus_tag LOCUS_02880 92378 93445 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072443.1 protein_id gnl|my_center|LOCUS_02880 94797 93658 gene locus_tag LOCUS_02890 94797 93658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 95581 94919 gene locus_tag LOCUS_02900 95581 94919 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_02900 95980 95669 gene locus_tag LOCUS_02910 95980 95669 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140361.1 protein_id gnl|my_center|LOCUS_02910 96216 95980 gene locus_tag LOCUS_02920 96216 95980 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265886.1 protein_id gnl|my_center|LOCUS_02920 96838 96620 gene locus_tag LOCUS_02930 96838 96620 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_02930 97240 97013 gene locus_tag LOCUS_02940 97240 97013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 97505 97212 gene locus_tag LOCUS_02950 97505 97212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 98016 98258 gene locus_tag LOCUS_02960 98016 98258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 98255 98662 gene locus_tag LOCUS_02970 98255 98662 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_02970 98803 99033 gene locus_tag LOCUS_02980 98803 99033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 99495 99163 gene locus_tag LOCUS_02990 gene mazF 99495 99163 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_02990 99755 99492 gene locus_tag LOCUS_03000 gene chpS 99755 99492 CDS product type II toxin-antitoxin system antitoxin ChpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223210.1 protein_id gnl|my_center|LOCUS_03000 101962 99932 gene locus_tag LOCUS_03010 101962 99932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 102677 106267 gene locus_tag LOCUS_03020 102677 106267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 107180 106356 gene locus_tag LOCUS_03030 107180 106356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 107710 107267 gene locus_tag LOCUS_03040 107710 107267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 108356 107775 gene locus_tag LOCUS_03050 108356 107775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 109307 109891 gene locus_tag LOCUS_03060 109307 109891 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_03060 110235 111215 gene locus_tag LOCUS_03070 110235 111215 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 protein_id gnl|my_center|LOCUS_03070 112628 111588 gene locus_tag LOCUS_03080 112628 111588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence034 336 49 gene locus_tag LOCUS_03090 336 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 >Feature sequence035 >Feature sequence036 >Feature sequence037 >Feature sequence038 >Feature sequence039 >Feature sequence040 >Feature sequence041 >Feature sequence042 >Feature sequence043 >Feature sequence044 1342 557 gene locus_tag LOCUS_03100 1342 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 2027 1683 gene locus_tag LOCUS_03110 2027 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03110 4349 2610 gene locus_tag LOCUS_03120 4349 2610 CDS product aldehyde ferredoxin oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792756.1 protein_id gnl|my_center|LOCUS_03120 4792 4346 gene locus_tag LOCUS_03130 4792 4346 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792757.1 protein_id gnl|my_center|LOCUS_03130 4961 5632 gene locus_tag LOCUS_03140 4961 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 6254 5889 gene locus_tag LOCUS_03150 6254 5889 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545480.1 protein_id gnl|my_center|LOCUS_03150 6821 7759 gene locus_tag LOCUS_03160 6821 7759 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941566.1 protein_id gnl|my_center|LOCUS_03160 7769 9826 gene locus_tag LOCUS_03170 7769 9826 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223895.1 protein_id gnl|my_center|LOCUS_03170 11352 10150 gene locus_tag LOCUS_03180 11352 10150 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_03180 11663 11451 gene locus_tag LOCUS_03190 11663 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 12871 11843 gene locus_tag LOCUS_03200 12871 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 13263 12991 gene locus_tag LOCUS_03210 13263 12991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 13244 13516 gene locus_tag LOCUS_03220 13244 13516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 14554 13592 gene locus_tag LOCUS_03230 14554 13592 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_03230 14938 14669 gene locus_tag LOCUS_03240 14938 14669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 15345 15037 gene locus_tag LOCUS_03250 15345 15037 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_03250 17193 15478 gene locus_tag LOCUS_03260 17193 15478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 18662 17199 gene locus_tag LOCUS_03270 18662 17199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 18973 18677 gene locus_tag LOCUS_03280 18973 18677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 19932 18994 gene locus_tag LOCUS_03290 19932 18994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 20241 19936 gene locus_tag LOCUS_03300 20241 19936 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_03300 20515 20228 gene locus_tag LOCUS_03310 20515 20228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 21168 20512 gene locus_tag LOCUS_03320 21168 20512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 21737 22000 gene locus_tag LOCUS_03330 21737 22000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 24514 22523 gene locus_tag LOCUS_03340 24514 22523 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_03340 25487 25411 gene locus_tag LOCUS_t00030 25487 25411 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 26944 25874 gene locus_tag LOCUS_03350 gene ychF 26944 25874 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949032.1 protein_id gnl|my_center|LOCUS_03350 27344 28528 gene locus_tag LOCUS_03360 27344 28528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 29718 28780 gene locus_tag LOCUS_03370 29718 28780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 30488 29826 gene locus_tag LOCUS_03380 30488 29826 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_03380 31297 30626 gene locus_tag LOCUS_03390 31297 30626 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943739.1 protein_id gnl|my_center|LOCUS_03390 32762 31302 gene locus_tag LOCUS_03400 32762 31302 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943740.1 protein_id gnl|my_center|LOCUS_03400 33424 34632 gene locus_tag LOCUS_03410 33424 34632 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551445.1 protein_id gnl|my_center|LOCUS_03410 34632 36581 gene locus_tag LOCUS_03420 34632 36581 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071115.1 protein_id gnl|my_center|LOCUS_03420 36586 37962 gene locus_tag LOCUS_03430 36586 37962 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535038.1 protein_id gnl|my_center|LOCUS_03430 39251 38172 gene locus_tag LOCUS_03440 39251 38172 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_03440 39539 40687 gene locus_tag LOCUS_03450 gene citZ 39539 40687 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_03450 41715 40819 gene locus_tag LOCUS_03460 41715 40819 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937487.1 protein_id gnl|my_center|LOCUS_03460 42403 41774 gene locus_tag LOCUS_03470 gene gmhB 42403 41774 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_03470 43465 42404 gene locus_tag LOCUS_03480 gene waaF 43465 42404 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_03480 45237 43462 gene locus_tag LOCUS_03490 45237 43462 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939485.1 protein_id gnl|my_center|LOCUS_03490 46054 45476 gene locus_tag LOCUS_03500 46054 45476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 46875 46408 gene locus_tag LOCUS_03510 gene rlmH 46875 46408 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_03510 47297 46872 gene locus_tag LOCUS_03520 47297 46872 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938301.1 protein_id gnl|my_center|LOCUS_03520 47546 47785 gene locus_tag LOCUS_03530 47546 47785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 48330 47776 gene locus_tag LOCUS_03540 48330 47776 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817044.1 protein_id gnl|my_center|LOCUS_03540 48520 48705 gene locus_tag LOCUS_03550 48520 48705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 50750 48876 gene locus_tag LOCUS_03560 50750 48876 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940637.1 protein_id gnl|my_center|LOCUS_03560 51064 51501 gene locus_tag LOCUS_03570 51064 51501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 51655 51452 gene locus_tag LOCUS_03580 51655 51452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 54486 51940 gene locus_tag LOCUS_03590 54486 51940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 55647 54763 gene locus_tag LOCUS_03600 gene galU 55647 54763 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892053.1 protein_id gnl|my_center|LOCUS_03600 56006 59749 gene locus_tag LOCUS_03610 gene hrpA 56006 59749 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_03610 59899 61242 gene locus_tag LOCUS_03620 59899 61242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:60472..60474,aa:Sec) note codon on position 192 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_03620 61960 61637 gene locus_tag LOCUS_03630 61960 61637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 62715 62074 gene locus_tag LOCUS_03640 62715 62074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 64484 62712 gene locus_tag LOCUS_03650 64484 62712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 65159 65764 gene locus_tag LOCUS_03660 gene fadR 65159 65764 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_03660 66533 66048 gene locus_tag LOCUS_03670 gene greA 66533 66048 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545525.1 protein_id gnl|my_center|LOCUS_03670 67970 66783 gene locus_tag LOCUS_03680 67970 66783 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007341012.1 protein_id gnl|my_center|LOCUS_03680 69005 68016 gene locus_tag LOCUS_03690 69005 68016 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_03690 69505 71229 gene locus_tag LOCUS_03700 gene lepA 69505 71229 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957093.1 protein_id gnl|my_center|LOCUS_03700 72072 71470 gene locus_tag LOCUS_03710 gene yihA 72072 71470 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_03710 73000 72125 gene locus_tag LOCUS_03720 gene hisG 73000 72125 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_03720 73491 73105 gene locus_tag LOCUS_03730 gene hisI 73491 73105 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_03730 73844 74284 gene locus_tag LOCUS_03740 73844 74284 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_03740 74798 77710 gene locus_tag LOCUS_03750 74798 77710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 77975 78424 gene locus_tag LOCUS_03760 77975 78424 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_03760 78517 79656 gene locus_tag LOCUS_03770 gene cheB 78517 79656 CDS product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245823.1 protein_id gnl|my_center|LOCUS_03770 79682 80518 gene locus_tag LOCUS_03780 79682 80518 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084985.1 protein_id gnl|my_center|LOCUS_03780 80581 81141 gene locus_tag LOCUS_03790 80581 81141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 81138 81569 gene locus_tag LOCUS_03800 81138 81569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 81832 82278 gene locus_tag LOCUS_03810 81832 82278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 82320 82559 gene locus_tag LOCUS_03820 82320 82559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 82574 83536 gene locus_tag LOCUS_03830 82574 83536 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941328.1 protein_id gnl|my_center|LOCUS_03830 83668 84129 gene locus_tag LOCUS_03840 gene rplI 83668 84129 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_03840 84461 85834 gene locus_tag LOCUS_03850 gene dnaB 84461 85834 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_03850 85882 88359 gene locus_tag LOCUS_03860 gene leuS 85882 88359 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_03860 88635 89174 gene locus_tag LOCUS_03870 88635 89174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 89412 90377 gene locus_tag LOCUS_03880 gene dusB 89412 90377 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_03880 91553 90771 gene locus_tag LOCUS_03890 91553 90771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 93949 91673 gene locus_tag LOCUS_03900 93949 91673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 94761 93949 gene locus_tag LOCUS_03910 94761 93949 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_03910 95431 96294 gene locus_tag LOCUS_03920 95431 96294 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_03920 96551 97939 gene locus_tag LOCUS_03930 96551 97939 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_03930 98811 97951 gene locus_tag LOCUS_03940 98811 97951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 99622 98801 gene locus_tag LOCUS_03950 gene proC 99622 98801 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_03950 100972 99980 gene locus_tag LOCUS_03960 gene lpxC 100972 99980 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555040.1 protein_id gnl|my_center|LOCUS_03960 102308 101235 gene locus_tag LOCUS_03970 gene lpxK 102308 101235 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_03970 102722 103843 gene locus_tag LOCUS_03980 102722 103843 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937853.1 protein_id gnl|my_center|LOCUS_03980 104045 105052 gene locus_tag LOCUS_03990 104045 105052 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_03990 105109 106266 gene locus_tag LOCUS_04000 gene lpxB 105109 106266 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_04000 106472 106777 gene locus_tag LOCUS_04010 106472 106777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 107249 106728 gene locus_tag LOCUS_04020 107249 106728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 107509 107246 gene locus_tag LOCUS_04030 107509 107246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 108112 107687 gene locus_tag LOCUS_04040 108112 107687 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404557.1 protein_id gnl|my_center|LOCUS_04040 109128 108082 gene locus_tag LOCUS_04050 109128 108082 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_04050 109672 110676 gene locus_tag LOCUS_04060 109672 110676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 111408 111010 gene locus_tag LOCUS_04070 111408 111010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938981.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence045 >Feature sequence046 >Feature sequence047 >Feature sequence048 >Feature sequence049 >Feature sequence050 >Feature sequence051 198 458 gene locus_tag LOCUS_04080 198 458 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064047.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence052 >Feature sequence053 >Feature sequence054 >Feature sequence055 209 412 gene locus_tag LOCUS_04090 209 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 2838 388 gene locus_tag LOCUS_04100 2838 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04100 3758 2835 gene locus_tag LOCUS_04110 3758 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04110 4394 4236 gene locus_tag LOCUS_04120 4394 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 4410 5240 gene locus_tag LOCUS_04130 4410 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 5343 6632 gene locus_tag LOCUS_04140 5343 6632 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_04140 7891 6872 gene locus_tag LOCUS_04150 7891 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 8439 7888 gene locus_tag LOCUS_04160 8439 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 9133 8627 gene locus_tag LOCUS_04170 9133 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 10422 9130 gene locus_tag LOCUS_04180 gene hemA 10422 9130 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938754.1 protein_id gnl|my_center|LOCUS_04180 11230 10412 gene locus_tag LOCUS_04190 gene ccsB 11230 10412 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_04190 11829 11227 gene locus_tag LOCUS_04200 11829 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 12754 12062 gene locus_tag LOCUS_04210 12754 12062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 13156 12962 gene locus_tag LOCUS_04220 13156 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 13764 13279 gene locus_tag LOCUS_04230 13764 13279 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933886.1 protein_id gnl|my_center|LOCUS_04230 14315 13962 gene locus_tag LOCUS_04240 14315 13962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 14659 15636 gene locus_tag LOCUS_04250 14659 15636 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_04250 15768 16529 gene locus_tag LOCUS_04260 15768 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 16526 17362 gene locus_tag LOCUS_04270 gene recO 16526 17362 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_04270 17561 20200 gene locus_tag LOCUS_04280 gene ndvB 17561 20200 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_04280 24698 20487 gene locus_tag LOCUS_04290 24698 20487 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 protein_id gnl|my_center|LOCUS_04290 26759 24882 gene locus_tag LOCUS_04300 26759 24882 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_04300 27006 27326 gene locus_tag LOCUS_04310 27006 27326 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940042.1 protein_id gnl|my_center|LOCUS_04310 27989 27738 gene locus_tag LOCUS_04320 27989 27738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 28370 28086 gene locus_tag LOCUS_04330 28370 28086 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_04330 30406 28373 gene locus_tag LOCUS_04340 gene ligA 30406 28373 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_04340 30581 30399 gene locus_tag LOCUS_04350 30581 30399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 31150 30926 gene locus_tag LOCUS_04360 31150 30926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 31178 32191 gene locus_tag LOCUS_04370 gene galE 31178 32191 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_04370 32212 32940 gene locus_tag LOCUS_04380 gene cmoA 32212 32940 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859101.1 protein_id gnl|my_center|LOCUS_04380 32942 33970 gene locus_tag LOCUS_04390 gene cmoB 32942 33970 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864121.1 protein_id gnl|my_center|LOCUS_04390 33967 34518 gene locus_tag LOCUS_04400 33967 34518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791841.1 protein_id gnl|my_center|LOCUS_04400 35165 36205 gene locus_tag LOCUS_04410 35165 36205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 37677 36280 gene locus_tag LOCUS_04420 gene mnmE 37677 36280 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_04420 38566 37655 gene locus_tag LOCUS_04430 38566 37655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 40245 38590 gene locus_tag LOCUS_04440 gene yidC 40245 38590 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_04440 40949 40590 gene locus_tag LOCUS_04450 gene rnpA 40949 40590 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789343.1 protein_id gnl|my_center|LOCUS_04450 41878 43761 gene locus_tag LOCUS_04460 gene mnmG 41878 43761 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_04460 43777 44625 gene locus_tag LOCUS_04470 gene lgt 43777 44625 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545160.1 protein_id gnl|my_center|LOCUS_04470 44929 44657 gene locus_tag LOCUS_04480 44929 44657 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261491.1 protein_id gnl|my_center|LOCUS_04480 45992 45339 gene locus_tag LOCUS_04490 45992 45339 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_04490 47452 46004 gene locus_tag LOCUS_04500 47452 46004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 48604 47735 gene locus_tag LOCUS_04510 48604 47735 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942627.1 protein_id gnl|my_center|LOCUS_04510 49682 48624 gene locus_tag LOCUS_04520 49682 48624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 51247 49655 gene locus_tag LOCUS_04530 51247 49655 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_04530 51259 51963 gene locus_tag LOCUS_04540 51259 51963 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772758.1 protein_id gnl|my_center|LOCUS_04540 52920 52000 gene locus_tag LOCUS_04550 gene epmA 52920 52000 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_04550 53488 52925 gene locus_tag LOCUS_04560 gene efp 53488 52925 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_04560 54107 53805 gene locus_tag LOCUS_04570 54107 53805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 53988 54344 gene locus_tag LOCUS_04580 53988 54344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 54341 54859 gene locus_tag LOCUS_04590 54341 54859 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524404.1 protein_id gnl|my_center|LOCUS_04590 54844 57519 gene locus_tag LOCUS_04600 gene mutS 54844 57519 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_04600 58196 60127 gene locus_tag LOCUS_04610 58196 60127 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791909.1 protein_id gnl|my_center|LOCUS_04610 60997 60581 gene locus_tag LOCUS_04620 60997 60581 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_04620 62449 61028 gene locus_tag LOCUS_04630 gene atpD 62449 61028 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938076.1 protein_id gnl|my_center|LOCUS_04630 63371 62496 gene locus_tag LOCUS_04640 63371 62496 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938077.1 protein_id gnl|my_center|LOCUS_04640 64912 63389 gene locus_tag LOCUS_04650 gene atpA 64912 63389 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938078.1 protein_id gnl|my_center|LOCUS_04650 65464 64916 gene locus_tag LOCUS_04660 gene atpH 65464 64916 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_04660 66174 65461 gene locus_tag LOCUS_04670 66174 65461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 66602 66171 gene locus_tag LOCUS_04680 66602 66171 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056287.1 protein_id gnl|my_center|LOCUS_04680 68000 66975 gene locus_tag LOCUS_04690 68000 66975 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071877.1 protein_id gnl|my_center|LOCUS_04690 69880 68249 gene locus_tag LOCUS_04700 69880 68249 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_04700 70750 69884 gene locus_tag LOCUS_04710 70750 69884 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259370.1 protein_id gnl|my_center|LOCUS_04710 71784 70750 gene locus_tag LOCUS_04720 71784 70750 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_04720 72366 72127 gene locus_tag LOCUS_04730 72366 72127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 73493 72693 gene locus_tag LOCUS_04740 73493 72693 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 protein_id gnl|my_center|LOCUS_04740 73937 73494 gene locus_tag LOCUS_04750 73937 73494 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922123.1 protein_id gnl|my_center|LOCUS_04750 74687 73947 gene locus_tag LOCUS_04760 gene fabG 74687 73947 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_04760 76133 74718 gene locus_tag LOCUS_04770 76133 74718 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921402.1 protein_id gnl|my_center|LOCUS_04770 77751 76351 gene locus_tag LOCUS_04780 77751 76351 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118443.1 protein_id gnl|my_center|LOCUS_04780 78046 77795 gene locus_tag LOCUS_04790 78046 77795 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_04790 79372 78122 gene locus_tag LOCUS_04800 79372 78122 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325817.1 protein_id gnl|my_center|LOCUS_04800 82043 79377 gene locus_tag LOCUS_04810 gene alaS 82043 79377 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_04810 84483 82498 gene locus_tag LOCUS_04820 gene acs 84483 82498 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940228.1 protein_id gnl|my_center|LOCUS_04820 84991 85308 gene locus_tag LOCUS_04830 84991 85308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 86819 85413 gene locus_tag LOCUS_04840 86819 85413 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837095.1 protein_id gnl|my_center|LOCUS_04840 88826 87207 gene locus_tag LOCUS_04850 88826 87207 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941660.1 protein_id gnl|my_center|LOCUS_04850 89995 89162 gene locus_tag LOCUS_04860 89995 89162 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941065.1 protein_id gnl|my_center|LOCUS_04860 91341 90193 gene locus_tag LOCUS_04870 gene hemW 91341 90193 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_04870 92078 91341 gene locus_tag LOCUS_04880 gene radC 92078 91341 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203904.1 protein_id gnl|my_center|LOCUS_04880 93512 92088 gene locus_tag LOCUS_04890 gene gatB 93512 92088 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_04890 94099 93533 gene locus_tag LOCUS_04900 94099 93533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791831.1 protein_id gnl|my_center|LOCUS_04900 96004 94235 gene locus_tag LOCUS_04910 96004 94235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 96654 96049 gene locus_tag LOCUS_04920 gene rdgC 96654 96049 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939729.1 protein_id gnl|my_center|LOCUS_04920 96868 96943 gene locus_tag LOCUS_t00040 96868 96943 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 96964 97041 gene locus_tag LOCUS_t00050 96964 97041 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 98878 97745 gene locus_tag LOCUS_04930 gene wecB 98878 97745 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703970.1 protein_id gnl|my_center|LOCUS_04930 99344 99138 gene locus_tag LOCUS_04940 99344 99138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 99437 100882 gene locus_tag LOCUS_04950 99437 100882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 101367 101666 gene locus_tag LOCUS_04960 101367 101666 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117857.1 protein_id gnl|my_center|LOCUS_04960 103916 101964 gene locus_tag LOCUS_04970 103916 101964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 105229 104462 gene locus_tag LOCUS_04980 105229 104462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 106028 107077 gene locus_tag LOCUS_04990 106028 107077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence056 >Feature sequence057 >Feature sequence058 >Feature sequence059 >Feature sequence060 >Feature sequence061 >Feature sequence062 >Feature sequence063 >Feature sequence064 >Feature sequence065 >Feature sequence066 1579 275 gene locus_tag LOCUS_05000 1579 275 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_05000 1991 3271 gene locus_tag LOCUS_05010 1991 3271 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792854.1 protein_id gnl|my_center|LOCUS_05010 4603 3323 gene locus_tag LOCUS_05020 gene nifB 4603 3323 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933205.1 protein_id gnl|my_center|LOCUS_05020 6023 4647 gene locus_tag LOCUS_05030 6023 4647 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933204.1 protein_id gnl|my_center|LOCUS_05030 7405 6047 gene locus_tag LOCUS_05040 gene nifE 7405 6047 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787306.1 protein_id gnl|my_center|LOCUS_05040 7727 8089 gene locus_tag LOCUS_05050 7727 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 9526 8321 gene locus_tag LOCUS_05060 9526 8321 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 protein_id gnl|my_center|LOCUS_05060 11517 9856 gene locus_tag LOCUS_05070 11517 9856 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_05070 11945 12124 gene locus_tag LOCUS_05080 11945 12124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 12866 12075 gene locus_tag LOCUS_05090 gene cobB 12866 12075 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868319.1 protein_id gnl|my_center|LOCUS_05090 13827 12946 gene locus_tag LOCUS_05100 13827 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 15151 13994 gene locus_tag LOCUS_05110 15151 13994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 16182 15280 gene locus_tag LOCUS_05120 16182 15280 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008870867.1 protein_id gnl|my_center|LOCUS_05120 17017 16367 gene locus_tag LOCUS_05130 17017 16367 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_05130 17465 17019 gene locus_tag LOCUS_05140 17465 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 17985 17740 gene locus_tag LOCUS_05150 17985 17740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 18497 19522 gene locus_tag LOCUS_05160 18497 19522 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_05160 19504 20346 gene locus_tag LOCUS_05170 gene panB 19504 20346 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_05170 21042 20413 gene locus_tag LOCUS_05180 21042 20413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 21317 21108 gene locus_tag LOCUS_05190 21317 21108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 22636 21395 gene locus_tag LOCUS_05200 gene purF 22636 21395 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937472.1 protein_id gnl|my_center|LOCUS_05200 22565 22843 gene locus_tag LOCUS_05210 22565 22843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 23176 24144 gene locus_tag LOCUS_05220 gene selD 23176 24144 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_05220 25319 24174 gene locus_tag LOCUS_05230 25319 24174 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230352.1 protein_id gnl|my_center|LOCUS_05230 26337 25306 gene locus_tag LOCUS_05240 26337 25306 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_05240 26290 26508 gene locus_tag LOCUS_05250 26290 26508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 27366 26926 gene locus_tag LOCUS_05260 27366 26926 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546858.1 protein_id gnl|my_center|LOCUS_05260 27385 27546 gene locus_tag LOCUS_05270 27385 27546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 28264 27536 gene locus_tag LOCUS_05280 28264 27536 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_05280 29202 28366 gene locus_tag LOCUS_05290 29202 28366 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_05290 29441 29365 gene locus_tag LOCUS_t00060 29441 29365 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 29893 31707 gene locus_tag LOCUS_05300 29893 31707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 33281 31977 gene locus_tag LOCUS_05310 33281 31977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 33498 34232 gene locus_tag LOCUS_05320 33498 34232 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085404.1 protein_id gnl|my_center|LOCUS_05320 34562 35314 gene locus_tag LOCUS_05330 gene surE 34562 35314 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545452.1 protein_id gnl|my_center|LOCUS_05330 35460 36314 gene locus_tag LOCUS_05340 35460 36314 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_05340 36833 37918 gene locus_tag LOCUS_05350 36833 37918 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_05350 38167 38457 gene locus_tag LOCUS_05360 gene groES 38167 38457 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388344.1 protein_id gnl|my_center|LOCUS_05360 38502 40157 gene locus_tag LOCUS_05370 gene groL 38502 40157 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939262.1 protein_id gnl|my_center|LOCUS_05370 40396 40472 gene locus_tag LOCUS_t00070 40396 40472 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 40749 41735 gene locus_tag LOCUS_05380 40749 41735 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940727.1 protein_id gnl|my_center|LOCUS_05380 42037 44220 gene locus_tag LOCUS_05390 42037 44220 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_05390 44217 45119 gene locus_tag LOCUS_05400 44217 45119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 45121 47178 gene locus_tag LOCUS_05410 gene cas8c 45121 47178 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392033.1 protein_id gnl|my_center|LOCUS_05410 47215 48201 gene locus_tag LOCUS_05420 gene cas7c 47215 48201 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384680.1 protein_id gnl|my_center|LOCUS_05420 48629 49408 gene locus_tag LOCUS_05430 48629 49408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 49687 50238 gene locus_tag LOCUS_05440 gene cas4 49687 50238 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932803.1 protein_id gnl|my_center|LOCUS_05440 50235 51263 gene locus_tag LOCUS_05450 gene cas1c 50235 51263 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_05450 51273 51563 gene locus_tag LOCUS_05460 gene cas2 51273 51563 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_05460 51740 53509 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgccccctgcgcgggggcgtggattgaaac 55474 53576 gene locus_tag LOCUS_05470 55474 53576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 57751 55592 gene locus_tag LOCUS_05480 57751 55592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 58602 57760 gene locus_tag LOCUS_05490 58602 57760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 59169 58807 gene locus_tag LOCUS_05500 59169 58807 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939487.1 protein_id gnl|my_center|LOCUS_05500 60567 59185 gene locus_tag LOCUS_05510 60567 59185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 60979 61464 gene locus_tag LOCUS_05520 60979 61464 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037309.1 protein_id gnl|my_center|LOCUS_05520 61626 61940 gene locus_tag LOCUS_05530 61626 61940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 61961 62248 gene locus_tag LOCUS_05540 61961 62248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 63103 64668 gene locus_tag LOCUS_05550 gene rny 63103 64668 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_05550 64681 65895 gene locus_tag LOCUS_05560 gene tyrS 64681 65895 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_05560 66543 66121 gene locus_tag LOCUS_05570 66543 66121 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_05570 66663 67694 gene locus_tag LOCUS_05580 gene dusB 66663 67694 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 protein_id gnl|my_center|LOCUS_05580 68965 67670 gene locus_tag LOCUS_05590 68965 67670 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938700.1 protein_id gnl|my_center|LOCUS_05590 69432 68980 gene locus_tag LOCUS_05600 69432 68980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 71927 69732 gene locus_tag LOCUS_05610 gene glgP 71927 69732 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545636.1 protein_id gnl|my_center|LOCUS_05610 72191 72712 gene locus_tag LOCUS_05620 72191 72712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 73029 73517 gene locus_tag LOCUS_05630 73029 73517 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545058.1 protein_id gnl|my_center|LOCUS_05630 73539 74564 gene locus_tag LOCUS_05640 gene rfaE1 73539 74564 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_05640 74664 75545 gene locus_tag LOCUS_05650 74664 75545 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_05650 75618 75923 gene locus_tag LOCUS_05660 75618 75923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 75916 76536 gene locus_tag LOCUS_05670 gene gmk 75916 76536 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_05670 76536 77318 gene locus_tag LOCUS_05680 gene rlmB 76536 77318 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459087.1 protein_id gnl|my_center|LOCUS_05680 78671 77505 gene locus_tag LOCUS_05690 gene rpsA 78671 77505 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_05690 79277 78765 gene locus_tag LOCUS_05700 79277 78765 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546148.1 protein_id gnl|my_center|LOCUS_05700 81055 79283 gene locus_tag LOCUS_05710 81055 79283 CDS product RiPP maturation radical SAM C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_05710 81791 81066 gene locus_tag LOCUS_05720 81791 81066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 82572 81784 gene locus_tag LOCUS_05730 gene murI 82572 81784 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_05730 83624 83184 gene locus_tag LOCUS_05740 83624 83184 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939797.1 protein_id gnl|my_center|LOCUS_05740 84267 84554 gene locus_tag LOCUS_05750 84267 84554 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941527.1 protein_id gnl|my_center|LOCUS_05750 86215 85109 gene locus_tag LOCUS_05760 gene queA 86215 85109 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_05760 86491 87225 gene locus_tag LOCUS_05770 gene mqnB 86491 87225 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136796951.1 protein_id gnl|my_center|LOCUS_05770 87218 88054 gene locus_tag LOCUS_05780 87218 88054 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_05780 88123 88680 gene locus_tag LOCUS_05790 88123 88680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 89097 89840 gene locus_tag LOCUS_05800 89097 89840 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039188.1 protein_id gnl|my_center|LOCUS_05800 90023 91078 gene locus_tag LOCUS_05810 90023 91078 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_05810 91614 92699 gene locus_tag LOCUS_05820 gene gmd 91614 92699 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_05820 92714 93655 gene locus_tag LOCUS_05830 92714 93655 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937401.1 protein_id gnl|my_center|LOCUS_05830 94049 93804 gene locus_tag LOCUS_05840 94049 93804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 94104 94922 gene locus_tag LOCUS_05850 94104 94922 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705991.1 protein_id gnl|my_center|LOCUS_05850 94912 96252 gene locus_tag LOCUS_05860 94912 96252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103412.1 protein_id gnl|my_center|LOCUS_05860 96472 98403 gene locus_tag LOCUS_05870 96472 98403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 99735 100517 gene locus_tag LOCUS_05880 99735 100517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 >Feature sequence067 >Feature sequence068 >Feature sequence069 >Feature sequence070 >Feature sequence071 >Feature sequence072 >Feature sequence073 478 194 gene locus_tag LOCUS_05890 478 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence074 >Feature sequence075 >Feature sequence076 >Feature sequence077 1609 590 gene locus_tag LOCUS_05900 1609 590 CDS product IS110-like element ISGsu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 protein_id gnl|my_center|LOCUS_05900 2510 2046 gene locus_tag LOCUS_05910 2510 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3408 2497 gene locus_tag LOCUS_05920 3408 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 4759 3749 gene locus_tag LOCUS_05930 4759 3749 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_05930 5014 4799 gene locus_tag LOCUS_05940 5014 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 5701 5186 gene locus_tag LOCUS_05950 5701 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 6554 6015 gene locus_tag LOCUS_05960 6554 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 7114 6458 gene locus_tag LOCUS_05970 7114 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 7357 7190 gene locus_tag LOCUS_05980 7357 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 8038 7511 gene locus_tag LOCUS_05990 8038 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 8616 8131 gene locus_tag LOCUS_06000 8616 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 8942 8685 gene locus_tag LOCUS_06010 8942 8685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 10915 9152 gene locus_tag LOCUS_06020 10915 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 12150 10912 gene locus_tag LOCUS_06030 12150 10912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 14408 12147 gene locus_tag LOCUS_06040 14408 12147 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331369.1 protein_id gnl|my_center|LOCUS_06040 15194 14463 gene locus_tag LOCUS_06050 15194 14463 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 protein_id gnl|my_center|LOCUS_06050 16682 15222 gene locus_tag LOCUS_06060 16682 15222 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389246.1 protein_id gnl|my_center|LOCUS_06060 17700 16720 gene locus_tag LOCUS_06070 17700 16720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 18615 17857 gene locus_tag LOCUS_06080 18615 17857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 19416 18742 gene locus_tag LOCUS_06090 19416 18742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 20209 19514 gene locus_tag LOCUS_06100 20209 19514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 20985 20590 gene locus_tag LOCUS_06110 20985 20590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 21444 20995 gene locus_tag LOCUS_06120 gene fliS 21444 20995 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943663.1 protein_id gnl|my_center|LOCUS_06120 22835 21444 gene locus_tag LOCUS_06130 gene fliD 22835 21444 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943664.1 protein_id gnl|my_center|LOCUS_06130 23271 22930 gene locus_tag LOCUS_06140 23271 22930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 24837 23344 gene locus_tag LOCUS_06150 24837 23344 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_06150 25316 25107 gene locus_tag LOCUS_06160 25316 25107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 26894 25389 gene locus_tag LOCUS_06170 26894 25389 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_06170 27708 27277 gene locus_tag LOCUS_06180 27708 27277 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674247.1 protein_id gnl|my_center|LOCUS_06180 27950 27705 gene locus_tag LOCUS_06190 gene csrA 27950 27705 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943667.1 protein_id gnl|my_center|LOCUS_06190 29095 28127 gene locus_tag LOCUS_06200 29095 28127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 30511 29099 gene locus_tag LOCUS_06210 gene flgK 30511 29099 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_06210 30598 30786 gene locus_tag LOCUS_06220 30598 30786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 31108 30755 gene locus_tag LOCUS_06230 31108 30755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 31371 31114 gene locus_tag LOCUS_06240 31371 31114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 31993 31427 gene locus_tag LOCUS_06250 31993 31427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941688.1 protein_id gnl|my_center|LOCUS_06250 32523 32158 gene locus_tag LOCUS_06260 32523 32158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 33714 32599 gene locus_tag LOCUS_06270 33714 32599 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_06270 34481 33744 gene locus_tag LOCUS_06280 34481 33744 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_06280 35434 34484 gene locus_tag LOCUS_06290 35434 34484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 36221 35439 gene locus_tag LOCUS_06300 gene flgG 36221 35439 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546478.1 protein_id gnl|my_center|LOCUS_06300 37127 36390 gene locus_tag LOCUS_06310 gene flgF 37127 36390 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_06310 37761 37351 gene locus_tag LOCUS_06320 37761 37351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 38669 37935 gene locus_tag LOCUS_06330 38669 37935 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_06330 39618 38719 gene locus_tag LOCUS_06340 39618 38719 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_06340 40882 39611 gene locus_tag LOCUS_06350 gene flhF 40882 39611 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943680.1 protein_id gnl|my_center|LOCUS_06350 42974 40872 gene locus_tag LOCUS_06360 gene flhA 42974 40872 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_06360 44044 42974 gene locus_tag LOCUS_06370 gene flhB 44044 42974 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_06370 45155 44376 gene locus_tag LOCUS_06380 gene fliR 45155 44376 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941094.1 protein_id gnl|my_center|LOCUS_06380 45449 45180 gene locus_tag LOCUS_06390 gene fliQ 45449 45180 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211131.1 protein_id gnl|my_center|LOCUS_06390 46211 45471 gene locus_tag LOCUS_06400 gene fliP 46211 45471 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_06400 46501 46208 gene locus_tag LOCUS_06410 46501 46208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 46965 46585 gene locus_tag LOCUS_06420 gene fliN 46965 46585 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937357.1 protein_id gnl|my_center|LOCUS_06420 47980 46952 gene locus_tag LOCUS_06430 gene fliM 47980 46952 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941089.1 protein_id gnl|my_center|LOCUS_06430 48476 47985 gene locus_tag LOCUS_06440 48476 47985 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546721.1 protein_id gnl|my_center|LOCUS_06440 49259 48510 gene locus_tag LOCUS_06450 49259 48510 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545014.1 protein_id gnl|my_center|LOCUS_06450 50041 49274 gene locus_tag LOCUS_06460 50041 49274 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_06460 52112 50811 gene locus_tag LOCUS_06470 52112 50811 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941087.1 protein_id gnl|my_center|LOCUS_06470 53008 52184 gene locus_tag LOCUS_06480 53008 52184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 53931 53026 gene locus_tag LOCUS_06490 53931 53026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 55164 54649 gene locus_tag LOCUS_06500 55164 54649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 55666 55214 gene locus_tag LOCUS_06510 55666 55214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 57048 55663 gene locus_tag LOCUS_06520 57048 55663 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941081.1 protein_id gnl|my_center|LOCUS_06520 57872 57120 gene locus_tag LOCUS_06530 57872 57120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 58848 57841 gene locus_tag LOCUS_06540 gene fliG 58848 57841 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941079.1 protein_id gnl|my_center|LOCUS_06540 60494 58896 gene locus_tag LOCUS_06550 gene fliF 60494 58896 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_06550 61177 60881 gene locus_tag LOCUS_06560 61177 60881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 61618 61181 gene locus_tag LOCUS_06570 gene flgC 61618 61181 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_06570 62070 61657 gene locus_tag LOCUS_06580 gene flgB 62070 61657 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941075.1 protein_id gnl|my_center|LOCUS_06580 64724 62292 gene locus_tag LOCUS_06590 64724 62292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 64975 66756 gene locus_tag LOCUS_06600 64975 66756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 66919 67290 gene locus_tag LOCUS_06610 66919 67290 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_06610 67369 67836 gene locus_tag LOCUS_06620 67369 67836 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_06620 67886 68344 gene locus_tag LOCUS_06630 67886 68344 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940808.1 protein_id gnl|my_center|LOCUS_06630 68684 70546 gene locus_tag LOCUS_06640 68684 70546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 71623 70553 gene locus_tag LOCUS_06650 71623 70553 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940154.1 protein_id gnl|my_center|LOCUS_06650 72128 71628 gene locus_tag LOCUS_06660 72128 71628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 72674 72853 gene locus_tag LOCUS_06670 72674 72853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 74248 72869 gene locus_tag LOCUS_06680 74248 72869 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073841.1 protein_id gnl|my_center|LOCUS_06680 76329 74527 gene locus_tag LOCUS_06690 gene ftsH 76329 74527 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938574.1 protein_id gnl|my_center|LOCUS_06690 77420 78613 gene locus_tag LOCUS_06700 gene nrfD 77420 78613 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762020.1 protein_id gnl|my_center|LOCUS_06700 78697 79140 gene locus_tag LOCUS_06710 78697 79140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 82062 79651 gene locus_tag LOCUS_06720 82062 79651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 83140 83895 gene locus_tag LOCUS_06730 83140 83895 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070833.1 protein_id gnl|my_center|LOCUS_06730 83915 84607 gene locus_tag LOCUS_06740 83915 84607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 86852 85659 gene locus_tag LOCUS_06750 86852 85659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 88108 87191 gene locus_tag LOCUS_06760 88108 87191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 89918 88092 gene locus_tag LOCUS_06770 gene ftsH 89918 88092 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_06770 90413 90183 gene locus_tag LOCUS_06780 90413 90183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 90757 90894 gene locus_tag LOCUS_06790 90757 90894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence078 >Feature sequence079 >Feature sequence080 >Feature sequence081 >Feature sequence082 >Feature sequence083 >Feature sequence084 >Feature sequence085 >Feature sequence086 >Feature sequence087 >Feature sequence088 1014 139 gene locus_tag LOCUS_06800 1014 139 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217633758.1 protein_id gnl|my_center|LOCUS_06800 1517 1026 gene locus_tag LOCUS_06810 1517 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 1893 2828 gene locus_tag LOCUS_06820 1893 2828 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_06820 3387 4157 gene locus_tag LOCUS_06830 3387 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 4177 5838 gene locus_tag LOCUS_06840 gene betA 4177 5838 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 protein_id gnl|my_center|LOCUS_06840 5849 7324 gene locus_tag LOCUS_06850 gene betB 5849 7324 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243430.1 protein_id gnl|my_center|LOCUS_06850 7379 8332 gene locus_tag LOCUS_06860 7379 8332 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104841.1 protein_id gnl|my_center|LOCUS_06860 8404 10878 gene locus_tag LOCUS_06870 8404 10878 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047729.1 protein_id gnl|my_center|LOCUS_06870 11034 12530 gene locus_tag LOCUS_06880 gene glpK 11034 12530 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113887.1 protein_id gnl|my_center|LOCUS_06880 12883 12569 gene locus_tag LOCUS_06890 12883 12569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 13148 14704 gene locus_tag LOCUS_06900 gene sbtM 13148 14704 CDS product thio(seleno)oxazole modification radical SAM maturase SbtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045007.1 protein_id gnl|my_center|LOCUS_06900 15540 14875 gene locus_tag LOCUS_06910 15540 14875 CDS product dimethylsulfonioproprionate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336734.1 protein_id gnl|my_center|LOCUS_06910 15615 15953 gene locus_tag LOCUS_06920 15615 15953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 16538 15963 gene locus_tag LOCUS_06930 16538 15963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 17783 16902 gene locus_tag LOCUS_06940 17783 16902 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_06940 19811 18051 gene locus_tag LOCUS_06950 19811 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 20884 24516 gene locus_tag LOCUS_06960 20884 24516 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 protein_id gnl|my_center|LOCUS_06960 24583 24768 gene locus_tag LOCUS_06970 24583 24768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 24863 25654 gene locus_tag LOCUS_06980 24863 25654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 26653 26279 gene locus_tag LOCUS_06990 26653 26279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 27656 27045 gene locus_tag LOCUS_07000 27656 27045 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 protein_id gnl|my_center|LOCUS_07000 27837 29468 gene locus_tag LOCUS_07010 gene hcp 27837 29468 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791786.1 protein_id gnl|my_center|LOCUS_07010 29593 30219 gene locus_tag LOCUS_07020 29593 30219 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938888.1 protein_id gnl|my_center|LOCUS_07020 30254 30997 gene locus_tag LOCUS_07030 30254 30997 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_07030 31190 31690 gene locus_tag LOCUS_07040 31190 31690 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_07040 32076 32708 gene locus_tag LOCUS_07050 32076 32708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 33251 32892 gene locus_tag LOCUS_07060 33251 32892 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_07060 33649 33275 gene locus_tag LOCUS_07070 33649 33275 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388948.1 protein_id gnl|my_center|LOCUS_07070 34801 33896 gene locus_tag LOCUS_07080 34801 33896 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_07080 35774 34932 gene locus_tag LOCUS_07090 35774 34932 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_07090 36172 35771 gene locus_tag LOCUS_07100 36172 35771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 37109 36576 gene locus_tag LOCUS_07110 37109 36576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 38657 37275 gene locus_tag LOCUS_07120 gene orpR 38657 37275 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_07120 39049 39393 gene locus_tag LOCUS_07130 39049 39393 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948112.1 protein_id gnl|my_center|LOCUS_07130 39386 40102 gene locus_tag LOCUS_07140 39386 40102 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784312.1 protein_id gnl|my_center|LOCUS_07140 42663 40258 gene locus_tag LOCUS_07150 42663 40258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 43731 42889 gene locus_tag LOCUS_07160 43731 42889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 45017 43782 gene locus_tag LOCUS_07170 45017 43782 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_07170 45702 45061 gene locus_tag LOCUS_07180 45702 45061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 46031 46978 gene locus_tag LOCUS_07190 46031 46978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 46975 48447 gene locus_tag LOCUS_07200 46975 48447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07200 48569 48919 gene locus_tag LOCUS_07210 48569 48919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07210 49905 51017 gene locus_tag LOCUS_07220 49905 51017 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_07220 51019 51786 gene locus_tag LOCUS_07230 gene gctB 51019 51786 CDS product glutaconate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902656.1 protein_id gnl|my_center|LOCUS_07230 52147 55791 gene locus_tag LOCUS_07240 52147 55791 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940330.1 protein_id gnl|my_center|LOCUS_07240 56066 57082 gene locus_tag LOCUS_07250 56066 57082 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940064.1 protein_id gnl|my_center|LOCUS_07250 57084 58433 gene locus_tag LOCUS_07260 57084 58433 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_07260 58480 59688 gene locus_tag LOCUS_07270 58480 59688 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337389.1 protein_id gnl|my_center|LOCUS_07270 59681 60466 gene locus_tag LOCUS_07280 59681 60466 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208715.1 protein_id gnl|my_center|LOCUS_07280 60459 61082 gene locus_tag LOCUS_07290 60459 61082 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092895.1 protein_id gnl|my_center|LOCUS_07290 61082 61684 gene locus_tag LOCUS_07300 gene nqrE 61082 61684 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_07300 61747 62970 gene locus_tag LOCUS_07310 gene nqrF 61747 62970 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_07310 63535 63804 gene locus_tag LOCUS_07320 63535 63804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 63838 64983 gene locus_tag LOCUS_07330 63838 64983 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 protein_id gnl|my_center|LOCUS_07330 64988 65836 gene locus_tag LOCUS_07340 64988 65836 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870041.1 protein_id gnl|my_center|LOCUS_07340 65879 66478 gene locus_tag LOCUS_07350 65879 66478 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496537.1 protein_id gnl|my_center|LOCUS_07350 66478 69876 gene locus_tag LOCUS_07360 66478 69876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 69869 71473 gene locus_tag LOCUS_07370 69869 71473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 71545 72174 gene locus_tag LOCUS_07380 71545 72174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07380 72190 73974 gene locus_tag LOCUS_07390 72190 73974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07390 74245 74775 gene locus_tag LOCUS_07400 74245 74775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 75131 75643 gene locus_tag LOCUS_07410 75131 75643 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 protein_id gnl|my_center|LOCUS_07410 75689 76225 gene locus_tag LOCUS_07420 75689 76225 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082414.1 protein_id gnl|my_center|LOCUS_07420 76983 76267 gene locus_tag LOCUS_07430 76983 76267 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792492.1 protein_id gnl|my_center|LOCUS_07430 78307 77381 gene locus_tag LOCUS_07440 78307 77381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 78496 79041 gene locus_tag LOCUS_07450 78496 79041 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107707.1 protein_id gnl|my_center|LOCUS_07450 80111 79173 gene locus_tag LOCUS_07460 80111 79173 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203335.1 protein_id gnl|my_center|LOCUS_07460 84251 81237 gene locus_tag LOCUS_07470 84251 81237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 85505 84282 gene locus_tag LOCUS_07480 85505 84282 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528574.1 protein_id gnl|my_center|LOCUS_07480 85947 86186 gene locus_tag LOCUS_07490 85947 86186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence089 >Feature sequence090 >Feature sequence091 >Feature sequence092 >Feature sequence093 >Feature sequence094 >Feature sequence095 >Feature sequence096 >Feature sequence097 >Feature sequence098 >Feature sequence099 580 1023 gene locus_tag LOCUS_07500 580 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 1122 1940 gene locus_tag LOCUS_07510 1122 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 2024 2203 gene locus_tag LOCUS_07520 2024 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 2337 2753 gene locus_tag LOCUS_07530 2337 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2768 3511 gene locus_tag LOCUS_07540 2768 3511 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861855.1 protein_id gnl|my_center|LOCUS_07540 3801 4034 gene locus_tag LOCUS_07550 3801 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 4018 4191 gene locus_tag LOCUS_07560 4018 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 4602 5756 gene locus_tag LOCUS_07570 gene solA 4602 5756 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_07570 5858 6154 gene locus_tag LOCUS_07580 5858 6154 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006027262.1 protein_id gnl|my_center|LOCUS_07580 6158 6460 gene locus_tag LOCUS_07590 6158 6460 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202809.1 protein_id gnl|my_center|LOCUS_07590 6806 7543 gene locus_tag LOCUS_07600 6806 7543 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440107.1 protein_id gnl|my_center|LOCUS_07600 7689 8714 gene locus_tag LOCUS_07610 7689 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 9530 10708 gene locus_tag LOCUS_07620 9530 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 11786 12064 gene locus_tag LOCUS_07630 11786 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 12151 12498 gene locus_tag LOCUS_07640 12151 12498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 12507 13487 gene locus_tag LOCUS_07650 12507 13487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 13645 14571 gene locus_tag LOCUS_07660 13645 14571 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045033.1 protein_id gnl|my_center|LOCUS_07660 14782 15675 gene locus_tag LOCUS_07670 14782 15675 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206713.1 protein_id gnl|my_center|LOCUS_07670 15732 16475 gene locus_tag LOCUS_07680 15732 16475 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444858.1 protein_id gnl|my_center|LOCUS_07680 16444 17928 gene locus_tag LOCUS_07690 16444 17928 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_07690 17925 19157 gene locus_tag LOCUS_07700 17925 19157 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444859.1 protein_id gnl|my_center|LOCUS_07700 19150 19887 gene locus_tag LOCUS_07710 19150 19887 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_07710 21017 20127 gene locus_tag LOCUS_07720 gene htpX 21017 20127 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090915.1 protein_id gnl|my_center|LOCUS_07720 20959 21168 gene locus_tag LOCUS_07730 20959 21168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 22344 21343 gene locus_tag LOCUS_07740 22344 21343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 22986 22441 gene locus_tag LOCUS_07750 22986 22441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 25122 23263 gene locus_tag LOCUS_07760 25122 23263 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_07760 28300 25403 gene locus_tag LOCUS_07770 28300 25403 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_07770 29069 28425 gene locus_tag LOCUS_07780 gene lipB 29069 28425 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 protein_id gnl|my_center|LOCUS_07780 29380 29135 gene locus_tag LOCUS_07790 29380 29135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 30597 29377 gene locus_tag LOCUS_07800 30597 29377 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404704.1 protein_id gnl|my_center|LOCUS_07800 31588 30590 gene locus_tag LOCUS_07810 31588 30590 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_07810 32562 31585 gene locus_tag LOCUS_07820 gene pdhA 32562 31585 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_07820 34322 32559 gene locus_tag LOCUS_07830 gene acsA 34322 32559 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 protein_id gnl|my_center|LOCUS_07830 35506 34976 gene locus_tag LOCUS_07840 35506 34976 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938827.1 protein_id gnl|my_center|LOCUS_07840 36045 35506 gene locus_tag LOCUS_07850 36045 35506 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938826.1 protein_id gnl|my_center|LOCUS_07850 37276 36128 gene locus_tag LOCUS_07860 37276 36128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933801.1 protein_id gnl|my_center|LOCUS_07860 37539 38555 gene locus_tag LOCUS_07870 37539 38555 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_07870 38471 38665 gene locus_tag LOCUS_07880 38471 38665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 39000 38770 gene locus_tag LOCUS_07890 39000 38770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 39326 39018 gene locus_tag LOCUS_07900 39326 39018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 39718 39425 gene locus_tag LOCUS_07910 39718 39425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 40301 41440 gene locus_tag LOCUS_07920 40301 41440 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939231.1 protein_id gnl|my_center|LOCUS_07920 41453 42283 gene locus_tag LOCUS_07930 41453 42283 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939232.1 protein_id gnl|my_center|LOCUS_07930 42292 42885 gene locus_tag LOCUS_07940 42292 42885 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_07940 42886 43470 gene locus_tag LOCUS_07950 42886 43470 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_07950 43793 43978 gene locus_tag LOCUS_07960 43793 43978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 44051 44662 gene locus_tag LOCUS_07970 44051 44662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 45833 44787 gene locus_tag LOCUS_07980 gene rlmN 45833 44787 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_07980 46780 45911 gene locus_tag LOCUS_07990 46780 45911 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965718.1 protein_id gnl|my_center|LOCUS_07990 48029 46947 gene locus_tag LOCUS_08000 gene serC 48029 46947 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_08000 48691 48221 gene locus_tag LOCUS_08010 48691 48221 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_08010 49152 50429 gene locus_tag LOCUS_08020 49152 50429 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_08020 50434 52026 gene locus_tag LOCUS_08030 gene cimA 50434 52026 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_08030 52010 52528 gene locus_tag LOCUS_08040 52010 52528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 52525 53508 gene locus_tag LOCUS_08050 gene miaA 52525 53508 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_08050 53505 55289 gene locus_tag LOCUS_08060 gene recJ 53505 55289 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_08060 55619 57061 gene locus_tag LOCUS_08070 gene purB 55619 57061 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_08070 57088 57372 gene locus_tag LOCUS_08080 57088 57372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 57365 58720 gene locus_tag LOCUS_08090 gene miaB 57365 58720 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_08090 58761 59414 gene locus_tag LOCUS_08100 58761 59414 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_08100 59499 60368 gene locus_tag LOCUS_08110 59499 60368 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986530.1 protein_id gnl|my_center|LOCUS_08110 61014 61928 gene locus_tag LOCUS_08120 61014 61928 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_08120 61925 64096 gene locus_tag LOCUS_08130 61925 64096 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 protein_id gnl|my_center|LOCUS_08130 64253 66643 gene locus_tag LOCUS_08140 64253 66643 CDS product sucrose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056890.1 protein_id gnl|my_center|LOCUS_08140 67739 66888 gene locus_tag LOCUS_08150 67739 66888 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217768.1 protein_id gnl|my_center|LOCUS_08150 68022 67762 gene locus_tag LOCUS_08160 68022 67762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 69103 68069 gene locus_tag LOCUS_08170 69103 68069 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_08170 69740 72343 gene locus_tag LOCUS_08180 gene pepN 69740 72343 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940973.1 protein_id gnl|my_center|LOCUS_08180 72532 73563 gene locus_tag LOCUS_08190 72532 73563 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_08190 73719 75362 gene locus_tag LOCUS_08200 73719 75362 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_08200 75369 76460 gene locus_tag LOCUS_08210 75369 76460 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388525.1 protein_id gnl|my_center|LOCUS_08210 77850 76360 gene locus_tag LOCUS_08220 77850 76360 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_08220 78821 78264 gene locus_tag LOCUS_08230 78821 78264 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_08230 80839 78884 gene locus_tag LOCUS_08240 gene nadN 80839 78884 CDS product NAD nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868956.1 protein_id gnl|my_center|LOCUS_08240 81135 81440 gene locus_tag LOCUS_08250 81135 81440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence100 >Feature sequence101 >Feature sequence102 >Feature sequence103 >Feature sequence104 >Feature sequence105 >Feature sequence106 >Feature sequence107 >Feature sequence108 >Feature sequence109 >Feature sequence110 5781 3850 gene locus_tag LOCUS_08260 gene glgB 5781 3850 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_08260 6597 6088 gene locus_tag LOCUS_08270 6597 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 7579 6893 gene locus_tag LOCUS_08280 7579 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 7861 7607 gene locus_tag LOCUS_08290 7861 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 8748 7858 gene locus_tag LOCUS_08300 gene rsmA 8748 7858 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_08300 9758 8754 gene locus_tag LOCUS_08310 gene tsaD 9758 8754 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_08310 9867 10913 gene locus_tag LOCUS_08320 gene moaA 9867 10913 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_08320 12745 10910 gene locus_tag LOCUS_08330 12745 10910 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814586.1 protein_id gnl|my_center|LOCUS_08330 13869 12766 gene locus_tag LOCUS_08340 gene pheA 13869 12766 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_08340 14494 14760 gene locus_tag LOCUS_08350 14494 14760 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_08350 15205 16503 gene locus_tag LOCUS_08360 15205 16503 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_08360 16753 16953 gene locus_tag LOCUS_08370 16753 16953 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292860.1 protein_id gnl|my_center|LOCUS_08370 17043 17198 gene locus_tag LOCUS_08380 17043 17198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 19043 17469 gene locus_tag LOCUS_08390 19043 17469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 19432 20325 gene locus_tag LOCUS_08400 19432 20325 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140474.1 protein_id gnl|my_center|LOCUS_08400 20325 21365 gene locus_tag LOCUS_08410 20325 21365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 21362 22699 gene locus_tag LOCUS_08420 gene der 21362 22699 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_08420 23544 23065 gene locus_tag LOCUS_08430 23544 23065 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689851.1 protein_id gnl|my_center|LOCUS_08430 26440 23756 gene locus_tag LOCUS_08440 26440 23756 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120353.1 protein_id gnl|my_center|LOCUS_08440 27178 28593 gene locus_tag LOCUS_08450 27178 28593 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205436.1 protein_id gnl|my_center|LOCUS_08450 28614 29414 gene locus_tag LOCUS_08460 28614 29414 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 protein_id gnl|my_center|LOCUS_08460 30274 30825 gene locus_tag LOCUS_08470 30274 30825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 31005 31193 gene locus_tag LOCUS_08480 31005 31193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 31190 32641 gene locus_tag LOCUS_08490 31190 32641 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_08490 33208 32870 gene locus_tag LOCUS_08500 33208 32870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 33092 33358 gene locus_tag LOCUS_08510 33092 33358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 33589 33380 gene locus_tag LOCUS_08520 33589 33380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 33567 34601 gene locus_tag LOCUS_08530 33567 34601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 34905 35564 gene locus_tag LOCUS_08540 34905 35564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 35716 36378 gene locus_tag LOCUS_08550 35716 36378 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_08550 38447 36522 gene locus_tag LOCUS_08560 gene selB 38447 36522 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_08560 39127 38495 gene locus_tag LOCUS_08570 39127 38495 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_08570 40145 39195 gene locus_tag LOCUS_08580 40145 39195 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545002.1 protein_id gnl|my_center|LOCUS_08580 40633 41079 gene locus_tag LOCUS_08590 40633 41079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 41083 43461 gene locus_tag LOCUS_08600 gene lon 41083 43461 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_08600 43461 44957 gene locus_tag LOCUS_08610 43461 44957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 45137 45982 gene locus_tag LOCUS_08620 45137 45982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 46155 47339 gene locus_tag LOCUS_08630 46155 47339 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_08630 47495 47779 gene locus_tag LOCUS_08640 47495 47779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 49240 47888 gene locus_tag LOCUS_08650 gene glmM 49240 47888 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_08650 50248 49313 gene locus_tag LOCUS_08660 50248 49313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 51044 50232 gene locus_tag LOCUS_08670 gene cdaA 51044 50232 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_08670 51381 51974 gene locus_tag LOCUS_08680 51381 51974 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_08680 52228 52614 gene locus_tag LOCUS_08690 52228 52614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 53617 53919 gene locus_tag LOCUS_08700 53617 53919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 53944 54309 gene locus_tag LOCUS_08710 53944 54309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 54336 55073 gene locus_tag LOCUS_08720 54336 55073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 55078 55740 gene locus_tag LOCUS_08730 55078 55740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08730 55879 56244 gene locus_tag LOCUS_08740 55879 56244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 57367 56351 gene locus_tag LOCUS_08750 57367 56351 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_08750 58572 57364 gene locus_tag LOCUS_08760 58572 57364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 58835 58762 gene locus_tag LOCUS_t00080 58835 58762 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 59846 59040 gene locus_tag LOCUS_08770 gene amrB 59846 59040 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942474.1 protein_id gnl|my_center|LOCUS_08770 61469 60006 gene locus_tag LOCUS_08780 gene cysS 61469 60006 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_08780 63013 61784 gene locus_tag LOCUS_08790 63013 61784 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198303.1 protein_id gnl|my_center|LOCUS_08790 64984 63737 gene locus_tag LOCUS_08800 64984 63737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 65209 66315 gene locus_tag LOCUS_08810 gene mutY 65209 66315 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629788.1 protein_id gnl|my_center|LOCUS_08810 66475 67998 gene locus_tag LOCUS_08820 66475 67998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 69691 68114 gene locus_tag LOCUS_08830 69691 68114 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_08830 70605 69691 gene locus_tag LOCUS_08840 70605 69691 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_08840 71021 72679 gene locus_tag LOCUS_08850 71021 72679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 72855 74159 gene locus_tag LOCUS_08860 72855 74159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 74558 75574 gene locus_tag LOCUS_08870 gene amrS 74558 75574 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_08870 75839 76441 gene locus_tag LOCUS_08880 75839 76441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 76698 77198 gene locus_tag LOCUS_08890 76698 77198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 77341 77153 gene locus_tag LOCUS_08900 77341 77153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 77714 78037 gene locus_tag LOCUS_08910 77714 78037 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_08910 78389 78547 gene locus_tag LOCUS_08920 78389 78547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 78544 78900 gene locus_tag LOCUS_08930 78544 78900 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence111 776 1048 gene locus_tag LOCUS_08940 776 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1248 1775 gene locus_tag LOCUS_08950 1248 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 2278 1913 gene locus_tag LOCUS_08960 2278 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 2278 2631 gene locus_tag LOCUS_08970 2278 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 2854 2684 gene locus_tag LOCUS_08980 2854 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3006 3263 gene locus_tag LOCUS_08990 3006 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 3260 3733 gene locus_tag LOCUS_09000 3260 3733 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_09000 4072 4374 gene locus_tag LOCUS_09010 4072 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09010 5821 4508 gene locus_tag LOCUS_09020 5821 4508 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_09020 6043 6720 gene locus_tag LOCUS_09030 6043 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 6707 7570 gene locus_tag LOCUS_09040 6707 7570 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068063.1 protein_id gnl|my_center|LOCUS_09040 7854 8570 gene locus_tag LOCUS_09050 7854 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 8778 9113 gene locus_tag LOCUS_09060 8778 9113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 9181 9447 gene locus_tag LOCUS_09070 9181 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 9444 9761 gene locus_tag LOCUS_09080 9444 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 9981 10262 gene locus_tag LOCUS_09090 9981 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 10243 10515 gene locus_tag LOCUS_09100 10243 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 11034 11483 gene locus_tag LOCUS_09110 11034 11483 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208381.1 protein_id gnl|my_center|LOCUS_09110 13201 12008 gene locus_tag LOCUS_09120 13201 12008 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_09120 14047 15480 gene locus_tag LOCUS_09130 14047 15480 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766752.1 protein_id gnl|my_center|LOCUS_09130 16010 15720 gene locus_tag LOCUS_09140 16010 15720 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_09140 16240 16007 gene locus_tag LOCUS_09150 16240 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 16537 16755 gene locus_tag LOCUS_09160 16537 16755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 16758 17882 gene locus_tag LOCUS_09170 16758 17882 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 protein_id gnl|my_center|LOCUS_09170 17892 19409 gene locus_tag LOCUS_09180 17892 19409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 19669 19974 gene locus_tag LOCUS_09190 19669 19974 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392518.1 protein_id gnl|my_center|LOCUS_09190 20281 20679 gene locus_tag LOCUS_09200 20281 20679 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548117.1 protein_id gnl|my_center|LOCUS_09200 20760 21365 gene locus_tag LOCUS_09210 20760 21365 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_09210 21404 24211 gene locus_tag LOCUS_09220 21404 24211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 24809 24561 gene locus_tag LOCUS_09230 24809 24561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 25964 24927 gene locus_tag LOCUS_09240 25964 24927 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524778.1 protein_id gnl|my_center|LOCUS_09240 27009 25966 gene locus_tag LOCUS_09250 27009 25966 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191693.1 protein_id gnl|my_center|LOCUS_09250 27571 27158 gene locus_tag LOCUS_09260 27571 27158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 29342 27723 gene locus_tag LOCUS_09270 29342 27723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 29250 29582 gene locus_tag LOCUS_09280 29250 29582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 30743 30219 gene locus_tag LOCUS_09290 30743 30219 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_09290 31458 30715 gene locus_tag LOCUS_09300 31458 30715 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_09300 33008 31464 gene locus_tag LOCUS_09310 33008 31464 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_09310 34202 33018 gene locus_tag LOCUS_09320 gene argJ 34202 33018 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_09320 34769 36229 gene locus_tag LOCUS_09330 gene cls 34769 36229 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705220.1 protein_id gnl|my_center|LOCUS_09330 36251 36967 gene locus_tag LOCUS_09340 36251 36967 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249618.1 protein_id gnl|my_center|LOCUS_09340 37597 37187 gene locus_tag LOCUS_09350 37597 37187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938912.1 protein_id gnl|my_center|LOCUS_09350 38012 38917 gene locus_tag LOCUS_09360 gene ppk2 38012 38917 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_09360 41587 39029 gene locus_tag LOCUS_09370 gene secA 41587 39029 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938126.1 protein_id gnl|my_center|LOCUS_09370 42161 41667 gene locus_tag LOCUS_09380 42161 41667 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_09380 42858 42550 gene locus_tag LOCUS_09390 42858 42550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 44935 43283 gene locus_tag LOCUS_09400 gene argS 44935 43283 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403746.1 protein_id gnl|my_center|LOCUS_09400 46238 45114 gene locus_tag LOCUS_09410 gene alr 46238 45114 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_09410 47265 47080 gene locus_tag LOCUS_09420 47265 47080 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_09420 47725 48060 gene locus_tag LOCUS_09430 47725 48060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 48140 49054 gene locus_tag LOCUS_09440 48140 49054 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667127.1 protein_id gnl|my_center|LOCUS_09440 49402 49130 gene locus_tag LOCUS_09450 49402 49130 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791188.1 protein_id gnl|my_center|LOCUS_09450 50386 49586 gene locus_tag LOCUS_09460 gene larE 50386 49586 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584116.1 protein_id gnl|my_center|LOCUS_09460 50363 50590 gene locus_tag LOCUS_09470 50363 50590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 51455 50676 gene locus_tag LOCUS_09480 51455 50676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 52067 52894 gene locus_tag LOCUS_09490 52067 52894 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657519.1 protein_id gnl|my_center|LOCUS_09490 56277 52960 gene locus_tag LOCUS_09500 56277 52960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 57374 56274 gene locus_tag LOCUS_09510 gene mexC 57374 56274 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003116286.1 protein_id gnl|my_center|LOCUS_09510 58390 57779 gene locus_tag LOCUS_09520 58390 57779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 58936 59574 gene locus_tag LOCUS_09530 gene pdxH 58936 59574 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705310.1 protein_id gnl|my_center|LOCUS_09530 59574 61040 gene locus_tag LOCUS_09540 59574 61040 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_09540 61277 62536 gene locus_tag LOCUS_09550 61277 62536 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020586886.1 protein_id gnl|my_center|LOCUS_09550 62533 63789 gene locus_tag LOCUS_09560 gene larA 62533 63789 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943907.1 protein_id gnl|my_center|LOCUS_09560 64084 65436 gene locus_tag LOCUS_09570 64084 65436 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_09570 65486 66331 gene locus_tag LOCUS_09580 gene ccsB 65486 66331 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_09580 66606 67001 gene locus_tag LOCUS_09590 66606 67001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 69318 67234 gene locus_tag LOCUS_09600 gene glyS 69318 67234 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_09600 70226 69462 gene locus_tag LOCUS_09610 gene folE2 70226 69462 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_09610 70596 70240 gene locus_tag LOCUS_09620 70596 70240 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546385.1 protein_id gnl|my_center|LOCUS_09620 71604 70606 gene locus_tag LOCUS_09630 gene galT 71604 70606 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_09630 71975 71613 gene locus_tag LOCUS_09640 gene dksA 71975 71613 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_09640 72622 72137 gene locus_tag LOCUS_09650 gene moaC 72622 72137 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_09650 73766 72615 gene locus_tag LOCUS_09660 gene dnaJ 73766 72615 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940501.1 protein_id gnl|my_center|LOCUS_09660 74060 73794 gene locus_tag LOCUS_09670 74060 73794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 75819 74515 gene locus_tag LOCUS_09680 75819 74515 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462314.1 protein_id gnl|my_center|LOCUS_09680 76458 76916 gene locus_tag LOCUS_09690 76458 76916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 76909 77652 gene locus_tag LOCUS_09700 gene tatC 76909 77652 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704121.1 protein_id gnl|my_center|LOCUS_09700 77949 79997 gene locus_tag LOCUS_09710 77949 79997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 81373 80348 gene locus_tag LOCUS_09720 81373 80348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 81982 81464 gene locus_tag LOCUS_09730 gene tadA 81982 81464 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837601.1 protein_id gnl|my_center|LOCUS_09730 83587 82304 gene locus_tag LOCUS_09740 83587 82304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 84823 83681 gene locus_tag LOCUS_09750 84823 83681 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_09750 85399 85881 gene locus_tag LOCUS_09760 85399 85881 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930802.1 protein_id gnl|my_center|LOCUS_09760 86846 85998 gene locus_tag LOCUS_09770 86846 85998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09770 87682 86843 gene locus_tag LOCUS_09780 87682 86843 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939573.1 protein_id gnl|my_center|LOCUS_09780 88856 87669 gene locus_tag LOCUS_09790 88856 87669 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814530.1 protein_id gnl|my_center|LOCUS_09790 89185 89535 gene locus_tag LOCUS_09800 89185 89535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 90949 89711 gene locus_tag LOCUS_09810 90949 89711 CDS product 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791484.1 protein_id gnl|my_center|LOCUS_09810 91476 91102 gene locus_tag LOCUS_09820 91476 91102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 93033 91936 gene locus_tag LOCUS_09830 gene aroB 93033 91936 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070659.1 protein_id gnl|my_center|LOCUS_09830 94632 93352 gene locus_tag LOCUS_09840 gene sat 94632 93352 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938590.1 protein_id gnl|my_center|LOCUS_09840 95484 95951 gene locus_tag LOCUS_09850 95484 95951 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403528.1 protein_id gnl|my_center|LOCUS_09850 95956 96648 gene locus_tag LOCUS_09860 95956 96648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 96649 97131 gene locus_tag LOCUS_09870 96649 97131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 97150 97695 gene locus_tag LOCUS_09880 97150 97695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 98030 103390 gene locus_tag LOCUS_09890 98030 103390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 104977 103589 gene locus_tag LOCUS_09900 104977 103589 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_09900 106045 105602 gene locus_tag LOCUS_09910 106045 105602 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412347.1 protein_id gnl|my_center|LOCUS_09910 107533 106139 gene locus_tag LOCUS_09920 107533 106139 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_09920 109093 107573 gene locus_tag LOCUS_09930 109093 107573 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_09930 111020 109107 gene locus_tag LOCUS_09940 gene nuoL 111020 109107 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_09940 111321 111025 gene locus_tag LOCUS_09950 gene nuoK 111321 111025 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964311.1 protein_id gnl|my_center|LOCUS_09950 111827 111318 gene locus_tag LOCUS_09960 111827 111318 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329056.1 protein_id gnl|my_center|LOCUS_09960 112356 111832 gene locus_tag LOCUS_09970 gene nuoI 112356 111832 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941014.1 protein_id gnl|my_center|LOCUS_09970 113655 112369 gene locus_tag LOCUS_09980 113655 112369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 115204 113642 gene locus_tag LOCUS_09990 115204 113642 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238899.1 protein_id gnl|my_center|LOCUS_09990 116493 115222 gene locus_tag LOCUS_10000 gene nuoF 116493 115222 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_10000 117015 116509 gene locus_tag LOCUS_10010 gene nuoE 117015 116509 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_10010 118727 117012 gene locus_tag LOCUS_10020 gene nuoC 118727 117012 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090458.1 protein_id gnl|my_center|LOCUS_10020 119241 118729 gene locus_tag LOCUS_10030 119241 118729 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524416.1 protein_id gnl|my_center|LOCUS_10030 119591 119232 gene locus_tag LOCUS_10040 119591 119232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 120267 119842 gene locus_tag LOCUS_10050 120267 119842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 121748 120489 gene locus_tag LOCUS_10060 121748 120489 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_10060 122144 121806 gene locus_tag LOCUS_10070 gene glnK 122144 121806 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_10070 122931 123434 gene locus_tag LOCUS_10080 gene hoxE 122931 123434 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943357.1 protein_id gnl|my_center|LOCUS_10080 123424 125046 gene locus_tag LOCUS_10090 123424 125046 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_10090 125043 125762 gene locus_tag LOCUS_10100 gene hoxU 125043 125762 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943355.1 protein_id gnl|my_center|LOCUS_10100 125759 126292 gene locus_tag LOCUS_10110 125759 126292 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_10110 126302 127723 gene locus_tag LOCUS_10120 126302 127723 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_10120 127884 128321 gene locus_tag LOCUS_10130 127884 128321 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544986.1 protein_id gnl|my_center|LOCUS_10130 128367 128744 gene locus_tag LOCUS_10140 gene crcB 128367 128744 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405171.1 protein_id gnl|my_center|LOCUS_10140 129163 129693 gene locus_tag LOCUS_10150 gene coaD 129163 129693 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692360.1 protein_id gnl|my_center|LOCUS_10150 129799 129895 gene locus_tag LOCUS_t00090 129799 129895 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 130732 130022 gene locus_tag LOCUS_10160 gene hypB 130732 130022 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_10160 131123 130737 gene locus_tag LOCUS_10170 131123 130737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 132176 131160 gene locus_tag LOCUS_10180 gene hypE 132176 131160 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940978.1 protein_id gnl|my_center|LOCUS_10180 133316 132189 gene locus_tag LOCUS_10190 gene hypD 133316 132189 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_10190 133591 133307 gene locus_tag LOCUS_10200 133591 133307 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940976.1 protein_id gnl|my_center|LOCUS_10200 135903 133582 gene locus_tag LOCUS_10210 gene hypF 135903 133582 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_10210 136412 136152 gene locus_tag LOCUS_10220 136412 136152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 137907 136558 gene locus_tag LOCUS_10230 137907 136558 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870705.1 protein_id gnl|my_center|LOCUS_10230 138836 137919 gene locus_tag LOCUS_10240 gene mvhG 138836 137919 CDS product F420-non-reducing hydrogenase subunit MvhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876759.1 protein_id gnl|my_center|LOCUS_10240 139269 138826 gene locus_tag LOCUS_10250 139269 138826 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_10250 142370 139266 gene locus_tag LOCUS_10260 142370 139266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 143821 142367 gene locus_tag LOCUS_10270 143821 142367 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392962.1 protein_id gnl|my_center|LOCUS_10270 144363 143818 gene locus_tag LOCUS_10280 gene frhD 144363 143818 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869751.1 protein_id gnl|my_center|LOCUS_10280 144684 145382 gene locus_tag LOCUS_10290 144684 145382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 145697 147976 gene locus_tag LOCUS_10300 145697 147976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 148211 148432 gene locus_tag LOCUS_10310 148211 148432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 148507 149355 gene locus_tag LOCUS_10320 gene speB 148507 149355 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_10320 149440 150300 gene locus_tag LOCUS_10330 149440 150300 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791673.1 protein_id gnl|my_center|LOCUS_10330 150394 151515 gene locus_tag LOCUS_10340 gene potA 150394 151515 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937409.1 protein_id gnl|my_center|LOCUS_10340 151505 152359 gene locus_tag LOCUS_10350 151505 152359 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937408.1 protein_id gnl|my_center|LOCUS_10350 152356 153123 gene locus_tag LOCUS_10360 gene potC 152356 153123 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937407.1 protein_id gnl|my_center|LOCUS_10360 153120 154163 gene locus_tag LOCUS_10370 153120 154163 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261916.1 protein_id gnl|my_center|LOCUS_10370 155377 154193 gene locus_tag LOCUS_10380 155377 154193 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545276.1 protein_id gnl|my_center|LOCUS_10380 156391 155486 gene locus_tag LOCUS_10390 156391 155486 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243723.1 protein_id gnl|my_center|LOCUS_10390 156992 156576 gene locus_tag LOCUS_10400 gene ndk 156992 156576 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941771.1 protein_id gnl|my_center|LOCUS_10400 158333 157170 gene locus_tag LOCUS_10410 158333 157170 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_10410 158809 158552 gene locus_tag LOCUS_10420 158809 158552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 160604 158994 gene locus_tag LOCUS_10430 160604 158994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 162558 161308 gene locus_tag LOCUS_10440 162558 161308 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_10440 163130 164323 gene locus_tag LOCUS_10450 163130 164323 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_10450 164653 164429 gene locus_tag LOCUS_10460 164653 164429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 165045 164731 gene locus_tag LOCUS_10470 165045 164731 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_10470 165277 165038 gene locus_tag LOCUS_10480 165277 165038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 165834 165475 gene locus_tag LOCUS_10490 165834 165475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 166141 165827 gene locus_tag LOCUS_10500 166141 165827 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_10500 166966 166709 gene locus_tag LOCUS_10510 166966 166709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 166853 167224 gene locus_tag LOCUS_10520 166853 167224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 167580 168509 gene locus_tag LOCUS_10530 167580 168509 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045033.1 protein_id gnl|my_center|LOCUS_10530 168550 170250 gene locus_tag LOCUS_10540 168550 170250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 170247 171107 gene locus_tag LOCUS_10550 170247 171107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545016.1 protein_id gnl|my_center|LOCUS_10550 171086 171274 gene locus_tag LOCUS_10560 171086 171274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 171316 171786 gene locus_tag LOCUS_10570 171316 171786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 173315 172344 gene locus_tag LOCUS_10580 gene uvsE 173315 172344 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110499.1 protein_id gnl|my_center|LOCUS_10580 173492 174079 gene locus_tag LOCUS_10590 173492 174079 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 protein_id gnl|my_center|LOCUS_10590 174080 174298 gene locus_tag LOCUS_10600 174080 174298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 174834 174193 gene locus_tag LOCUS_10610 174834 174193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 175015 175626 gene locus_tag LOCUS_10620 175015 175626 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867364.1 protein_id gnl|my_center|LOCUS_10620 175697 176695 gene locus_tag LOCUS_10630 175697 176695 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680714.1 protein_id gnl|my_center|LOCUS_10630 177182 176922 gene locus_tag LOCUS_10640 gene minE 177182 176922 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091581.1 protein_id gnl|my_center|LOCUS_10640 177996 177187 gene locus_tag LOCUS_10650 gene minD 177996 177187 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091579.1 protein_id gnl|my_center|LOCUS_10650 179214 178357 gene locus_tag LOCUS_10660 gene minC 179214 178357 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042146.1 protein_id gnl|my_center|LOCUS_10660 179793 179563 gene locus_tag LOCUS_10670 179793 179563 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_10670 181173 179875 gene locus_tag LOCUS_10680 181173 179875 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_10680 181566 181231 gene locus_tag LOCUS_10690 181566 181231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 181847 182851 gene locus_tag LOCUS_10700 181847 182851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 182873 183655 gene locus_tag LOCUS_10710 182873 183655 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_10710 184152 185336 gene locus_tag LOCUS_10720 184152 185336 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966157.1 protein_id gnl|my_center|LOCUS_10720 185431 187197 gene locus_tag LOCUS_10730 gene pabB 185431 187197 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_10730 188443 187280 gene locus_tag LOCUS_10740 188443 187280 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140822.1 protein_id gnl|my_center|LOCUS_10740 189839 188706 gene locus_tag LOCUS_10750 189839 188706 CDS product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389740.1 protein_id gnl|my_center|LOCUS_10750 191600 189840 gene locus_tag LOCUS_10760 gene ngg 191600 189840 CDS product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389741.1 protein_id gnl|my_center|LOCUS_10760 193304 191610 gene locus_tag LOCUS_10770 193304 191610 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975341.1 protein_id gnl|my_center|LOCUS_10770 194285 194833 gene locus_tag LOCUS_10780 194285 194833 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_10780 195108 196142 gene locus_tag LOCUS_10790 gene rtcA 195108 196142 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_10790 196269 196499 gene locus_tag LOCUS_10800 196269 196499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 196529 196792 gene locus_tag LOCUS_10810 196529 196792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 197420 196962 gene locus_tag LOCUS_10820 197420 196962 CDS product cytochrome C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930463.1 protein_id gnl|my_center|LOCUS_10820 199104 197740 gene locus_tag LOCUS_10830 199104 197740 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_10830 199376 199789 gene locus_tag LOCUS_10840 199376 199789 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811442.1 protein_id gnl|my_center|LOCUS_10840 200196 199885 gene locus_tag LOCUS_10850 200196 199885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 201139 200198 gene locus_tag LOCUS_10860 201139 200198 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306982.1 protein_id gnl|my_center|LOCUS_10860 201803 201219 gene locus_tag LOCUS_10870 gene iorB 201803 201219 CDS product indolepyruvate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877455.1 protein_id gnl|my_center|LOCUS_10870 203659 201800 gene locus_tag LOCUS_10880 gene iorA 203659 201800 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939237.1 protein_id gnl|my_center|LOCUS_10880 204321 203797 gene locus_tag LOCUS_10890 gene purE 204321 203797 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032812361.1 protein_id gnl|my_center|LOCUS_10890 205026 204598 gene locus_tag LOCUS_10900 205026 204598 CDS product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831496.1 protein_id gnl|my_center|LOCUS_10900 206040 205030 gene locus_tag LOCUS_10910 206040 205030 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940050.1 protein_id gnl|my_center|LOCUS_10910 208135 206396 gene locus_tag LOCUS_10920 208135 206396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 208950 208330 gene locus_tag LOCUS_10930 208950 208330 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 protein_id gnl|my_center|LOCUS_10930 209971 210366 gene locus_tag LOCUS_10940 209971 210366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 210380 210850 gene locus_tag LOCUS_10950 210380 210850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 210935 211315 gene locus_tag LOCUS_10960 210935 211315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 211775 213118 gene locus_tag LOCUS_10970 211775 213118 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_10970 213093 213287 gene locus_tag LOCUS_10980 213093 213287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 214220 213600 gene locus_tag LOCUS_10990 214220 213600 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 protein_id gnl|my_center|LOCUS_10990 214783 214472 gene locus_tag LOCUS_11000 214783 214472 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 protein_id gnl|my_center|LOCUS_11000 223866 215092 gene locus_tag LOCUS_11010 223866 215092 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 protein_id gnl|my_center|LOCUS_11010 224256 223900 gene locus_tag LOCUS_11020 224256 223900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 224505 224762 gene locus_tag LOCUS_11030 224505 224762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 226529 224823 gene locus_tag LOCUS_11040 226529 224823 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_11040 228265 226526 gene locus_tag LOCUS_11050 228265 226526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 228812 230197 gene locus_tag LOCUS_11060 228812 230197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence112 >Feature sequence113 >Feature sequence114 >Feature sequence115 >Feature sequence116 >Feature sequence117 >Feature sequence118 >Feature sequence119 >Feature sequence120 >Feature sequence121 >Feature sequence122 2232 760 gene locus_tag LOCUS_11070 2232 760 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982234.1 protein_id gnl|my_center|LOCUS_11070 3047 2229 gene locus_tag LOCUS_11080 3047 2229 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435787.1 protein_id gnl|my_center|LOCUS_11080 3982 3044 gene locus_tag LOCUS_11090 3982 3044 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037471335.1 protein_id gnl|my_center|LOCUS_11090 5502 3979 gene locus_tag LOCUS_11100 5502 3979 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034857493.1 protein_id gnl|my_center|LOCUS_11100 6722 6396 gene locus_tag LOCUS_11110 6722 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 7227 7373 gene locus_tag LOCUS_11120 7227 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 7746 9089 gene locus_tag LOCUS_11130 7746 9089 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944264.1 protein_id gnl|my_center|LOCUS_11130 9870 9445 gene locus_tag LOCUS_11140 9870 9445 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544986.1 protein_id gnl|my_center|LOCUS_11140 11072 9903 gene locus_tag LOCUS_11150 11072 9903 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546088.1 protein_id gnl|my_center|LOCUS_11150 12341 11343 gene locus_tag LOCUS_11160 12341 11343 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_11160 13045 12353 gene locus_tag LOCUS_11170 13045 12353 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_11170 13580 13116 gene locus_tag LOCUS_11180 13580 13116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 13923 13591 gene locus_tag LOCUS_11190 13923 13591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 15073 14204 gene locus_tag LOCUS_11200 15073 14204 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_11200 15703 15092 gene locus_tag LOCUS_11210 15703 15092 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_11210 16822 16250 gene locus_tag LOCUS_11220 gene pgsA 16822 16250 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_11220 17529 16819 gene locus_tag LOCUS_11230 17529 16819 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_11230 18187 17543 gene locus_tag LOCUS_11240 gene fsa 18187 17543 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544952.1 protein_id gnl|my_center|LOCUS_11240 18465 18184 gene locus_tag LOCUS_11250 18465 18184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 19368 18823 gene locus_tag LOCUS_11260 19368 18823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 20215 19406 gene locus_tag LOCUS_11270 gene dapB 20215 19406 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_11270 21136 20252 gene locus_tag LOCUS_11280 gene dapA 21136 20252 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_11280 22238 21399 gene locus_tag LOCUS_11290 gene dapF 22238 21399 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939153.1 protein_id gnl|my_center|LOCUS_11290 23339 22275 gene locus_tag LOCUS_11300 23339 22275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 24742 23336 gene locus_tag LOCUS_11310 gene argH 24742 23336 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_11310 25938 24739 gene locus_tag LOCUS_11320 25938 24739 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940829.1 protein_id gnl|my_center|LOCUS_11320 26909 25986 gene locus_tag LOCUS_11330 gene argF 26909 25986 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_11330 27759 27154 gene locus_tag LOCUS_11340 27759 27154 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_11340 28978 27782 gene locus_tag LOCUS_11350 28978 27782 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940827.1 protein_id gnl|my_center|LOCUS_11350 29859 28975 gene locus_tag LOCUS_11360 gene argB 29859 28975 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_11360 30695 31219 gene locus_tag LOCUS_11370 30695 31219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 31225 31956 gene locus_tag LOCUS_11380 gene lptB 31225 31956 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_11380 32017 33477 gene locus_tag LOCUS_11390 gene rpoN 32017 33477 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_11390 33487 33942 gene locus_tag LOCUS_11400 gene ptsN 33487 33942 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527726.1 protein_id gnl|my_center|LOCUS_11400 35649 34225 gene locus_tag LOCUS_11410 35649 34225 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104160.1 protein_id gnl|my_center|LOCUS_11410 36218 35646 gene locus_tag LOCUS_11420 36218 35646 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937707.1 protein_id gnl|my_center|LOCUS_11420 36805 37737 gene locus_tag LOCUS_11430 gene prmA 36805 37737 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_11430 38402 37782 gene locus_tag LOCUS_11440 38402 37782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 38723 39238 gene locus_tag LOCUS_11450 gene cobO 38723 39238 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666509.1 protein_id gnl|my_center|LOCUS_11450 39510 41021 gene locus_tag LOCUS_11460 39510 41021 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932618.1 protein_id gnl|my_center|LOCUS_11460 41018 42109 gene locus_tag LOCUS_11470 41018 42109 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545158.1 protein_id gnl|my_center|LOCUS_11470 42118 43080 gene locus_tag LOCUS_11480 gene cbiB 42118 43080 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153666.1 protein_id gnl|my_center|LOCUS_11480 43309 43118 gene locus_tag LOCUS_11490 43309 43118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 44623 43349 gene locus_tag LOCUS_11500 44623 43349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 45312 44620 gene locus_tag LOCUS_11510 45312 44620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 45865 45347 gene locus_tag LOCUS_11520 45865 45347 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_11520 46632 47816 gene locus_tag LOCUS_11530 gene fabB 46632 47816 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460738.1 protein_id gnl|my_center|LOCUS_11530 48889 47819 gene locus_tag LOCUS_11540 48889 47819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 49336 48965 gene locus_tag LOCUS_11550 49336 48965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 49891 50613 gene locus_tag LOCUS_11560 49891 50613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 50749 52065 gene locus_tag LOCUS_11570 50749 52065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 52907 52191 gene locus_tag LOCUS_11580 52907 52191 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172597933.1 protein_id gnl|my_center|LOCUS_11580 53970 52912 gene locus_tag LOCUS_11590 53970 52912 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886400.1 protein_id gnl|my_center|LOCUS_11590 54433 55260 gene locus_tag LOCUS_11600 gene nifH 54433 55260 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176593.1 protein_id gnl|my_center|LOCUS_11600 55396 55743 gene locus_tag LOCUS_11610 55396 55743 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176592.1 protein_id gnl|my_center|LOCUS_11610 55740 56114 gene locus_tag LOCUS_11620 55740 56114 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933200.1 protein_id gnl|my_center|LOCUS_11620 56143 57780 gene locus_tag LOCUS_11630 gene nifD 56143 57780 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933201.1 protein_id gnl|my_center|LOCUS_11630 57805 59178 gene locus_tag LOCUS_11640 gene nifK 57805 59178 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933202.1 protein_id gnl|my_center|LOCUS_11640 59260 60417 gene locus_tag LOCUS_11650 gene nifB 59260 60417 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933205.1 protein_id gnl|my_center|LOCUS_11650 60451 60753 gene locus_tag LOCUS_11660 60451 60753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 60770 61213 gene locus_tag LOCUS_11670 60770 61213 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754241.1 protein_id gnl|my_center|LOCUS_11670 61319 61765 gene locus_tag LOCUS_11680 61319 61765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 62609 61875 gene locus_tag LOCUS_11690 62609 61875 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_11690 63172 62711 gene locus_tag LOCUS_11700 63172 62711 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545540.1 protein_id gnl|my_center|LOCUS_11700 65004 63538 gene locus_tag LOCUS_11710 65004 63538 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_11710 66116 65130 gene locus_tag LOCUS_11720 66116 65130 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_11720 66531 66106 gene locus_tag LOCUS_11730 66531 66106 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842401.1 protein_id gnl|my_center|LOCUS_11730 67448 66531 gene locus_tag LOCUS_11740 67448 66531 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022853557.1 protein_id gnl|my_center|LOCUS_11740 67969 67466 gene locus_tag LOCUS_11750 67969 67466 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546510.1 protein_id gnl|my_center|LOCUS_11750 69991 67982 gene locus_tag LOCUS_11760 69991 67982 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546462.1 protein_id gnl|my_center|LOCUS_11760 71088 71909 gene locus_tag LOCUS_11770 71088 71909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 73795 72005 gene locus_tag LOCUS_11780 73795 72005 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870139.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence123 >Feature sequence124 >Feature sequence125 >Feature sequence126 >Feature sequence127 >Feature sequence128 >Feature sequence129 >Feature sequence130 >Feature sequence131 165 356 gene locus_tag LOCUS_11790 gene rpmC 165 356 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307965.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence132 >Feature sequence133 1 342 gene locus_tag LOCUS_11800 1 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 626 432 gene locus_tag LOCUS_11810 626 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1360 1572 gene locus_tag LOCUS_11820 1360 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 2264 2626 gene locus_tag LOCUS_11830 2264 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2623 3789 gene locus_tag LOCUS_11840 2623 3789 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_11840 3786 4442 gene locus_tag LOCUS_11850 3786 4442 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870305.1 protein_id gnl|my_center|LOCUS_11850 5125 5040 gene locus_tag LOCUS_t00100 5125 5040 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6423 5245 gene locus_tag LOCUS_11860 6423 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 7454 6426 gene locus_tag LOCUS_11870 7454 6426 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_11870 8367 7456 gene locus_tag LOCUS_11880 8367 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 9041 11203 gene locus_tag LOCUS_11890 9041 11203 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_11890 11494 12342 gene locus_tag LOCUS_11900 11494 12342 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946265.1 protein_id gnl|my_center|LOCUS_11900 12397 12972 gene locus_tag LOCUS_11910 12397 12972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 13025 14632 gene locus_tag LOCUS_11920 13025 14632 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 protein_id gnl|my_center|LOCUS_11920 15327 14692 gene locus_tag LOCUS_11930 15327 14692 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768695.1 protein_id gnl|my_center|LOCUS_11930 18473 15327 gene locus_tag LOCUS_11940 18473 15327 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706711.1 protein_id gnl|my_center|LOCUS_11940 19676 18477 gene locus_tag LOCUS_11950 19676 18477 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706712.1 protein_id gnl|my_center|LOCUS_11950 20064 20996 gene locus_tag LOCUS_11960 gene gldA 20064 20996 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_11960 20993 23908 gene locus_tag LOCUS_11970 20993 23908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 23905 24903 gene locus_tag LOCUS_11980 23905 24903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 24956 25723 gene locus_tag LOCUS_11990 gene mtgA 24956 25723 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037989.1 protein_id gnl|my_center|LOCUS_11990 25686 25859 gene locus_tag LOCUS_12000 25686 25859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 25856 26152 gene locus_tag LOCUS_12010 25856 26152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 26438 26914 gene locus_tag LOCUS_12020 26438 26914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 27851 27168 gene locus_tag LOCUS_12030 27851 27168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 28421 29590 gene locus_tag LOCUS_12040 28421 29590 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_12040 29747 30814 gene locus_tag LOCUS_12050 gene lpxD 29747 30814 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_12050 30811 31263 gene locus_tag LOCUS_12060 gene fabZ 30811 31263 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257317.1 protein_id gnl|my_center|LOCUS_12060 31446 32243 gene locus_tag LOCUS_12070 gene lpxA 31446 32243 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_12070 32236 33084 gene locus_tag LOCUS_12080 gene lpxI 32236 33084 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_12080 33191 34579 gene locus_tag LOCUS_12090 gene asnS 33191 34579 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058304.1 protein_id gnl|my_center|LOCUS_12090 34713 36275 gene locus_tag LOCUS_12100 gene hflX 34713 36275 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545622.1 protein_id gnl|my_center|LOCUS_12100 36815 36339 gene locus_tag LOCUS_12110 36815 36339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 36996 36826 gene locus_tag LOCUS_12120 36996 36826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 37559 36993 gene locus_tag LOCUS_12130 gene pyrE 37559 36993 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 protein_id gnl|my_center|LOCUS_12130 37884 39812 gene locus_tag LOCUS_12140 gene glmS 37884 39812 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_12140 40513 39941 gene locus_tag LOCUS_12150 40513 39941 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103433.1 protein_id gnl|my_center|LOCUS_12150 42495 40516 gene locus_tag LOCUS_12160 42495 40516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 43766 42492 gene locus_tag LOCUS_12170 43766 42492 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768840.1 protein_id gnl|my_center|LOCUS_12170 44811 43993 gene locus_tag LOCUS_12180 44811 43993 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_12180 45436 45020 gene locus_tag LOCUS_12190 45436 45020 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912062.1 protein_id gnl|my_center|LOCUS_12190 46547 45603 gene locus_tag LOCUS_12200 46547 45603 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_12200 46731 46922 gene locus_tag LOCUS_12210 46731 46922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 47671 47090 gene locus_tag LOCUS_12220 47671 47090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 48996 48070 gene locus_tag LOCUS_12230 48996 48070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 49954 49679 gene locus_tag LOCUS_12240 49954 49679 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228240.1 protein_id gnl|my_center|LOCUS_12240 50408 50217 gene locus_tag LOCUS_12250 50408 50217 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937612.1 protein_id gnl|my_center|LOCUS_12250 53162 50493 gene locus_tag LOCUS_12260 53162 50493 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404851.1 protein_id gnl|my_center|LOCUS_12260 54030 55193 gene locus_tag LOCUS_12270 54030 55193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 55190 55867 gene locus_tag LOCUS_12280 55190 55867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903135.1 protein_id gnl|my_center|LOCUS_12280 55872 57080 gene locus_tag LOCUS_12290 55872 57080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_12290 57088 58287 gene locus_tag LOCUS_12300 57088 58287 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_12300 58369 58962 gene locus_tag LOCUS_12310 58369 58962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 59706 59065 gene locus_tag LOCUS_12320 59706 59065 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528866.1 protein_id gnl|my_center|LOCUS_12320 60315 59794 gene locus_tag LOCUS_12330 60315 59794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 60788 60988 gene locus_tag LOCUS_12340 60788 60988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 61360 61169 gene locus_tag LOCUS_12350 61360 61169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 61619 61543 gene locus_tag LOCUS_t00110 61619 61543 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 62496 61831 gene locus_tag LOCUS_12360 62496 61831 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815172.1 protein_id gnl|my_center|LOCUS_12360 64486 62513 gene locus_tag LOCUS_12370 64486 62513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 64920 64609 gene locus_tag LOCUS_12380 64920 64609 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092213181.1 protein_id gnl|my_center|LOCUS_12380 66239 64917 gene locus_tag LOCUS_12390 66239 64917 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_12390 68184 66280 gene locus_tag LOCUS_12400 68184 66280 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403289.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence134 >Feature sequence135 >Feature sequence136 >Feature sequence137 >Feature sequence138 >Feature sequence139 >Feature sequence140 >Feature sequence141 >Feature sequence142 >Feature sequence143 >Feature sequence144 884 477 gene locus_tag LOCUS_12410 884 477 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_12410 5083 923 gene locus_tag LOCUS_12420 5083 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 5902 5189 gene locus_tag LOCUS_12430 5902 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 8470 6038 gene locus_tag LOCUS_12440 8470 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 9132 8827 gene locus_tag LOCUS_12450 9132 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12450 9701 9231 gene locus_tag LOCUS_12460 9701 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263939.1 protein_id gnl|my_center|LOCUS_12460 9898 10203 gene locus_tag LOCUS_12470 9898 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 14064 10405 gene locus_tag LOCUS_12480 14064 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 17544 14482 gene locus_tag LOCUS_12490 17544 14482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 18678 17719 gene locus_tag LOCUS_12500 18678 17719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 19326 18682 gene locus_tag LOCUS_12510 19326 18682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 19814 19329 gene locus_tag LOCUS_12520 19814 19329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 23317 20129 gene locus_tag LOCUS_12530 23317 20129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 27229 23618 gene locus_tag LOCUS_12540 27229 23618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 29682 27484 gene locus_tag LOCUS_12550 29682 27484 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545732.1 protein_id gnl|my_center|LOCUS_12550 30215 29985 gene locus_tag LOCUS_12560 30215 29985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 30690 30229 gene locus_tag LOCUS_12570 30690 30229 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_12570 31036 30960 gene locus_tag LOCUS_t00120 31036 30960 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31546 31082 gene locus_tag LOCUS_12580 31546 31082 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_12580 32771 31536 gene locus_tag LOCUS_12590 32771 31536 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_12590 34095 32788 gene locus_tag LOCUS_12600 34095 32788 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_12600 34413 35087 gene locus_tag LOCUS_12610 34413 35087 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939218.1 protein_id gnl|my_center|LOCUS_12610 35181 35777 gene locus_tag LOCUS_12620 35181 35777 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546496.1 protein_id gnl|my_center|LOCUS_12620 35811 36764 gene locus_tag LOCUS_12630 35811 36764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_12630 36842 37780 gene locus_tag LOCUS_12640 gene hemC 36842 37780 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_12640 37782 39407 gene locus_tag LOCUS_12650 gene cobA 37782 39407 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_12650 39648 39451 gene locus_tag LOCUS_12660 39648 39451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 40163 40843 gene locus_tag LOCUS_12670 40163 40843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 40992 42710 gene locus_tag LOCUS_12680 40992 42710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 42954 44159 gene locus_tag LOCUS_12690 42954 44159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 46300 44471 gene locus_tag LOCUS_12700 46300 44471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 46660 47094 gene locus_tag LOCUS_12710 46660 47094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 47087 49141 gene locus_tag LOCUS_12720 47087 49141 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881716.1 protein_id gnl|my_center|LOCUS_12720 49152 50168 gene locus_tag LOCUS_12730 49152 50168 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338461.1 protein_id gnl|my_center|LOCUS_12730 50169 51101 gene locus_tag LOCUS_12740 50169 51101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 52071 51151 gene locus_tag LOCUS_12750 gene ispH 52071 51151 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446429.1 protein_id gnl|my_center|LOCUS_12750 53596 52073 gene locus_tag LOCUS_12760 53596 52073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 54376 55074 gene locus_tag LOCUS_12770 gene aat 54376 55074 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_12770 57339 55234 gene locus_tag LOCUS_12780 57339 55234 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_12780 57508 57320 gene locus_tag LOCUS_12790 57508 57320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 57653 59779 gene locus_tag LOCUS_12800 gene rnr 57653 59779 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_12800 60028 60534 gene locus_tag LOCUS_12810 60028 60534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 60544 61320 gene locus_tag LOCUS_12820 60544 61320 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_12820 62346 61648 gene locus_tag LOCUS_12830 62346 61648 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393069.1 protein_id gnl|my_center|LOCUS_12830 63467 62379 gene locus_tag LOCUS_12840 63467 62379 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_12840 63914 64129 gene locus_tag LOCUS_12850 63914 64129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 64328 66919 gene locus_tag LOCUS_12860 gene clpB 64328 66919 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_12860 67164 67451 gene locus_tag LOCUS_12870 67164 67451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939234.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence145 >Feature sequence146 >Feature sequence147 >Feature sequence148 181 17 gene locus_tag LOCUS_12880 181 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence149 >Feature sequence150 >Feature sequence151 >Feature sequence152 >Feature sequence153 >Feature sequence154 >Feature sequence155 1649 396 gene locus_tag LOCUS_12890 1649 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2367 2666 gene locus_tag LOCUS_12900 2367 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 3119 6694 gene locus_tag LOCUS_12910 gene nifJ 3119 6694 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940774.1 protein_id gnl|my_center|LOCUS_12910 7922 6990 gene locus_tag LOCUS_12920 7922 6990 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_12920 8223 8420 gene locus_tag LOCUS_12930 8223 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 8567 9286 gene locus_tag LOCUS_12940 gene hisJ 8567 9286 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_12940 10927 9299 gene locus_tag LOCUS_12950 10927 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 12851 11124 gene locus_tag LOCUS_12960 12851 11124 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940470.1 protein_id gnl|my_center|LOCUS_12960 15229 12923 gene locus_tag LOCUS_12970 15229 12923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 16412 15810 gene locus_tag LOCUS_12980 16412 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 17169 16384 gene locus_tag LOCUS_12990 17169 16384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12990 17801 18259 gene locus_tag LOCUS_13000 17801 18259 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693476.1 protein_id gnl|my_center|LOCUS_13000 18746 18348 gene locus_tag LOCUS_13010 18746 18348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 20052 18955 gene locus_tag LOCUS_13020 20052 18955 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941541.1 protein_id gnl|my_center|LOCUS_13020 21628 20111 gene locus_tag LOCUS_13030 gene zwf 21628 20111 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_13030 22656 21631 gene locus_tag LOCUS_13040 gene gnd 22656 21631 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_13040 24211 22727 gene locus_tag LOCUS_13050 24211 22727 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938336.1 protein_id gnl|my_center|LOCUS_13050 24942 24235 gene locus_tag LOCUS_13060 24942 24235 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457207.1 protein_id gnl|my_center|LOCUS_13060 25940 24963 gene locus_tag LOCUS_13070 25940 24963 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294587.1 protein_id gnl|my_center|LOCUS_13070 26252 27286 gene locus_tag LOCUS_13080 26252 27286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 27283 27951 gene locus_tag LOCUS_13090 27283 27951 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968331.1 protein_id gnl|my_center|LOCUS_13090 27973 29175 gene locus_tag LOCUS_13100 27973 29175 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338058.1 protein_id gnl|my_center|LOCUS_13100 29172 30878 gene locus_tag LOCUS_13110 29172 30878 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217807779.1 protein_id gnl|my_center|LOCUS_13110 31663 30965 gene locus_tag LOCUS_13120 31663 30965 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085225034.1 protein_id gnl|my_center|LOCUS_13120 33814 31679 gene locus_tag LOCUS_13130 33814 31679 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556205.1 protein_id gnl|my_center|LOCUS_13130 34195 33848 gene locus_tag LOCUS_13140 34195 33848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 34922 34206 gene locus_tag LOCUS_13150 34922 34206 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296408.1 protein_id gnl|my_center|LOCUS_13150 35617 34922 gene locus_tag LOCUS_13160 35617 34922 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296409.1 protein_id gnl|my_center|LOCUS_13160 36880 35765 gene locus_tag LOCUS_13170 36880 35765 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939260.1 protein_id gnl|my_center|LOCUS_13170 37467 36877 gene locus_tag LOCUS_13180 37467 36877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13180 37722 37501 gene locus_tag LOCUS_13190 37722 37501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13190 39209 38220 gene locus_tag LOCUS_13200 39209 38220 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921954.1 protein_id gnl|my_center|LOCUS_13200 41316 39271 gene locus_tag LOCUS_13210 gene brxL 41316 39271 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 protein_id gnl|my_center|LOCUS_13210 41748 41365 gene locus_tag LOCUS_13220 41748 41365 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_13220 44104 41735 gene locus_tag LOCUS_13230 gene pglZ 44104 41735 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_13230 45600 44101 gene locus_tag LOCUS_13240 45600 44101 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035773.1 protein_id gnl|my_center|LOCUS_13240 49370 45597 gene locus_tag LOCUS_13250 49370 45597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 49771 49370 gene locus_tag LOCUS_13260 49771 49370 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261014.1 protein_id gnl|my_center|LOCUS_13260 53278 49790 gene locus_tag LOCUS_13270 gene brxC 53278 49790 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_13270 53699 53319 gene locus_tag LOCUS_13280 53699 53319 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_13280 54278 53727 gene locus_tag LOCUS_13290 54278 53727 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_13290 54978 54265 gene locus_tag LOCUS_13300 54978 54265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_13300 55844 55626 gene locus_tag LOCUS_13310 55844 55626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 55987 56970 gene locus_tag LOCUS_13320 55987 56970 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_13320 57842 57324 gene locus_tag LOCUS_13330 57842 57324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 57979 58344 gene locus_tag LOCUS_13340 57979 58344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 58726 59436 gene locus_tag LOCUS_13350 58726 59436 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002661712.1 protein_id gnl|my_center|LOCUS_13350 63206 59538 gene locus_tag LOCUS_13360 63206 59538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 64451 63576 gene locus_tag LOCUS_13370 64451 63576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 67367 64602 gene locus_tag LOCUS_13380 67367 64602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence156 >Feature sequence157 >Feature sequence158 >Feature sequence159 >Feature sequence160 >Feature sequence161 >Feature sequence162 >Feature sequence163 >Feature sequence164 >Feature sequence165 >Feature sequence166 668 817 gene locus_tag LOCUS_13390 668 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 941 1120 gene locus_tag LOCUS_13400 941 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1642 1854 gene locus_tag LOCUS_13410 1642 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2686 4962 gene locus_tag LOCUS_13420 2686 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5360 6694 gene locus_tag LOCUS_13430 5360 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 6949 8031 gene locus_tag LOCUS_13440 6949 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 8127 11198 gene locus_tag LOCUS_13450 8127 11198 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_13450 11673 12512 gene locus_tag LOCUS_13460 11673 12512 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546502.1 protein_id gnl|my_center|LOCUS_13460 13841 12537 gene locus_tag LOCUS_13470 13841 12537 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258332.1 protein_id gnl|my_center|LOCUS_13470 14266 13928 gene locus_tag LOCUS_13480 14266 13928 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943583.1 protein_id gnl|my_center|LOCUS_13480 14716 14276 gene locus_tag LOCUS_13490 14716 14276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 15210 15806 gene locus_tag LOCUS_13500 15210 15806 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530047.1 protein_id gnl|my_center|LOCUS_13500 15909 16910 gene locus_tag LOCUS_13510 15909 16910 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_13510 17176 17601 gene locus_tag LOCUS_13520 17176 17601 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399589.1 protein_id gnl|my_center|LOCUS_13520 19151 17802 gene locus_tag LOCUS_13530 19151 17802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 19878 19138 gene locus_tag LOCUS_13540 19878 19138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 21139 19895 gene locus_tag LOCUS_13550 21139 19895 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_13550 22056 21355 gene locus_tag LOCUS_13560 22056 21355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523242.1 protein_id gnl|my_center|LOCUS_13560 22687 23562 gene locus_tag LOCUS_13570 22687 23562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 24836 23781 gene locus_tag LOCUS_13580 gene modC 24836 23781 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943591.1 protein_id gnl|my_center|LOCUS_13580 25521 24841 gene locus_tag LOCUS_13590 gene modB 25521 24841 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943592.1 protein_id gnl|my_center|LOCUS_13590 26307 25546 gene locus_tag LOCUS_13600 gene modA 26307 25546 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943593.1 protein_id gnl|my_center|LOCUS_13600 26649 26365 gene locus_tag LOCUS_13610 26649 26365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 27098 28216 gene locus_tag LOCUS_13620 27098 28216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 28319 29017 gene locus_tag LOCUS_13630 28319 29017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 29112 30434 gene locus_tag LOCUS_13640 29112 30434 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_13640 30776 31027 gene locus_tag LOCUS_13650 30776 31027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 31260 31973 gene locus_tag LOCUS_13660 31260 31973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 32476 34113 gene locus_tag LOCUS_13670 32476 34113 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392693.1 protein_id gnl|my_center|LOCUS_13670 35743 34436 gene locus_tag LOCUS_13680 35743 34436 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545483.1 protein_id gnl|my_center|LOCUS_13680 36245 37885 gene locus_tag LOCUS_13690 36245 37885 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940904.1 protein_id gnl|my_center|LOCUS_13690 38025 38192 gene locus_tag LOCUS_13700 38025 38192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 40104 38410 gene locus_tag LOCUS_13710 gene leuA 40104 38410 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933761.1 protein_id gnl|my_center|LOCUS_13710 41621 40605 gene locus_tag LOCUS_13720 gene fbp 41621 40605 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 protein_id gnl|my_center|LOCUS_13720 43235 41673 gene locus_tag LOCUS_13730 43235 41673 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_13730 43746 44780 gene locus_tag LOCUS_13740 43746 44780 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792562.1 protein_id gnl|my_center|LOCUS_13740 44865 45566 gene locus_tag LOCUS_13750 44865 45566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 46852 45713 gene locus_tag LOCUS_13760 46852 45713 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_13760 47324 47124 gene locus_tag LOCUS_13770 47324 47124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 47515 48576 gene locus_tag LOCUS_13780 gene purM 47515 48576 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_13780 49158 48643 gene locus_tag LOCUS_13790 49158 48643 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227870.1 protein_id gnl|my_center|LOCUS_13790 51224 49158 gene locus_tag LOCUS_13800 51224 49158 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938180.1 protein_id gnl|my_center|LOCUS_13800 51417 53024 gene locus_tag LOCUS_13810 gene murJ 51417 53024 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_13810 53740 53003 gene locus_tag LOCUS_13820 53740 53003 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266363.1 protein_id gnl|my_center|LOCUS_13820 55061 53802 gene locus_tag LOCUS_13830 gene lysA 55061 53802 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_13830 55579 55124 gene locus_tag LOCUS_13840 55579 55124 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027181.1 protein_id gnl|my_center|LOCUS_13840 56093 57409 gene locus_tag LOCUS_13850 gene waaA 56093 57409 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094897.1 protein_id gnl|my_center|LOCUS_13850 57417 60026 gene locus_tag LOCUS_13860 57417 60026 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_13860 60301 60107 gene locus_tag LOCUS_13870 60301 60107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 61637 60555 gene locus_tag LOCUS_13880 61637 60555 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_13880 62390 61707 gene locus_tag LOCUS_13890 62390 61707 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863794.1 protein_id gnl|my_center|LOCUS_13890 64747 62630 gene locus_tag LOCUS_13900 64747 62630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 66189 64750 gene locus_tag LOCUS_13910 gene selA 66189 64750 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940143.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence167 >Feature sequence168 >Feature sequence169 >Feature sequence170 >Feature sequence171 >Feature sequence172 >Feature sequence173 >Feature sequence174 >Feature sequence175 >Feature sequence176 >Feature sequence177 2485 38 gene locus_tag LOCUS_13920 gene ppsA 2485 38 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_13920 2759 4516 gene locus_tag LOCUS_13930 2759 4516 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545176.1 protein_id gnl|my_center|LOCUS_13930 4606 5442 gene locus_tag LOCUS_13940 gene nifU 4606 5442 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_13940 5442 6629 gene locus_tag LOCUS_13950 gene nifS 5442 6629 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_13950 6944 7876 gene locus_tag LOCUS_13960 6944 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 8339 10537 gene locus_tag LOCUS_13970 gene pilB 8339 10537 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_13970 10534 11316 gene locus_tag LOCUS_13980 10534 11316 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770612.1 protein_id gnl|my_center|LOCUS_13980 12226 11429 gene locus_tag LOCUS_13990 12226 11429 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 protein_id gnl|my_center|LOCUS_13990 13451 12372 gene locus_tag LOCUS_14000 gene waaC 13451 12372 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_14000 16025 13527 gene locus_tag LOCUS_14010 16025 13527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 17779 16043 gene locus_tag LOCUS_14020 gene msbA 17779 16043 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_14020 20475 18193 gene locus_tag LOCUS_14030 20475 18193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 22027 20567 gene locus_tag LOCUS_14040 22027 20567 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938056.1 protein_id gnl|my_center|LOCUS_14040 22694 22161 gene locus_tag LOCUS_14050 gene pyrR 22694 22161 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_14050 23274 22699 gene locus_tag LOCUS_14060 gene purN 23274 22699 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436064.1 protein_id gnl|my_center|LOCUS_14060 23899 23267 gene locus_tag LOCUS_14070 23899 23267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 24632 24252 gene locus_tag LOCUS_14080 gene hslR 24632 24252 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465328.1 protein_id gnl|my_center|LOCUS_14080 25095 25847 gene locus_tag LOCUS_14090 gene folE2 25095 25847 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_14090 27334 25862 gene locus_tag LOCUS_14100 gene gabD 27334 25862 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_14100 27659 28096 gene locus_tag LOCUS_14110 27659 28096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 28066 28266 gene locus_tag LOCUS_14120 28066 28266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 29777 28224 gene locus_tag LOCUS_14130 29777 28224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 29922 31343 gene locus_tag LOCUS_14140 29922 31343 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_14140 31495 32262 gene locus_tag LOCUS_14150 31495 32262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 33263 32343 gene locus_tag LOCUS_14160 33263 32343 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878259.1 protein_id gnl|my_center|LOCUS_14160 34919 33489 gene locus_tag LOCUS_14170 34919 33489 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478391.1 protein_id gnl|my_center|LOCUS_14170 35894 34941 gene locus_tag LOCUS_14180 gene rfbN 35894 34941 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_14180 36936 36115 gene locus_tag LOCUS_14190 36936 36115 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706051.1 protein_id gnl|my_center|LOCUS_14190 37995 36949 gene locus_tag LOCUS_14200 37995 36949 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256314.1 protein_id gnl|my_center|LOCUS_14200 38964 38005 gene locus_tag LOCUS_14210 38964 38005 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_14210 39473 40159 gene locus_tag LOCUS_14220 39473 40159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 40166 40876 gene locus_tag LOCUS_14230 40166 40876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 40959 41756 gene locus_tag LOCUS_14240 40959 41756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 41757 43502 gene locus_tag LOCUS_14250 41757 43502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 43830 44846 gene locus_tag LOCUS_14260 43830 44846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 44964 46001 gene locus_tag LOCUS_14270 44964 46001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 46526 47107 gene locus_tag LOCUS_14280 46526 47107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 48615 47479 gene locus_tag LOCUS_14290 48615 47479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 49154 48615 gene locus_tag LOCUS_14300 49154 48615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 49038 49433 gene locus_tag LOCUS_14310 49038 49433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 49764 49498 gene locus_tag LOCUS_14320 49764 49498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 51882 49786 gene locus_tag LOCUS_14330 51882 49786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 52904 51924 gene locus_tag LOCUS_14340 52904 51924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 53649 52918 gene locus_tag LOCUS_14350 53649 52918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 54624 53728 gene locus_tag LOCUS_14360 54624 53728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 54760 54984 gene locus_tag LOCUS_14370 54760 54984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 56121 55153 gene locus_tag LOCUS_14380 56121 55153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 56947 56180 gene locus_tag LOCUS_14390 56947 56180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence178 >Feature sequence179 >Feature sequence180 >Feature sequence181 >Feature sequence182 1 429 gene locus_tag LOCUS_14400 1 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence183 >Feature sequence184 >Feature sequence185 >Feature sequence186 >Feature sequence187 >Feature sequence188 508 1533 gene locus_tag LOCUS_14410 508 1533 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003321939.1 protein_id gnl|my_center|LOCUS_14410 5028 1663 gene locus_tag LOCUS_14420 5028 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 5762 7504 gene locus_tag LOCUS_14430 5762 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 8414 9880 gene locus_tag LOCUS_14440 8414 9880 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077027088.1 protein_id gnl|my_center|LOCUS_14440 10401 11597 gene locus_tag LOCUS_14450 10401 11597 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_14450 11788 12114 gene locus_tag LOCUS_14460 gene yhbY 11788 12114 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941918.1 protein_id gnl|my_center|LOCUS_14460 12803 12363 gene locus_tag LOCUS_14470 12803 12363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 14090 15340 gene locus_tag LOCUS_14480 14090 15340 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_14480 17054 15639 gene locus_tag LOCUS_14490 gene nuoN 17054 15639 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443945.1 protein_id gnl|my_center|LOCUS_14490 18664 17147 gene locus_tag LOCUS_14500 18664 17147 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967804.1 protein_id gnl|my_center|LOCUS_14500 20468 18678 gene locus_tag LOCUS_14510 20468 18678 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969263.1 protein_id gnl|my_center|LOCUS_14510 20743 20465 gene locus_tag LOCUS_14520 20743 20465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 22233 20740 gene locus_tag LOCUS_14530 22233 20740 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_14530 22575 22249 gene locus_tag LOCUS_14540 22575 22249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 23151 22579 gene locus_tag LOCUS_14550 23151 22579 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124337.1 protein_id gnl|my_center|LOCUS_14550 23591 23139 gene locus_tag LOCUS_14560 23591 23139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 24585 23593 gene locus_tag LOCUS_14570 gene nuoH 24585 23593 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_14570 25722 24604 gene locus_tag LOCUS_14580 gene nuoD 25722 24604 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_14580 26234 25719 gene locus_tag LOCUS_14590 26234 25719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 26745 26248 gene locus_tag LOCUS_14600 26745 26248 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392493.1 protein_id gnl|my_center|LOCUS_14600 27122 26715 gene locus_tag LOCUS_14610 27122 26715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 27009 27224 gene locus_tag LOCUS_14620 27009 27224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 27383 28363 gene locus_tag LOCUS_14630 27383 28363 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943443.1 protein_id gnl|my_center|LOCUS_14630 29888 28680 gene locus_tag LOCUS_14640 29888 28680 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_14640 31913 30141 gene locus_tag LOCUS_14650 gene extM 31913 30141 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_14650 33653 32028 gene locus_tag LOCUS_14660 33653 32028 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_14660 34061 33861 gene locus_tag LOCUS_14670 34061 33861 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_14670 35530 34541 gene locus_tag LOCUS_14680 gene mltG 35530 34541 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_14680 38301 35872 gene locus_tag LOCUS_14690 gene lon 38301 35872 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_14690 38498 39298 gene locus_tag LOCUS_14700 38498 39298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 40007 39738 gene locus_tag LOCUS_14710 40007 39738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 40038 41129 gene locus_tag LOCUS_14720 40038 41129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 41696 41319 gene locus_tag LOCUS_14730 41696 41319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 42299 41814 gene locus_tag LOCUS_14740 42299 41814 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938329.1 protein_id gnl|my_center|LOCUS_14740 42920 43972 gene locus_tag LOCUS_14750 42920 43972 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_14750 44083 45105 gene locus_tag LOCUS_14760 gene hemE 44083 45105 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944063.1 protein_id gnl|my_center|LOCUS_14760 45545 46153 gene locus_tag LOCUS_14770 45545 46153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 46271 47377 gene locus_tag LOCUS_14780 46271 47377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 47664 49052 gene locus_tag LOCUS_14790 47664 49052 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_14790 49347 50087 gene locus_tag LOCUS_14800 49347 50087 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_14800 50098 52410 gene locus_tag LOCUS_14810 50098 52410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_14810 54149 52536 gene locus_tag LOCUS_14820 54149 52536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence189 >Feature sequence190 >Feature sequence191 >Feature sequence192 >Feature sequence193 >Feature sequence194 >Feature sequence195 >Feature sequence196 >Feature sequence197 >Feature sequence198 >Feature sequence199 1204 686 gene locus_tag LOCUS_14830 1204 686 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199982.1 protein_id gnl|my_center|LOCUS_14830 1325 1414 gene locus_tag LOCUS_t00130 1325 1414 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1830 2411 gene locus_tag LOCUS_14840 1830 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 2426 3049 gene locus_tag LOCUS_14850 2426 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939792.1 protein_id gnl|my_center|LOCUS_14850 3089 4090 gene locus_tag LOCUS_14860 3089 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14860 4062 5339 gene locus_tag LOCUS_14870 4062 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14870 5421 6653 gene locus_tag LOCUS_14880 5421 6653 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927132.1 protein_id gnl|my_center|LOCUS_14880 6748 7923 gene locus_tag LOCUS_14890 6748 7923 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403266.1 protein_id gnl|my_center|LOCUS_14890 9762 8041 gene locus_tag LOCUS_14900 9762 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 10104 10526 gene locus_tag LOCUS_14910 10104 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 10893 11831 gene locus_tag LOCUS_14920 10893 11831 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937953.1 protein_id gnl|my_center|LOCUS_14920 12522 13910 gene locus_tag LOCUS_14930 gene mgtE 12522 13910 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384985.1 protein_id gnl|my_center|LOCUS_14930 14055 15422 gene locus_tag LOCUS_14940 14055 15422 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_14940 16531 17040 gene locus_tag LOCUS_14950 16531 17040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 17318 18922 gene locus_tag LOCUS_14960 17318 18922 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 protein_id gnl|my_center|LOCUS_14960 19178 20413 gene locus_tag LOCUS_14970 19178 20413 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868516.1 protein_id gnl|my_center|LOCUS_14970 20446 21117 gene locus_tag LOCUS_14980 20446 21117 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883319.1 protein_id gnl|my_center|LOCUS_14980 22709 21273 gene locus_tag LOCUS_14990 22709 21273 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937845.1 protein_id gnl|my_center|LOCUS_14990 25353 22732 gene locus_tag LOCUS_15000 25353 22732 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937846.1 protein_id gnl|my_center|LOCUS_15000 25746 27497 gene locus_tag LOCUS_15010 25746 27497 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524295.1 protein_id gnl|my_center|LOCUS_15010 27511 27780 gene locus_tag LOCUS_15020 27511 27780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 28012 29007 gene locus_tag LOCUS_15030 28012 29007 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546361.1 protein_id gnl|my_center|LOCUS_15030 29647 29042 gene locus_tag LOCUS_15040 29647 29042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 31935 29830 gene locus_tag LOCUS_15050 31935 29830 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_15050 32953 32096 gene locus_tag LOCUS_15060 32953 32096 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106903.1 protein_id gnl|my_center|LOCUS_15060 33815 32946 gene locus_tag LOCUS_15070 33815 32946 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267339.1 protein_id gnl|my_center|LOCUS_15070 34916 33903 gene locus_tag LOCUS_15080 34916 33903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 35072 35452 gene locus_tag LOCUS_15090 35072 35452 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_15090 35843 36490 gene locus_tag LOCUS_15100 35843 36490 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_15100 36647 37309 gene locus_tag LOCUS_15110 36647 37309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_15110 37309 39867 gene locus_tag LOCUS_15120 37309 39867 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 protein_id gnl|my_center|LOCUS_15120 40169 39951 gene locus_tag LOCUS_15130 40169 39951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 41837 40194 gene locus_tag LOCUS_15140 41837 40194 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_15140 43224 42316 gene locus_tag LOCUS_15150 43224 42316 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 protein_id gnl|my_center|LOCUS_15150 43585 43247 gene locus_tag LOCUS_15160 43585 43247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 43784 43881 gene locus_tag LOCUS_t00140 43784 43881 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 44445 45389 gene locus_tag LOCUS_15170 44445 45389 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941034.1 protein_id gnl|my_center|LOCUS_15170 46281 46961 gene locus_tag LOCUS_15180 46281 46961 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583302.1 protein_id gnl|my_center|LOCUS_15180 48784 46937 gene locus_tag LOCUS_15190 gene ftsH 48784 46937 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_15190 48984 49592 gene locus_tag LOCUS_15200 48984 49592 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524311.1 protein_id gnl|my_center|LOCUS_15200 50768 49758 gene locus_tag LOCUS_15210 50768 49758 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_15210 51169 51852 gene locus_tag LOCUS_15220 51169 51852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 52083 52583 gene locus_tag LOCUS_15230 52083 52583 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932995.1 protein_id gnl|my_center|LOCUS_15230 53192 52908 gene locus_tag LOCUS_15240 53192 52908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 53400 54158 gene locus_tag LOCUS_15250 53400 54158 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044966.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence200 >Feature sequence201 >Feature sequence202 >Feature sequence203 >Feature sequence204 >Feature sequence205 >Feature sequence206 >Feature sequence207 >Feature sequence208 >Feature sequence209 >Feature sequence210 185 817 gene locus_tag LOCUS_15260 185 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1131 1478 gene locus_tag LOCUS_15270 1131 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1646 2341 gene locus_tag LOCUS_15280 1646 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2619 3629 gene locus_tag LOCUS_15290 2619 3629 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_15290 3919 4173 gene locus_tag LOCUS_15300 3919 4173 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101799467.1 protein_id gnl|my_center|LOCUS_15300 4170 4589 gene locus_tag LOCUS_15310 4170 4589 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769733.1 protein_id gnl|my_center|LOCUS_15310 5439 5008 gene locus_tag LOCUS_15320 5439 5008 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_15320 5693 5439 gene locus_tag LOCUS_15330 5693 5439 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766946.1 protein_id gnl|my_center|LOCUS_15330 6201 5914 gene locus_tag LOCUS_15340 6201 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 6467 6201 gene locus_tag LOCUS_15350 6467 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 7029 7340 gene locus_tag LOCUS_15360 7029 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 7523 7813 gene locus_tag LOCUS_15370 7523 7813 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869621.1 protein_id gnl|my_center|LOCUS_15370 7806 8177 gene locus_tag LOCUS_15380 7806 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 8453 10126 gene locus_tag LOCUS_15390 8453 10126 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_15390 10657 10403 gene locus_tag LOCUS_15400 10657 10403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 10983 12020 gene locus_tag LOCUS_15410 10983 12020 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972496.1 protein_id gnl|my_center|LOCUS_15410 12346 13257 gene locus_tag LOCUS_15420 12346 13257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 13263 14720 gene locus_tag LOCUS_15430 gene qseE 13263 14720 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311037.1 protein_id gnl|my_center|LOCUS_15430 14849 15307 gene locus_tag LOCUS_15440 14849 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 15309 16658 gene locus_tag LOCUS_15450 gene glrR 15309 16658 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 protein_id gnl|my_center|LOCUS_15450 16667 16849 gene locus_tag LOCUS_15460 16667 16849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 17908 17063 gene locus_tag LOCUS_15470 gene mutM 17908 17063 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114505.1 protein_id gnl|my_center|LOCUS_15470 18674 17901 gene locus_tag LOCUS_15480 18674 17901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 18783 19358 gene locus_tag LOCUS_15490 18783 19358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 20259 19384 gene locus_tag LOCUS_15500 gene rfbD 20259 19384 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_15500 21176 20307 gene locus_tag LOCUS_15510 gene rfbA 21176 20307 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938224.1 protein_id gnl|my_center|LOCUS_15510 21429 22802 gene locus_tag LOCUS_15520 21429 22802 CDS product phosphohexose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506571.1 protein_id gnl|my_center|LOCUS_15520 23110 24528 gene locus_tag LOCUS_15530 23110 24528 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_15530 25056 24673 gene locus_tag LOCUS_15540 25056 24673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 25883 26221 gene locus_tag LOCUS_15550 25883 26221 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_15550 26221 28830 gene locus_tag LOCUS_15560 gene glnD 26221 28830 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_15560 28927 30255 gene locus_tag LOCUS_15570 gene glnA 28927 30255 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_15570 30457 30648 gene locus_tag LOCUS_15580 30457 30648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 31677 30841 gene locus_tag LOCUS_15590 31677 30841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 32109 34595 gene locus_tag LOCUS_15600 32109 34595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 35283 34651 gene locus_tag LOCUS_15610 35283 34651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 36659 35286 gene locus_tag LOCUS_15620 36659 35286 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_15620 38846 36675 gene locus_tag LOCUS_15630 38846 36675 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706513.1 protein_id gnl|my_center|LOCUS_15630 38963 39292 gene locus_tag LOCUS_15640 38963 39292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 41265 39298 gene locus_tag LOCUS_15650 41265 39298 CDS product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706510.1 protein_id gnl|my_center|LOCUS_15650 41966 41262 gene locus_tag LOCUS_15660 41966 41262 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263954.1 protein_id gnl|my_center|LOCUS_15660 43712 42342 gene locus_tag LOCUS_15670 43712 42342 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_15670 43939 44421 gene locus_tag LOCUS_15680 43939 44421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 44524 46851 gene locus_tag LOCUS_15690 44524 46851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 46956 47032 gene locus_tag LOCUS_t00150 46956 47032 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 47191 47400 gene locus_tag LOCUS_15700 47191 47400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence211 >Feature sequence212 3 152 gene locus_tag LOCUS_15710 3 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence213 >Feature sequence214 >Feature sequence215 >Feature sequence216 >Feature sequence217 >Feature sequence218 349 107 gene locus_tag LOCUS_15720 349 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence219 >Feature sequence220 >Feature sequence221 415 630 gene locus_tag LOCUS_15730 415 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 627 896 gene locus_tag LOCUS_15740 627 896 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_15740 1588 2589 gene locus_tag LOCUS_15750 1588 2589 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_15750 2603 2992 gene locus_tag LOCUS_15760 2603 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 2994 3401 gene locus_tag LOCUS_15770 2994 3401 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_15770 3923 3477 gene locus_tag LOCUS_15780 gene vapC 3923 3477 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331362.1 protein_id gnl|my_center|LOCUS_15780 4335 4105 gene locus_tag LOCUS_15790 4335 4105 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 protein_id gnl|my_center|LOCUS_15790 4756 4532 gene locus_tag LOCUS_15800 4756 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_15800 5009 4737 gene locus_tag LOCUS_15810 5009 4737 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_15810 5947 5288 gene locus_tag LOCUS_15820 5947 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 6542 6324 gene locus_tag LOCUS_15830 6542 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 6980 6636 gene locus_tag LOCUS_15840 6980 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 7260 6967 gene locus_tag LOCUS_15850 7260 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 8135 7467 gene locus_tag LOCUS_15860 8135 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 8523 8383 gene locus_tag LOCUS_15870 8523 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 8930 9274 gene locus_tag LOCUS_15880 8930 9274 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_15880 9271 9597 gene locus_tag LOCUS_15890 9271 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 9784 10095 gene locus_tag LOCUS_15900 9784 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 10169 10570 gene locus_tag LOCUS_15910 10169 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 10874 11179 gene locus_tag LOCUS_15920 10874 11179 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_15920 11176 11457 gene locus_tag LOCUS_15930 11176 11457 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390830.1 protein_id gnl|my_center|LOCUS_15930 12655 11810 gene locus_tag LOCUS_15940 12655 11810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 13311 12661 gene locus_tag LOCUS_15950 13311 12661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 14860 13358 gene locus_tag LOCUS_15960 14860 13358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 15639 14872 gene locus_tag LOCUS_15970 15639 14872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 15962 18253 gene locus_tag LOCUS_15980 gene prsT 15962 18253 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_15980 18265 18792 gene locus_tag LOCUS_15990 gene hpt 18265 18792 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019295.1 protein_id gnl|my_center|LOCUS_15990 19009 19665 gene locus_tag LOCUS_16000 gene elbB 19009 19665 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390979.1 protein_id gnl|my_center|LOCUS_16000 20708 20028 gene locus_tag LOCUS_16010 gene tpiA 20708 20028 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 protein_id gnl|my_center|LOCUS_16010 21166 20942 gene locus_tag LOCUS_16020 21166 20942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 21578 21276 gene locus_tag LOCUS_16030 21578 21276 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_16030 22089 21793 gene locus_tag LOCUS_16040 22089 21793 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_16040 24137 22191 gene locus_tag LOCUS_16050 gene metG 24137 22191 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_16050 25353 24370 gene locus_tag LOCUS_16060 25353 24370 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942871.1 protein_id gnl|my_center|LOCUS_16060 26835 25867 gene locus_tag LOCUS_16070 gene holB 26835 25867 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_16070 27984 26839 gene locus_tag LOCUS_16080 27984 26839 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_16080 28173 29477 gene locus_tag LOCUS_16090 28173 29477 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_16090 29624 29827 gene locus_tag LOCUS_16100 29624 29827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 29824 31518 gene locus_tag LOCUS_16110 29824 31518 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804353.1 protein_id gnl|my_center|LOCUS_16110 31939 34827 gene locus_tag LOCUS_16120 31939 34827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 35013 38189 gene locus_tag LOCUS_16130 35013 38189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294648.1 protein_id gnl|my_center|LOCUS_16130 38606 40144 gene locus_tag LOCUS_16140 38606 40144 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858826.1 protein_id gnl|my_center|LOCUS_16140 40146 41294 gene locus_tag LOCUS_16150 gene cydB 40146 41294 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851984.1 protein_id gnl|my_center|LOCUS_16150 41842 43239 gene locus_tag LOCUS_16160 gene oprM 41842 43239 CDS product multidrug efflux RND transporter outer membrane channel subunit OprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084633.1 protein_id gnl|my_center|LOCUS_16160 43242 43667 gene locus_tag LOCUS_16170 43242 43667 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_16170 45380 43752 gene locus_tag LOCUS_16180 45380 43752 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937340.1 protein_id gnl|my_center|LOCUS_16180 46088 45534 gene locus_tag LOCUS_16190 46088 45534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence222 374 613 gene locus_tag LOCUS_16200 374 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 688 1071 gene locus_tag LOCUS_16210 688 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1074 1262 gene locus_tag LOCUS_16220 1074 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2248 2084 gene locus_tag LOCUS_16230 2248 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2500 2760 gene locus_tag LOCUS_16240 2500 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2744 3073 gene locus_tag LOCUS_16250 2744 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3430 3681 gene locus_tag LOCUS_16260 3430 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 4527 6728 gene locus_tag LOCUS_16270 4527 6728 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164979579.1 protein_id gnl|my_center|LOCUS_16270 6725 7789 gene locus_tag LOCUS_16280 6725 7789 CDS product nuclease-related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888392.1 protein_id gnl|my_center|LOCUS_16280 8109 8726 gene locus_tag LOCUS_16290 8109 8726 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942188.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16290 8749 8916 gene locus_tag LOCUS_16300 8749 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 9120 9650 gene locus_tag LOCUS_16310 9120 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 9683 9856 gene locus_tag LOCUS_16320 9683 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 9945 10226 gene locus_tag LOCUS_16330 9945 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 11073 11234 gene locus_tag LOCUS_16340 11073 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 11209 11484 gene locus_tag LOCUS_16350 11209 11484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 11581 11820 gene locus_tag LOCUS_16360 11581 11820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 11987 12232 gene locus_tag LOCUS_16370 11987 12232 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_16370 12229 12615 gene locus_tag LOCUS_16380 12229 12615 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_16380 12846 13166 gene locus_tag LOCUS_16390 12846 13166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 13229 14098 gene locus_tag LOCUS_16400 13229 14098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 14162 14701 gene locus_tag LOCUS_16410 14162 14701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 15019 15636 gene locus_tag LOCUS_16420 15019 15636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 16713 15916 gene locus_tag LOCUS_16430 16713 15916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 20700 17146 gene locus_tag LOCUS_16440 20700 17146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 22518 21496 gene locus_tag LOCUS_16450 22518 21496 CDS product ribonuclease T2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443921.1 protein_id gnl|my_center|LOCUS_16450 24633 22897 gene locus_tag LOCUS_16460 24633 22897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 26126 24630 gene locus_tag LOCUS_16470 26126 24630 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_16470 27577 26126 gene locus_tag LOCUS_16480 27577 26126 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090055.1 protein_id gnl|my_center|LOCUS_16480 27870 27574 gene locus_tag LOCUS_16490 27870 27574 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090054.1 protein_id gnl|my_center|LOCUS_16490 28565 27867 gene locus_tag LOCUS_16500 28565 27867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 28828 28562 gene locus_tag LOCUS_16510 28828 28562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 29211 28831 gene locus_tag LOCUS_16520 29211 28831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 29500 29159 gene locus_tag LOCUS_16530 29500 29159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 29667 29497 gene locus_tag LOCUS_16540 29667 29497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 32368 30704 gene locus_tag LOCUS_16550 32368 30704 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926325.1 protein_id gnl|my_center|LOCUS_16550 33441 32365 gene locus_tag LOCUS_16560 33441 32365 CDS product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705805.1 protein_id gnl|my_center|LOCUS_16560 34669 33650 gene locus_tag LOCUS_16570 34669 33650 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892094.1 protein_id gnl|my_center|LOCUS_16570 35121 34948 gene locus_tag LOCUS_16580 35121 34948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 36447 35749 gene locus_tag LOCUS_16590 36447 35749 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 protein_id gnl|my_center|LOCUS_16590 36974 36444 gene locus_tag LOCUS_16600 36974 36444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258560.1 protein_id gnl|my_center|LOCUS_16600 38374 36971 gene locus_tag LOCUS_16610 38374 36971 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_16610 39233 38466 gene locus_tag LOCUS_16620 39233 38466 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932386.1 protein_id gnl|my_center|LOCUS_16620 42278 39234 gene locus_tag LOCUS_16630 42278 39234 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263395.1 protein_id gnl|my_center|LOCUS_16630 43581 42271 gene locus_tag LOCUS_16640 43581 42271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 45758 43578 gene locus_tag LOCUS_16650 45758 43578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 49512 46255 gene locus_tag LOCUS_16660 49512 46255 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_16660 50304 49687 gene locus_tag LOCUS_16670 50304 49687 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_16670 50646 50392 gene locus_tag LOCUS_16680 50646 50392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16680 51880 50948 gene locus_tag LOCUS_16690 51880 50948 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 protein_id gnl|my_center|LOCUS_16690 54402 51877 gene locus_tag LOCUS_16700 54402 51877 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390312.1 protein_id gnl|my_center|LOCUS_16700 57874 54689 gene locus_tag LOCUS_16710 57874 54689 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_16710 59086 58115 gene locus_tag LOCUS_16720 59086 58115 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_16720 60543 59113 gene locus_tag LOCUS_16730 60543 59113 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_16730 61609 60818 gene locus_tag LOCUS_16740 61609 60818 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 protein_id gnl|my_center|LOCUS_16740 62594 62373 gene locus_tag LOCUS_16750 62594 62373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 62593 63216 gene locus_tag LOCUS_16760 62593 63216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16760 63255 64061 gene locus_tag LOCUS_16770 63255 64061 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_16770 64124 65110 gene locus_tag LOCUS_16780 64124 65110 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895564.1 protein_id gnl|my_center|LOCUS_16780 65103 66104 gene locus_tag LOCUS_16790 65103 66104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 66751 66227 gene locus_tag LOCUS_16800 66751 66227 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868874.1 protein_id gnl|my_center|LOCUS_16800 67117 67374 gene locus_tag LOCUS_16810 67117 67374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022267.1 protein_id gnl|my_center|LOCUS_16810 67489 67809 gene locus_tag LOCUS_16820 67489 67809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932391.1 protein_id gnl|my_center|LOCUS_16820 68801 69466 gene locus_tag LOCUS_16830 68801 69466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 69546 72092 gene locus_tag LOCUS_16840 69546 72092 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 protein_id gnl|my_center|LOCUS_16840 72287 72982 gene locus_tag LOCUS_16850 72287 72982 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114586.1 protein_id gnl|my_center|LOCUS_16850 73109 74218 gene locus_tag LOCUS_16860 73109 74218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 74491 75729 gene locus_tag LOCUS_16870 74491 75729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434737.1 protein_id gnl|my_center|LOCUS_16870 76077 76241 gene locus_tag LOCUS_16880 76077 76241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 76279 77094 gene locus_tag LOCUS_16890 76279 77094 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460667.1 protein_id gnl|my_center|LOCUS_16890 77267 77191 gene locus_tag LOCUS_t00160 77267 77191 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 78152 77496 gene locus_tag LOCUS_16900 78152 77496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 80088 78403 gene locus_tag LOCUS_16910 80088 78403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 80563 83526 gene locus_tag LOCUS_16920 80563 83526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 84036 83584 gene locus_tag LOCUS_16930 84036 83584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 84829 84014 gene locus_tag LOCUS_16940 84829 84014 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_16940 85893 84832 gene locus_tag LOCUS_16950 85893 84832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 87351 86062 gene locus_tag LOCUS_16960 gene tolB 87351 86062 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932320.1 protein_id gnl|my_center|LOCUS_16960 88534 87449 gene locus_tag LOCUS_16970 88534 87449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 88975 88553 gene locus_tag LOCUS_16980 gene tolR 88975 88553 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_16980 89672 88980 gene locus_tag LOCUS_16990 gene tolQ 89672 88980 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_16990 89958 90881 gene locus_tag LOCUS_17000 gene trxB 89958 90881 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879051.1 protein_id gnl|my_center|LOCUS_17000 91792 91226 gene locus_tag LOCUS_17010 91792 91226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 93069 91816 gene locus_tag LOCUS_17020 gene coaBC 93069 91816 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_17020 93566 93081 gene locus_tag LOCUS_17030 93566 93081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 94171 94998 gene locus_tag LOCUS_17040 94171 94998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 94995 95696 gene locus_tag LOCUS_17050 94995 95696 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_17050 95693 97003 gene locus_tag LOCUS_17060 95693 97003 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_17060 97616 97371 gene locus_tag LOCUS_17070 97616 97371 CDS product PxxKW family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942657.1 protein_id gnl|my_center|LOCUS_17070 97810 99015 gene locus_tag LOCUS_17080 97810 99015 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_17080 99047 100351 gene locus_tag LOCUS_17090 gene eno 99047 100351 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_17090 100433 100720 gene locus_tag LOCUS_17100 100433 100720 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942767.1 protein_id gnl|my_center|LOCUS_17100 101040 102008 gene locus_tag LOCUS_17110 101040 102008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 102008 102268 gene locus_tag LOCUS_17120 102008 102268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 103310 102186 gene locus_tag LOCUS_17130 gene ribD 103310 102186 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_17130 103793 103329 gene locus_tag LOCUS_17140 gene nrdR 103793 103329 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_17140 104391 103966 gene locus_tag LOCUS_17150 gene rpiB 104391 103966 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_17150 105653 104415 gene locus_tag LOCUS_17160 gene fabF 105653 104415 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_17160 105902 105669 gene locus_tag LOCUS_17170 gene acpP 105902 105669 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081231.1 protein_id gnl|my_center|LOCUS_17170 106737 105988 gene locus_tag LOCUS_17180 gene fabG 106737 105988 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_17180 107924 106734 gene locus_tag LOCUS_17190 107924 106734 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545166.1 protein_id gnl|my_center|LOCUS_17190 108744 107965 gene locus_tag LOCUS_17200 108744 107965 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_17200 109906 108758 gene locus_tag LOCUS_17210 109906 108758 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_17210 110902 109925 gene locus_tag LOCUS_17220 110902 109925 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_17220 111904 110915 gene locus_tag LOCUS_17230 gene plsX 111904 110915 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938504.1 protein_id gnl|my_center|LOCUS_17230 112723 112199 gene locus_tag LOCUS_17240 112723 112199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 113386 113186 gene locus_tag LOCUS_17250 113386 113186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 114025 113387 gene locus_tag LOCUS_17260 114025 113387 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938539.1 protein_id gnl|my_center|LOCUS_17260 114953 114198 gene locus_tag LOCUS_17270 114953 114198 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938538.1 protein_id gnl|my_center|LOCUS_17270 115421 114969 gene locus_tag LOCUS_17280 gene mlaD 115421 114969 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_17280 116233 115421 gene locus_tag LOCUS_17290 116233 115421 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_17290 116955 116230 gene locus_tag LOCUS_17300 116955 116230 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_17300 117586 117179 gene locus_tag LOCUS_17310 117586 117179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 119039 117963 gene locus_tag LOCUS_17320 119039 117963 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937555.1 protein_id gnl|my_center|LOCUS_17320 121522 119042 gene locus_tag LOCUS_17330 121522 119042 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793045.1 protein_id gnl|my_center|LOCUS_17330 122441 121785 gene locus_tag LOCUS_17340 122441 121785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 123825 122671 gene locus_tag LOCUS_17350 123825 122671 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793041.1 protein_id gnl|my_center|LOCUS_17350 125924 124242 gene locus_tag LOCUS_17360 125924 124242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 126378 126007 gene locus_tag LOCUS_17370 126378 126007 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937557.1 protein_id gnl|my_center|LOCUS_17370 126891 127139 gene locus_tag LOCUS_17380 126891 127139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 127518 127102 gene locus_tag LOCUS_17390 127518 127102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 128929 127520 gene locus_tag LOCUS_17400 128929 127520 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938245.1 protein_id gnl|my_center|LOCUS_17400 130098 129070 gene locus_tag LOCUS_17410 gene thiL 130098 129070 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_17410 130858 130481 gene locus_tag LOCUS_17420 130858 130481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 132708 131038 gene locus_tag LOCUS_17430 132708 131038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 135071 132705 gene locus_tag LOCUS_17440 135071 132705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 135039 135281 gene locus_tag LOCUS_17450 135039 135281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 135445 135642 gene locus_tag LOCUS_17460 135445 135642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 135738 135547 gene locus_tag LOCUS_17470 135738 135547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 136544 135744 gene locus_tag LOCUS_17480 136544 135744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 139000 137471 gene locus_tag LOCUS_17490 139000 137471 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_17490 139602 139006 gene locus_tag LOCUS_17500 139602 139006 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_17500 139546 139731 gene locus_tag LOCUS_17510 139546 139731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 140134 140502 gene locus_tag LOCUS_17520 gene queD 140134 140502 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_17520 141717 140608 gene locus_tag LOCUS_17530 141717 140608 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_17530 142198 142866 gene locus_tag LOCUS_17540 142198 142866 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_17540 143005 144282 gene locus_tag LOCUS_17550 gene tviB 143005 144282 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_17550 144392 146659 gene locus_tag LOCUS_17560 144392 146659 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112497.1 protein_id gnl|my_center|LOCUS_17560 146833 147330 gene locus_tag LOCUS_17570 146833 147330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 148029 147376 gene locus_tag LOCUS_17580 148029 147376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 148989 148045 gene locus_tag LOCUS_17590 148989 148045 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 protein_id gnl|my_center|LOCUS_17590 149782 148982 gene locus_tag LOCUS_17600 149782 148982 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_17600 150284 150619 gene locus_tag LOCUS_17610 150284 150619 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819377.1 protein_id gnl|my_center|LOCUS_17610 150816 150625 gene locus_tag LOCUS_17620 150816 150625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 151102 152973 gene locus_tag LOCUS_17630 151102 152973 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_17630 152970 154976 gene locus_tag LOCUS_17640 152970 154976 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_17640 154976 156844 gene locus_tag LOCUS_17650 gene aspA 154976 156844 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851742.1 protein_id gnl|my_center|LOCUS_17650 158138 156909 gene locus_tag LOCUS_17660 158138 156909 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_17660 158703 159728 gene locus_tag LOCUS_17670 158703 159728 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_17670 159725 160609 gene locus_tag LOCUS_17680 159725 160609 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_17680 160578 161987 gene locus_tag LOCUS_17690 160578 161987 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 protein_id gnl|my_center|LOCUS_17690 162184 162780 gene locus_tag LOCUS_17700 162184 162780 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749261.1 protein_id gnl|my_center|LOCUS_17700 163007 163744 gene locus_tag LOCUS_17710 163007 163744 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038753.1 protein_id gnl|my_center|LOCUS_17710 164513 163767 gene locus_tag LOCUS_17720 164513 163767 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_17720 165292 164546 gene locus_tag LOCUS_17730 165292 164546 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_17730 165550 165744 gene locus_tag LOCUS_17740 165550 165744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 166226 166726 gene locus_tag LOCUS_17750 166226 166726 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_17750 166839 167789 gene locus_tag LOCUS_17760 166839 167789 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144685205.1 protein_id gnl|my_center|LOCUS_17760 167786 168286 gene locus_tag LOCUS_17770 167786 168286 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_17770 168826 168338 gene locus_tag LOCUS_17780 168826 168338 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144198.1 protein_id gnl|my_center|LOCUS_17780 170900 168828 gene locus_tag LOCUS_17790 170900 168828 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_17790 172210 171242 gene locus_tag LOCUS_17800 172210 171242 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_17800 172807 173901 gene locus_tag LOCUS_17810 gene msrB 172807 173901 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796156.1 protein_id gnl|my_center|LOCUS_17810 175301 174018 gene locus_tag LOCUS_17820 gene thiC 175301 174018 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015816.1 protein_id gnl|my_center|LOCUS_17820 175985 175338 gene locus_tag LOCUS_17830 gene thiE 175985 175338 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939368.1 protein_id gnl|my_center|LOCUS_17830 176511 175966 gene locus_tag LOCUS_17840 176511 175966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 177617 176508 gene locus_tag LOCUS_17850 gene thiH 177617 176508 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393166.1 protein_id gnl|my_center|LOCUS_17850 178709 177936 gene locus_tag LOCUS_17860 178709 177936 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393165.1 protein_id gnl|my_center|LOCUS_17860 178954 178712 gene locus_tag LOCUS_17870 178954 178712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 180181 179786 gene locus_tag LOCUS_17880 180181 179786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 180424 180191 gene locus_tag LOCUS_17890 180424 180191 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791779.1 protein_id gnl|my_center|LOCUS_17890 180530 183025 gene locus_tag LOCUS_17900 180530 183025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 183476 184618 gene locus_tag LOCUS_17910 183476 184618 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384656.1 protein_id gnl|my_center|LOCUS_17910 185186 184791 gene locus_tag LOCUS_17920 185186 184791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 185586 185443 gene locus_tag LOCUS_17930 185586 185443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 186001 185729 gene locus_tag LOCUS_17940 186001 185729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 187290 185998 gene locus_tag LOCUS_17950 187290 185998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 187619 189913 gene locus_tag LOCUS_17960 187619 189913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 190142 191125 gene locus_tag LOCUS_17970 190142 191125 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583585.1 protein_id gnl|my_center|LOCUS_17970 191250 195608 gene locus_tag LOCUS_17980 191250 195608 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081484.1 protein_id gnl|my_center|LOCUS_17980 197044 195773 gene locus_tag LOCUS_17990 197044 195773 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040212.1 protein_id gnl|my_center|LOCUS_17990 197862 198383 gene locus_tag LOCUS_18000 gene cobO 197862 198383 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056120.1 protein_id gnl|my_center|LOCUS_18000 198582 200126 gene locus_tag LOCUS_18010 198582 200126 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932106.1 protein_id gnl|my_center|LOCUS_18010 200685 200281 gene locus_tag LOCUS_18020 200685 200281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 201294 201968 gene locus_tag LOCUS_18030 201294 201968 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162995.1 protein_id gnl|my_center|LOCUS_18030 202174 202980 gene locus_tag LOCUS_18040 gene thiM 202174 202980 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256281.1 protein_id gnl|my_center|LOCUS_18040 202991 203662 gene locus_tag LOCUS_18050 gene thiE 202991 203662 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_18050 203629 204453 gene locus_tag LOCUS_18060 gene thiD 203629 204453 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_18060 205647 204793 gene locus_tag LOCUS_18070 205647 204793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 206243 205749 gene locus_tag LOCUS_18080 206243 205749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 206422 207066 gene locus_tag LOCUS_18090 206422 207066 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072260.1 protein_id gnl|my_center|LOCUS_18090 207068 207373 gene locus_tag LOCUS_18100 207068 207373 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762233.1 protein_id gnl|my_center|LOCUS_18100 207405 208325 gene locus_tag LOCUS_18110 207405 208325 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 protein_id gnl|my_center|LOCUS_18110 208890 208393 gene locus_tag LOCUS_18120 208890 208393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 209375 208884 gene locus_tag LOCUS_18130 gene lepB 209375 208884 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_18130 210434 209787 gene locus_tag LOCUS_18140 210434 209787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 211147 210431 gene locus_tag LOCUS_18150 211147 210431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 211716 211288 gene locus_tag LOCUS_18160 gene trxC 211716 211288 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216643.1 protein_id gnl|my_center|LOCUS_18160 212128 213897 gene locus_tag LOCUS_18170 gene cydD 212128 213897 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261563.1 protein_id gnl|my_center|LOCUS_18170 213894 215639 gene locus_tag LOCUS_18180 gene cydC 213894 215639 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171075.1 protein_id gnl|my_center|LOCUS_18180 217682 215691 gene locus_tag LOCUS_18190 217682 215691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 218116 218859 gene locus_tag LOCUS_18200 218116 218859 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938534.1 protein_id gnl|my_center|LOCUS_18200 218965 219792 gene locus_tag LOCUS_18210 218965 219792 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792490.1 protein_id gnl|my_center|LOCUS_18210 219779 220519 gene locus_tag LOCUS_18220 219779 220519 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938532.1 protein_id gnl|my_center|LOCUS_18220 220617 220907 gene locus_tag LOCUS_18230 220617 220907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 221112 222788 gene locus_tag LOCUS_18240 221112 222788 CDS product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706282.1 protein_id gnl|my_center|LOCUS_18240 224121 223051 gene locus_tag LOCUS_18250 224121 223051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 224831 224118 gene locus_tag LOCUS_18260 224831 224118 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583200.1 protein_id gnl|my_center|LOCUS_18260 225967 224846 gene locus_tag LOCUS_18270 gene devC 225967 224846 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_18270 226949 225960 gene locus_tag LOCUS_18280 226949 225960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 227444 227031 gene locus_tag LOCUS_18290 227444 227031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 228215 227898 gene locus_tag LOCUS_18300 228215 227898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 229100 228252 gene locus_tag LOCUS_18310 229100 228252 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552077.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence223 >Feature sequence224 >Feature sequence225 >Feature sequence226 190 29 gene locus_tag LOCUS_18320 190 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18320 >Feature sequence227 >Feature sequence228 >Feature sequence229 >Feature sequence230 >Feature sequence231 >Feature sequence232 >Feature sequence233 345 1205 gene locus_tag LOCUS_18330 345 1205 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125497.1 protein_id gnl|my_center|LOCUS_18330 1205 2296 gene locus_tag LOCUS_18340 1205 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107641.1 protein_id gnl|my_center|LOCUS_18340 2388 3203 gene locus_tag LOCUS_18350 2388 3203 CDS product putative capsular polysaccharide synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478215.1 protein_id gnl|my_center|LOCUS_18350 3961 4857 gene locus_tag LOCUS_18360 3961 4857 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942157.1 protein_id gnl|my_center|LOCUS_18360 4962 6098 gene locus_tag LOCUS_18370 4962 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 6891 7397 gene locus_tag LOCUS_18380 6891 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 7394 8479 gene locus_tag LOCUS_18390 7394 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 8943 10766 gene locus_tag LOCUS_18400 8943 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 11797 10787 gene locus_tag LOCUS_18410 11797 10787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 12592 11801 gene locus_tag LOCUS_18420 12592 11801 CDS product PGL/p-HBAD biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003918527.1 protein_id gnl|my_center|LOCUS_18420 13821 12589 gene locus_tag LOCUS_18430 13821 12589 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_18430 14857 13823 gene locus_tag LOCUS_18440 14857 13823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 15975 14857 gene locus_tag LOCUS_18450 15975 14857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 17088 15991 gene locus_tag LOCUS_18460 17088 15991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 17641 17081 gene locus_tag LOCUS_18470 17641 17081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 18362 19114 gene locus_tag LOCUS_18480 18362 19114 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496955.1 protein_id gnl|my_center|LOCUS_18480 19125 19520 gene locus_tag LOCUS_18490 19125 19520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 19548 20531 gene locus_tag LOCUS_18500 gene galE 19548 20531 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992438.1 protein_id gnl|my_center|LOCUS_18500 20561 21517 gene locus_tag LOCUS_18510 20561 21517 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_18510 21874 22290 gene locus_tag LOCUS_18520 21874 22290 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_18520 22287 22586 gene locus_tag LOCUS_18530 22287 22586 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_18530 22929 22660 gene locus_tag LOCUS_18540 22929 22660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 23193 25712 gene locus_tag LOCUS_18550 23193 25712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 25766 26026 gene locus_tag LOCUS_18560 25766 26026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 26176 27162 gene locus_tag LOCUS_18570 26176 27162 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783220.1 protein_id gnl|my_center|LOCUS_18570 27193 28866 gene locus_tag LOCUS_18580 27193 28866 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_18580 28882 30057 gene locus_tag LOCUS_18590 28882 30057 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259083.1 protein_id gnl|my_center|LOCUS_18590 30158 32026 gene locus_tag LOCUS_18600 gene asnB 30158 32026 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_18600 32463 34049 gene locus_tag LOCUS_18610 32463 34049 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_18610 34095 35789 gene locus_tag LOCUS_18620 34095 35789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 35929 36828 gene locus_tag LOCUS_18630 35929 36828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 37166 36921 gene locus_tag LOCUS_18640 37166 36921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 37047 39101 gene locus_tag LOCUS_18650 37047 39101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 39105 39347 gene locus_tag LOCUS_18660 39105 39347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 39661 41526 gene locus_tag LOCUS_18670 39661 41526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence234 >Feature sequence235 >Feature sequence236 >Feature sequence237 >Feature sequence238 >Feature sequence239 >Feature sequence240 >Feature sequence241 >Feature sequence242 >Feature sequence243 >Feature sequence244 1491 226 gene locus_tag LOCUS_18680 1491 226 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_18680 1968 1810 gene locus_tag LOCUS_18690 1968 1810 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933679.1 protein_id gnl|my_center|LOCUS_18690 2552 2863 gene locus_tag LOCUS_18700 gene rplU 2552 2863 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943851.1 protein_id gnl|my_center|LOCUS_18700 2894 3151 gene locus_tag LOCUS_18710 gene rpmA 2894 3151 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_18710 3209 4279 gene locus_tag LOCUS_18720 gene obgE 3209 4279 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_18720 4263 5453 gene locus_tag LOCUS_18730 gene proB 4263 5453 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_18730 5839 7104 gene locus_tag LOCUS_18740 5839 7104 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_18740 7108 7785 gene locus_tag LOCUS_18750 gene nadD 7108 7785 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144004.1 protein_id gnl|my_center|LOCUS_18750 7782 11096 gene locus_tag LOCUS_18760 7782 11096 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_18760 11098 12798 gene locus_tag LOCUS_18770 11098 12798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 13021 14328 gene locus_tag LOCUS_18780 13021 14328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 14855 14400 gene locus_tag LOCUS_18790 14855 14400 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939197.1 protein_id gnl|my_center|LOCUS_18790 16459 14864 gene locus_tag LOCUS_18800 16459 14864 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_18800 18392 16953 gene locus_tag LOCUS_18810 18392 16953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 19794 18415 gene locus_tag LOCUS_18820 19794 18415 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_18820 21374 19869 gene locus_tag LOCUS_18830 gene rng 21374 19869 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_18830 21778 22620 gene locus_tag LOCUS_18840 21778 22620 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_18840 22626 23750 gene locus_tag LOCUS_18850 22626 23750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 24019 24303 gene locus_tag LOCUS_18860 24019 24303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 25232 24342 gene locus_tag LOCUS_18870 25232 24342 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_18870 25696 26790 gene locus_tag LOCUS_18880 25696 26790 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_18880 26822 27196 gene locus_tag LOCUS_18890 26822 27196 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_18890 27362 27493 gene locus_tag LOCUS_18900 27362 27493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 27512 27841 gene locus_tag LOCUS_18910 27512 27841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 29350 28040 gene locus_tag LOCUS_18920 29350 28040 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939416.1 protein_id gnl|my_center|LOCUS_18920 31107 29410 gene locus_tag LOCUS_18930 31107 29410 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939515.1 protein_id gnl|my_center|LOCUS_18930 31759 31253 gene locus_tag LOCUS_18940 31759 31253 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_18940 33492 32260 gene locus_tag LOCUS_18950 33492 32260 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941190.1 protein_id gnl|my_center|LOCUS_18950 35132 33807 gene locus_tag LOCUS_18960 35132 33807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 35809 35297 gene locus_tag LOCUS_18970 35809 35297 CDS product DUF2058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086049.1 protein_id gnl|my_center|LOCUS_18970 36307 38430 gene locus_tag LOCUS_18980 36307 38430 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_18980 38564 39352 gene locus_tag LOCUS_18990 gene trxB 38564 39352 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080734.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence245 >Feature sequence246 >Feature sequence247 >Feature sequence248 >Feature sequence249 >Feature sequence250 >Feature sequence251 >Feature sequence252 >Feature sequence253 >Feature sequence254 >Feature sequence255 188 760 gene locus_tag LOCUS_19000 188 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 1136 1504 gene locus_tag LOCUS_19010 1136 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 1586 1894 gene locus_tag LOCUS_19020 1586 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1908 3608 gene locus_tag LOCUS_19030 1908 3608 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_19030 4164 3844 gene locus_tag LOCUS_19040 4164 3844 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028066.1 protein_id gnl|my_center|LOCUS_19040 4365 4177 gene locus_tag LOCUS_19050 4365 4177 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096523.1 protein_id gnl|my_center|LOCUS_19050 6983 4407 gene locus_tag LOCUS_19060 6983 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 7419 8456 gene locus_tag LOCUS_19070 7419 8456 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 protein_id gnl|my_center|LOCUS_19070 8447 9904 gene locus_tag LOCUS_19080 8447 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427771.1 protein_id gnl|my_center|LOCUS_19080 10803 9934 gene locus_tag LOCUS_19090 10803 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 11258 10803 gene locus_tag LOCUS_19100 11258 10803 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931994.1 protein_id gnl|my_center|LOCUS_19100 11788 11258 gene locus_tag LOCUS_19110 gene coaD 11788 11258 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938824.1 protein_id gnl|my_center|LOCUS_19110 12439 11861 gene locus_tag LOCUS_19120 gene rsmD 12439 11861 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241227.1 protein_id gnl|my_center|LOCUS_19120 13217 12465 gene locus_tag LOCUS_19130 gene pssA 13217 12465 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_19130 14383 13715 gene locus_tag LOCUS_19140 14383 13715 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940238.1 protein_id gnl|my_center|LOCUS_19140 14944 14456 gene locus_tag LOCUS_19150 gene ilvN 14944 14456 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_19150 16725 15025 gene locus_tag LOCUS_19160 gene ilvB 16725 15025 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938671.1 protein_id gnl|my_center|LOCUS_19160 16845 17039 gene locus_tag LOCUS_19170 16845 17039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 17593 17006 gene locus_tag LOCUS_19180 17593 17006 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939849.1 protein_id gnl|my_center|LOCUS_19180 19046 18183 gene locus_tag LOCUS_19190 19046 18183 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878207.1 protein_id gnl|my_center|LOCUS_19190 20015 19167 gene locus_tag LOCUS_19200 20015 19167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 20586 22292 gene locus_tag LOCUS_19210 20586 22292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 22520 22723 gene locus_tag LOCUS_19220 22520 22723 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942197.1 protein_id gnl|my_center|LOCUS_19220 22773 24476 gene locus_tag LOCUS_19230 22773 24476 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399950.1 protein_id gnl|my_center|LOCUS_19230 24548 25492 gene locus_tag LOCUS_19240 24548 25492 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713800.1 protein_id gnl|my_center|LOCUS_19240 25905 27320 gene locus_tag LOCUS_19250 25905 27320 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816520.1 protein_id gnl|my_center|LOCUS_19250 29337 27592 gene locus_tag LOCUS_19260 29337 27592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 32797 29450 gene locus_tag LOCUS_19270 32797 29450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 35170 32843 gene locus_tag LOCUS_19280 35170 32843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 37472 35163 gene locus_tag LOCUS_19290 37472 35163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 <38542 37696 gene locus_tag LOCUS_19300 <38542 37696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941506.1:ATP-binding protein note possible pseudo, frameshifted >Feature sequence256 >Feature sequence257 2 211 gene locus_tag LOCUS_19310 2 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence258 >Feature sequence259 >Feature sequence260 >Feature sequence261 >Feature sequence262 >Feature sequence263 >Feature sequence264 >Feature sequence265 >Feature sequence266 194 2728 gene locus_tag LOCUS_19320 194 2728 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057914.1 protein_id gnl|my_center|LOCUS_19320 2863 4797 gene locus_tag LOCUS_19330 2863 4797 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250356.1 protein_id gnl|my_center|LOCUS_19330 6835 4943 gene locus_tag LOCUS_19340 6835 4943 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929297.1 protein_id gnl|my_center|LOCUS_19340 7263 7550 gene locus_tag LOCUS_19350 7263 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 8782 7901 gene locus_tag LOCUS_19360 gene purU 8782 7901 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762395.1 protein_id gnl|my_center|LOCUS_19360 9619 9104 gene locus_tag LOCUS_19370 9619 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 10694 9915 gene locus_tag LOCUS_19380 10694 9915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 12432 10882 gene locus_tag LOCUS_19390 gene guaA 12432 10882 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_19390 13939 12476 gene locus_tag LOCUS_19400 gene guaB 13939 12476 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938343.1 protein_id gnl|my_center|LOCUS_19400 14692 15375 gene locus_tag LOCUS_19410 14692 15375 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_19410 15936 15649 gene locus_tag LOCUS_19420 gene ihfB 15936 15649 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091441.1 protein_id gnl|my_center|LOCUS_19420 17825 16092 gene locus_tag LOCUS_19430 17825 16092 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940408.1 protein_id gnl|my_center|LOCUS_19430 18738 18058 gene locus_tag LOCUS_19440 18738 18058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 19971 18799 gene locus_tag LOCUS_19450 19971 18799 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_19450 20484 22268 gene locus_tag LOCUS_19460 gene ilvD 20484 22268 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_19460 22520 23368 gene locus_tag LOCUS_19470 22520 23368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 23899 23699 gene locus_tag LOCUS_19480 23899 23699 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546429.1 protein_id gnl|my_center|LOCUS_19480 25778 24909 gene locus_tag LOCUS_19490 gene glyQ 25778 24909 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460838.1 protein_id gnl|my_center|LOCUS_19490 26126 28954 gene locus_tag LOCUS_19500 gene uvrA 26126 28954 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462189.1 protein_id gnl|my_center|LOCUS_19500 29378 29842 gene locus_tag LOCUS_19510 gene secB 29378 29842 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970595.1 protein_id gnl|my_center|LOCUS_19510 30757 30266 gene locus_tag LOCUS_19520 30757 30266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 31753 31301 gene locus_tag LOCUS_19530 31753 31301 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546418.1 protein_id gnl|my_center|LOCUS_19530 32499 31828 gene locus_tag LOCUS_19540 32499 31828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 32924 32553 gene locus_tag LOCUS_19550 32924 32553 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_19550 33870 33337 gene locus_tag LOCUS_19560 33870 33337 CDS product DUF5698 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357138.1 protein_id gnl|my_center|LOCUS_19560 34445 36130 gene locus_tag LOCUS_19570 gene ettA 34445 36130 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_19570 36853 36182 gene locus_tag LOCUS_19580 36853 36182 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence267 >Feature sequence268 >Feature sequence269 >Feature sequence270 >Feature sequence271 >Feature sequence272 >Feature sequence273 >Feature sequence274 >Feature sequence275 >Feature sequence276 760 566 gene locus_tag LOCUS_19590 760 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1331 2617 gene locus_tag LOCUS_19600 1331 2617 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994245.1 protein_id gnl|my_center|LOCUS_19600 2617 3219 gene locus_tag LOCUS_19610 2617 3219 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_19610 3486 4892 gene locus_tag LOCUS_19620 3486 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 5011 5337 gene locus_tag LOCUS_19630 5011 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 5321 5701 gene locus_tag LOCUS_19640 5321 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 5780 7225 gene locus_tag LOCUS_19650 5780 7225 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_19650 7228 7863 gene locus_tag LOCUS_19660 7228 7863 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727561.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19660 7856 11221 gene locus_tag LOCUS_19670 7856 11221 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_19670 11218 12393 gene locus_tag LOCUS_19680 11218 12393 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_19680 12813 14933 gene locus_tag LOCUS_19690 gene aspS 12813 14933 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881092.1 protein_id gnl|my_center|LOCUS_19690 15018 16238 gene locus_tag LOCUS_19700 gene gatA 15018 16238 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040608.1 protein_id gnl|my_center|LOCUS_19700 16235 17671 gene locus_tag LOCUS_19710 gene gatB 16235 17671 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880264.1 protein_id gnl|my_center|LOCUS_19710 18628 17849 gene locus_tag LOCUS_19720 18628 17849 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_19720 19342 22017 gene locus_tag LOCUS_19730 19342 22017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 22299 22475 gene locus_tag LOCUS_19740 22299 22475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 22444 22797 gene locus_tag LOCUS_19750 22444 22797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 22985 22909 gene locus_tag LOCUS_t00170 22985 22909 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 23658 23125 gene locus_tag LOCUS_19760 23658 23125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 24142 25389 gene locus_tag LOCUS_19770 24142 25389 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_19770 25778 29446 gene locus_tag LOCUS_19780 25778 29446 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932819.1 protein_id gnl|my_center|LOCUS_19780 29831 29460 gene locus_tag LOCUS_19790 29831 29460 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706544.1 protein_id gnl|my_center|LOCUS_19790 30256 30627 gene locus_tag LOCUS_19800 30256 30627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 31045 32046 gene locus_tag LOCUS_19810 gene mnmA 31045 32046 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_19810 32043 33368 gene locus_tag LOCUS_19820 gene mtaB 32043 33368 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_19820 34018 35241 gene locus_tag LOCUS_19830 34018 35241 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_19830 35265 36311 gene locus_tag LOCUS_19840 gene recA 35265 36311 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_19840 36704 37192 gene locus_tag LOCUS_19850 36704 37192 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941234.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence277 >Feature sequence278 >Feature sequence279 >Feature sequence280 >Feature sequence281 >Feature sequence282 >Feature sequence283 >Feature sequence284 >Feature sequence285 >Feature sequence286 >Feature sequence287 131 997 gene locus_tag LOCUS_19860 131 997 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_19860 1008 2258 gene locus_tag LOCUS_19870 1008 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2384 3019 gene locus_tag LOCUS_19880 2384 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 3000 3734 gene locus_tag LOCUS_19890 3000 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 4932 3793 gene locus_tag LOCUS_19900 4932 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 5678 4932 gene locus_tag LOCUS_19910 5678 4932 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920801.1 protein_id gnl|my_center|LOCUS_19910 6181 5684 gene locus_tag LOCUS_19920 6181 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 6587 6402 gene locus_tag LOCUS_19930 6587 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 7818 6580 gene locus_tag LOCUS_19940 7818 6580 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_19940 8785 7949 gene locus_tag LOCUS_19950 8785 7949 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058219.1 protein_id gnl|my_center|LOCUS_19950 9837 8842 gene locus_tag LOCUS_19960 9837 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 11416 10745 gene locus_tag LOCUS_19970 11416 10745 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403380.1 protein_id gnl|my_center|LOCUS_19970 12578 11460 gene locus_tag LOCUS_19980 12578 11460 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_19980 13290 12592 gene locus_tag LOCUS_19990 13290 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 13548 13399 gene locus_tag LOCUS_20000 13548 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 14906 13830 gene locus_tag LOCUS_20010 gene neuB 14906 13830 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066398080.1 protein_id gnl|my_center|LOCUS_20010 15634 14885 gene locus_tag LOCUS_20020 15634 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 16485 15631 gene locus_tag LOCUS_20030 16485 15631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 18088 16478 gene locus_tag LOCUS_20040 18088 16478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 18705 18208 gene locus_tag LOCUS_20050 18705 18208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 19365 18748 gene locus_tag LOCUS_20060 19365 18748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 20091 19381 gene locus_tag LOCUS_20070 gene pseF 20091 19381 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_20070 21737 20088 gene locus_tag LOCUS_20080 21737 20088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 21987 21724 gene locus_tag LOCUS_20090 21987 21724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 23060 22044 gene locus_tag LOCUS_20100 gene pseB 23060 22044 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_20100 24905 23091 gene locus_tag LOCUS_20110 24905 23091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052039695.1 protein_id gnl|my_center|LOCUS_20110 25193 24942 gene locus_tag LOCUS_20120 25193 24942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 25770 25222 gene locus_tag LOCUS_20130 25770 25222 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_20130 26059 25871 gene locus_tag LOCUS_20140 26059 25871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 26077 27219 gene locus_tag LOCUS_20150 gene gmd 26077 27219 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_20150 27478 28638 gene locus_tag LOCUS_20160 27478 28638 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544929.1 protein_id gnl|my_center|LOCUS_20160 29722 28769 gene locus_tag LOCUS_20170 29722 28769 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_20170 31488 29770 gene locus_tag LOCUS_20180 31488 29770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 31897 31475 gene locus_tag LOCUS_20190 31897 31475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 32210 31872 gene locus_tag LOCUS_20200 32210 31872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 33861 32686 gene locus_tag LOCUS_20210 33861 32686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 35965 33845 gene locus_tag LOCUS_20220 35965 33845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 36451 36026 gene locus_tag LOCUS_20230 36451 36026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 36922 37167 gene locus_tag LOCUS_20240 36922 37167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence288 >Feature sequence289 >Feature sequence290 >Feature sequence291 >Feature sequence292 >Feature sequence293 >Feature sequence294 >Feature sequence295 >Feature sequence296 >Feature sequence297 >Feature sequence298 880 1158 gene locus_tag LOCUS_20250 880 1158 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810239.1 protein_id gnl|my_center|LOCUS_20250 1398 2021 gene locus_tag LOCUS_20260 1398 2021 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932570.1 protein_id gnl|my_center|LOCUS_20260 2194 3507 gene locus_tag LOCUS_20270 2194 3507 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880611.1 protein_id gnl|my_center|LOCUS_20270 3584 5107 gene locus_tag LOCUS_20280 3584 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 5111 6835 gene locus_tag LOCUS_20290 5111 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 6838 8523 gene locus_tag LOCUS_20300 6838 8523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 8745 8930 gene locus_tag LOCUS_20310 8745 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 8917 10161 gene locus_tag LOCUS_20320 8917 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 11027 10332 gene locus_tag LOCUS_20330 gene yrfG 11027 10332 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942337.1 protein_id gnl|my_center|LOCUS_20330 14560 11024 gene locus_tag LOCUS_20340 gene mfd 14560 11024 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_20340 17249 14610 gene locus_tag LOCUS_20350 gene bamA 17249 14610 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791908.1 protein_id gnl|my_center|LOCUS_20350 18393 17626 gene locus_tag LOCUS_20360 18393 17626 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_20360 18868 20085 gene locus_tag LOCUS_20370 18868 20085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 20455 20168 gene locus_tag LOCUS_20380 20455 20168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 20396 20881 gene locus_tag LOCUS_20390 20396 20881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 21477 22793 gene locus_tag LOCUS_20400 gene dnaA 21477 22793 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_20400 24378 22975 gene locus_tag LOCUS_20410 gene hemG 24378 22975 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545161.1 protein_id gnl|my_center|LOCUS_20410 24563 26452 gene locus_tag LOCUS_20420 gene htpG 24563 26452 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_20420 26636 27013 gene locus_tag LOCUS_20430 26636 27013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 27010 27663 gene locus_tag LOCUS_20440 27010 27663 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_20440 27647 28279 gene locus_tag LOCUS_20450 27647 28279 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533195.1 protein_id gnl|my_center|LOCUS_20450 28401 30227 gene locus_tag LOCUS_20460 28401 30227 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039157.1 protein_id gnl|my_center|LOCUS_20460 30574 31047 gene locus_tag LOCUS_20470 gene smpB 30574 31047 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_20470 31109 31468 gene locus_tag LOCUS_tm00010 31109 31468 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 31864 31556 gene locus_tag LOCUS_20480 31864 31556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 32115 32582 gene locus_tag LOCUS_20490 32115 32582 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_20490 32579 32908 gene locus_tag LOCUS_20500 32579 32908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 32905 33114 gene locus_tag LOCUS_20510 32905 33114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 33114 33704 gene locus_tag LOCUS_20520 33114 33704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 33785 34795 gene locus_tag LOCUS_20530 33785 34795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 34788 34958 gene locus_tag LOCUS_20540 34788 34958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 34955 35260 gene locus_tag LOCUS_20550 34955 35260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence299 >Feature sequence300 >Feature sequence301 >Feature sequence302 >Feature sequence303 >Feature sequence304 >Feature sequence305 >Feature sequence306 >Feature sequence307 >Feature sequence308 >Feature sequence309 262 648 gene locus_tag LOCUS_20560 262 648 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943046.1 protein_id gnl|my_center|LOCUS_20560 743 1315 gene locus_tag LOCUS_20570 743 1315 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444187.1 protein_id gnl|my_center|LOCUS_20570 2240 1455 gene locus_tag LOCUS_20580 2240 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2773 2372 gene locus_tag LOCUS_20590 2773 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 4299 2794 gene locus_tag LOCUS_20600 4299 2794 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258626.1 protein_id gnl|my_center|LOCUS_20600 5237 4302 gene locus_tag LOCUS_20610 5237 4302 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893633.1 protein_id gnl|my_center|LOCUS_20610 5809 6066 gene locus_tag LOCUS_20620 5809 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 7116 6226 gene locus_tag LOCUS_20630 7116 6226 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_20630 7517 7975 gene locus_tag LOCUS_20640 7517 7975 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_20640 7987 8388 gene locus_tag LOCUS_20650 7987 8388 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922983.1 protein_id gnl|my_center|LOCUS_20650 9400 8561 gene locus_tag LOCUS_20660 9400 8561 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941333.1 protein_id gnl|my_center|LOCUS_20660 10259 9402 gene locus_tag LOCUS_20670 gene ubiA 10259 9402 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_20670 10834 10262 gene locus_tag LOCUS_20680 10834 10262 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940563.1 protein_id gnl|my_center|LOCUS_20680 11594 10875 gene locus_tag LOCUS_20690 11594 10875 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940432.1 protein_id gnl|my_center|LOCUS_20690 12460 11636 gene locus_tag LOCUS_20700 12460 11636 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_20700 13698 12466 gene locus_tag LOCUS_20710 13698 12466 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942352.1 protein_id gnl|my_center|LOCUS_20710 14756 13698 gene locus_tag LOCUS_20720 gene mqnC 14756 13698 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940023.1 protein_id gnl|my_center|LOCUS_20720 15857 14763 gene locus_tag LOCUS_20730 gene mqnE 15857 14763 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_20730 17430 16111 gene locus_tag LOCUS_20740 17430 16111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 17851 19434 gene locus_tag LOCUS_20750 gene malQ 17851 19434 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_20750 19415 19987 gene locus_tag LOCUS_20760 19415 19987 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459824.1 protein_id gnl|my_center|LOCUS_20760 20076 20151 gene locus_tag LOCUS_t00180 20076 20151 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20543 20941 gene locus_tag LOCUS_20770 20543 20941 CDS product PA2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939881.1 protein_id gnl|my_center|LOCUS_20770 20943 21485 gene locus_tag LOCUS_20780 20943 21485 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545498.1 protein_id gnl|my_center|LOCUS_20780 21482 22063 gene locus_tag LOCUS_20790 21482 22063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 22715 22524 gene locus_tag LOCUS_20800 22715 22524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 24018 22795 gene locus_tag LOCUS_20810 24018 22795 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_20810 24305 27796 gene locus_tag LOCUS_20820 24305 27796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence310 >Feature sequence311 >Feature sequence312 245 9 gene locus_tag LOCUS_20830 245 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence313 >Feature sequence314 >Feature sequence315 >Feature sequence316 >Feature sequence317 >Feature sequence318 >Feature sequence319 >Feature sequence320 731 477 gene locus_tag LOCUS_20840 gene relE 731 477 CDS product type II toxin-antitoxin system mRNA interferase RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898789.1 protein_id gnl|my_center|LOCUS_20840 930 709 gene locus_tag LOCUS_20850 930 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 2400 1438 gene locus_tag LOCUS_20860 2400 1438 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970133.1 protein_id gnl|my_center|LOCUS_20860 2868 4379 gene locus_tag LOCUS_20870 2868 4379 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918532.1 protein_id gnl|my_center|LOCUS_20870 5466 4432 gene locus_tag LOCUS_20880 5466 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 6512 5754 gene locus_tag LOCUS_20890 gene ubiE 6512 5754 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103462.1 protein_id gnl|my_center|LOCUS_20890 7986 6766 gene locus_tag LOCUS_20900 7986 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 9850 8006 gene locus_tag LOCUS_20910 9850 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 10692 10027 gene locus_tag LOCUS_20920 10692 10027 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022654.1 protein_id gnl|my_center|LOCUS_20920 11036 10827 gene locus_tag LOCUS_20930 11036 10827 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940352.1 protein_id gnl|my_center|LOCUS_20930 12159 11137 gene locus_tag LOCUS_20940 12159 11137 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986837.1 protein_id gnl|my_center|LOCUS_20940 14327 12561 gene locus_tag LOCUS_20950 14327 12561 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704111.1 protein_id gnl|my_center|LOCUS_20950 18360 14575 gene locus_tag LOCUS_20960 18360 14575 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926858.1 protein_id gnl|my_center|LOCUS_20960 19867 18380 gene locus_tag LOCUS_20970 19867 18380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 22071 20050 gene locus_tag LOCUS_20980 22071 20050 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545775.1 protein_id gnl|my_center|LOCUS_20980 22436 22200 gene locus_tag LOCUS_20990 22436 22200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 23806 22595 gene locus_tag LOCUS_21000 23806 22595 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_21000 24568 23834 gene locus_tag LOCUS_21010 24568 23834 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545759.1 protein_id gnl|my_center|LOCUS_21010 25404 24568 gene locus_tag LOCUS_21020 25404 24568 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_21020 26468 25416 gene locus_tag LOCUS_21030 26468 25416 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932112.1 protein_id gnl|my_center|LOCUS_21030 <27539 26465 gene locus_tag LOCUS_21040 <27539 26465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932111.1:magnesium chelatase subunit D family protein >Feature sequence321 >Feature sequence322 >Feature sequence323 >Feature sequence324 >Feature sequence325 >Feature sequence326 >Feature sequence327 >Feature sequence328 >Feature sequence329 51 127 gene locus_tag LOCUS_t00190 51 127 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence330 >Feature sequence331 134 1882 gene locus_tag LOCUS_21050 134 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1898 2545 gene locus_tag LOCUS_21060 1898 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 3075 2641 gene locus_tag LOCUS_21070 3075 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 3589 3158 gene locus_tag LOCUS_21080 3589 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 4519 3779 gene locus_tag LOCUS_21090 gene istB 4519 3779 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391832.1 protein_id gnl|my_center|LOCUS_21090 5996 4506 gene locus_tag LOCUS_21100 5996 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 6405 5986 gene locus_tag LOCUS_21110 6405 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 6898 6485 gene locus_tag LOCUS_21120 6898 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 7536 7075 gene locus_tag LOCUS_21130 7536 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21130 7832 7533 gene locus_tag LOCUS_21140 7832 7533 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_21140 8167 9213 gene locus_tag LOCUS_21150 8167 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 10060 11367 gene locus_tag LOCUS_21160 10060 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 11761 12744 gene locus_tag LOCUS_21170 11761 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21170 13250 14251 gene locus_tag LOCUS_21180 13250 14251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 15424 14768 gene locus_tag LOCUS_21190 15424 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 18366 15598 gene locus_tag LOCUS_21200 18366 15598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 19066 18509 gene locus_tag LOCUS_21210 19066 18509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 19209 19445 gene locus_tag LOCUS_21220 19209 19445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 22515 19504 gene locus_tag LOCUS_21230 22515 19504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 23521 22733 gene locus_tag LOCUS_21240 23521 22733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 25936 23720 gene locus_tag LOCUS_21250 25936 23720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence332 643 2853 gene locus_tag LOCUS_21260 gene rlmKL 643 2853 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819954.1 protein_id gnl|my_center|LOCUS_21260 2850 3368 gene locus_tag LOCUS_21270 gene yfcD 2850 3368 CDS product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815932.1 protein_id gnl|my_center|LOCUS_21270 4147 3431 gene locus_tag LOCUS_21280 gene rph 4147 3431 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083501.1 protein_id gnl|my_center|LOCUS_21280 4741 4292 gene locus_tag LOCUS_21290 4741 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 7180 5015 gene locus_tag LOCUS_21300 7180 5015 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_21300 9066 7357 gene locus_tag LOCUS_21310 9066 7357 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_21310 10211 9114 gene locus_tag LOCUS_21320 gene ispG 10211 9114 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_21320 10938 10204 gene locus_tag LOCUS_21330 gene tsaB 10938 10204 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_21330 12008 10923 gene locus_tag LOCUS_21340 gene rseP 12008 10923 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942559.1 protein_id gnl|my_center|LOCUS_21340 13526 12369 gene locus_tag LOCUS_21350 13526 12369 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_21350 14320 13523 gene locus_tag LOCUS_21360 14320 13523 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_21360 15067 14327 gene locus_tag LOCUS_21370 15067 14327 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_21370 15621 15100 gene locus_tag LOCUS_21380 gene frr 15621 15100 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_21380 16480 15758 gene locus_tag LOCUS_21390 gene pyrH 16480 15758 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 protein_id gnl|my_center|LOCUS_21390 17099 16509 gene locus_tag LOCUS_21400 gene tsf 17099 16509 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_21400 18346 17570 gene locus_tag LOCUS_21410 gene rpsB 18346 17570 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_21410 19503 18703 gene locus_tag LOCUS_21420 19503 18703 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_21420 19938 19543 gene locus_tag LOCUS_21430 19938 19543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 21035 19995 gene locus_tag LOCUS_21440 21035 19995 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_21440 21685 21056 gene locus_tag LOCUS_21450 gene rpsD 21685 21056 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_21450 22144 21746 gene locus_tag LOCUS_21460 gene rpsK 22144 21746 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101625.1 protein_id gnl|my_center|LOCUS_21460 22557 22189 gene locus_tag LOCUS_21470 gene rpsM 22557 22189 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938621.1 protein_id gnl|my_center|LOCUS_21470 22981 22745 gene locus_tag LOCUS_21480 gene infA 22981 22745 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_21480 23895 23101 gene locus_tag LOCUS_21490 gene map 23895 23101 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_21490 25207 23903 gene locus_tag LOCUS_21500 gene secY 25207 23903 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_21500 25648 25211 gene locus_tag LOCUS_21510 gene rplO 25648 25211 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943467.1 protein_id gnl|my_center|LOCUS_21510 25830 25651 gene locus_tag LOCUS_21520 gene rpmD 25830 25651 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536508.1 protein_id gnl|my_center|LOCUS_21520 26370 25858 gene locus_tag LOCUS_21530 gene rpsE 26370 25858 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_21530 26773 26408 gene locus_tag LOCUS_21540 gene rplR 26773 26408 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357434.1 protein_id gnl|my_center|LOCUS_21540 27346 26807 gene locus_tag LOCUS_21550 gene rplF 27346 26807 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851302.1 protein_id gnl|my_center|LOCUS_21550 27777 27379 gene locus_tag LOCUS_21560 gene rpsH 27777 27379 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_21560 28677 28078 gene locus_tag LOCUS_21570 gene rplE 28677 28078 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_21570 28982 28647 gene locus_tag LOCUS_21580 gene rplX 28982 28647 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_21580 29385 29017 gene locus_tag LOCUS_21590 gene rplN 29385 29017 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938608.1 protein_id gnl|my_center|LOCUS_21590 29701 29447 gene locus_tag LOCUS_21600 gene rpsQ 29701 29447 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869920.1 protein_id gnl|my_center|LOCUS_21600 29924 29736 gene locus_tag LOCUS_21610 gene rpmC 29924 29736 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549032.1 protein_id gnl|my_center|LOCUS_21610 30337 29921 gene locus_tag LOCUS_21620 gene rplP 30337 29921 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950835.1 protein_id gnl|my_center|LOCUS_21620 31029 30361 gene locus_tag LOCUS_21630 gene rpsC 31029 30361 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_21630 31421 31089 gene locus_tag LOCUS_21640 gene rplV 31421 31089 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486710.1 protein_id gnl|my_center|LOCUS_21640 31738 31466 gene locus_tag LOCUS_21650 gene rpsS 31738 31466 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_21650 32469 31756 gene locus_tag LOCUS_21660 gene rplB 32469 31756 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_21660 32919 32629 gene locus_tag LOCUS_21670 32919 32629 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_21670 33539 32916 gene locus_tag LOCUS_21680 gene rplD 33539 32916 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_21680 34201 33569 gene locus_tag LOCUS_21690 gene rplC 34201 33569 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_21690 34594 34280 gene locus_tag LOCUS_21700 gene rpsJ 34594 34280 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_21700 35795 34605 gene locus_tag LOCUS_21710 gene tuf 35795 34605 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943488.1 protein_id gnl|my_center|LOCUS_21710 37906 35825 gene locus_tag LOCUS_21720 gene fusA 37906 35825 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_21720 38495 38022 gene locus_tag LOCUS_21730 gene rpsG 38495 38022 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385326.1 protein_id gnl|my_center|LOCUS_21730 38896 38525 gene locus_tag LOCUS_21740 gene rpsL 38896 38525 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_21740 43071 39007 gene locus_tag LOCUS_21750 gene rpoC 43071 39007 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_21750 47234 43158 gene locus_tag LOCUS_21760 gene rpoB 47234 43158 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_21760 47809 47432 gene locus_tag LOCUS_21770 gene rplL 47809 47432 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_21770 48394 47876 gene locus_tag LOCUS_21780 gene rplJ 48394 47876 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390507.1 protein_id gnl|my_center|LOCUS_21780 49353 48643 gene locus_tag LOCUS_21790 gene rplA 49353 48643 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_21790 49736 49416 gene locus_tag LOCUS_21800 49736 49416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 50432 49869 gene locus_tag LOCUS_21810 gene nusG 50432 49869 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_21810 50730 50455 gene locus_tag LOCUS_21820 50730 50455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 50841 50766 gene locus_tag LOCUS_t00200 50841 50766 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 52267 51077 gene locus_tag LOCUS_21830 gene tuf 52267 51077 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943488.1 protein_id gnl|my_center|LOCUS_21830 52408 52334 gene locus_tag LOCUS_t00210 52408 52334 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 52537 52463 gene locus_tag LOCUS_t00220 52537 52463 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 52675 52591 gene locus_tag LOCUS_t00230 52675 52591 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 52833 52758 gene locus_tag LOCUS_t00240 52833 52758 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 54269 53061 gene locus_tag LOCUS_21840 gene qmoC 54269 53061 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938150.1 protein_id gnl|my_center|LOCUS_21840 56643 54394 gene locus_tag LOCUS_21850 56643 54394 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938149.1 protein_id gnl|my_center|LOCUS_21850 57908 56655 gene locus_tag LOCUS_21860 57908 56655 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546111.1 protein_id gnl|my_center|LOCUS_21860 60110 58095 gene locus_tag LOCUS_21870 gene aprA 60110 58095 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938147.1 protein_id gnl|my_center|LOCUS_21870 60599 60174 gene locus_tag LOCUS_21880 gene aprB 60599 60174 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938146.1 protein_id gnl|my_center|LOCUS_21880 63168 60994 gene locus_tag LOCUS_21890 63168 60994 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 protein_id gnl|my_center|LOCUS_21890 63881 63462 gene locus_tag LOCUS_21900 gene nusB 63881 63462 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_21900 64423 63956 gene locus_tag LOCUS_21910 gene ribE 64423 63956 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_21910 65912 64668 gene locus_tag LOCUS_21920 65912 64668 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_21920 66753 66103 gene locus_tag LOCUS_21930 66753 66103 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_21930 67359 66754 gene locus_tag LOCUS_21940 67359 66754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 68497 67352 gene locus_tag LOCUS_21950 68497 67352 CDS product PBS lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393103.1 protein_id gnl|my_center|LOCUS_21950 69134 68487 gene locus_tag LOCUS_21960 69134 68487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 70421 69291 gene locus_tag LOCUS_21970 70421 69291 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_21970 70567 70653 gene locus_tag LOCUS_t00250 70567 70653 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 72865 70817 gene locus_tag LOCUS_21980 gene recD 72865 70817 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103277.1 protein_id gnl|my_center|LOCUS_21980 76544 72849 gene locus_tag LOCUS_21990 gene recB 76544 72849 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103276.1 protein_id gnl|my_center|LOCUS_21990 80077 76547 gene locus_tag LOCUS_22000 gene recC 80077 76547 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793829.1 protein_id gnl|my_center|LOCUS_22000 80948 80373 gene locus_tag LOCUS_22010 80948 80373 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_22010 81274 81092 gene locus_tag LOCUS_22020 81274 81092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 81248 81442 gene locus_tag LOCUS_22030 81248 81442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 81588 82247 gene locus_tag LOCUS_22040 81588 82247 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938888.1 protein_id gnl|my_center|LOCUS_22040 82854 85343 gene locus_tag LOCUS_22050 82854 85343 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_22050 86009 85467 gene locus_tag LOCUS_22060 gene orn 86009 85467 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_22060 87216 86236 gene locus_tag LOCUS_22070 87216 86236 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 protein_id gnl|my_center|LOCUS_22070 87765 89216 gene locus_tag LOCUS_22080 87765 89216 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937940.1 protein_id gnl|my_center|LOCUS_22080 89171 89551 gene locus_tag LOCUS_22090 89171 89551 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939916.1 protein_id gnl|my_center|LOCUS_22090 90181 90972 gene locus_tag LOCUS_22100 90181 90972 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_22100 91289 92140 gene locus_tag LOCUS_22110 91289 92140 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272323.1 protein_id gnl|my_center|LOCUS_22110 92206 92655 gene locus_tag LOCUS_22120 92206 92655 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_22120 92789 93934 gene locus_tag LOCUS_22130 92789 93934 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_22130 94084 96087 gene locus_tag LOCUS_22140 94084 96087 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986815.1 protein_id gnl|my_center|LOCUS_22140 96274 97041 gene locus_tag LOCUS_22150 96274 97041 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986814.1 protein_id gnl|my_center|LOCUS_22150 97053 97970 gene locus_tag LOCUS_22160 97053 97970 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933795.1 protein_id gnl|my_center|LOCUS_22160 99211 98105 gene locus_tag LOCUS_22170 99211 98105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 99335 100309 gene locus_tag LOCUS_22180 99335 100309 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942309.1 protein_id gnl|my_center|LOCUS_22180 100439 101644 gene locus_tag LOCUS_22190 100439 101644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 101692 102642 gene locus_tag LOCUS_22200 gene hflC 101692 102642 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_22200 103906 103232 gene locus_tag LOCUS_22210 103906 103232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 104703 106004 gene locus_tag LOCUS_22220 104703 106004 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_22220 106595 106215 gene locus_tag LOCUS_22230 106595 106215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 109833 107068 gene locus_tag LOCUS_22240 gene polA 109833 107068 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_22240 110607 110065 gene locus_tag LOCUS_22250 110607 110065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 110895 111848 gene locus_tag LOCUS_22260 gene hemH 110895 111848 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943924.1 protein_id gnl|my_center|LOCUS_22260 113276 112140 gene locus_tag LOCUS_22270 gene rodA 113276 112140 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_22270 115624 113510 gene locus_tag LOCUS_22280 gene mrdA 115624 113510 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_22280 116297 115755 gene locus_tag LOCUS_22290 116297 115755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 117509 116628 gene locus_tag LOCUS_22300 117509 116628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 118623 117586 gene locus_tag LOCUS_22310 118623 117586 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_22310 118833 118908 gene locus_tag LOCUS_t00260 118833 118908 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 119989 119165 gene locus_tag LOCUS_22320 119989 119165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 121230 119974 gene locus_tag LOCUS_22330 121230 119974 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938989.1 protein_id gnl|my_center|LOCUS_22330 121676 121227 gene locus_tag LOCUS_22340 121676 121227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 122627 121683 gene locus_tag LOCUS_22350 122627 121683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 123108 122887 gene locus_tag LOCUS_22360 123108 122887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 125162 123060 gene locus_tag LOCUS_22370 125162 123060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 129370 125486 gene locus_tag LOCUS_22380 129370 125486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 132605 129408 gene locus_tag LOCUS_22390 132605 129408 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228378.1 protein_id gnl|my_center|LOCUS_22390 133449 132826 gene locus_tag LOCUS_22400 133449 132826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 136718 133485 gene locus_tag LOCUS_22410 136718 133485 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228376.1 protein_id gnl|my_center|LOCUS_22410 137261 136791 gene locus_tag LOCUS_22420 137261 136791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 138032 137310 gene locus_tag LOCUS_22430 138032 137310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 139132 138548 gene locus_tag LOCUS_22440 139132 138548 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_22440 139599 139129 gene locus_tag LOCUS_22450 139599 139129 CDS product mobile mystery protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942039.1 protein_id gnl|my_center|LOCUS_22450 140122 139745 gene locus_tag LOCUS_22460 140122 139745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 140339 140115 gene locus_tag LOCUS_22470 140339 140115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 140951 140442 gene locus_tag LOCUS_22480 140951 140442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 142083 141031 gene locus_tag LOCUS_22490 142083 141031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 142910 142098 gene locus_tag LOCUS_22500 142910 142098 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775488.1 protein_id gnl|my_center|LOCUS_22500 143765 142923 gene locus_tag LOCUS_22510 143765 142923 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975914.1 protein_id gnl|my_center|LOCUS_22510 144768 143752 gene locus_tag LOCUS_22520 144768 143752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 145620 144778 gene locus_tag LOCUS_22530 145620 144778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 146282 145617 gene locus_tag LOCUS_22540 146282 145617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 146724 146461 gene locus_tag LOCUS_22550 146724 146461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 147244 146681 gene locus_tag LOCUS_22560 147244 146681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 148060 147248 gene locus_tag LOCUS_22570 148060 147248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 149702 148062 gene locus_tag LOCUS_22580 149702 148062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 150192 150040 gene locus_tag LOCUS_22590 150192 150040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 151124 151576 gene locus_tag LOCUS_22600 151124 151576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 154174 152282 gene locus_tag LOCUS_22610 154174 152282 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968009.1 protein_id gnl|my_center|LOCUS_22610 154860 154513 gene locus_tag LOCUS_22620 154860 154513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 156980 154872 gene locus_tag LOCUS_22630 156980 154872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 158709 156973 gene locus_tag LOCUS_22640 gene dnaK 158709 156973 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183314.1 protein_id gnl|my_center|LOCUS_22640 159470 158841 gene locus_tag LOCUS_22650 159470 158841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 161759 159765 gene locus_tag LOCUS_22660 161759 159765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 163283 161832 gene locus_tag LOCUS_22670 163283 161832 CDS product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691594.1 protein_id gnl|my_center|LOCUS_22670 164869 163280 gene locus_tag LOCUS_22680 164869 163280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 166657 165572 gene locus_tag LOCUS_22690 166657 165572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 167752 166658 gene locus_tag LOCUS_22700 gene aroC 167752 166658 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_22700 169024 167993 gene locus_tag LOCUS_22710 169024 167993 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937626.1 protein_id gnl|my_center|LOCUS_22710 169168 170262 gene locus_tag LOCUS_22720 gene dinB 169168 170262 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052451755.1 protein_id gnl|my_center|LOCUS_22720 170378 170776 gene locus_tag LOCUS_22730 170378 170776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 170778 172526 gene locus_tag LOCUS_22740 170778 172526 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 protein_id gnl|my_center|LOCUS_22740 172911 174116 gene locus_tag LOCUS_22750 172911 174116 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016134.1 protein_id gnl|my_center|LOCUS_22750 175559 174480 gene locus_tag LOCUS_22760 gene nadA 175559 174480 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072333.1 protein_id gnl|my_center|LOCUS_22760 176117 177571 gene locus_tag LOCUS_22770 176117 177571 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943049.1 protein_id gnl|my_center|LOCUS_22770 178817 177621 gene locus_tag LOCUS_22780 178817 177621 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990816.1 protein_id gnl|my_center|LOCUS_22780 180123 179299 gene locus_tag LOCUS_22790 gene fetB 180123 179299 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_22790 180739 180113 gene locus_tag LOCUS_22800 180739 180113 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_22800 182336 180849 gene locus_tag LOCUS_22810 182336 180849 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791433.1 protein_id gnl|my_center|LOCUS_22810 184002 182317 gene locus_tag LOCUS_22820 184002 182317 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_22820 185669 184455 gene locus_tag LOCUS_22830 gene ftsZ 185669 184455 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939769.1 protein_id gnl|my_center|LOCUS_22830 187023 185755 gene locus_tag LOCUS_22840 gene ftsA 187023 185755 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_22840 187855 186974 gene locus_tag LOCUS_22850 187855 186974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 188874 187942 gene locus_tag LOCUS_22860 gene murB 188874 187942 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_22860 190389 189004 gene locus_tag LOCUS_22870 gene murC 190389 189004 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_22870 191512 190415 gene locus_tag LOCUS_22880 gene murG 191512 190415 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_22880 193106 191721 gene locus_tag LOCUS_22890 gene murD 193106 191721 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_22890 194188 193109 gene locus_tag LOCUS_22900 gene mraY 194188 193109 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939777.1 protein_id gnl|my_center|LOCUS_22900 197227 194192 gene locus_tag LOCUS_22910 gene murF 197227 194192 CDS product bifunctional UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase MurE/UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase MurF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064959.1 protein_id gnl|my_center|LOCUS_22910 199059 197224 gene locus_tag LOCUS_22920 199059 197224 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_22920 199426 199067 gene locus_tag LOCUS_22930 199426 199067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 200385 199483 gene locus_tag LOCUS_22940 gene rsmH 200385 199483 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_22940 200834 200385 gene locus_tag LOCUS_22950 gene mraZ 200834 200385 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_22950 202489 201443 gene locus_tag LOCUS_22960 gene ruvB 202489 201443 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_22960 203246 202566 gene locus_tag LOCUS_22970 gene ruvA 203246 202566 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_22970 203768 203259 gene locus_tag LOCUS_22980 gene ruvC 203768 203259 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687445.1 protein_id gnl|my_center|LOCUS_22980 204685 203936 gene locus_tag LOCUS_22990 204685 203936 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_22990 205656 205054 gene locus_tag LOCUS_23000 205656 205054 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_23000 207425 205884 gene locus_tag LOCUS_23010 207425 205884 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881416.1 protein_id gnl|my_center|LOCUS_23010 208587 207547 gene locus_tag LOCUS_23020 208587 207547 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938390.1 protein_id gnl|my_center|LOCUS_23020 210278 208584 gene locus_tag LOCUS_23030 gene recN 210278 208584 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_23030 210686 211198 gene locus_tag LOCUS_23040 210686 211198 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_23040 211312 212556 gene locus_tag LOCUS_23050 211312 212556 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_23050 214630 212939 gene locus_tag LOCUS_23060 gene gspE 214630 212939 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 protein_id gnl|my_center|LOCUS_23060 216988 214697 gene locus_tag LOCUS_23070 gene gspD 216988 214697 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_23070 217832 217122 gene locus_tag LOCUS_23080 217832 217122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 218768 217839 gene locus_tag LOCUS_23090 218768 217839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 219321 218782 gene locus_tag LOCUS_23100 219321 218782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 220829 219321 gene locus_tag LOCUS_23110 220829 219321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 221883 220858 gene locus_tag LOCUS_23120 gene gspK 221883 220858 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940990.1 protein_id gnl|my_center|LOCUS_23120 222556 221873 gene locus_tag LOCUS_23130 222556 221873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 222924 222559 gene locus_tag LOCUS_23140 222924 222559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 223444 222974 gene locus_tag LOCUS_23150 223444 222974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 223994 223530 gene locus_tag LOCUS_23160 gene gspG 223994 223530 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_23160 226920 224353 gene locus_tag LOCUS_23170 226920 224353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 228072 227059 gene locus_tag LOCUS_23180 228072 227059 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392449.1 protein_id gnl|my_center|LOCUS_23180 228700 228873 gene locus_tag LOCUS_23190 228700 228873 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937959.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence333 >Feature sequence334 >Feature sequence335 >Feature sequence336 >Feature sequence337 >Feature sequence338 >Feature sequence339 >Feature sequence340 >Feature sequence341 >Feature sequence342 >Feature sequence343 675 262 gene locus_tag LOCUS_23200 675 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 882 1064 gene locus_tag LOCUS_23210 882 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 1288 2163 gene locus_tag LOCUS_23220 1288 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2472 3515 gene locus_tag LOCUS_23230 2472 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 3484 4359 gene locus_tag LOCUS_23240 3484 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 5773 4529 gene locus_tag LOCUS_23250 gene umuC 5773 4529 CDS product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096856.1 protein_id gnl|my_center|LOCUS_23250 6213 5773 gene locus_tag LOCUS_23260 gene umuD 6213 5773 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882790.1 protein_id gnl|my_center|LOCUS_23260 6787 7056 gene locus_tag LOCUS_23270 6787 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 8084 7710 gene locus_tag LOCUS_23280 8084 7710 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106996.1 protein_id gnl|my_center|LOCUS_23280 8318 8088 gene locus_tag LOCUS_23290 8318 8088 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_23290 8591 8956 gene locus_tag LOCUS_23300 8591 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 8957 9349 gene locus_tag LOCUS_23310 8957 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 9626 10219 gene locus_tag LOCUS_23320 9626 10219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 11154 10450 gene locus_tag LOCUS_23330 11154 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 11530 11345 gene locus_tag LOCUS_23340 11530 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 11910 11578 gene locus_tag LOCUS_23350 11910 11578 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941369.1 protein_id gnl|my_center|LOCUS_23350 12651 13655 gene locus_tag LOCUS_23360 12651 13655 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458694.1 protein_id gnl|my_center|LOCUS_23360 13702 14157 gene locus_tag LOCUS_23370 13702 14157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 15969 14329 gene locus_tag LOCUS_23380 15969 14329 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942735.1 protein_id gnl|my_center|LOCUS_23380 16993 16187 gene locus_tag LOCUS_23390 gene tsaA 16993 16187 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 protein_id gnl|my_center|LOCUS_23390 18636 17059 gene locus_tag LOCUS_23400 18636 17059 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537520.1 protein_id gnl|my_center|LOCUS_23400 19880 18633 gene locus_tag LOCUS_23410 19880 18633 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383637.1 protein_id gnl|my_center|LOCUS_23410 19898 20083 gene locus_tag LOCUS_23420 19898 20083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 20684 21409 gene locus_tag LOCUS_23430 20684 21409 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_23430 21584 22486 gene locus_tag LOCUS_23440 21584 22486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444439.1 protein_id gnl|my_center|LOCUS_23440 22786 24051 gene locus_tag LOCUS_23450 22786 24051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 24239 25294 gene locus_tag LOCUS_23460 24239 25294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence344 >Feature sequence345 >Feature sequence346 >Feature sequence347 >Feature sequence348 >Feature sequence349 >Feature sequence350 >Feature sequence351 >Feature sequence352 >Feature sequence353 >Feature sequence354 144 935 gene locus_tag LOCUS_23470 144 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 935 2566 gene locus_tag LOCUS_23480 935 2566 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876085.1 protein_id gnl|my_center|LOCUS_23480 2563 4149 gene locus_tag LOCUS_23490 2563 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 4419 4916 gene locus_tag LOCUS_23500 4419 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 5101 4931 gene locus_tag LOCUS_23510 5101 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 5125 5379 gene locus_tag LOCUS_23520 5125 5379 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102761837.1 protein_id gnl|my_center|LOCUS_23520 5376 5708 gene locus_tag LOCUS_23530 5376 5708 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_23530 5705 5950 gene locus_tag LOCUS_23540 5705 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 6126 6989 gene locus_tag LOCUS_23550 6126 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 7695 7441 gene locus_tag LOCUS_23560 7695 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 8277 8585 gene locus_tag LOCUS_23570 8277 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 9205 9129 gene locus_tag LOCUS_t00270 9205 9129 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9687 9415 gene locus_tag LOCUS_23580 9687 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 9568 10758 gene locus_tag LOCUS_23590 9568 10758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 10775 11617 gene locus_tag LOCUS_23600 10775 11617 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937704.1 protein_id gnl|my_center|LOCUS_23600 12277 11606 gene locus_tag LOCUS_23610 12277 11606 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_23610 13053 12274 gene locus_tag LOCUS_23620 gene trpC 13053 12274 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_23620 14081 13053 gene locus_tag LOCUS_23630 gene trpD 14081 13053 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_23630 14732 14112 gene locus_tag LOCUS_23640 gene pabA 14732 14112 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392854.1 protein_id gnl|my_center|LOCUS_23640 16187 14736 gene locus_tag LOCUS_23650 gene trpE 16187 14736 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_23650 16086 16325 gene locus_tag LOCUS_23660 16086 16325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 16700 16428 gene locus_tag LOCUS_23670 gene rpsT 16700 16428 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391549.1 protein_id gnl|my_center|LOCUS_23670 18290 16881 gene locus_tag LOCUS_23680 18290 16881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 19532 19164 gene locus_tag LOCUS_23690 19532 19164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 20799 19615 gene locus_tag LOCUS_23700 gene nrfD 20799 19615 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762020.1 protein_id gnl|my_center|LOCUS_23700 22789 23343 gene locus_tag LOCUS_23710 22789 23343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 23550 23326 gene locus_tag LOCUS_23720 23550 23326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 24038 24682 gene locus_tag LOCUS_23730 24038 24682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence355 >Feature sequence356 >Feature sequence357 >Feature sequence358 >Feature sequence359 >Feature sequence360 >Feature sequence361 >Feature sequence362 >Feature sequence363 >Feature sequence364 >Feature sequence365 2593 1382 gene locus_tag LOCUS_23740 2593 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 3722 2649 gene locus_tag LOCUS_23750 3722 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 4919 3762 gene locus_tag LOCUS_23760 gene wecB 4919 3762 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_23760 7067 4938 gene locus_tag LOCUS_23770 7067 4938 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089039.1 protein_id gnl|my_center|LOCUS_23770 9107 7317 gene locus_tag LOCUS_23780 gene asnB 9107 7317 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_23780 10343 9201 gene locus_tag LOCUS_23790 10343 9201 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_23790 12246 10348 gene locus_tag LOCUS_23800 gene asnB 12246 10348 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_23800 13174 12254 gene locus_tag LOCUS_23810 13174 12254 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_23810 14458 13298 gene locus_tag LOCUS_23820 14458 13298 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_23820 15130 15741 gene locus_tag LOCUS_23830 15130 15741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 16305 17018 gene locus_tag LOCUS_23840 16305 17018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 17884 17459 gene locus_tag LOCUS_23850 17884 17459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 18020 18217 gene locus_tag LOCUS_23860 18020 18217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 18428 18658 gene locus_tag LOCUS_23870 18428 18658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 19744 19484 gene locus_tag LOCUS_23880 19744 19484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 20484 20113 gene locus_tag LOCUS_23890 20484 20113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 20687 20481 gene locus_tag LOCUS_23900 20687 20481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence366 >Feature sequence367 >Feature sequence368 >Feature sequence369 >Feature sequence370 >Feature sequence371 >Feature sequence372 >Feature sequence373 >Feature sequence374 >Feature sequence375 >Feature sequence376 2924 882 gene locus_tag LOCUS_23910 2924 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 5717 3246 gene locus_tag LOCUS_23920 5717 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 8963 5772 gene locus_tag LOCUS_23930 8963 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 14371 9395 gene locus_tag LOCUS_23940 14371 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 16029 14980 gene locus_tag LOCUS_23950 16029 14980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 16679 16155 gene locus_tag LOCUS_23960 16679 16155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 18025 17306 gene locus_tag LOCUS_23970 18025 17306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 18635 19069 gene locus_tag LOCUS_23980 18635 19069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 19998 19771 gene locus_tag LOCUS_23990 19998 19771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23990 20297 20043 gene locus_tag LOCUS_24000 20297 20043 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172325.1 protein_id gnl|my_center|LOCUS_24000 20721 20509 gene locus_tag LOCUS_24010 20721 20509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence377 284 90 gene locus_tag LOCUS_24020 284 90 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099038.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence378 >Feature sequence379 >Feature sequence380 >Feature sequence381 >Feature sequence382 >Feature sequence383 >Feature sequence384 >Feature sequence385 >Feature sequence386 >Feature sequence387 1081 2268 gene locus_tag LOCUS_24030 gene metK 1081 2268 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_24030 2381 3790 gene locus_tag LOCUS_24040 gene ahcY 2381 3790 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932403.1 protein_id gnl|my_center|LOCUS_24040 3865 4680 gene locus_tag LOCUS_24050 3865 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 4704 5540 gene locus_tag LOCUS_24060 4704 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 5872 6738 gene locus_tag LOCUS_24070 gene metF 5872 6738 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938296.1 protein_id gnl|my_center|LOCUS_24070 6863 7048 gene locus_tag LOCUS_24080 6863 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 7159 8097 gene locus_tag LOCUS_24090 7159 8097 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_24090 8117 9040 gene locus_tag LOCUS_24100 8117 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24100 9037 11469 gene locus_tag LOCUS_24110 9037 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24110 11700 12482 gene locus_tag LOCUS_24120 11700 12482 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948569.1 protein_id gnl|my_center|LOCUS_24120 13197 13541 gene locus_tag LOCUS_24130 13197 13541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 17674 13634 gene locus_tag LOCUS_24140 17674 13634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 18516 17953 gene locus_tag LOCUS_24150 18516 17953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24150 19091 18612 gene locus_tag LOCUS_24160 19091 18612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24160 20120 19269 gene locus_tag LOCUS_24170 20120 19269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence388 >Feature sequence389 >Feature sequence390 >Feature sequence391 >Feature sequence392 >Feature sequence393 >Feature sequence394 >Feature sequence395 >Feature sequence396 >Feature sequence397 >Feature sequence398 1375 278 gene locus_tag LOCUS_24180 1375 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2354 1392 gene locus_tag LOCUS_24190 2354 1392 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929363.1 protein_id gnl|my_center|LOCUS_24190 4513 2813 gene locus_tag LOCUS_24200 4513 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 4816 5952 gene locus_tag LOCUS_24210 4816 5952 CDS product IS630-like element ISMsm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728598.1 protein_id gnl|my_center|LOCUS_24210 6675 6046 gene locus_tag LOCUS_24220 gene vioB 6675 6046 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose acetyltransferase VioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382700.1 protein_id gnl|my_center|LOCUS_24220 7497 6739 gene locus_tag LOCUS_24230 7497 6739 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_24230 8507 7500 gene locus_tag LOCUS_24240 8507 7500 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042001299.1 protein_id gnl|my_center|LOCUS_24240 8848 8618 gene locus_tag LOCUS_24250 8848 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 10061 8952 gene locus_tag LOCUS_24260 gene vioA 10061 8952 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198210.1 protein_id gnl|my_center|LOCUS_24260 11339 10209 gene locus_tag LOCUS_24270 11339 10209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 12651 11380 gene locus_tag LOCUS_24280 12651 11380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 13601 12750 gene locus_tag LOCUS_24290 13601 12750 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679019.1 protein_id gnl|my_center|LOCUS_24290 14337 13846 gene locus_tag LOCUS_24300 14337 13846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 15420 14446 gene locus_tag LOCUS_24310 gene gmd 15420 14446 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880676.1 protein_id gnl|my_center|LOCUS_24310 16117 15473 gene locus_tag LOCUS_24320 16117 15473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 16554 16345 gene locus_tag LOCUS_24330 16554 16345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 16926 16591 gene locus_tag LOCUS_24340 16926 16591 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_24340 17326 16907 gene locus_tag LOCUS_24350 17326 16907 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_24350 18482 17319 gene locus_tag LOCUS_24360 18482 17319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 19291 18479 gene locus_tag LOCUS_24370 19291 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 20028 19717 gene locus_tag LOCUS_24380 20028 19717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence399 >Feature sequence400 >Feature sequence401 >Feature sequence402 >Feature sequence403 >Feature sequence404 90 236 gene locus_tag LOCUS_24390 90 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence405 >Feature sequence406 >Feature sequence407 >Feature sequence408 >Feature sequence409 947 72 gene locus_tag LOCUS_24400 947 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2783 996 gene locus_tag LOCUS_24410 2783 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 6457 2786 gene locus_tag LOCUS_24420 gene brxC 6457 2786 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942753.1 protein_id gnl|my_center|LOCUS_24420 7071 6472 gene locus_tag LOCUS_24430 7071 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 7843 7052 gene locus_tag LOCUS_24440 7843 7052 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858941.1 protein_id gnl|my_center|LOCUS_24440 8355 7846 gene locus_tag LOCUS_24450 8355 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 8834 8610 gene locus_tag LOCUS_24460 8834 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 9913 9827 gene locus_tag LOCUS_t00280 9913 9827 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10406 11770 gene locus_tag LOCUS_24470 gene rsmB 10406 11770 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_24470 11849 12436 gene locus_tag LOCUS_24480 11849 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 12439 13545 gene locus_tag LOCUS_24490 12439 13545 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087103.1 protein_id gnl|my_center|LOCUS_24490 13672 14004 gene locus_tag LOCUS_24500 13672 14004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 14197 14730 gene locus_tag LOCUS_24510 14197 14730 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461633.1 protein_id gnl|my_center|LOCUS_24510 15045 15668 gene locus_tag LOCUS_24520 15045 15668 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404639.1 protein_id gnl|my_center|LOCUS_24520 17163 15922 gene locus_tag LOCUS_24530 gene radA 17163 15922 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_24530 17852 19294 gene locus_tag LOCUS_24540 gene pyk 17852 19294 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence410 >Feature sequence411 >Feature sequence412 >Feature sequence413 >Feature sequence414 >Feature sequence415 >Feature sequence416 >Feature sequence417 >Feature sequence418 >Feature sequence419 >Feature sequence420 101 346 gene locus_tag LOCUS_24550 101 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 524 715 gene locus_tag LOCUS_24560 524 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 791 1834 gene locus_tag LOCUS_24570 791 1834 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_24570 2308 2622 gene locus_tag LOCUS_24580 2308 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 2745 3092 gene locus_tag LOCUS_24590 2745 3092 CDS product MarR family EPS-associated transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340715.1 protein_id gnl|my_center|LOCUS_24590 3570 4664 gene locus_tag LOCUS_24600 3570 4664 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_24600 4676 5251 gene locus_tag LOCUS_24610 4676 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 5478 5975 gene locus_tag LOCUS_24620 5478 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 6885 7190 gene locus_tag LOCUS_24630 6885 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 7265 8551 gene locus_tag LOCUS_24640 7265 8551 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_24640 8574 10040 gene locus_tag LOCUS_24650 8574 10040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 10073 11296 gene locus_tag LOCUS_24660 10073 11296 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296319.1 protein_id gnl|my_center|LOCUS_24660 11960 12160 gene locus_tag LOCUS_24670 11960 12160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 13736 14851 gene locus_tag LOCUS_24680 13736 14851 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975598.1 protein_id gnl|my_center|LOCUS_24680 15069 15698 gene locus_tag LOCUS_24690 15069 15698 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256836.1 protein_id gnl|my_center|LOCUS_24690 15695 16363 gene locus_tag LOCUS_24700 gene perB 15695 16363 CDS product GDP-perosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055391.1 protein_id gnl|my_center|LOCUS_24700 16357 17532 gene locus_tag LOCUS_24710 16357 17532 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462475.1 protein_id gnl|my_center|LOCUS_24710 18942 18085 gene locus_tag LOCUS_24720 18942 18085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence421 >Feature sequence422 78 434 gene locus_tag LOCUS_24730 78 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 546 1325 gene locus_tag LOCUS_24740 546 1325 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228537.1 protein_id gnl|my_center|LOCUS_24740 2272 3738 gene locus_tag LOCUS_24750 gene gabD 2272 3738 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071494.1 protein_id gnl|my_center|LOCUS_24750 4168 3971 gene locus_tag LOCUS_24760 4168 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 4854 6476 gene locus_tag LOCUS_24770 4854 6476 CDS product protein adenylyltransferase SelO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125671.1 protein_id gnl|my_center|LOCUS_24770 6780 7721 gene locus_tag LOCUS_24780 6780 7721 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458881.1 protein_id gnl|my_center|LOCUS_24780 7784 8542 gene locus_tag LOCUS_24790 7784 8542 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_24790 8588 9718 gene locus_tag LOCUS_24800 8588 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 9891 10997 gene locus_tag LOCUS_24810 9891 10997 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_24810 13853 11277 gene locus_tag LOCUS_24820 13853 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 14329 13943 gene locus_tag LOCUS_24830 14329 13943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 14960 17191 gene locus_tag LOCUS_24840 14960 17191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence423 216 1409 gene locus_tag LOCUS_24850 216 1409 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_24850 2128 3663 gene locus_tag LOCUS_24860 2128 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 5485 4565 gene locus_tag LOCUS_24870 5485 4565 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038852.1 protein_id gnl|my_center|LOCUS_24870 6219 5482 gene locus_tag LOCUS_24880 6219 5482 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199747194.1 protein_id gnl|my_center|LOCUS_24880 6817 6512 gene locus_tag LOCUS_24890 6817 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 6725 6955 gene locus_tag LOCUS_24900 6725 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 7093 7380 gene locus_tag LOCUS_24910 7093 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 7367 7675 gene locus_tag LOCUS_24920 7367 7675 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_24920 8802 7927 gene locus_tag LOCUS_24930 8802 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 9286 9519 gene locus_tag LOCUS_24940 9286 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 9516 9806 gene locus_tag LOCUS_24950 9516 9806 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_24950 11147 9984 gene locus_tag LOCUS_24960 11147 9984 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039039.1 protein_id gnl|my_center|LOCUS_24960 11946 11194 gene locus_tag LOCUS_24970 11946 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 12989 12432 gene locus_tag LOCUS_24980 12989 12432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 13030 14106 gene locus_tag LOCUS_24990 13030 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 14084 14440 gene locus_tag LOCUS_25000 14084 14440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 14437 15918 gene locus_tag LOCUS_25010 14437 15918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 15997 16440 gene locus_tag LOCUS_25020 15997 16440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence424 1614 682 gene locus_tag LOCUS_25030 1614 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 3454 2357 gene locus_tag LOCUS_25040 3454 2357 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_25040 4597 3638 gene locus_tag LOCUS_25050 4597 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_25050 7006 4634 gene locus_tag LOCUS_25060 gene lptD 7006 4634 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792614.1 protein_id gnl|my_center|LOCUS_25060 7282 8307 gene locus_tag LOCUS_25070 7282 8307 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015868484.1 protein_id gnl|my_center|LOCUS_25070 8361 10496 gene locus_tag LOCUS_25080 8361 10496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 10599 10675 gene locus_tag LOCUS_t00290 10599 10675 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11128 13242 gene locus_tag LOCUS_25090 11128 13242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 13249 14862 gene locus_tag LOCUS_25100 13249 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 15969 15781 gene locus_tag LOCUS_25110 15969 15781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 15883 16629 gene locus_tag LOCUS_25120 15883 16629 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417961.1 protein_id gnl|my_center|LOCUS_25120 16700 19126 gene locus_tag LOCUS_25130 16700 19126 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 protein_id gnl|my_center|LOCUS_25130 19382 20380 gene locus_tag LOCUS_25140 19382 20380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 20395 21189 gene locus_tag LOCUS_25150 20395 21189 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893951.1 protein_id gnl|my_center|LOCUS_25150 21663 21244 gene locus_tag LOCUS_25160 gene nikR 21663 21244 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_25160 21936 22694 gene locus_tag LOCUS_25170 21936 22694 CDS product DUF4382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920868.1 protein_id gnl|my_center|LOCUS_25170 22685 23200 gene locus_tag LOCUS_25180 22685 23200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 23200 23841 gene locus_tag LOCUS_25190 gene cbiM 23200 23841 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920867.1 protein_id gnl|my_center|LOCUS_25190 23838 24584 gene locus_tag LOCUS_25200 23838 24584 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920686.1 protein_id gnl|my_center|LOCUS_25200 24619 25368 gene locus_tag LOCUS_25210 24619 25368 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140293.1 protein_id gnl|my_center|LOCUS_25210 25852 27708 gene locus_tag LOCUS_25220 25852 27708 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_25220 27705 28757 gene locus_tag LOCUS_25230 27705 28757 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_25230 29910 29305 gene locus_tag LOCUS_25240 29910 29305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 32870 30072 gene locus_tag LOCUS_25250 32870 30072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 33092 33364 gene locus_tag LOCUS_25260 33092 33364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 33691 33317 gene locus_tag LOCUS_25270 33691 33317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 34673 36619 gene locus_tag LOCUS_25280 34673 36619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 36931 37386 gene locus_tag LOCUS_25290 36931 37386 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_25290 37513 39177 gene locus_tag LOCUS_25300 37513 39177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 39992 39291 gene locus_tag LOCUS_25310 39992 39291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 41813 40077 gene locus_tag LOCUS_25320 41813 40077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 44123 42018 gene locus_tag LOCUS_25330 44123 42018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 44648 44271 gene locus_tag LOCUS_25340 44648 44271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 46380 44968 gene locus_tag LOCUS_25350 46380 44968 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941505.1 protein_id gnl|my_center|LOCUS_25350 49294 46445 gene locus_tag LOCUS_25360 49294 46445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 49669 50115 gene locus_tag LOCUS_25370 49669 50115 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_25370 50475 52838 gene locus_tag LOCUS_25380 50475 52838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 52852 53889 gene locus_tag LOCUS_25390 52852 53889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 53901 54953 gene locus_tag LOCUS_25400 53901 54953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 55157 56059 gene locus_tag LOCUS_25410 55157 56059 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088645.1 protein_id gnl|my_center|LOCUS_25410 55977 56924 gene locus_tag LOCUS_25420 55977 56924 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_25420 58307 56967 gene locus_tag LOCUS_25430 58307 56967 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_25430 59037 58249 gene locus_tag LOCUS_25440 59037 58249 CDS product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047139.1 protein_id gnl|my_center|LOCUS_25440 59485 60357 gene locus_tag LOCUS_25450 59485 60357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 60990 61580 gene locus_tag LOCUS_25460 60990 61580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 62503 61718 gene locus_tag LOCUS_25470 62503 61718 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703877.1 protein_id gnl|my_center|LOCUS_25470 63668 62544 gene locus_tag LOCUS_25480 63668 62544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 64521 63682 gene locus_tag LOCUS_25490 64521 63682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 65359 64523 gene locus_tag LOCUS_25500 gene phnE 65359 64523 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008226.1 protein_id gnl|my_center|LOCUS_25500 66102 65356 gene locus_tag LOCUS_25510 gene phnC 66102 65356 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_25510 67160 66240 gene locus_tag LOCUS_25520 67160 66240 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169047059.1 protein_id gnl|my_center|LOCUS_25520 69332 67569 gene locus_tag LOCUS_25530 69332 67569 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895651.1 protein_id gnl|my_center|LOCUS_25530 69794 71029 gene locus_tag LOCUS_25540 69794 71029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 74429 71373 gene locus_tag LOCUS_25550 74429 71373 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402871.1 protein_id gnl|my_center|LOCUS_25550 75544 74426 gene locus_tag LOCUS_25560 75544 74426 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837901.1 protein_id gnl|my_center|LOCUS_25560 76950 75541 gene locus_tag LOCUS_25570 76950 75541 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_25570 78038 77130 gene locus_tag LOCUS_25580 78038 77130 CDS product DUF6268 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073159.1 protein_id gnl|my_center|LOCUS_25580 79136 78261 gene locus_tag LOCUS_25590 79136 78261 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965718.1 protein_id gnl|my_center|LOCUS_25590 82076 79161 gene locus_tag LOCUS_25600 gene treY 82076 79161 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388265.1 protein_id gnl|my_center|LOCUS_25600 83964 82096 gene locus_tag LOCUS_25610 gene treZ 83964 82096 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388264.1 protein_id gnl|my_center|LOCUS_25610 86153 84000 gene locus_tag LOCUS_25620 gene glgX 86153 84000 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388263.1 protein_id gnl|my_center|LOCUS_25620 87120 86788 gene locus_tag LOCUS_25630 87120 86788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 88410 87328 gene locus_tag LOCUS_25640 88410 87328 CDS product putative zinc-binding peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967100.1 protein_id gnl|my_center|LOCUS_25640 89545 88415 gene locus_tag LOCUS_25650 89545 88415 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898036.1 protein_id gnl|my_center|LOCUS_25650 89765 89986 gene locus_tag LOCUS_25660 89765 89986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 90145 90966 gene locus_tag LOCUS_25670 90145 90966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 90981 91976 gene locus_tag LOCUS_25680 90981 91976 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095144.1 protein_id gnl|my_center|LOCUS_25680 91973 92302 gene locus_tag LOCUS_25690 91973 92302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 93211 92720 gene locus_tag LOCUS_25700 93211 92720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25700 94125 93217 gene locus_tag LOCUS_25710 94125 93217 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947828.1 protein_id gnl|my_center|LOCUS_25710 95206 94295 gene locus_tag LOCUS_25720 95206 94295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 96464 95184 gene locus_tag LOCUS_25730 96464 95184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 97021 96764 gene locus_tag LOCUS_25740 97021 96764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 97922 97227 gene locus_tag LOCUS_25750 97922 97227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 98137 97934 gene locus_tag LOCUS_25760 98137 97934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 99353 98130 gene locus_tag LOCUS_25770 gene metK 99353 98130 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199069.1 protein_id gnl|my_center|LOCUS_25770 99845 99573 gene locus_tag LOCUS_25780 99845 99573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 100027 99951 gene locus_tag LOCUS_t00300 100027 99951 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 101497 100229 gene locus_tag LOCUS_25790 101497 100229 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258382.1 protein_id gnl|my_center|LOCUS_25790 102747 101494 gene locus_tag LOCUS_25800 102747 101494 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258382.1 protein_id gnl|my_center|LOCUS_25800 103930 102899 gene locus_tag LOCUS_25810 103930 102899 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937763.1 protein_id gnl|my_center|LOCUS_25810 104380 105462 gene locus_tag LOCUS_25820 gene lptG 104380 105462 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_25820 105462 106217 gene locus_tag LOCUS_25830 105462 106217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 106217 106876 gene locus_tag LOCUS_25840 106217 106876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 108129 107401 gene locus_tag LOCUS_25850 gene mip 108129 107401 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_25850 109667 108369 gene locus_tag LOCUS_25860 109667 108369 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_25860 110477 109752 gene locus_tag LOCUS_25870 110477 109752 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_25870 111290 110523 gene locus_tag LOCUS_25880 111290 110523 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_25880 112442 111312 gene locus_tag LOCUS_25890 112442 111312 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810748.1 protein_id gnl|my_center|LOCUS_25890 113371 112442 gene locus_tag LOCUS_25900 113371 112442 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_25900 114544 113387 gene locus_tag LOCUS_25910 114544 113387 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_25910 115054 114623 gene locus_tag LOCUS_25920 115054 114623 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_25920 116407 115109 gene locus_tag LOCUS_25930 116407 115109 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_25930 117028 116444 gene locus_tag LOCUS_25940 117028 116444 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_25940 118839 117025 gene locus_tag LOCUS_25950 gene iorA 118839 117025 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_25950 120937 119234 gene locus_tag LOCUS_25960 120937 119234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 123099 121111 gene locus_tag LOCUS_25970 123099 121111 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932067.1 protein_id gnl|my_center|LOCUS_25970 124491 123457 gene locus_tag LOCUS_25980 124491 123457 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_25980 125249 124512 gene locus_tag LOCUS_25990 gene rnc 125249 124512 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938733.1 protein_id gnl|my_center|LOCUS_25990 125308 125382 gene locus_tag LOCUS_t00310 125308 125382 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 126451 125783 gene locus_tag LOCUS_26000 126451 125783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 127556 128236 gene locus_tag LOCUS_26010 127556 128236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 129162 128605 gene locus_tag LOCUS_26020 gene thpR 129162 128605 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_26020 130269 129406 gene locus_tag LOCUS_26030 gene nadC 130269 129406 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_26030 132955 130271 gene locus_tag LOCUS_26040 132955 130271 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_26040 134089 133013 gene locus_tag LOCUS_26050 134089 133013 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_26050 135131 134109 gene locus_tag LOCUS_26060 gene prfB 135131 134109 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_26060 136999 135410 gene locus_tag LOCUS_26070 gene lnt 136999 135410 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_26070 137954 136977 gene locus_tag LOCUS_26080 137954 136977 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942919.1 protein_id gnl|my_center|LOCUS_26080 138157 138232 gene locus_tag LOCUS_t00320 138157 138232 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 138810 138451 gene locus_tag LOCUS_26090 138810 138451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 139051 138830 gene locus_tag LOCUS_26100 139051 138830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 140351 139311 gene locus_tag LOCUS_26110 140351 139311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 141221 140937 gene locus_tag LOCUS_26120 141221 140937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 141577 141218 gene locus_tag LOCUS_26130 141577 141218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 142278 141808 gene locus_tag LOCUS_26140 142278 141808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087299.1 protein_id gnl|my_center|LOCUS_26140 142940 142275 gene locus_tag LOCUS_26150 142940 142275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 143133 142927 gene locus_tag LOCUS_26160 143133 142927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 143951 143130 gene locus_tag LOCUS_26170 143951 143130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 144394 143951 gene locus_tag LOCUS_26180 144394 143951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 145160 144549 gene locus_tag LOCUS_26190 145160 144549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 146567 145290 gene locus_tag LOCUS_26200 146567 145290 CDS product primase-helicase zinc-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937501.1 protein_id gnl|my_center|LOCUS_26200 148036 146783 gene locus_tag LOCUS_26210 148036 146783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 148391 148188 gene locus_tag LOCUS_26220 148391 148188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 149372 148623 gene locus_tag LOCUS_26230 149372 148623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 150703 149477 gene locus_tag LOCUS_26240 150703 149477 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_26240 151595 151837 gene locus_tag LOCUS_26250 151595 151837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 151834 153990 gene locus_tag LOCUS_26260 151834 153990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 154265 154477 gene locus_tag LOCUS_26270 154265 154477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 154641 154868 gene locus_tag LOCUS_26280 154641 154868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 155331 154900 gene locus_tag LOCUS_26290 155331 154900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 157573 155522 gene locus_tag LOCUS_26300 gene brxL 157573 155522 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 protein_id gnl|my_center|LOCUS_26300 159902 157578 gene locus_tag LOCUS_26310 gene pglZ 159902 157578 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_26310 161017 159899 gene locus_tag LOCUS_26320 161017 159899 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_26320 164538 161014 gene locus_tag LOCUS_26330 164538 161014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 167981 164535 gene locus_tag LOCUS_26340 gene brxC 167981 164535 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_26340 168535 167978 gene locus_tag LOCUS_26350 168535 167978 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_26350 169269 168532 gene locus_tag LOCUS_26360 169269 168532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_26360 170131 169646 gene locus_tag LOCUS_26370 170131 169646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 170713 170285 gene locus_tag LOCUS_26380 170713 170285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 171003 170632 gene locus_tag LOCUS_26390 171003 170632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 172232 171696 gene locus_tag LOCUS_26400 172232 171696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 172927 172607 gene locus_tag LOCUS_26410 172927 172607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 173227 173075 gene locus_tag LOCUS_26420 173227 173075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 173770 173342 gene locus_tag LOCUS_26430 173770 173342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 175200 173977 gene locus_tag LOCUS_26440 gene metK 175200 173977 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199069.1 protein_id gnl|my_center|LOCUS_26440 175599 175420 gene locus_tag LOCUS_26450 175599 175420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 176490 175777 gene locus_tag LOCUS_26460 176490 175777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 177712 176483 gene locus_tag LOCUS_26470 177712 176483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 177799 177951 gene locus_tag LOCUS_26480 177799 177951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 178199 178579 gene locus_tag LOCUS_26490 178199 178579 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942959.1 protein_id gnl|my_center|LOCUS_26490 178584 179036 gene locus_tag LOCUS_26500 178584 179036 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279207.1 protein_id gnl|my_center|LOCUS_26500 179033 181228 gene locus_tag LOCUS_26510 179033 181228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 183755 181530 gene locus_tag LOCUS_26520 183755 181530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 185591 183792 gene locus_tag LOCUS_26530 185591 183792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 186500 185742 gene locus_tag LOCUS_26540 gene tagT 186500 185742 CDS product type IV secretion associated ABC transporter ATP-binding protein TagT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114657.1 protein_id gnl|my_center|LOCUS_26540 188634 186505 gene locus_tag LOCUS_26550 188634 186505 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390899.1 protein_id gnl|my_center|LOCUS_26550 190008 188884 gene locus_tag LOCUS_26560 190008 188884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 190752 190261 gene locus_tag LOCUS_26570 190752 190261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 191436 190765 gene locus_tag LOCUS_26580 191436 190765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 193216 191612 gene locus_tag LOCUS_26590 193216 191612 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267835.1 protein_id gnl|my_center|LOCUS_26590 193562 193359 gene locus_tag LOCUS_26600 193562 193359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 194170 193469 gene locus_tag LOCUS_26610 194170 193469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 194763 197423 gene locus_tag LOCUS_26620 gene aceE 194763 197423 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_26620 197437 198750 gene locus_tag LOCUS_26630 gene aceF 197437 198750 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205154.1 protein_id gnl|my_center|LOCUS_26630 198841 200253 gene locus_tag LOCUS_26640 gene lpdA 198841 200253 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519338.1 protein_id gnl|my_center|LOCUS_26640 200498 200776 gene locus_tag LOCUS_26650 200498 200776 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390817.1 protein_id gnl|my_center|LOCUS_26650 200794 201084 gene locus_tag LOCUS_26660 200794 201084 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034027947.1 protein_id gnl|my_center|LOCUS_26660 201461 202453 gene locus_tag LOCUS_26670 gene pyrC 201461 202453 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258604.1 protein_id gnl|my_center|LOCUS_26670 202485 202850 gene locus_tag LOCUS_26680 202485 202850 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941351.1 protein_id gnl|my_center|LOCUS_26680 203012 203263 gene locus_tag LOCUS_26690 203012 203263 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943075.1 protein_id gnl|my_center|LOCUS_26690 204239 204502 gene locus_tag LOCUS_26700 204239 204502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 204495 204881 gene locus_tag LOCUS_26710 204495 204881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence425 <1 4094 gene locus_tag LOCUS_26720 <1 4094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943038.1:PocR ligand-binding domain-containing protein 4102 4275 gene locus_tag LOCUS_26730 4102 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 4535 4251 gene locus_tag LOCUS_26740 4535 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 5149 4595 gene locus_tag LOCUS_26750 5149 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265691.1 protein_id gnl|my_center|LOCUS_26750 5539 5330 gene locus_tag LOCUS_26760 5539 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 7269 5602 gene locus_tag LOCUS_26770 7269 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 7520 7302 gene locus_tag LOCUS_26780 7520 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 7770 7528 gene locus_tag LOCUS_26790 7770 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 9918 7819 gene locus_tag LOCUS_26800 9918 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 12434 9915 gene locus_tag LOCUS_26810 12434 9915 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942750.1 protein_id gnl|my_center|LOCUS_26810 15838 12545 gene locus_tag LOCUS_26820 gene pglX 15838 12545 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942751.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence426 4823 1056 gene locus_tag LOCUS_26830 gene cobN 4823 1056 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932109.1 protein_id gnl|my_center|LOCUS_26830 6070 4823 gene locus_tag LOCUS_26840 6070 4823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439823.1 protein_id gnl|my_center|LOCUS_26840 7056 6067 gene locus_tag LOCUS_26850 7056 6067 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965737.1 protein_id gnl|my_center|LOCUS_26850 8245 7103 gene locus_tag LOCUS_26860 8245 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 9066 8248 gene locus_tag LOCUS_26870 9066 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 9851 9063 gene locus_tag LOCUS_26880 9851 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 11161 9848 gene locus_tag LOCUS_26890 11161 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 11831 11166 gene locus_tag LOCUS_26900 11831 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 12256 11837 gene locus_tag LOCUS_26910 12256 11837 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_26910 12867 12250 gene locus_tag LOCUS_26920 12867 12250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 14291 12861 gene locus_tag LOCUS_26930 14291 12861 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 protein_id gnl|my_center|LOCUS_26930 15073 14288 gene locus_tag LOCUS_26940 15073 14288 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029797603.1 protein_id gnl|my_center|LOCUS_26940 >Feature sequence427 1097 33 gene locus_tag LOCUS_26950 1097 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 2206 1097 gene locus_tag LOCUS_26960 2206 1097 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_26960 3534 2203 gene locus_tag LOCUS_26970 3534 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 3815 3531 gene locus_tag LOCUS_26980 3815 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 9250 4088 gene locus_tag LOCUS_26990 9250 4088 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670058.1 protein_id gnl|my_center|LOCUS_26990 9643 9302 gene locus_tag LOCUS_27000 9643 9302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 10133 9885 gene locus_tag LOCUS_27010 10133 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 10722 10192 gene locus_tag LOCUS_27020 10722 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 11603 11298 gene locus_tag LOCUS_27030 11603 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 12939 11863 gene locus_tag LOCUS_27040 12939 11863 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_27040 13526 12936 gene locus_tag LOCUS_27050 13526 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 13568 14083 gene locus_tag LOCUS_27060 13568 14083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence428 883 668 gene locus_tag LOCUS_27070 883 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 1245 1571 gene locus_tag LOCUS_27080 1245 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 2283 1738 gene locus_tag LOCUS_27090 2283 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2941 2360 gene locus_tag LOCUS_27100 2941 2360 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530047.1 protein_id gnl|my_center|LOCUS_27100 2971 3135 gene locus_tag LOCUS_27110 2971 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 3369 3860 gene locus_tag LOCUS_27120 3369 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 3800 4486 gene locus_tag LOCUS_27130 3800 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 6182 4947 gene locus_tag LOCUS_27140 6182 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 9180 6469 gene locus_tag LOCUS_27150 9180 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 10157 9240 gene locus_tag LOCUS_27160 10157 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 13168 10154 gene locus_tag LOCUS_27170 13168 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence429 1187 216 gene locus_tag LOCUS_27180 1187 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 2166 1489 gene locus_tag LOCUS_27190 2166 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 2545 2862 gene locus_tag LOCUS_27200 2545 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089624.1 protein_id gnl|my_center|LOCUS_27200 2969 3784 gene locus_tag LOCUS_27210 2969 3784 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_27210 3938 4273 gene locus_tag LOCUS_27220 3938 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 4237 6402 gene locus_tag LOCUS_27230 4237 6402 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390606.1 protein_id gnl|my_center|LOCUS_27230 6406 7158 gene locus_tag LOCUS_27240 6406 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 7452 7168 gene locus_tag LOCUS_27250 7452 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 7634 7452 gene locus_tag LOCUS_27260 7634 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 7821 10157 gene locus_tag LOCUS_27270 gene ctpC 7821 10157 CDS product manganese-exporting P-type ATPase CtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899995.1 protein_id gnl|my_center|LOCUS_27270 10343 10864 gene locus_tag LOCUS_27280 10343 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 10864 11289 gene locus_tag LOCUS_27290 10864 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 11349 12026 gene locus_tag LOCUS_27300 11349 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence430 317 2539 gene locus_tag LOCUS_27310 317 2539 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731007.1 protein_id gnl|my_center|LOCUS_27310 2683 2880 gene locus_tag LOCUS_27320 2683 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 2912 3559 gene locus_tag LOCUS_27330 2912 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 3645 4091 gene locus_tag LOCUS_27340 3645 4091 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362768.1 protein_id gnl|my_center|LOCUS_27340 4219 4905 gene locus_tag LOCUS_27350 4219 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 4956 5099 gene locus_tag LOCUS_27360 4956 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 5194 5985 gene locus_tag LOCUS_27370 5194 5985 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942188.1 protein_id gnl|my_center|LOCUS_27370 6487 6032 gene locus_tag LOCUS_27380 6487 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 7991 6720 gene locus_tag LOCUS_27390 7991 6720 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338025.1 protein_id gnl|my_center|LOCUS_27390 9032 8049 gene locus_tag LOCUS_27400 9032 8049 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_27400 <11244 9143 gene locus_tag LOCUS_27410 <11244 9143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123734.1:tetratricopeptide repeat protein >Feature sequence431 509 826 gene locus_tag LOCUS_27420 509 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089624.1 protein_id gnl|my_center|LOCUS_27420 932 1747 gene locus_tag LOCUS_27430 932 1747 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_27430 2279 1953 gene locus_tag LOCUS_27440 2279 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2652 3170 gene locus_tag LOCUS_27450 2652 3170 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228871.1 protein_id gnl|my_center|LOCUS_27450 3372 4247 gene locus_tag LOCUS_27460 3372 4247 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943314.1 protein_id gnl|my_center|LOCUS_27460 5153 4359 gene locus_tag LOCUS_27470 5153 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 5592 6476 gene locus_tag LOCUS_27480 5592 6476 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532353.1 protein_id gnl|my_center|LOCUS_27480 7180 9492 gene locus_tag LOCUS_27490 7180 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence432 984 7718 gene locus_tag LOCUS_27500 984 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 7731 8048 gene locus_tag LOCUS_27510 7731 8048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 8507 9544 gene locus_tag LOCUS_27520 8507 9544 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_27520 >Feature sequence433 275 66 gene locus_tag LOCUS_27530 275 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 186 608 gene locus_tag LOCUS_27540 186 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 868 704 gene locus_tag LOCUS_27550 868 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 2449 1016 gene locus_tag LOCUS_27560 gene lpdA 2449 1016 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436922.1 protein_id gnl|my_center|LOCUS_27560 2670 3113 gene locus_tag LOCUS_27570 2670 3113 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530560.1 protein_id gnl|my_center|LOCUS_27570 3154 4404 gene locus_tag LOCUS_27580 3154 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 4422 4820 gene locus_tag LOCUS_27590 gene gcvH 4422 4820 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_27590 4826 6163 gene locus_tag LOCUS_27600 gene gcvPA 4826 6163 CDS product aminomethyl-transferring glycine dehydrogenase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903240.1 protein_id gnl|my_center|LOCUS_27600 6160 7617 gene locus_tag LOCUS_27610 gene gcvPB 6160 7617 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948420.1 protein_id gnl|my_center|LOCUS_27610 7626 8309 gene locus_tag LOCUS_27620 gene lipB 7626 8309 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938205.1 protein_id gnl|my_center|LOCUS_27620 8302 9207 gene locus_tag LOCUS_27630 gene lipA 8302 9207 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence434 275 153 gene locus_tag LOCUS_27640 275 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 1084 482 gene locus_tag LOCUS_27650 1084 482 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_27650 1618 2907 gene locus_tag LOCUS_27660 1618 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27660 2850 3794 gene locus_tag LOCUS_27670 2850 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27670 3791 5164 gene locus_tag LOCUS_27680 3791 5164 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895634.1 protein_id gnl|my_center|LOCUS_27680 5403 7976 gene locus_tag LOCUS_27690 5403 7976 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence435 458 1804 gene locus_tag LOCUS_27700 458 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 2220 3890 gene locus_tag LOCUS_27710 2220 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 3956 5404 gene locus_tag LOCUS_27720 3956 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 5407 6426 gene locus_tag LOCUS_27730 5407 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 6677 6853 gene locus_tag LOCUS_27740 6677 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 7279 6935 gene locus_tag LOCUS_27750 7279 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 7690 7914 gene locus_tag LOCUS_27760 7690 7914 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312031.1 protein_id gnl|my_center|LOCUS_27760 7911 8321 gene locus_tag LOCUS_27770 7911 8321 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_27770 8595 9257 gene locus_tag LOCUS_27780 8595 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 9398 11338 gene locus_tag LOCUS_27790 9398 11338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 11387 12703 gene locus_tag LOCUS_27800 11387 12703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 12941 14131 gene locus_tag LOCUS_27810 12941 14131 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_27810 14128 14688 gene locus_tag LOCUS_27820 14128 14688 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_27820 14974 14898 gene locus_tag LOCUS_t00330 14974 14898 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15435 15016 gene locus_tag LOCUS_27830 15435 15016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 15836 15546 gene locus_tag LOCUS_27840 gene ihfA 15836 15546 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384166.1 protein_id gnl|my_center|LOCUS_27840 18274 15833 gene locus_tag LOCUS_27850 gene pheT 18274 15833 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_27850 19620 18607 gene locus_tag LOCUS_27860 gene pheS 19620 18607 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_27860 19987 19631 gene locus_tag LOCUS_27870 gene rplT 19987 19631 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_27870 20306 20109 gene locus_tag LOCUS_27880 gene rpmI 20306 20109 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_27880 20721 20386 gene locus_tag LOCUS_27890 20721 20386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27890 22886 20961 gene locus_tag LOCUS_27900 gene thrS 22886 20961 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_27900 23025 22951 gene locus_tag LOCUS_t00340 23025 22951 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 24094 23279 gene locus_tag LOCUS_27910 gene phnE 24094 23279 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 protein_id gnl|my_center|LOCUS_27910 24921 24094 gene locus_tag LOCUS_27920 gene phnE 24921 24094 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 protein_id gnl|my_center|LOCUS_27920 25748 24921 gene locus_tag LOCUS_27930 gene phnC 25748 24921 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_27930 26717 25752 gene locus_tag LOCUS_27940 gene phnD 26717 25752 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 protein_id gnl|my_center|LOCUS_27940 27364 26960 gene locus_tag LOCUS_27950 27364 26960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27950 27567 27298 gene locus_tag LOCUS_27960 27567 27298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 28187 29044 gene locus_tag LOCUS_27970 28187 29044 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939745.1 protein_id gnl|my_center|LOCUS_27970 29065 30468 gene locus_tag LOCUS_27980 gene gltA 29065 30468 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_27980 31657 30776 gene locus_tag LOCUS_27990 31657 30776 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071840.1 protein_id gnl|my_center|LOCUS_27990 32268 34352 gene locus_tag LOCUS_28000 32268 34352 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404730.1 protein_id gnl|my_center|LOCUS_28000 35779 34622 gene locus_tag LOCUS_28010 35779 34622 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509130.1 protein_id gnl|my_center|LOCUS_28010 36771 36034 gene locus_tag LOCUS_28020 36771 36034 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387006.1 protein_id gnl|my_center|LOCUS_28020 37772 36771 gene locus_tag LOCUS_28030 37772 36771 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_28030 38403 37819 gene locus_tag LOCUS_28040 38403 37819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 38787 39803 gene locus_tag LOCUS_28050 38787 39803 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021661.1 protein_id gnl|my_center|LOCUS_28050 40118 42820 gene locus_tag LOCUS_28060 40118 42820 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014439.1 protein_id gnl|my_center|LOCUS_28060 45159 42961 gene locus_tag LOCUS_28070 gene katG 45159 42961 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942744.1 protein_id gnl|my_center|LOCUS_28070 45790 48012 gene locus_tag LOCUS_28080 gene ppk1 45790 48012 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943936.1 protein_id gnl|my_center|LOCUS_28080 48909 51014 gene locus_tag LOCUS_28090 48909 51014 CDS product thiosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937484.1 protein_id gnl|my_center|LOCUS_28090 51011 51514 gene locus_tag LOCUS_28100 51011 51514 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545501.1 protein_id gnl|my_center|LOCUS_28100 51529 51903 gene locus_tag LOCUS_28110 gene nuoA 51529 51903 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179273.1 protein_id gnl|my_center|LOCUS_28110 51891 52412 gene locus_tag LOCUS_28120 51891 52412 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545381.1 protein_id gnl|my_center|LOCUS_28120 52394 52999 gene locus_tag LOCUS_28130 52394 52999 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546804.1 protein_id gnl|my_center|LOCUS_28130 52999 54225 gene locus_tag LOCUS_28140 52999 54225 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545708.1 protein_id gnl|my_center|LOCUS_28140 54405 55373 gene locus_tag LOCUS_28150 gene nuoH 54405 55373 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546488.1 protein_id gnl|my_center|LOCUS_28150 55385 56023 gene locus_tag LOCUS_28160 gene nuoI 55385 56023 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546584.1 protein_id gnl|my_center|LOCUS_28160 56037 56624 gene locus_tag LOCUS_28170 56037 56624 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546215.1 protein_id gnl|my_center|LOCUS_28170 56621 56923 gene locus_tag LOCUS_28180 gene nuoK 56621 56923 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100078.1 protein_id gnl|my_center|LOCUS_28180 56927 58849 gene locus_tag LOCUS_28190 gene nuoL 56927 58849 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_28190 58880 60391 gene locus_tag LOCUS_28200 58880 60391 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_28200 60437 61882 gene locus_tag LOCUS_28210 60437 61882 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_28210 62473 62240 gene locus_tag LOCUS_28220 62473 62240 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_28220 62971 63414 gene locus_tag LOCUS_28230 62971 63414 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932389.1 protein_id gnl|my_center|LOCUS_28230 63776 66511 gene locus_tag LOCUS_28240 63776 66511 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942202.1 protein_id gnl|my_center|LOCUS_28240 66711 68321 gene locus_tag LOCUS_28250 66711 68321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 68963 69196 gene locus_tag LOCUS_28260 68963 69196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 69183 69440 gene locus_tag LOCUS_28270 69183 69440 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_28270 69807 71309 gene locus_tag LOCUS_28280 69807 71309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 71237 71791 gene locus_tag LOCUS_28290 71237 71791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 71788 72474 gene locus_tag LOCUS_28300 71788 72474 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_28300 72462 72638 gene locus_tag LOCUS_28310 72462 72638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 72655 73980 gene locus_tag LOCUS_28320 72655 73980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 73973 74359 gene locus_tag LOCUS_28330 73973 74359 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_28330 74356 77616 gene locus_tag LOCUS_28340 74356 77616 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_28340 77671 78006 gene locus_tag LOCUS_28350 77671 78006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28350 78112 79368 gene locus_tag LOCUS_28360 78112 79368 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035773.1 protein_id gnl|my_center|LOCUS_28360 79377 79949 gene locus_tag LOCUS_28370 79377 79949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 81288 81749 gene locus_tag LOCUS_28380 81288 81749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 81746 82840 gene locus_tag LOCUS_28390 81746 82840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 82904 84004 gene locus_tag LOCUS_28400 82904 84004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 84001 86100 gene locus_tag LOCUS_28410 84001 86100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 86236 86625 gene locus_tag LOCUS_28420 gene csx20 86236 86625 CDS product CRISPR-associated protein Csx20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871197.1 protein_id gnl|my_center|LOCUS_28420 86690 88024 gene locus_tag LOCUS_28430 86690 88024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 88041 89006 gene locus_tag LOCUS_28440 gene cas6 88041 89006 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259217.1 protein_id gnl|my_center|LOCUS_28440 89131 91788 gene locus_tag LOCUS_28450 gene cas10 89131 91788 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545463.1 protein_id gnl|my_center|LOCUS_28450 91785 92264 gene locus_tag LOCUS_28460 91785 92264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 92267 93001 gene locus_tag LOCUS_28470 gene csm3 92267 93001 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545508.1 protein_id gnl|my_center|LOCUS_28470 93014 93994 gene locus_tag LOCUS_28480 93014 93994 CDS product CRISPR-associated protein, Csm4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546365.1 protein_id gnl|my_center|LOCUS_28480 93991 95886 gene locus_tag LOCUS_28490 93991 95886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 96366 102203 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq accggaacgaatgccccgatcagaggggattgagac 102312 102593 gene locus_tag LOCUS_28500 102312 102593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 102932 102603 gene locus_tag LOCUS_28510 102932 102603 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669261.1 protein_id gnl|my_center|LOCUS_28510 103532 103711 gene locus_tag LOCUS_28520 103532 103711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 103971 105440 gene locus_tag LOCUS_28530 103971 105440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 105415 107043 gene locus_tag LOCUS_28540 105415 107043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 107055 108074 gene locus_tag LOCUS_28550 gene cas1c 107055 108074 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_28550 108099 108377 gene locus_tag LOCUS_28560 108099 108377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 108615 109475 gene locus_tag LOCUS_28570 108615 109475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 109506 111350 gene locus_tag LOCUS_28580 109506 111350 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704972.1 protein_id gnl|my_center|LOCUS_28580 111999 111388 gene locus_tag LOCUS_28590 gene rdgB 111999 111388 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926068.1 protein_id gnl|my_center|LOCUS_28590 113490 112051 gene locus_tag LOCUS_28600 gene pyk 113490 112051 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_28600 116268 113764 gene locus_tag LOCUS_28610 116268 113764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 117714 116770 gene locus_tag LOCUS_28620 117714 116770 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_28620 118082 117750 gene locus_tag LOCUS_28630 118082 117750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 118380 119114 gene locus_tag LOCUS_28640 118380 119114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 122557 119141 gene locus_tag LOCUS_28650 122557 119141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 124628 122586 gene locus_tag LOCUS_28660 124628 122586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 125376 126179 gene locus_tag LOCUS_28670 125376 126179 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_28670 126246 127193 gene locus_tag LOCUS_28680 126246 127193 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938071.1 protein_id gnl|my_center|LOCUS_28680 129763 127253 gene locus_tag LOCUS_28690 129763 127253 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_28690 130920 130009 gene locus_tag LOCUS_28700 130920 130009 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967768.1 protein_id gnl|my_center|LOCUS_28700 131856 131125 gene locus_tag LOCUS_28710 131856 131125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969991.1 protein_id gnl|my_center|LOCUS_28710 132517 131867 gene locus_tag LOCUS_28720 132517 131867 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967771.1 protein_id gnl|my_center|LOCUS_28720 133867 132740 gene locus_tag LOCUS_28730 133867 132740 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967770.1 protein_id gnl|my_center|LOCUS_28730 134384 134980 gene locus_tag LOCUS_28740 134384 134980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 135108 136856 gene locus_tag LOCUS_28750 135108 136856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939173.1 protein_id gnl|my_center|LOCUS_28750 137052 138131 gene locus_tag LOCUS_28760 gene cobT 137052 138131 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393223.1 protein_id gnl|my_center|LOCUS_28760 139573 138242 gene locus_tag LOCUS_28770 gene xseA 139573 138242 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_28770 140012 140704 gene locus_tag LOCUS_28780 140012 140704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 140701 141561 gene locus_tag LOCUS_28790 gene panC 140701 141561 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_28790 141634 142833 gene locus_tag LOCUS_28800 141634 142833 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_28800 143389 142895 gene locus_tag LOCUS_28810 143389 142895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 143303 143683 gene locus_tag LOCUS_28820 143303 143683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 144024 144782 gene locus_tag LOCUS_28830 gene kdsB 144024 144782 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072444.1 protein_id gnl|my_center|LOCUS_28830 145001 147352 gene locus_tag LOCUS_28840 145001 147352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 147349 149094 gene locus_tag LOCUS_28850 147349 149094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 149091 149456 gene locus_tag LOCUS_28860 149091 149456 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_28860 149449 151413 gene locus_tag LOCUS_28870 149449 151413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 151728 152768 gene locus_tag LOCUS_28880 151728 152768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 152765 154531 gene locus_tag LOCUS_28890 152765 154531 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989772.1 protein_id gnl|my_center|LOCUS_28890 154524 156320 gene locus_tag LOCUS_28900 154524 156320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_28900 157249 156434 gene locus_tag LOCUS_28910 157249 156434 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222181.1 protein_id gnl|my_center|LOCUS_28910 157666 157394 gene locus_tag LOCUS_28920 157666 157394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 >Feature sequence436 301 86 gene locus_tag LOCUS_28930 301 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 509 1300 gene locus_tag LOCUS_28940 509 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 1360 1435 gene locus_tag LOCUS_t00350 1360 1435 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1712 1876 gene locus_tag LOCUS_28950 1712 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28950 1876 2223 gene locus_tag LOCUS_28960 1876 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28960 2913 4070 gene locus_tag LOCUS_28970 2913 4070 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_28970 4067 4831 gene locus_tag LOCUS_28980 4067 4831 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_28980 4850 5926 gene locus_tag LOCUS_28990 4850 5926 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390200.1 protein_id gnl|my_center|LOCUS_28990 5923 6519 gene locus_tag LOCUS_29000 5923 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 6589 7248 gene locus_tag LOCUS_29010 6589 7248 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964933.1 protein_id gnl|my_center|LOCUS_29010 7245 7550 gene locus_tag LOCUS_29020 7245 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence437 130 627 gene locus_tag LOCUS_29030 130 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 1014 2441 gene locus_tag LOCUS_29040 1014 2441 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942926.1 protein_id gnl|my_center|LOCUS_29040 2444 3055 gene locus_tag LOCUS_29050 gene pncA 2444 3055 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942927.1 protein_id gnl|my_center|LOCUS_29050 3052 5247 gene locus_tag LOCUS_29060 3052 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 5890 5342 gene locus_tag LOCUS_29070 5890 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 6144 6587 gene locus_tag LOCUS_29080 6144 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 >Feature sequence438 1528 410 gene locus_tag LOCUS_29090 1528 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 2850 1714 gene locus_tag LOCUS_29100 2850 1714 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496696.1 protein_id gnl|my_center|LOCUS_29100 3543 3722 gene locus_tag LOCUS_29110 3543 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 3947 4867 gene locus_tag LOCUS_29120 3947 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 5110 4880 gene locus_tag LOCUS_29130 5110 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 5227 5553 gene locus_tag LOCUS_29140 5227 5553 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493756.1 protein_id gnl|my_center|LOCUS_29140 5550 5843 gene locus_tag LOCUS_29150 gene nadS 5550 5843 CDS product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356397.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence439 825 94 gene locus_tag LOCUS_29160 825 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 1138 818 gene locus_tag LOCUS_29170 1138 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 2089 2409 gene locus_tag LOCUS_29180 2089 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 2771 2481 gene locus_tag LOCUS_29190 2771 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 3412 4476 gene locus_tag LOCUS_29200 3412 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence440 445 1692 gene locus_tag LOCUS_29210 445 1692 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626085.1 protein_id gnl|my_center|LOCUS_29210 1766 2122 gene locus_tag LOCUS_29220 1766 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 3754 2528 gene locus_tag LOCUS_29230 3754 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 4434 3766 gene locus_tag LOCUS_29240 4434 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789206.1 protein_id gnl|my_center|LOCUS_29240 5314 4436 gene locus_tag LOCUS_29250 5314 4436 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767082.1 protein_id gnl|my_center|LOCUS_29250 >Feature sequence441 117 1671 gene locus_tag LOCUS_r00010 117 1671 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1748 1825 gene locus_tag LOCUS_t00360 1748 1825 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1842 1917 gene locus_tag LOCUS_t00370 1842 1917 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2111 5047 gene locus_tag LOCUS_r00020 2111 5047 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5101 5212 gene locus_tag LOCUS_r00030 5101 5212 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence442 <1 1010 gene locus_tag LOCUS_29260 <1 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012220240.1:DUF4351 domain-containing protein 1621 1199 gene locus_tag LOCUS_29270 1621 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 2000 1596 gene locus_tag LOCUS_29280 2000 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 2378 4156 gene locus_tag LOCUS_29290 2378 4156 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_29290 >Feature sequence443 451 741 gene locus_tag LOCUS_29300 451 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 1026 1262 gene locus_tag LOCUS_29310 1026 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 1259 2041 gene locus_tag LOCUS_29320 1259 2041 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_29320 2078 2473 gene locus_tag LOCUS_29330 2078 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 2775 2476 gene locus_tag LOCUS_29340 2775 2476 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143494.1 protein_id gnl|my_center|LOCUS_29340 3051 2776 gene locus_tag LOCUS_29350 3051 2776 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142529.1 protein_id gnl|my_center|LOCUS_29350 3546 3791 gene locus_tag LOCUS_29360 3546 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 >Feature sequence444 57 392 gene locus_tag LOCUS_29370 57 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 670 882 gene locus_tag LOCUS_29380 670 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 2810 1455 gene locus_tag LOCUS_29390 2810 1455 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_29390 3313 3047 gene locus_tag LOCUS_29400 3313 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 >Feature sequence445 534 821 gene locus_tag LOCUS_29410 534 821 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219993657.1 protein_id gnl|my_center|LOCUS_29410 811 987 gene locus_tag LOCUS_29420 811 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 1291 1515 gene locus_tag LOCUS_29430 1291 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 1515 1916 gene locus_tag LOCUS_29440 1515 1916 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_29440 2149 2472 gene locus_tag LOCUS_29450 2149 2472 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141642.1 protein_id gnl|my_center|LOCUS_29450 3453 3175 gene locus_tag LOCUS_29460 3453 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence446 2386 1439 gene locus_tag LOCUS_29470 2386 1439 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942950.1 protein_id gnl|my_center|LOCUS_29470 7922 2595 gene locus_tag LOCUS_29480 7922 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 10474 8135 gene locus_tag LOCUS_29490 10474 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 10901 10740 gene locus_tag LOCUS_29500 10901 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 12681 11248 gene locus_tag LOCUS_29510 gene cdaA 12681 11248 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941532.1 protein_id gnl|my_center|LOCUS_29510 13245 13439 gene locus_tag LOCUS_29520 gene rpmB 13245 13439 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_29520 13547 13807 gene locus_tag LOCUS_29530 13547 13807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 14644 13823 gene locus_tag LOCUS_29540 gene fabG 14644 13823 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051065148.1 protein_id gnl|my_center|LOCUS_29540 14728 17607 gene locus_tag LOCUS_29550 14728 17607 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_29550 18670 17738 gene locus_tag LOCUS_29560 18670 17738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 19999 19028 gene locus_tag LOCUS_29570 19999 19028 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937994.1 protein_id gnl|my_center|LOCUS_29570 20321 21499 gene locus_tag LOCUS_29580 20321 21499 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_29580 23390 21528 gene locus_tag LOCUS_29590 gene sppA 23390 21528 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262204.1 protein_id gnl|my_center|LOCUS_29590 25421 23496 gene locus_tag LOCUS_29600 25421 23496 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225895010.1 protein_id gnl|my_center|LOCUS_29600 27931 25862 gene locus_tag LOCUS_29610 27931 25862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 28600 28947 gene locus_tag LOCUS_29620 28600 28947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 28953 29360 gene locus_tag LOCUS_29630 28953 29360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 29614 30708 gene locus_tag LOCUS_29640 gene mtnA 29614 30708 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_29640 30705 31352 gene locus_tag LOCUS_29650 30705 31352 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388112.1 protein_id gnl|my_center|LOCUS_29650 33429 31738 gene locus_tag LOCUS_29660 33429 31738 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_29660 34942 33455 gene locus_tag LOCUS_29670 gene gltX 34942 33455 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545418.1 protein_id gnl|my_center|LOCUS_29670 35697 36035 gene locus_tag LOCUS_29680 35697 36035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 36051 37025 gene locus_tag LOCUS_29690 gene ispE 36051 37025 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_29690 37005 37079 gene locus_tag LOCUS_t00380 37005 37079 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 37101 38039 gene locus_tag LOCUS_29700 37101 38039 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_29700 38277 38834 gene locus_tag LOCUS_29710 38277 38834 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_29710 39281 38919 gene locus_tag LOCUS_29720 39281 38919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 39162 39533 gene locus_tag LOCUS_29730 39162 39533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 39773 40231 gene locus_tag LOCUS_29740 39773 40231 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_29740 40253 41239 gene locus_tag LOCUS_29750 40253 41239 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371731.1 protein_id gnl|my_center|LOCUS_29750 41236 41874 gene locus_tag LOCUS_29760 gene coaE 41236 41874 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209319.1 protein_id gnl|my_center|LOCUS_29760 42406 43656 gene locus_tag LOCUS_29770 gene rho 42406 43656 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_29770 43746 43964 gene locus_tag LOCUS_29780 gene rpmE 43746 43964 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_29780 44247 45317 gene locus_tag LOCUS_29790 gene prfA 44247 45317 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943725.1 protein_id gnl|my_center|LOCUS_29790 45336 46199 gene locus_tag LOCUS_29800 gene prmC 45336 46199 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_29800 46251 47537 gene locus_tag LOCUS_29810 gene murA 46251 47537 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_29810 49242 47527 gene locus_tag LOCUS_29820 49242 47527 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_29820 50680 49304 gene locus_tag LOCUS_29830 50680 49304 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_29830 50902 51141 gene locus_tag LOCUS_29840 50902 51141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 51366 51719 gene locus_tag LOCUS_29850 51366 51719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29850 52108 53388 gene locus_tag LOCUS_29860 52108 53388 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941850.1 protein_id gnl|my_center|LOCUS_29860 53428 54462 gene locus_tag LOCUS_29870 53428 54462 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_29870 54576 54836 gene locus_tag LOCUS_29880 54576 54836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 56672 54750 gene locus_tag LOCUS_29890 gene dxs 56672 54750 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_29890 57571 56675 gene locus_tag LOCUS_29900 57571 56675 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_29900 57794 57561 gene locus_tag LOCUS_29910 57794 57561 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093283.1 protein_id gnl|my_center|LOCUS_29910 58125 59063 gene locus_tag LOCUS_29920 gene xerC 58125 59063 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_29920 59285 59824 gene locus_tag LOCUS_29930 gene hslV 59285 59824 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_29930 59830 61239 gene locus_tag LOCUS_29940 gene hslU 59830 61239 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_29940 61292 61828 gene locus_tag LOCUS_29950 61292 61828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 61987 62790 gene locus_tag LOCUS_29960 61987 62790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 63066 63353 gene locus_tag LOCUS_29970 63066 63353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 67120 63518 gene locus_tag LOCUS_29980 gene dnaE 67120 63518 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_29980 68376 67546 gene locus_tag LOCUS_29990 68376 67546 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393241.1 protein_id gnl|my_center|LOCUS_29990 69540 68377 gene locus_tag LOCUS_30000 69540 68377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 70178 71917 gene locus_tag LOCUS_30010 70178 71917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 71889 73772 gene locus_tag LOCUS_30020 71889 73772 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626303.1 protein_id gnl|my_center|LOCUS_30020 73772 78208 gene locus_tag LOCUS_30030 73772 78208 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389851.1 protein_id gnl|my_center|LOCUS_30030 79087 78278 gene locus_tag LOCUS_30040 79087 78278 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183894.1 protein_id gnl|my_center|LOCUS_30040 81347 79131 gene locus_tag LOCUS_30050 81347 79131 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_30050 81950 81348 gene locus_tag LOCUS_30060 81950 81348 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902583.1 protein_id gnl|my_center|LOCUS_30060 82402 82782 gene locus_tag LOCUS_30070 82402 82782 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_30070 83384 82905 gene locus_tag LOCUS_30080 83384 82905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 83928 86735 gene locus_tag LOCUS_30090 gene ileS 83928 86735 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_30090 86749 87213 gene locus_tag LOCUS_30100 gene lspA 86749 87213 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157006.1 protein_id gnl|my_center|LOCUS_30100 87251 88201 gene locus_tag LOCUS_30110 gene fabD 87251 88201 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392463.1 protein_id gnl|my_center|LOCUS_30110 88348 89697 gene locus_tag LOCUS_30120 gene ffh 88348 89697 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_30120 89933 90190 gene locus_tag LOCUS_30130 gene rpsP 89933 90190 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_30130 90191 90421 gene locus_tag LOCUS_30140 90191 90421 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_30140 90421 90960 gene locus_tag LOCUS_30150 gene rimM 90421 90960 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_30150 91155 91760 gene locus_tag LOCUS_30160 gene trmD 91155 91760 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_30160 91720 92310 gene locus_tag LOCUS_30170 91720 92310 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941308.1 protein_id gnl|my_center|LOCUS_30170 92612 92959 gene locus_tag LOCUS_30180 gene rplS 92612 92959 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_30180 93338 94057 gene locus_tag LOCUS_30190 93338 94057 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_30190 94062 94445 gene locus_tag LOCUS_30200 94062 94445 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_30200 94716 95735 gene locus_tag LOCUS_30210 gene pdxA 94716 95735 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_30210 95732 96352 gene locus_tag LOCUS_30220 gene tmk 95732 96352 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039005.1 protein_id gnl|my_center|LOCUS_30220 96340 98100 gene locus_tag LOCUS_30230 96340 98100 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_30230 98193 98915 gene locus_tag LOCUS_30240 98193 98915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 99861 98896 gene locus_tag LOCUS_30250 99861 98896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 100228 102774 gene locus_tag LOCUS_30260 100228 102774 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_30260 102948 104291 gene locus_tag LOCUS_30270 102948 104291 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_30270 104632 105831 gene locus_tag LOCUS_30280 gene dacB 104632 105831 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212651.1 protein_id gnl|my_center|LOCUS_30280 105913 106857 gene locus_tag LOCUS_30290 105913 106857 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_30290 107315 106968 gene locus_tag LOCUS_30300 107315 106968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 107606 107328 gene locus_tag LOCUS_30310 107606 107328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 108619 108089 gene locus_tag LOCUS_30320 108619 108089 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942547.1 protein_id gnl|my_center|LOCUS_30320 109933 108647 gene locus_tag LOCUS_30330 109933 108647 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942548.1 protein_id gnl|my_center|LOCUS_30330 110354 112198 gene locus_tag LOCUS_30340 110354 112198 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193219.1 protein_id gnl|my_center|LOCUS_30340 112481 113452 gene locus_tag LOCUS_30350 112481 113452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679695.1 protein_id gnl|my_center|LOCUS_30350 114844 116001 gene locus_tag LOCUS_30360 gene sucC 114844 116001 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_30360 116179 117057 gene locus_tag LOCUS_30370 gene sucD 116179 117057 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_30370 117159 118709 gene locus_tag LOCUS_30380 117159 118709 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_30380 118771 118965 gene locus_tag LOCUS_30390 118771 118965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 119021 121003 gene locus_tag LOCUS_30400 gene oadA 119021 121003 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_30400 121970 121098 gene locus_tag LOCUS_30410 121970 121098 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387970.1 protein_id gnl|my_center|LOCUS_30410 123935 122355 gene locus_tag LOCUS_30420 123935 122355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 125118 124027 gene locus_tag LOCUS_30430 125118 124027 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_30430 126261 125497 gene locus_tag LOCUS_30440 126261 125497 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783491.1 protein_id gnl|my_center|LOCUS_30440 128256 126331 gene locus_tag LOCUS_30450 128256 126331 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_30450 128993 128388 gene locus_tag LOCUS_30460 128993 128388 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_30460 130471 129377 gene locus_tag LOCUS_30470 130471 129377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 131134 132732 gene locus_tag LOCUS_30480 131134 132732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 132959 134185 gene locus_tag LOCUS_30490 gene trpB 132959 134185 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_30490 134240 135022 gene locus_tag LOCUS_30500 gene trpA 134240 135022 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881005.1 protein_id gnl|my_center|LOCUS_30500 135121 136920 gene locus_tag LOCUS_30510 135121 136920 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_30510 137639 138373 gene locus_tag LOCUS_30520 137639 138373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 138416 138889 gene locus_tag LOCUS_30530 gene pilG 138416 138889 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_30530 139131 139739 gene locus_tag LOCUS_30540 139131 139739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 139794 142805 gene locus_tag LOCUS_30550 139794 142805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 142802 143236 gene locus_tag LOCUS_30560 142802 143236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 143495 144016 gene locus_tag LOCUS_30570 143495 144016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 144263 146422 gene locus_tag LOCUS_30580 144263 146422 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266434.1 protein_id gnl|my_center|LOCUS_30580 148692 146596 gene locus_tag LOCUS_30590 148692 146596 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256665.1 protein_id gnl|my_center|LOCUS_30590 149871 148879 gene locus_tag LOCUS_30600 149871 148879 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256666.1 protein_id gnl|my_center|LOCUS_30600 150154 149945 gene locus_tag LOCUS_30610 150154 149945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 150966 150493 gene locus_tag LOCUS_30620 150966 150493 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546571.1 protein_id gnl|my_center|LOCUS_30620 152671 151793 gene locus_tag LOCUS_30630 152671 151793 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392729.1 protein_id gnl|my_center|LOCUS_30630 153405 152722 gene locus_tag LOCUS_30640 153405 152722 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 protein_id gnl|my_center|LOCUS_30640 154727 153846 gene locus_tag LOCUS_30650 gene rsmI 154727 153846 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_30650 >Feature sequence447 438 662 gene locus_tag LOCUS_30660 438 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 996 709 gene locus_tag LOCUS_30670 996 709 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971059.1 protein_id gnl|my_center|LOCUS_30670 1262 996 gene locus_tag LOCUS_30680 1262 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 1757 2068 gene locus_tag LOCUS_30690 1757 2068 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493756.1 protein_id gnl|my_center|LOCUS_30690 2065 2358 gene locus_tag LOCUS_30700 gene nadS 2065 2358 CDS product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356397.1 protein_id gnl|my_center|LOCUS_30700 2875 2663 gene locus_tag LOCUS_30710 2875 2663 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_30710 >Feature sequence448 183 1076 gene locus_tag LOCUS_30720 183 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 1885 2232 gene locus_tag LOCUS_30730 1885 2232 CDS product MarR family EPS-associated transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340715.1 protein_id gnl|my_center|LOCUS_30730 >Feature sequence449 1009 170 gene locus_tag LOCUS_30740 1009 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 2217 1006 gene locus_tag LOCUS_30750 2217 1006 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917061.1 protein_id gnl|my_center|LOCUS_30750 2842 2291 gene locus_tag LOCUS_30760 2842 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence450 625 747 gene locus_tag LOCUS_30770 625 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 936 1211 gene locus_tag LOCUS_30780 936 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 1329 1967 gene locus_tag LOCUS_30790 1329 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 2347 2916 gene locus_tag LOCUS_30800 2347 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 >Feature sequence451 <1 738 gene locus_tag LOCUS_30810 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393558.1:cation:proton antiporter 927 2303 gene locus_tag LOCUS_30820 gene trkA 927 2303 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_30820 >Feature sequence452 2526 7 gene locus_tag LOCUS_30830 2526 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence453 299 78 gene locus_tag LOCUS_30840 299 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 499 323 gene locus_tag LOCUS_30850 499 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 1698 502 gene locus_tag LOCUS_30860 1698 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 2711 2544 gene locus_tag LOCUS_30870 2711 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 >Feature sequence454 431 141 gene locus_tag LOCUS_30880 431 141 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015205689.1 protein_id gnl|my_center|LOCUS_30880 706 428 gene locus_tag LOCUS_30890 706 428 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_30890 1586 1164 gene locus_tag LOCUS_30900 1586 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 1965 1561 gene locus_tag LOCUS_30910 1965 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 >Feature sequence455 2395 1541 gene locus_tag LOCUS_30920 2395 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 >Feature sequence456 2259 52 gene locus_tag LOCUS_30930 2259 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 >Feature sequence457 883 807 gene locus_tag LOCUS_t00390 883 807 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 972 897 gene locus_tag LOCUS_t00400 972 897 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3521 1104 gene locus_tag LOCUS_30940 gene lon 3521 1104 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938632.1 protein_id gnl|my_center|LOCUS_30940 4801 3530 gene locus_tag LOCUS_30950 gene clpX 4801 3530 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_30950 5405 4803 gene locus_tag LOCUS_30960 gene clpP 5405 4803 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 protein_id gnl|my_center|LOCUS_30960 6815 5487 gene locus_tag LOCUS_30970 gene tig 6815 5487 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_30970 7091 7006 gene locus_tag LOCUS_t00410 7091 7006 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8383 7196 gene locus_tag LOCUS_30980 gene norA 8383 7196 CDS product multidrug efflux MFS transporter NorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458987.1 protein_id gnl|my_center|LOCUS_30980 8683 10074 gene locus_tag LOCUS_30990 gene ppnN 8683 10074 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705076.1 protein_id gnl|my_center|LOCUS_30990 10180 12525 gene locus_tag LOCUS_31000 10180 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 12974 13357 gene locus_tag LOCUS_31010 12974 13357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 13958 13668 gene locus_tag LOCUS_31020 13958 13668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 15840 14047 gene locus_tag LOCUS_31030 15840 14047 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_31030 16607 17206 gene locus_tag LOCUS_31040 16607 17206 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_31040 17219 19183 gene locus_tag LOCUS_31050 17219 19183 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_31050 19675 21405 gene locus_tag LOCUS_31060 19675 21405 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_31060 21422 21646 gene locus_tag LOCUS_31070 21422 21646 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358284.1 protein_id gnl|my_center|LOCUS_31070 21892 23130 gene locus_tag LOCUS_31080 21892 23130 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_31080 23225 25153 gene locus_tag LOCUS_31090 23225 25153 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940249.1 protein_id gnl|my_center|LOCUS_31090 25958 25272 gene locus_tag LOCUS_31100 25958 25272 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986474.1 protein_id gnl|my_center|LOCUS_31100 26707 28203 gene locus_tag LOCUS_31110 26707 28203 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937928.1 protein_id gnl|my_center|LOCUS_31110 28288 28761 gene locus_tag LOCUS_31120 28288 28761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 29214 29468 gene locus_tag LOCUS_31130 29214 29468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 29951 30994 gene locus_tag LOCUS_31140 29951 30994 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815960.1 protein_id gnl|my_center|LOCUS_31140 31237 33390 gene locus_tag LOCUS_31150 31237 33390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 33877 33617 gene locus_tag LOCUS_31160 33877 33617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 34556 34005 gene locus_tag LOCUS_31170 34556 34005 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933129.1 protein_id gnl|my_center|LOCUS_31170 35671 34838 gene locus_tag LOCUS_31180 35671 34838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 36922 35684 gene locus_tag LOCUS_31190 36922 35684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 37523 38047 gene locus_tag LOCUS_31200 37523 38047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 38772 38356 gene locus_tag LOCUS_31210 38772 38356 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_31210 39868 38804 gene locus_tag LOCUS_31220 39868 38804 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_31220 41964 39865 gene locus_tag LOCUS_31230 41964 39865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 43787 42378 gene locus_tag LOCUS_31240 43787 42378 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937712.1 protein_id gnl|my_center|LOCUS_31240 44951 44253 gene locus_tag LOCUS_31250 44951 44253 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_31250 47010 44944 gene locus_tag LOCUS_31260 gene uvrB 47010 44944 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_31260 49033 47153 gene locus_tag LOCUS_31270 49033 47153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 51196 49091 gene locus_tag LOCUS_31280 51196 49091 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_31280 51864 51208 gene locus_tag LOCUS_31290 51864 51208 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_31290 52891 51905 gene locus_tag LOCUS_31300 52891 51905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 53047 53250 gene locus_tag LOCUS_31310 53047 53250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 53987 53424 gene locus_tag LOCUS_31320 53987 53424 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791480.1 protein_id gnl|my_center|LOCUS_31320 55372 56388 gene locus_tag LOCUS_31330 55372 56388 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_31330 56593 57390 gene locus_tag LOCUS_31340 56593 57390 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_31340 57680 58084 gene locus_tag LOCUS_31350 gene mce 57680 58084 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_31350 58253 60400 gene locus_tag LOCUS_31360 gene scpA 58253 60400 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073260.1 protein_id gnl|my_center|LOCUS_31360 60494 61483 gene locus_tag LOCUS_31370 gene meaB 60494 61483 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_31370 62086 64065 gene locus_tag LOCUS_31380 gene dnaX 62086 64065 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_31380 64216 64524 gene locus_tag LOCUS_31390 64216 64524 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001996460.1 protein_id gnl|my_center|LOCUS_31390 64525 65136 gene locus_tag LOCUS_31400 gene recR 64525 65136 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_31400 65443 65991 gene locus_tag LOCUS_31410 65443 65991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 66522 66328 gene locus_tag LOCUS_31420 66522 66328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 66733 66527 gene locus_tag LOCUS_31430 66733 66527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 67620 66730 gene locus_tag LOCUS_31440 gene folD 67620 66730 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 protein_id gnl|my_center|LOCUS_31440 68057 69559 gene locus_tag LOCUS_31450 68057 69559 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_31450 69567 70676 gene locus_tag LOCUS_31460 69567 70676 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 protein_id gnl|my_center|LOCUS_31460 70676 73825 gene locus_tag LOCUS_31470 70676 73825 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_31470 73837 75111 gene locus_tag LOCUS_31480 73837 75111 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869985.1 protein_id gnl|my_center|LOCUS_31480 77523 75406 gene locus_tag LOCUS_31490 gene pta 77523 75406 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122411.1 protein_id gnl|my_center|LOCUS_31490 79810 77825 gene locus_tag LOCUS_31500 gene betT 79810 77825 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 protein_id gnl|my_center|LOCUS_31500 81343 80006 gene locus_tag LOCUS_31510 81343 80006 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_31510 82559 81429 gene locus_tag LOCUS_31520 82559 81429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 83214 84272 gene locus_tag LOCUS_31530 83214 84272 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939569.1 protein_id gnl|my_center|LOCUS_31530 84417 84695 gene locus_tag LOCUS_31540 84417 84695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 84692 85078 gene locus_tag LOCUS_31550 84692 85078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 85535 86317 gene locus_tag LOCUS_31560 85535 86317 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390585.1 protein_id gnl|my_center|LOCUS_31560 87696 87271 gene locus_tag LOCUS_31570 87696 87271 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087586.1 protein_id gnl|my_center|LOCUS_31570 90959 87693 gene locus_tag LOCUS_31580 90959 87693 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479332.1 protein_id gnl|my_center|LOCUS_31580 92112 90949 gene locus_tag LOCUS_31590 92112 90949 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897600.1 protein_id gnl|my_center|LOCUS_31590 93612 92119 gene locus_tag LOCUS_31600 gene tolC 93612 92119 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969270.1 protein_id gnl|my_center|LOCUS_31600 93915 93830 gene locus_tag LOCUS_t00420 93915 93830 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 94501 94022 gene locus_tag LOCUS_31610 gene tadA 94501 94022 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 protein_id gnl|my_center|LOCUS_31610 94848 96224 gene locus_tag LOCUS_31620 94848 96224 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_31620 97717 96293 gene locus_tag LOCUS_31630 97717 96293 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938869.1 protein_id gnl|my_center|LOCUS_31630 98810 97914 gene locus_tag LOCUS_31640 98810 97914 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937979.1 protein_id gnl|my_center|LOCUS_31640 99659 98835 gene locus_tag LOCUS_31650 99659 98835 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937978.1 protein_id gnl|my_center|LOCUS_31650 100541 99774 gene locus_tag LOCUS_31660 100541 99774 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443456.1 protein_id gnl|my_center|LOCUS_31660 101333 100542 gene locus_tag LOCUS_31670 101333 100542 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626073.1 protein_id gnl|my_center|LOCUS_31670 101736 103382 gene locus_tag LOCUS_31680 101736 103382 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 protein_id gnl|my_center|LOCUS_31680 103511 103861 gene locus_tag LOCUS_31690 103511 103861 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937898.1 protein_id gnl|my_center|LOCUS_31690 103878 105704 gene locus_tag LOCUS_31700 gene uvrC 103878 105704 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_31700 105745 106683 gene locus_tag LOCUS_31710 105745 106683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 109387 106976 gene locus_tag LOCUS_31720 109387 106976 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_31720 110807 109815 gene locus_tag LOCUS_31730 110807 109815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256204.1 protein_id gnl|my_center|LOCUS_31730 111436 112656 gene locus_tag LOCUS_31740 111436 112656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 112677 113906 gene locus_tag LOCUS_31750 112677 113906 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288841.1 protein_id gnl|my_center|LOCUS_31750 114144 114791 gene locus_tag LOCUS_31760 114144 114791 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_31760 115236 118442 gene locus_tag LOCUS_31770 gene carB 115236 118442 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_31770 118499 119125 gene locus_tag LOCUS_31780 118499 119125 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932936.1 protein_id gnl|my_center|LOCUS_31780 119318 120502 gene locus_tag LOCUS_31790 119318 120502 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_31790 120493 121248 gene locus_tag LOCUS_31800 120493 121248 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_31800 121509 121664 gene locus_tag LOCUS_31810 121509 121664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 121661 122308 gene locus_tag LOCUS_31820 121661 122308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 122912 122364 gene locus_tag LOCUS_31830 122912 122364 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942952.1 protein_id gnl|my_center|LOCUS_31830 123948 123130 gene locus_tag LOCUS_31840 gene pyrF 123948 123130 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039203.1 protein_id gnl|my_center|LOCUS_31840 125981 124089 gene locus_tag LOCUS_31850 125981 124089 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 protein_id gnl|my_center|LOCUS_31850 126423 127400 gene locus_tag LOCUS_31860 gene pstS 126423 127400 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_31860 127538 130153 gene locus_tag LOCUS_31870 127538 130153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 130366 132042 gene locus_tag LOCUS_31880 gene pstA 130366 132042 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174518729.1 protein_id gnl|my_center|LOCUS_31880 132074 132979 gene locus_tag LOCUS_31890 gene pstB 132074 132979 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105523.1 protein_id gnl|my_center|LOCUS_31890 133185 134114 gene locus_tag LOCUS_31900 133185 134114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 134616 135278 gene locus_tag LOCUS_31910 gene phoU 134616 135278 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_31910 136289 137896 gene locus_tag LOCUS_31920 136289 137896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 138162 139214 gene locus_tag LOCUS_31930 138162 139214 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_31930 139744 140154 gene locus_tag LOCUS_31940 139744 140154 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_31940 140248 141111 gene locus_tag LOCUS_31950 140248 141111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 141126 141389 gene locus_tag LOCUS_31960 141126 141389 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008777585.1 protein_id gnl|my_center|LOCUS_31960 141489 142172 gene locus_tag LOCUS_31970 141489 142172 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_31970 143960 142467 gene locus_tag LOCUS_31980 gene opuD 143960 142467 CDS product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229220.1 protein_id gnl|my_center|LOCUS_31980 144783 143986 gene locus_tag LOCUS_31990 144783 143986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 145178 144990 gene locus_tag LOCUS_32000 145178 144990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence458 <1 1855 gene locus_tag LOCUS_32010 <1 1855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941506.1:ATP-binding protein >Feature sequence459 <1 567 gene locus_tag LOCUS_32020 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114402.1:type I restriction endonuclease subunit R 557 1636 gene locus_tag LOCUS_32030 557 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 >Feature sequence460 44 1198 gene locus_tag LOCUS_32040 44 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 >Feature sequence461 1741 26 gene locus_tag LOCUS_32050 1741 26 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090936308.1 protein_id gnl|my_center|LOCUS_32050 >Feature sequence462 406 651 gene locus_tag LOCUS_32060 406 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 1212 1544 gene locus_tag LOCUS_32070 1212 1544 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669261.1 protein_id gnl|my_center|LOCUS_32070 >Feature sequence463 1247 366 gene locus_tag LOCUS_32080 1247 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 >Feature sequence464 537 797 gene locus_tag LOCUS_32090 537 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 1012 1221 gene locus_tag LOCUS_32100 1012 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 >Feature sequence465 119 1150 gene locus_tag LOCUS_32110 119 1150 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128929876.1 protein_id gnl|my_center|LOCUS_32110 >Feature sequence466 >Feature sequence467 72 1298 gene locus_tag LOCUS_32120 72 1298 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_32120 >Feature sequence468 235 1143 gene locus_tag LOCUS_32130 235 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 1590 3629 gene locus_tag LOCUS_32140 1590 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 3669 5222 gene locus_tag LOCUS_32150 3669 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 5315 5863 gene locus_tag LOCUS_32160 5315 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 5886 6497 gene locus_tag LOCUS_32170 5886 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 6494 8551 gene locus_tag LOCUS_32180 6494 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 8562 9620 gene locus_tag LOCUS_32190 8562 9620 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_32190 9632 11287 gene locus_tag LOCUS_32200 gene pilB 9632 11287 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_32200 11304 12506 gene locus_tag LOCUS_32210 11304 12506 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_32210 12673 13542 gene locus_tag LOCUS_32220 12673 13542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 13548 14117 gene locus_tag LOCUS_32230 13548 14117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 14136 14516 gene locus_tag LOCUS_32240 14136 14516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 14498 15301 gene locus_tag LOCUS_32250 14498 15301 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_32250 15298 15675 gene locus_tag LOCUS_32260 15298 15675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 15672 16202 gene locus_tag LOCUS_32270 15672 16202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 18345 17212 gene locus_tag LOCUS_32280 18345 17212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 19760 19675 gene locus_tag LOCUS_t00430 19760 19675 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20165 19770 gene locus_tag LOCUS_32290 20165 19770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 20917 20162 gene locus_tag LOCUS_32300 gene tpiA 20917 20162 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_32300 22138 20963 gene locus_tag LOCUS_32310 gene pgk 22138 20963 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942273.1 protein_id gnl|my_center|LOCUS_32310 22593 22135 gene locus_tag LOCUS_32320 gene rimI 22593 22135 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546589.1 protein_id gnl|my_center|LOCUS_32320 23810 22590 gene locus_tag LOCUS_32330 23810 22590 CDS product glyceraldehyde 3-phosphate dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546756.1 protein_id gnl|my_center|LOCUS_32330 24050 24748 gene locus_tag LOCUS_32340 gene sfsA 24050 24748 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_32340 25040 25756 gene locus_tag LOCUS_32350 gene queC 25040 25756 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_32350 27043 25766 gene locus_tag LOCUS_32360 27043 25766 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_32360 28228 27296 gene locus_tag LOCUS_32370 28228 27296 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_32370 29158 28508 gene locus_tag LOCUS_32380 gene lepB 29158 28508 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_32380 29094 29264 gene locus_tag LOCUS_32390 29094 29264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 29479 30525 gene locus_tag LOCUS_32400 gene pilM 29479 30525 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_32400 30532 31101 gene locus_tag LOCUS_32410 30532 31101 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_32410 31119 31760 gene locus_tag LOCUS_32420 31119 31760 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_32420 31812 32336 gene locus_tag LOCUS_32430 31812 32336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 32339 34189 gene locus_tag LOCUS_32440 32339 34189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 34222 35922 gene locus_tag LOCUS_32450 gene mshL 34222 35922 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545709.1 protein_id gnl|my_center|LOCUS_32450 35952 36974 gene locus_tag LOCUS_32460 35952 36974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 37910 37470 gene locus_tag LOCUS_32470 37910 37470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 39348 38062 gene locus_tag LOCUS_32480 39348 38062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 40220 42100 gene locus_tag LOCUS_32490 40220 42100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 42632 43174 gene locus_tag LOCUS_32500 42632 43174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 43479 44072 gene locus_tag LOCUS_32510 43479 44072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 44088 44411 gene locus_tag LOCUS_32520 44088 44411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 44433 45899 gene locus_tag LOCUS_32530 44433 45899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 45877 46197 gene locus_tag LOCUS_32540 45877 46197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 46348 47520 gene locus_tag LOCUS_32550 46348 47520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 47559 50279 gene locus_tag LOCUS_32560 47559 50279 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258514.1 protein_id gnl|my_center|LOCUS_32560 50405 51661 gene locus_tag LOCUS_32570 50405 51661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 51679 52236 gene locus_tag LOCUS_32580 51679 52236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 52366 53169 gene locus_tag LOCUS_32590 52366 53169 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811803.1 protein_id gnl|my_center|LOCUS_32590 54662 53421 gene locus_tag LOCUS_32600 54662 53421 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_32600 55529 55134 gene locus_tag LOCUS_32610 55529 55134 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942961.1 protein_id gnl|my_center|LOCUS_32610 56324 55899 gene locus_tag LOCUS_32620 56324 55899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 56211 56750 gene locus_tag LOCUS_32630 56211 56750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 56747 57124 gene locus_tag LOCUS_32640 56747 57124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 57484 58419 gene locus_tag LOCUS_32650 57484 58419 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583585.1 protein_id gnl|my_center|LOCUS_32650 58903 60150 gene locus_tag LOCUS_32660 58903 60150 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812397.1 protein_id gnl|my_center|LOCUS_32660 60152 60367 gene locus_tag LOCUS_32670 60152 60367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 60904 60428 gene locus_tag LOCUS_32680 60904 60428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 61135 62724 gene locus_tag LOCUS_32690 61135 62724 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940375.1 protein_id gnl|my_center|LOCUS_32690 62780 64312 gene locus_tag LOCUS_32700 62780 64312 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940888.1 protein_id gnl|my_center|LOCUS_32700 64577 68377 gene locus_tag LOCUS_32710 gene purL 64577 68377 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544968.1 protein_id gnl|my_center|LOCUS_32710 69009 68692 gene locus_tag LOCUS_32720 69009 68692 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938537.1 protein_id gnl|my_center|LOCUS_32720 69375 70271 gene locus_tag LOCUS_32730 69375 70271 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940333.1 protein_id gnl|my_center|LOCUS_32730 70339 71175 gene locus_tag LOCUS_32740 70339 71175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 71384 71902 gene locus_tag LOCUS_32750 71384 71902 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094124518.1 protein_id gnl|my_center|LOCUS_32750 72310 75594 gene locus_tag LOCUS_32760 72310 75594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 75683 76087 gene locus_tag LOCUS_32770 75683 76087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 77710 76241 gene locus_tag LOCUS_32780 gene ilvC 77710 76241 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074006.1 protein_id gnl|my_center|LOCUS_32780 78279 78710 gene locus_tag LOCUS_32790 78279 78710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 79967 78741 gene locus_tag LOCUS_32800 79967 78741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 80517 80296 gene locus_tag LOCUS_32810 80517 80296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 81152 83236 gene locus_tag LOCUS_32820 gene fusA 81152 83236 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682356.1 protein_id gnl|my_center|LOCUS_32820 83294 83995 gene locus_tag LOCUS_32830 83294 83995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 84051 84812 gene locus_tag LOCUS_32840 84051 84812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 84799 84975 gene locus_tag LOCUS_32850 84799 84975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 85235 86164 gene locus_tag LOCUS_32860 85235 86164 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193057.1 protein_id gnl|my_center|LOCUS_32860 86748 87671 gene locus_tag LOCUS_32870 86748 87671 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_32870 87726 88343 gene locus_tag LOCUS_32880 gene yedF 87726 88343 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986892.1 protein_id gnl|my_center|LOCUS_32880 88431 90623 gene locus_tag LOCUS_32890 88431 90623 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_32890 90786 91310 gene locus_tag LOCUS_32900 90786 91310 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393113.1 protein_id gnl|my_center|LOCUS_32900 91593 92612 gene locus_tag LOCUS_32910 gene dsrM 91593 92612 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810497.1 protein_id gnl|my_center|LOCUS_32910 92647 94278 gene locus_tag LOCUS_32920 92647 94278 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_32920 94308 94682 gene locus_tag LOCUS_32930 gene dsrJ 94308 94682 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938584.1 protein_id gnl|my_center|LOCUS_32930 94706 95533 gene locus_tag LOCUS_32940 94706 95533 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933894.1 protein_id gnl|my_center|LOCUS_32940 95541 96713 gene locus_tag LOCUS_32950 gene nrfD 95541 96713 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272193.1 protein_id gnl|my_center|LOCUS_32950 97788 97003 gene locus_tag LOCUS_32960 97788 97003 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_32960 98167 97898 gene locus_tag LOCUS_32970 98167 97898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 98593 98213 gene locus_tag LOCUS_32980 98593 98213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 98623 99564 gene locus_tag LOCUS_32990 98623 99564 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_32990 99564 100256 gene locus_tag LOCUS_33000 gene aroD 99564 100256 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_33000 100256 101110 gene locus_tag LOCUS_33010 100256 101110 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_33010 101138 102415 gene locus_tag LOCUS_33020 gene aroA 101138 102415 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072383.1 protein_id gnl|my_center|LOCUS_33020 102743 102904 gene locus_tag LOCUS_33030 102743 102904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 104196 103288 gene locus_tag LOCUS_33040 104196 103288 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040035.1 protein_id gnl|my_center|LOCUS_33040 104833 104618 gene locus_tag LOCUS_33050 104833 104618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 105160 105993 gene locus_tag LOCUS_33060 105160 105993 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932822.1 protein_id gnl|my_center|LOCUS_33060 106061 107191 gene locus_tag LOCUS_33070 106061 107191 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404839.1 protein_id gnl|my_center|LOCUS_33070 108069 107398 gene locus_tag LOCUS_33080 gene phoU 108069 107398 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_33080 108335 109030 gene locus_tag LOCUS_33090 108335 109030 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272621.1 protein_id gnl|my_center|LOCUS_33090 109153 110958 gene locus_tag LOCUS_33100 109153 110958 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_33100 111068 111143 gene locus_tag LOCUS_t00440 111068 111143 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 111801 111514 gene locus_tag LOCUS_33110 111801 111514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 112484 111813 gene locus_tag LOCUS_33120 112484 111813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 113502 114065 gene locus_tag LOCUS_33130 113502 114065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 114185 114619 gene locus_tag LOCUS_33140 114185 114619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 114745 115272 gene locus_tag LOCUS_33150 114745 115272 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925223.1 protein_id gnl|my_center|LOCUS_33150 115435 115662 gene locus_tag LOCUS_33160 115435 115662 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_33160 115732 119178 gene locus_tag LOCUS_33170 115732 119178 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065207.1 protein_id gnl|my_center|LOCUS_33170 119178 120485 gene locus_tag LOCUS_33180 119178 120485 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881249.1 protein_id gnl|my_center|LOCUS_33180 120485 121030 gene locus_tag LOCUS_33190 120485 121030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 121269 124103 gene locus_tag LOCUS_33200 121269 124103 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020506622.1 protein_id gnl|my_center|LOCUS_33200 124152 125261 gene locus_tag LOCUS_33210 124152 125261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 125254 125805 gene locus_tag LOCUS_33220 125254 125805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 125818 128775 gene locus_tag LOCUS_33230 125818 128775 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148590534.1 protein_id gnl|my_center|LOCUS_33230 129060 132620 gene locus_tag LOCUS_33240 129060 132620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 132610 135657 gene locus_tag LOCUS_33250 132610 135657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 135871 136653 gene locus_tag LOCUS_33260 135871 136653 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026837.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33260 137000 137485 gene locus_tag LOCUS_33270 gene arfB 137000 137485 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463517.1 protein_id gnl|my_center|LOCUS_33270 137570 140047 gene locus_tag LOCUS_33280 137570 140047 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202769.1 protein_id gnl|my_center|LOCUS_33280 140520 140194 gene locus_tag LOCUS_33290 140520 140194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 141417 140995 gene locus_tag LOCUS_33300 141417 140995 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_33300 141817 141407 gene locus_tag LOCUS_33310 141817 141407 CDS product type II toxin-antitoxin system antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073052.1 protein_id gnl|my_center|LOCUS_33310 142800 142207 gene locus_tag LOCUS_33320 142800 142207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 143243 145228 gene locus_tag LOCUS_33330 143243 145228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 >Feature sequence469 1254 28 gene locus_tag LOCUS_33340 1254 28 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_33340 >Feature sequence470 146 1084 gene locus_tag LOCUS_33350 146 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 >Feature sequence471 <1227 278 gene locus_tag LOCUS_33360 <1227 278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011921673.1:IS110 family transposase >Feature sequence472 >Feature sequence473 412 1122 gene locus_tag LOCUS_33370 412 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 >Feature sequence474 1 402 gene locus_tag LOCUS_33380 1 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 555 301 gene locus_tag LOCUS_33390 555 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 >Feature sequence475 112 354 gene locus_tag LOCUS_33400 112 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 >Feature sequence476 >Feature sequence477 702 106 gene locus_tag LOCUS_33410 702 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 >Feature sequence478 >Feature sequence479 717 166 gene locus_tag LOCUS_33420 717 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 943 1674 gene locus_tag LOCUS_33430 943 1674 CDS product Lpg2936 family Dot/Icm T4SS effector methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948621.1 protein_id gnl|my_center|LOCUS_33430 1749 2198 gene locus_tag LOCUS_33440 gene dtd 1749 2198 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_33440 2211 5135 gene locus_tag LOCUS_33450 2211 5135 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_33450 6010 5582 gene locus_tag LOCUS_33460 6010 5582 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940617.1 protein_id gnl|my_center|LOCUS_33460 8103 6502 gene locus_tag LOCUS_33470 gene nadB 8103 6502 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_33470 8246 9028 gene locus_tag LOCUS_33480 8246 9028 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_33480 9025 9909 gene locus_tag LOCUS_33490 9025 9909 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_33490 10262 11167 gene locus_tag LOCUS_33500 10262 11167 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_33500 11164 11631 gene locus_tag LOCUS_33510 11164 11631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 11772 12578 gene locus_tag LOCUS_33520 gene bioC 11772 12578 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205939.1 protein_id gnl|my_center|LOCUS_33520 12797 13510 gene locus_tag LOCUS_33530 gene bioD 12797 13510 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429216.1 protein_id gnl|my_center|LOCUS_33530 14450 13950 gene locus_tag LOCUS_33540 gene tpx 14450 13950 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_33540 15149 14700 gene locus_tag LOCUS_33550 15149 14700 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943436.1 protein_id gnl|my_center|LOCUS_33550 16249 15335 gene locus_tag LOCUS_33560 16249 15335 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940539.1 protein_id gnl|my_center|LOCUS_33560 16750 17877 gene locus_tag LOCUS_33570 16750 17877 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938013.1 protein_id gnl|my_center|LOCUS_33570 18002 18907 gene locus_tag LOCUS_33580 18002 18907 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_33580 18904 19863 gene locus_tag LOCUS_33590 18904 19863 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938015.1 protein_id gnl|my_center|LOCUS_33590 19860 20651 gene locus_tag LOCUS_33600 19860 20651 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_33600 20654 21364 gene locus_tag LOCUS_33610 20654 21364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938017.1 protein_id gnl|my_center|LOCUS_33610 22214 21450 gene locus_tag LOCUS_33620 22214 21450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 22798 23769 gene locus_tag LOCUS_33630 22798 23769 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_33630 24456 24010 gene locus_tag LOCUS_33640 24456 24010 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457820.1 protein_id gnl|my_center|LOCUS_33640 25092 25595 gene locus_tag LOCUS_33650 25092 25595 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921917.1 protein_id gnl|my_center|LOCUS_33650 25592 26929 gene locus_tag LOCUS_33660 25592 26929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 29893 27050 gene locus_tag LOCUS_33670 29893 27050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 30112 31035 gene locus_tag LOCUS_33680 30112 31035 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545377.1 protein_id gnl|my_center|LOCUS_33680 31086 31436 gene locus_tag LOCUS_33690 31086 31436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 31451 32536 gene locus_tag LOCUS_33700 31451 32536 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124950.1 protein_id gnl|my_center|LOCUS_33700 32826 33254 gene locus_tag LOCUS_33710 32826 33254 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036503.1 protein_id gnl|my_center|LOCUS_33710 33276 34409 gene locus_tag LOCUS_33720 gene tgt 33276 34409 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_33720 34425 34754 gene locus_tag LOCUS_33730 gene yajC 34425 34754 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_33730 34998 35780 gene locus_tag LOCUS_33740 34998 35780 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687893.1 protein_id gnl|my_center|LOCUS_33740 36760 35831 gene locus_tag LOCUS_33750 36760 35831 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928968.1 protein_id gnl|my_center|LOCUS_33750 37454 36864 gene locus_tag LOCUS_33760 37454 36864 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255938.1 protein_id gnl|my_center|LOCUS_33760 38655 37582 gene locus_tag LOCUS_33770 38655 37582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 39923 38652 gene locus_tag LOCUS_33780 39923 38652 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943192.1 protein_id gnl|my_center|LOCUS_33780 40089 40454 gene locus_tag LOCUS_33790 40089 40454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 41110 40556 gene locus_tag LOCUS_33800 41110 40556 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851622.1 protein_id gnl|my_center|LOCUS_33800 43035 41494 gene locus_tag LOCUS_33810 43035 41494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938369.1 protein_id gnl|my_center|LOCUS_33810 43525 43040 gene locus_tag LOCUS_33820 gene gpt 43525 43040 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938365.1 protein_id gnl|my_center|LOCUS_33820 44627 43707 gene locus_tag LOCUS_33830 44627 43707 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938368.1 protein_id gnl|my_center|LOCUS_33830 45685 44624 gene locus_tag LOCUS_33840 45685 44624 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938367.1 protein_id gnl|my_center|LOCUS_33840 46794 45733 gene locus_tag LOCUS_33850 46794 45733 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_33850 48453 47065 gene locus_tag LOCUS_33860 gene modF 48453 47065 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482730.1 protein_id gnl|my_center|LOCUS_33860 49443 48490 gene locus_tag LOCUS_33870 49443 48490 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_33870 49877 51187 gene locus_tag LOCUS_33880 49877 51187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 51597 53465 gene locus_tag LOCUS_33890 51597 53465 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_33890 53466 54305 gene locus_tag LOCUS_33900 53466 54305 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_33900 54429 54680 gene locus_tag LOCUS_33910 54429 54680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 54705 54977 gene locus_tag LOCUS_33920 54705 54977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 54992 56176 gene locus_tag LOCUS_33930 54992 56176 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202494.1 protein_id gnl|my_center|LOCUS_33930 56181 56831 gene locus_tag LOCUS_33940 56181 56831 CDS product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107784.1 protein_id gnl|my_center|LOCUS_33940 57146 57388 gene locus_tag LOCUS_33950 57146 57388 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976578.1 protein_id gnl|my_center|LOCUS_33950 57385 57648 gene locus_tag LOCUS_33960 57385 57648 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_33960 58389 57628 gene locus_tag LOCUS_33970 58389 57628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 60611 59577 gene locus_tag LOCUS_33980 60611 59577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 60936 60628 gene locus_tag LOCUS_33990 60936 60628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 61571 61188 gene locus_tag LOCUS_34000 61571 61188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 61994 62695 gene locus_tag LOCUS_34010 61994 62695 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064970.1 protein_id gnl|my_center|LOCUS_34010 62708 64429 gene locus_tag LOCUS_34020 62708 64429 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_34020 64913 65737 gene locus_tag LOCUS_34030 64913 65737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 65898 66908 gene locus_tag LOCUS_34040 65898 66908 CDS product ISAs1-like element ISEc5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421020.1 protein_id gnl|my_center|LOCUS_34040 67102 68154 gene locus_tag LOCUS_34050 67102 68154 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256572.1 protein_id gnl|my_center|LOCUS_34050 68151 68645 gene locus_tag LOCUS_34060 68151 68645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 69344 69252 gene locus_tag LOCUS_t00450 69344 69252 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 69450 69365 gene locus_tag LOCUS_t00460 69450 69365 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 69510 71081 gene locus_tag LOCUS_34070 69510 71081 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_34070 71082 71654 gene locus_tag LOCUS_34080 71082 71654 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941742.1 protein_id gnl|my_center|LOCUS_34080 71792 72475 gene locus_tag LOCUS_34090 71792 72475 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_34090 73568 72558 gene locus_tag LOCUS_34100 73568 72558 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_34100 76053 73555 gene locus_tag LOCUS_34110 gene gyrA 76053 73555 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_34110 78526 76115 gene locus_tag LOCUS_34120 gene gyrB 78526 76115 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072078.1 protein_id gnl|my_center|LOCUS_34120 79731 78601 gene locus_tag LOCUS_34130 gene dnaN 79731 78601 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_34130 81454 81281 gene locus_tag LOCUS_34140 81454 81281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 81814 81467 gene locus_tag LOCUS_34150 81814 81467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 82159 81827 gene locus_tag LOCUS_34160 82159 81827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 82459 82202 gene locus_tag LOCUS_34170 82459 82202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 82932 84188 gene locus_tag LOCUS_34180 82932 84188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 84324 84929 gene locus_tag LOCUS_34190 84324 84929 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_34190 84926 85990 gene locus_tag LOCUS_34200 84926 85990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 86193 87248 gene locus_tag LOCUS_34210 86193 87248 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_34210 87322 87609 gene locus_tag LOCUS_34220 gene gatC 87322 87609 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_34220 87740 89203 gene locus_tag LOCUS_34230 gene gatA 87740 89203 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_34230 89426 90544 gene locus_tag LOCUS_34240 gene hisC 89426 90544 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_34240 90531 91229 gene locus_tag LOCUS_34250 gene cmk 90531 91229 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546614.1 protein_id gnl|my_center|LOCUS_34250 92660 91440 gene locus_tag LOCUS_34260 92660 91440 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392801.1 protein_id gnl|my_center|LOCUS_34260 93271 93113 gene locus_tag LOCUS_34270 93271 93113 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_34270 93672 93298 gene locus_tag LOCUS_34280 93672 93298 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_34280 94652 94059 gene locus_tag LOCUS_34290 94652 94059 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943859.1 protein_id gnl|my_center|LOCUS_34290 95425 94769 gene locus_tag LOCUS_34300 95425 94769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 96566 95940 gene locus_tag LOCUS_34310 96566 95940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 97048 98706 gene locus_tag LOCUS_34320 97048 98706 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938914.1 protein_id gnl|my_center|LOCUS_34320 98892 99737 gene locus_tag LOCUS_34330 gene kdsA 98892 99737 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938915.1 protein_id gnl|my_center|LOCUS_34330 99730 100371 gene locus_tag LOCUS_34340 99730 100371 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_34340 100368 100937 gene locus_tag LOCUS_34350 100368 100937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 101013 102236 gene locus_tag LOCUS_34360 101013 102236 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_34360 103208 102414 gene locus_tag LOCUS_34370 103208 102414 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_34370 103750 103289 gene locus_tag LOCUS_34380 103750 103289 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 protein_id gnl|my_center|LOCUS_34380 104944 103760 gene locus_tag LOCUS_34390 gene larC 104944 103760 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_34390 105885 104944 gene locus_tag LOCUS_34400 gene fmt 105885 104944 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_34400 106403 105882 gene locus_tag LOCUS_34410 gene def 106403 105882 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940805.1 protein_id gnl|my_center|LOCUS_34410 106575 107441 gene locus_tag LOCUS_34420 106575 107441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 107643 108284 gene locus_tag LOCUS_34430 gene plsY 107643 108284 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_34430 108281 108616 gene locus_tag LOCUS_34440 108281 108616 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942407.1 protein_id gnl|my_center|LOCUS_34440 108707 109585 gene locus_tag LOCUS_34450 gene metF 108707 109585 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938296.1 protein_id gnl|my_center|LOCUS_34450 111183 109783 gene locus_tag LOCUS_34460 gene pmpM 111183 109783 CDS product proton-coupled multidrug efflux MATE transporter PmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112388.1 protein_id gnl|my_center|LOCUS_34460 112731 111205 gene locus_tag LOCUS_34470 112731 111205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 115489 112808 gene locus_tag LOCUS_34480 gene acnA 115489 112808 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958393.1 protein_id gnl|my_center|LOCUS_34480 117551 115917 gene locus_tag LOCUS_34490 117551 115917 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625288.1 protein_id gnl|my_center|LOCUS_34490 117901 119094 gene locus_tag LOCUS_34500 117901 119094 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583100.1 protein_id gnl|my_center|LOCUS_34500 119091 119501 gene locus_tag LOCUS_34510 119091 119501 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939217.1 protein_id gnl|my_center|LOCUS_34510 119572 120270 gene locus_tag LOCUS_34520 119572 120270 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871050.1 protein_id gnl|my_center|LOCUS_34520 122070 120598 gene locus_tag LOCUS_34530 gene htrA 122070 120598 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873435.1 protein_id gnl|my_center|LOCUS_34530 122680 124035 gene locus_tag LOCUS_34540 122680 124035 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943456.1 protein_id gnl|my_center|LOCUS_34540 124383 124844 gene locus_tag LOCUS_34550 124383 124844 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_34550 125143 125940 gene locus_tag LOCUS_34560 125143 125940 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_34560 126031 126108 gene locus_tag LOCUS_t00470 126031 126108 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 126948 126445 gene locus_tag LOCUS_34570 126948 126445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570